BUILDING DESIGNER RNA NANO-STRUCTURES FOR SYNTHETIC BIOLOGY APPLICATIONS
20230332161 · 2023-10-19
Inventors
Cpc classification
B82Y5/00
PERFORMING OPERATIONS; TRANSPORTING
B82Y40/00
PERFORMING OPERATIONS; TRANSPORTING
C12N2310/51
CHEMISTRY; METALLURGY
C12N15/1093
CHEMISTRY; METALLURGY
C40B40/06
CHEMISTRY; METALLURGY
International classification
C12N15/115
CHEMISTRY; METALLURGY
C12N15/10
CHEMISTRY; METALLURGY
Abstract
Embodiments of the disclosure include compositions and methods for generating RNA nanostructures, particularly in a cell. In particular embodiments, RNA subunits comprising at least one three-way junction and at least one kissing loop are configured such that multiple RNA subunits can polymerize into a specific structure. In particular embodiments, the RNA subunits are configured such that sequence of at least one kissing loop is complementary to sequence of another kissing loop, such as on another RNA subunit, and the summation of multiple RNA subunits having specific individual structures results in a combined polymerized structure of a defined shape. In specific embodiments, an RNA nanostructure generated from methods herein is utilized for an application, such as manufacturing or genetic modifications in a cell.
Claims
1. (canceled)
2. (canceled)
3. (canceled)
4. (canceled)
5. (canceled)
6. (canceled)
7. (canceled)
8. (canceled)
9. (canceled)
10. (canceled)
11. (canceled)
12. (canceled)
13. (canceled)
14. (canceled)
15. (canceled)
16. (canceled)
17. (canceled)
18. (canceled)
19. (canceled)
20. (canceled)
21. (canceled)
22. (canceled)
23. (canceled)
24. (canceled)
25. (canceled)
26. (canceled)
27. (canceled)
28. (canceled)
29. (canceled)
30. (canceled)
31. (canceled)
32. (canceled)
33. (canceled)
34. (canceled)
35. (canceled)
36. (canceled)
37. (canceled)
38. (canceled)
39. A method of producing a structure of a plurality of RNA molecules comprising the step of designing RNA molecules to complementarily bind to another RNA molecule in at least one kissing loop region under suitable conditions, wherein at least two RNA molecules in the structure are bound to each other through complementary binding of a kissing loop on each RNA molecule, and wherein at least two RNA molecules comprise at least one three-way junction and at least one kissing loop.
40. The method of claim 39, wherein: (a) the conditions are suitable for self-assembly of the RNA molecules into the plurality; (b) the conditions are isothermal conditions; or (c) the conditions comprise a temperature greater than freezing.
41. (canceled) (canceled)
43. The method of claim 40, wherein the temperature is room temperature or 37 ° C.
44. The method of claim 39, wherein: (a) the RNA molecules self-assemble into the structure by binding only in a linear direction; (b) wherein the RNA molecules self-assemble into the structure by binding in a linear direction and in a direction perpendicular to the linear direction or at an angle from the linear direction; (c) wherein the RNA molecules self-assemble into the structure by binding in a linear direction and/or in a non-linear direction; (d) wherein the RNA molecules self-assemble into the structure by binding in a linear direction and in a direction perpendicular to the linear direction, wherein the linear direction and the direction perpendicular to the linear direction are within a plane, and also RNA molecules bind in a direction that is perpendicular to the plane and in a 90 angle from the plane.
45. (canceled) (canceled)
47. The method of claim 44(c), wherein the linear direction and the direction perpendicular to the linear direction are within a plane.
48. The method of claim 44(b), wherein the RNA molecules self-assemble into the structure by binding in a linear direction and in a direction perpendicular to the linear direction, wherein the linear direction and the direction perpendicular to the linear direction are within a plane, and also RNA molecules bind in a direction that is perpendicular to the plane and in a 90 angle from the plane.
49. The method of claim 39 wherein the method lacks a denature-renature cycle, an enzyme, a co-factor, or a combination thereof.
