A METALLIC SAMPLE HOLDER, A PROBE FOR PERFORMNG DETECTION REACTIONS, AND APPARATUS FOR RECEIVING THE SAMPLE HOLDER

Abstract

A metallic sample holder includes an array of wells, wherein each well of the array is adapted to capture a sample volume. A first sector of the array comprises wells that are loaded with a first reagent of a first dried or freeze-dried nucleic acid amplification test reagent. A second sector of the array comprises wells that are loaded with a second reagent of a second dried or freeze-dried nucleic acid amplification test reagent.

Claims

1. A metallic sample holder, comprising an array of wells, wherein each well of the array is adapted to capture a sample volume, wherein a first sector of the array comprises wells that are loaded with a first dried nucleic acid amplification test kit or a first freeze-dried nucleic acid amplification test, wherein a second sector of the array comprises wells that are loaded with a second dried nucleic acid amplification test kit or a second freeze-dried nucleic acid amplification test kit, wherein the first sector is in thermal connection with the second sector, wherein the sample holder is adapted to have the same temperature in the first section and in the second section if the sample holder is exposed to a temperature change.

2. The metallic sample holder according to claim 1, wherein the distance d.sub.w between a well of the first sector and a well of the second sector is d.sub.w<0.9 mm, or 0.2 mm≤d.sub.w≤2 mm.

3. The metallic sample holder according to claim 1 is adapted for capturing sample volumes for nucleic acid amplification test reactions.

4. The metallic sample holder according to claim 1, wherein the first test kit comprises a first set of primers specific for a first test for identifying and/or quantifying a first nucleic acid and wherein the second test kit comprises a second set of primers specific for a second test for identifying and/or quantifying a second nucleic acid.

5. The metallic sample holder according to claim 4, wherein the first test kit comprises a nucleic acid amplification enzyme, dNTPs and a buffer; and/or wherein the second test kit comprises a nucleic acid amplification enzyme, dNTPs and a buffer.

6. The metallic sample holder according to claim 1, wherein the first test kit comprises a nucleic acid detection probe for a first test for identifying and/or quantifying a first nucleic acid and/or a fluorescent dye; and/or wherein the second test kit comprises a nucleic acid detection probe for a second test for identifying and/or quantifying a second nucleic acid and/or a fluorescent dye.

7. The metallic sample holder according to claim 1, wherein the first test kit comprises a reverse transcriptase enzyme; and/or wherein the second test kit comprises a reverse transcriptase enzyme.

8. The metallic sample holder according to claim 1, wherein the first nucleic acid is a first RNA or DNA isolated from a first virus, in particular from a corona virus; and/or wherein the second nucleic acid is a second RNA or DNA isolated from a second virus, in particular an influenza virus.

9. The metallic sample holder according to claim 1, wherein the first nucleic acid is a first RNA or DNA isolated from a first virus, in particular from the SARS-Co-2 virus; and/or wherein the second nucleic acid is a second RNA or DNA isolated from a second virus, in particular an influenza virus.

10. The metallic sample holder according to claim 1, wherein the first set of primers and the second set of primers have essentially the same annealing temperature; or have a difference ΔTm of 0.1-5° C. in annealing temperature.

11. The metallic sample holder according to claim 1, wherein a first length of a fragment of the first nucleic acid is essentially equal to a second length of a fragment of the second nucleic acid.

12. The metallic sample holder according to claim 1, wherein each well is adapted to capture a maximal sample volume v.sub.max, with v.sub.max=15 μl, and/or wherein the metallic sample holder consists of aluminum, silver, gold, copper, or alloys thereof.

13. The metallic sample according to claim 1, wherein a well (NEG/POS) of first sector is adapted for a positive or negative test control, and/or wherein a well (NEG/POS) of the second sector is adapted for a positive or negative test control.

14. The metallic sample holder according to claim 1, wherein each well is of cylindrical shape, of conical shape, or of elliptical shape and/or has at least partially a flat bottom area, and/or wherein the bottom area is configured to reflect an optical signal by means of a flat metallic layer, and/or wherein the surface of the wells is free of any coating except nucleic acid amplification test kits.