50. (canceled)
51. (canceled)
52. (canceled)
53. (canceled)
54. A structure comprising a plurality of RNA units configured in a pattern of one, two, or three dimensions, wherein the RNA units comprise one or more RNA molecules, wherein the one or more RNA molecules comprise at least one three-way junction and at least one kissing loop, wherein the structure is an ordered structure and/or wherein the structure is a designed structure.
55. The structure of claim 54, wherein the molecule is double stranded except for the kissing loop.
56. (canceled)
57. (canceled) (canceled)
59. A method of producing the a structure comprising the steps of: providing a synthetic RNA molecule, comprising at least one three-way junction and at least one kissing loop or providing a plurality of RNA molecules, wherein at least two RNA molecules in the plurality are bound to each other through complementary binding of a kissing loop on each RNA molecule, and wherein at least two RNA molecules in the plurality comprise at least one three-way junction and at least one kissing loop; and subjecting a plurality of the synthetic RNA molecules or the plurality of RNA molecules to suitable conditions to allow them to self-assemble to form the structure, wherein the structure comprises a plurality of RNA units configured in a pattern of one, two, or three dimensions, wherein the RNA units comprise one or more RNA molecules, wherein the one or more RNA molecules comprise at least one three-way junction and at least one kissing loop.
60. (canceled)
61. (canceled)
62. (canceled)
63. (canceled)
64. (canceled)
65. The method of claim 59 any one of claims 59, wherein the method occurs in a cell and structure binds to a region of a chromosome or organelle in the cell, wherein the structure binds to the chromosome through a single stranded region of the RNA molecule.
66. (canceled)
67. (canceled)
68. (canceled)
69. (canceled)
70. (canceled)
71. (canceled)
72. (canceled)
73. (canceled)
74. (canceled)
75. (canceled)
76. (canceled)
77. (canceled)
78. The method of claim 59,-wherein the method occurs in a cell and the structure binds to a region of a chromosome or organelle in the cell, and wherein the method comprises targeting of the structure to the chromosome using the CRISPR-Cas9 system.
79. The structure of claim 54, wherein the structure is configured in a linear string of molecules.
80. The structure of claim 54, wherein the structure is configured in a circle, a square, or a ladder.
81. The structure of claim 80, wherein the circle comprises an even number of RNA molecules.
82. The structure of claim 80, wherein the circle comprises an odd number of RNA molecules.
83. The structure of claim 80, wherein whether or not the circle has even or add number of RNA molecules is determined by whether the kissing loops are designed to engage in homodimer or heterodimer kissing loop interaction.
84. The structure of claim 54, wherein the structure is one-dimensional (1D), one and a half-dimensional (1.5D), two-dimensional (2D), or three-dimensional (3D).
85. The structure of claim 54, wherein one or more RNA molecules of the structure are polymerizable from a kissing loop.
Description
BRIEF DESCRIPTION OF THE DRAWINGS
[0021] For a more complete understanding of the present invention, reference is now made to the following descriptions taken in conjunction with the accompanying drawings.
[0022]
[0023]
[0024]
[0025]
[0026]
[0027]
[0028]
[0029]
[0030]
[0031]
[0032]
[0033]
[0034]
[0035]
[0036]
[0037]
[0038]
[0039]
[0040]
[0041]
[0042]
[0043]
[0044]
[0045]
[0046]
[0047]
[0048]
[0049]
DETAILED DESCRIPTION
[0050] As used herein the specification, “a” or “an” may mean one or more. As used herein in the claim(s), when used in conjunction with the word “comprising”, the words “a” or “an” may mean one or more than one. As used herein “another” may mean at least a second or more. Still further, the terms “having”, “including”, “containing” and “comprising” are interchangeable and one of skill in the art is cognizant that these terms are open ended terms. Some embodiments of the disclosure may consist of or consist essentially of one or more elements, method steps, and/or methods of the disclosure. It is contemplated that any method or composition described herein can be implemented with respect to any other method or composition described herein.
[0051] As used herein, the term “kissing loop” (which may also be referred to in the art as a kissing stem-loop) refers to when unpaired nucleotides in one hairpin loop base pair with unpaired nucleotides in another hairpin loop.