15. The metallic sample holder according to claim 1, comprising an identifier.

16. The metallic sample holder according to claim 15, wherein the identifier comprises information about the method for detection of the nucleic acid.

17. An apparatus adapted for receiving the metallic sample holder according to claim 1, comprising a thermal setting element thermally coupleable to the sample holder for controlling the temperature of the sample holder, a controller for controlling a thermal cycle of the thermal setting element, an optical detector arranged in line of sight of the array of wells of the sample holder, wherein the optical detector is configured to detect a plurality of optical signals from the sample volume of each well of the first sector of the array, and to detect a plurality of optical signals from the sample volume of each well of the second sector of the array of said metallic sample holder.

18. The apparatus according to claim 17, wherein the controller is configured to control the optical detector for recording a plurality of optical signals from a plurality of sample volumes of a plurality of wells for each thermal cycle of the thermal setting element, and/or wherein the optical detector (4) is configured to assign each optical signal to the corresponding sample volume, and in particular to the corresponding first or second sector.

19. The apparatus according to claim 17, wherein the thermal interface conductance between the thermal setting element and the sample holder is at least 1000 W/(m.sup.2K), and/or wherein the controller is configured to steer the thermal setting element to heat the sample holder with a net effective heating ramp equal or higher than 5.0° C./s, and/or wherein the controller is configured to steer the thermal setting element to cool down the sample holder with a net effective cooling ramp equal or lower than −5.0° C./s.

20. A method for detection of a first or a second nucleic acid from a sample and/or for distinction of the first nucleic acid from the second nucleic acid of the sample, comprising the steps of providing a sample holder comprising an array of wells, wherein each well of the array is adapted to capture a sample volume, wherein a first sector of the array comprises wells that are loaded with a first dried nucleic acid amplification test kit or a first freeze-dried nucleic acid amplification test, wherein a second sector of the array comprises wells that are loaded with a second dried nucleic acid amplification test kit or a second freeze-dried nucleic acid amplification test kit, wherein the first sector is in thermal connection with the second sector, wherein the sample holder is adapted to have the same temperature in the first section and in the second section if the sample holder is exposed to a temperature change, application of the nucleic acids isolated from the sample onto the first sector and the second sector of the array of the sample holder and thereby dissolving the dried nucleic acid amplification test kit or the freeze-dried nucleic acid amplification test kit running a temperature program with the apparatus according to claim 17, detection of the presence or absence of the first and/or second nucleic acid.

21. A method of using an apparatus according to claim 17 for detection of a first or a second nucleic acid from a sample and/or for distinction of the first nucleic acid form the second nucleic acid of the sample, wherein the apparatus comprises a camera for monitoring the method steps, wherein a feedback loop informs an operator of the apparatus about whether the method steps have been conducted.

22. The metallic sample holder according to claim 7, wherein the first nucleic acid is a first RNA or DNA isolated from a first virus, in particular from a corona virus; and/or wherein the second nucleic acid is a second RNA or DNA isolated from a second virus, in particular an influenza virus.

23. The metallic sample holder according to claim 7, wherein the first nucleic acid is a first RNA or DNA isolated from a first virus, in particular from the SARS-Co-2 virus; and/or wherein the second nucleic acid is a second RNA or DNA isolated from a second virus, in particular an influenza virus.

24. The metallic sample holder according to claim 15, wherein the identifier comprises information on how to run a program for the PCR reaction detection.

25. An apparatus according to claim 17 which is an apparatus for polymerase chain reaction detection.

Description

BRIEF DESCRIPTION OF THE DRAWINGS

[0099] The invention will be better understood and objects other than those set forth above will become apparent from the following detailed description thereof. Such description makes reference to the annexed drawings, wherein:

[0100] FIG. 1 shows a schematic of a metallic sample holder according to an embodiment of the invention,

[0101] FIG. 2a shows an enlarged section of the sample holder,

[0102] FIG. 2b shows a schematic of the metallic sample holder with the first and second sector according to an embodiment of the invention;

[0103] FIG. 3 shows a schematic of a cross section of an apparatus according to an embodiment of the invention,

[0104] FIG. 4 shows a schematic perspective view of an apparatus according to an embodiment of the invention,

[0105] FIG. 5 shows a schematic view of a cross section of an apparatus according to an embodiment of the invention.

[0106] FIG. 6 shows a schematic view of an embodiment of a sample holder with a positive and negative test control.

MODES FOR CARRYING OUT THE INVENTION

[0107] FIG. 1 shows a schematic view of a preferred embodiment of the metallic sample holder 1 according to the invention. The sample holder 1 comprises an array of wells 10. The array 10 can cover selected areas of the sample holder 1 as shown in the figure or can extend over the full area of the sample holder 1. In particular, the wells 11 of the array 10 can be arranged in a specific pattern. In the embodiment shown in the figure, the wells 11 are arranged evenly spaced in a regular rectangular pattern.

[0108] A preferred embodiment of the invention comprises an array 10 with at least 2-3 wells. The array of wells 10 displayed in the figure showing only few wells 11 is a symbolic illustration of the preferred array 10.

[0109] The metallic sample holder 1 is preferably made of aluminum.

[0110] A preferred size of the sample may be 4 cm times 4 cm. The small size and the correlating small mass of the sample holder allows fast heating and cooling of the holder and therefore faster thermal cycling. In particular, the arrangement of the array 10 on the sample holder 1 leaves space at the edge of the sample holder 1 to handle the holder 1 by means of hands or tweezers without interfering with the array of wells 10. Preferably, no wells 11 are arranged within a distance of 0.5 cm from the edge of the sample holder 1.

[0111] As shown in the enlarged section in FIG. 2a, the wells 11 themselves are essentially of cylindrical shape. The essentially cylindrical shape can also tend to be slightly conical, for fabrication reasons, as shown in the figure.

[0112] In particular, the wells 11 have an at least partially flat bottom area 111. The essentially flat bottom area 111 serves for reflecting an optical signal. In particular because the sample holder 1 is made of metal, the reflected optical signal is very strong and can be detected by an optical detector 4.

[0113] The sample volumes are directly filled into the wells. No coating of the metallic sample holder 1 is required.

[0114] In particular, the well 11 has a flat bottom surface 111 that promotes reflection of the optical signal within the well 11.

[0115] FIG. 2b schematically shows the separation of the array into a first sector 151 and a second sector 152, wherein the first sector 151 of the array comprises wells that are loaded with a first dried or freeze-dried nucleic acid amplification test kit. Wherein the second sector 152 of the array comprises wells that are loaded with a second dried or freeze-dried nucleic acid amplification test kit.

[0116] In a further advantageous embodiment of the invention, the first set of primers and the second set of primers have essentially the same annealing temperature or a difference ΔTm in annealing temperature.

[0117] The difference between the annealing temperatures of the first set of primers and the second set of primers is in particular ΔTm is 0.1-5° C., in particular 0.1-3° C., in particular 1-5° C., very particular 1-3° C.

[0118] In a further advantageous embodiment of the invention, a first length of a fragment of the first nucleid acid that is amplified is essentially equal to a second length of a fragment of the second nucleid acid that is amplified.

[0119] In particular, the difference in length between the first length of a fragment and the second length of a fragment is maximal 10-1000 bp, in particular 10-500 bp, 10-200 bp, wherein bp refers to base pairs.

[0120] Furthermore, an embodiment of the sample holder as shown in FIG. 2b might comprise an identifier (155). The identifier might provide information regarding the test kits of the first and/or second sector of the sample holder.

[0121] FIG. 3 shows a cross-section of a preferred embodiment of the apparatus 200. The apparatus 200 comprises a body 2. In the preferred embodiment shown in the figure, all components of the apparatus 200 are arranged within this body 2.

[0122] The apparatus 200 is adapted for receiving the metallic sample holder 1. In the figure, the apparatus 200 is illustrated comprising the sample holder 1. The apparatus 200 comprises a thermal setting element 3 that is thermally coupled to the sample holder 1 for controlling the sample holder 1 temperature. In the figure, the sample holder 1 is arranged on the thermal setting element 3.