[0052] Embodiments of the disclosure encompass building of designer RNA structures, including nanostructures, and in specific embodiments the structures are utilized for an application, such as a biological application. Unlike proteins, RNAs are highly programmable polymers because of their ability to form specific Watson-Crick base pairing, a property that can be exploited to generate well-defined 1D, 2D, and 3D structures, for example. These structures are thermodynamically stable and form via spontaneous self-assembly, a process that requires no catalytic co-factors, in certain embodiments. In contrast to DNA, single-stranded RNA can be efficiently expressed at high levels in live cells, thus offering the opportunity to program cells to assemble designer nanostructures.
[0053] By considering the RNA sequences and RNA domains to be used, one can develop a useful RNA single unit design that can self-assemble into higher order architectures, reaching a size of micrometers, in some embodiments. Depending on specific configuration(s) used, these repeating RNA units assemble spontaneously into precisely organized structures including, for example, 1D strings and circles, 1.5D ladders, and 2D grids in isothermal condition without the denature-renature cycles. They are very stable, as they maintain their structural integrity in wet and dry condition.
[0054] The results demonstrated herein indicate that RNA can be used to program mammalian cells to assemble designer nanostructures for specific cellular functions useful for any one of synthetic biology applications. The disclosure encompasses genetically encodable higher order RNA nanostructures useful for programming cells to assemble designer nanostructures for specific cellular functions or for synthetic biology applications. In particular, depending on specific configurations used, these repeating RNA single units assembled spontaneously into precisely organized 1D strings and circles, 1.5D ladders, and 2D grids in isothermal condition without the denature-renature cycles. When these RNA single units were expressed in cells, they appeared to form stable higher order structures. Furthermore, RNA single units are genetically encodable and can be expressed by plasmids, viral vectors, or directly from engineered genome.
[0055] This lays the technological foundation for higher order RNA nanostructures useful for programming cells to assemble designer nanostructures for specific cellular functions or for synthetic biology applications.
I. RNA Structured Compositions and Methods of Producing Same
[0056] Embodiments of the disclosure include at least RNA subunits, polymers comprising 2 or more RNA subunits, structures generated therefrom, and methods of making and/or using them. The RNA subunits each at least have one three-way junction and one kissing loop that is not inactivated, in specific embodiments. In at least some cases, the three-way junction(s) of a particular RNA subunit provides the geometry of the subunit, and the kissing loop (KL) is an active site that is used for the interaction between two (or more) units.
[0057] In particular embodiments, RNA that is expressed in cells generates a dsRNA scaffold to minimize mis-foldings and mis-interactions. In certain embodiments, ssRNA is not utilized to avoid interference with other molecules. Thus, in particular embodiments the RNA molecules lack ssRNA sequences, although in certain embodiments the RNA molecules comprise ssRNA sequences. The RNA molecules are capable of undergoing spontaneous self-assembly, including in isothermal conditions at 37° C. In specific aspects the RNA molecules are not subject to a denature-renature cycle. In specific embodiments, the RNA is devoid of one or more cellular signals, such as devoid of a splice site, a polyA signal, and/or devoid of a protein domain. In alternative embodiments, the RNA may comprise one or more cellular signals and in such cases, the cellular signal(s) may be present in the RNA but not by design.
[0058] In particular embodiments, an RNA molecule utilized in compositions and methods of the disclosure comprise, consist of, or consist essentially of one or more three-way junctions (for example from rRNA, riboswitches, ribozymes, viruse, and/or pRNA) and one or more kissing loops (for example from HIV virus and other viruses, and kissing developed by in vitro evolution. In fact, any two loops with complimentary in sequence that allow stable interactions can be used. In a plurality of RNA subunits of the disclosure (for example, in a single structure), all (or in some cases less than all) of the RNA subunits comprise, consist of, or consist essentially of one or more three-way junctions and one or more kissing loops. In specific embodiments, in a plurality of RNA subunits, the majority of RNA subunits comprise, consist of, or consist essentially of one or more three-way junctions and one or more kissing loops. In a plurality of RNA subunits, at least 70, 75, 80, 85, 90, 91, 92, 93, 94, 95, 96, 97, 98, or 99% of RNA molecules comprise, consist of, or consist essentially of one or more three-way junctions and one or more kissing loops. In specific cases, the RNA molecules lack ssRNA sequences except in the kissing loop(s).