[0123] In addition, the apparatus 200 further comprises a controller 6 for controlling the thermal cycle of the thermal setting element 3. The controller 6 might be arranged in a base body of the apparatus 200 as shown in FIG. 3. The controller 6 might comprise a screen 61 for displaying the cycling data. In particular, the controller 6 sends signals to the thermal setting element 3 for steering the heating or cooling of the thermal setting element 3. Since the thermal setting element 3 is thermally coupled to the sample holder 1, the sample holder 1 reaches the same temperature as the thermal setting element 3.

[0124] Therefore, the temperature of the sample holder 1 can be controlled by the controller 3. In addition, the temperature cycles of the sample holder 1 can also be controlled by the controller 3.

[0125] For example, three consecutive heating and cooling cycles are performed. Initially, the sample holder 1 is heated for 9 seconds, then it is kept at a temperature above 80° C. for 14 seconds and then it is cooled for 6.5 seconds. Preferably, the system is switched off for 10 seconds after every heating and cooling cycle.

[0126] The apparatus comprises further an optical detector 4 arranged in a way that the array of wells 10 of the sample holder 1, if there is any sample holder 1 mounted to the apparatus 200, would be in line of sight of the optical detector 4. In line of sight of the optical detector 4 refers to the arrangement of the optical detector 4 in an optical line with the array of wells 10, as shown in FIG. 3, where the optical detector 4 is arranged in an upper part of the body 2 of the apparatus 200. The thermal setting element 3 that preferably comprises a stage for the sample holder 1 is arranged in a centre part of the body 2 of the apparatus 200.

[0127] The distance between the level of the sample holder 1 that is mounted to the stage of the thermal setting element 3 and the level of the optical detector 4 is about 4.5 cm.

[0128] Not visible on the figures, a lens could be arranged between the sample holder 1 and the optical detector 4.

[0129] The optical detector 4 is configured to detect at least one optical signal from one sample volume of one well 11 of the sample holder 1.

[0130] The optical signal that can be detected by the optical detector 4 is preferably an optical signal that is generated by the liquid sample volume if the sample volume is excited by light that is reflected on the surface area, in particular on the flat bottom area 111, of one of the wells 11.

[0131] Preferably, the optical detector 4 receives an optical signal from each sample volume of the wells 11 of the array 10 simultaneously.

[0132] The optical detector 4 comprises preferably a CCD or CMOS sensor as an optical sensor element. In particular, the optical detector 4 can comprise a lens for focusing the optical signal to the optical sensor element.

[0133] The apparatus 200 can comprise a light source 5 for exciting the sample volume. The light source 5 might be an individual lamp. Preferably, the light source 5 is designed as a set of lamps arranged close to and/or around the optical detector 4. The light source 5 might be one or more LEDs or a mercury lamp.

[0134] FIG. 4 shows a perspective view of an embodiment of an apparatus 200 according to the invention. The sample holder 1 is mounted to the apparatus 200.

[0135] Preferably, the sample holder 1 is mounted to the thermal setting element 3 or in particular to a stage of the thermal setting element 3 of the apparatus 200. In a further embodiment, the sample holder 1 could also be mounted to a stage of the apparatus 200, wherein the thermal setting element 3 is in thermal connection to the sample holder 1 for heating or cooling the sample holder 1 and the sample volumes respectively.

[0136] The body 2 serves as a housing and also as a scaffold for all the components of the apparatus 200.

[0137] The body 2 has preferably a pyramidal outer shape as shown in the figure. This shape of the body 2 is advantageous, since it has a bigger surface for a given machine volume and therefore its functionality as a heat sink is very efficient.

[0138] In particular the sample holder 1, if mounted to the apparatus 200 as shown in this figure, is thermally coupled to the body 2, such that the body 2 might serve as a thermal heat sink for enabling fast change of temperature of the sample holder 2.

[0139] The optical detector 4 and any optional lenses are arranged within a peak section 21 of the preferably pyramidal body 2. In addition, also the light source 5 can be arranged within this peak 21.