[0059] An RNA molecule may comprise, consist of, or consist essentially of at least two RNA subunits. An RNA molecule may comprise, consist of, or consist essentially of multiple RNA subunits, such as at least 2, 3, 4, 5, 6, 7, 8, 9, 10, 25, 30, 35, 40, 45, 50, 75, 100, 250, 500, 750, 1000, or more subunits. The number of RNA subunits in a higher order structure is limited only by the cellular compartments where they are expressed. In specific cases, an RNA molecule comprises, consists of, or consists essentially of at least or no more than between 2 and 1000, 2 and 750, 2 and 500, 2 and 250, 2 and 100, 2 and 75, 2 and 50, 2 and 25, 2 and 10, 2 and 5, 5 and 1000, 5 and 750, 5 and 500, 5 and 250, 5 and 100, 5 and 75, 5 and 50, 5 and 25, 5 and 10, 10 and 1000, 10 and 750, 10 and 500, 10 and 250, 10 and 100, 10 and 75, 10 and 50, 10 and 25, 25 and 1000, 25 and 750, 25 and 500, 25 and 250, 25 and 100, 25 and 75, 25 and 50, 50 and 1000, 50 and 750, 50 and 500, 50 and 250, 50 and 100, 50 and 75, 75 and 1000, 75 and 500, 75 and 250, 75 and 100, 100 and 1000, 100 and 750, 100 and 500, 100 and 250, 250 and 1000, 250 and 750, 250 and 500, 500 and 1000, 500 and 750, or 750 and 1000 RNA subunits.
[0060] In particular embodiments, an RNA subunit is of a particular size including particular dimensions. In some cases the RNA subunit is at least 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, or more nanometers in length and/or in some cases the RNA subunit is at least 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, or more nanometers in width.
[0061] In specific embodiments, the RNA subunit is at least 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 100, 125, 150, 175, 200, 225, 250, 300, or more nucleotides in length.
[0062] In an RNA subunit, there may be a certain number of three-way junctions and a certain number of kissing loops. The RNA subunit itself may or may not comprise in-plane geometry The RNA may or may not comprise a generally bone shape. The RNA subunit (and therefore the RNA molecule that comprises it) may lack alternative folding or have minimized alternative folding because of its sequence design. In specific embodiments, an RNA subunit may comprise, consist of, or consist essentially of two three-way junctions and three kissing loops (see
[0063]
[0064] In specific cases, an RNA molecule that is a polymer of RNA subunits comprises multiple units of the same RNA subunit having the same sequence and structure. In other cases, an RNA molecule that is a polymer of RNA subunits comprises multiple units of different RNA subunits having different sequence (that may or may not have the same general structure, such as generally bone shaped, for example). In cases in which closed circles are generated, there may be an even number of RNA subunits therein, or odd number depending on the kissing loops employed.
[0065]
[0066]
[0067]
[0068]
[0069]
[0070]
[0071]
[0072]
[0073]
[0074] In particular embodiments, RNA structures are produced in a cell. The cell may be of any kind. The cell may be transformed or transfected with ssRNA that upon secondary structure folding produces folded single RNA subunits that then within the cell self-assemble into polymerized structures (
[0075] In particular embodiments, one can visualize nanostructures in cells, for example using RNA FISH combined with light microscopy. As illustrated in
[0076] In some embodiments, an RNA molecule or one or more RNA molecules in a plurality thereof comprises at least one arm that extends from a three way junction away from a plane that comprises two arms from the same junction (the extending arm may be referred to as the Z arm). In specific embodiments, the Z arm protects the 5′ and/or 3′ end of the RNA molecule. In such a case, the part of the RNA molecule that has activity is in the XY plane.
[0077] However, in some cases, a RNA molecule can host additional three way junctions and kissing loops in the Z-axis. This modularity or flexibility allows the possibility of polymerization in the Z direction for constructing higher order structures with 3-dimension.
II. Applications for RNA Structured Compositions
[0078] In one embodiment, the RNA structures produced by methods encompassed by the disclosure are utilized for a specific purpose. In particular embodiments, genetically encodable higher order RNA nanostructures are utilized for synthetic biology applications in cells, including mammalian cells.
[0079] The RNA structures may be generated for manufacturing purposes or for genetic manipulation, for example. In one embodiment, the RNA structures are utilized to produce a product, for example as a substrate for producing one or more end products from one or more starting products. In one example, a product is manufactured using the RNA structures as a support or scaffold for the process. The RNA structure itself may or may not be modified to incorporate a component of the manufacturing process. In one embodiment the RNA structures are utilized as a structure that contains aptamers to anchor one or more manufacturing components, such as an enzyme or cofactor, for example. In specific embodiments, one or more products are produced in cells that house the RNA structures, including cells that have themselves produced the RNA structures. In one embodiment, RNA structures can be engineered and expressed in cells as cytoskeleton to control the shape of the cells.
[0080] In particular embodiments, one or more agents, such as one or more enzymes, are affixed to the structure via an aptamer or a set of aptamers that replaces a kissing loop at the end of an arm in a X, Y, or Z direction, for example. The aptamers can also be embedded in the middle of the arm so that the end of arm is available for other functionalization. RNA structures of any kind may be modified to incorporate one or more enzymes to produce a product. As demonstrated in
[0081] In some cases, one can utilize RNA structures produced by methods of the disclosure to manipulate other nucleic acids, such as regions of cellular DNA, including genomic or mitochondrial DNA. In specific embodiments, highly structured RNA nanostructures may be used to anchor and coat one or more specific regions of one or more chromosomes, thereby shutting down or regulating gene expression at those region(s)s (analogous to X-chromosome inactivation by Xist RNA). This could be achieved by using CRISPER/Cas9 to target guide RNA with embedded subunit to specific genome locations as anchoring ‘seeds’. Subsequent polymerization on the anchored seed RNA would lead to the coating of those regions with RNA.
[0082] In some cases, one can engineer and express designer RNA structures to build dynamic cytoskeleton system in cells to control the shape of the cells (analogous to actin filaments and microtubules). In specific embodiments, designer RNA cytoskeletons may be used to extend the axons of motor neurons to cross the scar lesion in spinal cord due to spinal cord injury, thus facilitating the re-innervation of muscle cells by motor neurons.
EXAMPLES
[0083] The following examples are included to demonstrate preferred embodiments of the invention. It should be appreciated by those of skill in the art that the techniques disclosed in the examples that follow represent techniques discovered by the inventors to function well in the practice of the invention, and thus can be considered to constitute preferred modes for its practice. However, those of skill in the art should, in light of the present disclosure, appreciate that many changes can be made in the specific embodiments which are disclosed and still obtain a like or similar result without departing from the spirit and scope of the invention.
Example 1
Building Designer RNA Nanostructures for Synthetic Biology Applications
[0084] Unlike proteins, RNAs are highly programmable polymers due to their ability to form specific WatsonCrick base pairing, a property that can be exploited to create well-defined 2D and 3D structures. These structures are thermodynamically stable, and formed via spontaneous self-assembly, a process that requires no catalytic cofactors.
[0085] In contrast to DNA, single-stranded RNA can be efficiently expressed at high levels in live cells, thus offers the opportunity to program cells to assemble designer nanostructures. By careful considering the RNA sequences and RNA domains used, an RNA single unit design was developed that self-assembled into higher order architectures, reaching a size of micrometers. Depending on specific configurations used, these repeating RNA single units assembled spontaneously into precisely organized 1D strings and circles, 1.5D ladders, and 2D grids in isothermal condition without the denature-renature cycles. They are very stable, as they maintained the structural integrity in wet and dry condition. When these RNA single units were expressed in human cells, they appeared to form stable higher order structures. The results represent a first in the field, and lays the technological foundation for genetically encodable higher order RNA nanostructures useful for programing cells to assemble designer nanostructures for specific cellular functions or for synthetic biology applications.
[0086]
[0087] Sequences of these examples of structures sequences are provided herein:
TABLE-US-00001 19f (SEQ ID NO: 1) Ggctgcagcttgatcccggcttgagcgctgcgagagcaagccgaagcgg gcacggcttgctctcgctaacgtgtcttcgacggacagcacgagagctg aagccggcacggctctcgtgctgcacaccgaacgcgaagcccgcacgcg ttcggtgtgctaacgttgaagacacggacagcgctcgagccggtcgatc gctgtagcc 22b (SEQ ID NO: 2) Ggctgcagcagatctagaccgctgccgacgatggcgaagccggcacgcc atcgttggctaacgtgccatgagacggacagctcgctcctagaccgtga acaacaaacgcggtctaggagtgagctgcacaccgaaccgaggtgcaca cggttcggtgtgctaacgtctcgtggcacggacagcggtctggatctgt tgcagcc 24a (SEQ ID NO: 3) Ggctgcagtgattagtctggtggctcggacagcggtctggacgaagccg gcacgtccagatcgctgccgacgatgagcgaagcgggcacgctcatcgt tggctaacgagtcacctaacgagtgacggacagctcgctcagcgaggtg cacacgctgagtgagctgcacatcgaacgcgaagcccgcacgcgttcgg tgtgctaacgtcgctcggacagactgatcattgcagcc 28a (SEQ ID NO: 4) Ggctgcagtgattagctggtcagtgcacggacagcggtctggacgaagc gcgcacgtccagatcgctgccgacgatgagcgaagggcccacgctcatc gttggctaacgtgcattgacctaacgagacggacagctcgctcagcgaa gccggcacgctgagtgagctgcacatcgaacgcgaggtgcacacgcgtt cggtgtgctaacgtctcggacagctgatcattgcagcc 30a (SEQ ID NO: 5) Ggctgcagtgattagtctggtagagtctcggacagcggtctggacgaag ccggcacgtccagatcgctgccgacgatgagcgaagcgggcacgctcat cgttggctaacgagattctacctaacgagttgtgacggacagctcgctc agcgaggtgcacacgctgagtgagctgcacatcgaacgcgaagcccgca cgcgttcggtgtgctaacgtcgcaactcggacagactgatcattgcagcc 39a (SEQ ID NO: 6) Ggctgcagtgattagtctggtagagtctcggacagcggtctggacgagg tgcacacgtccagatcgctgccgacgatgagcgaagcgcgcacgctcat cgttggctaacgagattctacctaacgagttgtgacggacagctcgctc agcgaggtgcacacgctgagtgagctgcacatcgaacgcgaagcgcgca cgcgttcggtgtgctaacgtcgcaactcggacagactgatcattgcagc c 40a (SEQ ID NO: 7) Ggctgcagtgattagtctggtagagtctcggacagcggtctggacgaag ccggcacgtccagatcgctgccgacgatgagcgaagcgcgcacgctcat cgttggctaacgagattctacctaacgagttgtgacggacagctcgctc agcgaagccggcacgctgagtgagctgcacatcgaacgcgaagcgcgca cgcgttcggtgtgctaacgtcgcaactcggacagactgatcattgcagc c 41a (SEQ ID NO: 8) Ggctgcagtgattagtctggtagagtctcggacagcggtctggacgaag ccggcacgtccagatcgctgccgacgatgagcgaggtgcacacgctcat cgttggctaacgagattctacctaacgagttgtgacggacagctcgctc agcgaagccggcacgctgagtgagctgcacatcgaacgcgaggtgcaca cgcgttcggtgtgctaacgtcgcaactcggacagactgatcattgcagc c
[0088] Although the present invention and its advantages have been described in detail, it should be understood that various changes, substitutions and alterations can be made herein without departing from the spirit and scope of the invention as defined by the appended claims. Moreover, the scope of the present application is not intended to be limited to the particular embodiments of the process, machine, manufacture, composition of matter, means, methods and steps described in the specification. As one of ordinary skill in the art will readily appreciate from the disclosure of the present invention, processes, machines, manufacture, compositions of matter, means, methods, or steps, presently existing or later to be developed that perform substantially the same function or achieve substantially the same result as the corresponding embodiments described herein may be utilized according to the present invention. Accordingly, the appended claims are intended to include within their scope such processes, machines, manufacture, compositions of matter, means, methods, or steps.