[0140] To mount the sample holder 2 to the apparatus 200, the peak section 21 can be lifted as shown in the figure and the sample holder 1 can be arranged onto the thermal setting element 3 or a stage of the thermal setting element 3.

[0141] The body 2 of the apparatus 200 can further comprise a screen 61, e.g. to display temperature data of the thermal setting element 3 or of a temperature sensor.

[0142] Preferably, the apparatus 200 has the dimensions of 8 cm×8 cm×17 cm and is very lightweight. Preferably, the apparatus 200 weights less than 5 kg, in particular less than 3 kg.

[0143] FIG. 5 shows a cross section of a preferred embodiment of the apparatus 200. The sample holder 1 is mounted to the apparatus 200.

[0144] The cross-sectional view reveals the interior of the apparatus 200. In particular, the optical detector 4 and the light source 5 are arranged in the peak section 21 of the apparatus body 2.

[0145] The sample holder 1 is mounted to the thermal setting element 3.

[0146] The light source 5 in this embodiment is arranged close by the location, in particular a stage, where the sample holder 1 is mounted.

[0147] The peak section 21 can be lifted for mounting the sample holder 1 onto the stage. In particular, the peak section 21 might be connected to the remaining body 2 by means of a hinge.

[0148] A controller 6 is arranged within the lower part, respectively the remaining part without the peak section 21, of the apparatus body 2.

[0149] FIG. 6 shows an embodiment of a sample holder comprising a first (151, a second (152) and further sectors (153, 154). In particular, each of the sectors comprises a test kit, wherein each of the test kits comprises a set of primers specific for detecting a virus.

[0150] In the example as shown in FIG. 6, one of the wells (NEG) of the first and of the second sector is adapted for a negative test control. One of the wells (POS) of the third and fourth sector is adapted for a positive test control. It is clear that the respective wells (NEG, POS) might also be arranged in different sectors of the sample holder.

EXAMPLES

Example 1

[0151] The first example was performed with a sample holder with dimensions of 40×40×8 mm. The wells had a diameter of 2 mm, a depth of 0.6 mm and the sample holder is made of aluminum.

[0152] The detection capabilities of the device have been investigated by analyzing a sample volume comprising: [0153] Mastermix: gGeneon One.Direct.Step RT-qPCR Kit for Probes (2×), which contains Hot Start Taq DNA Polymerase, reverse transcriptase, reaction buffer, dNTPs. [0154] A solution of bovine serum albumin and MgSO4 [0155] Deionized water
The first section testing for a coronavirus had the following primers and probes: [0156] A forward primer: GAC CC C A AA ATC AG C G AA AT [0157] A reverse primer: TCT GG T T AC TGC CA G T TG AAT CT G [0158] A fluorescent probe: [FAM] ACC CC G C AT TAC GT T T GG TGG AC C[BHQ-1]
A positive control single strand RNA template:

TABLE-US-00001 EURM-019 Sequence (5′-3′): GGGAGACGAAUUGGGCCCUCUAGAUGCAUGCUCGAGCGGCCGCCAGUGUG AUGGAUAUCUGCAGAAUUCGCCCUUAUUCAAGUAUUGAGUGAAAUGGUCA UGUGUGGCGGUUCACUAUAUGUUAAACCAGGUGGAACCUCAUCAGGAGAU GCCACAACUGCUUAUGCUAAUAGUGUUUUUAACAUUUGUCAAGCUGUCCG GAAGAGACAGGUACGUUAAUAGUUAAUAGCGUACUUCUUUUUCUUGCUUU CGUGGUAUUCUUGCUAGUUACACUAGCCAUCCUUACUGCGCUUCGAUUGU GUGCGUACUGCUGCAAUAUUGUUAACGUAUAAUGGACCCCAAAAUCAGCG AAAUGCACCCCGCAUUACGUUUGGUGGACCCUCAGAUUCAACUGGCAGUA ACCAGAAUGGAGAACGCAUUGCAACUGAGGGAGCCUUGAAUACACCAAAA GAUCACAUUGGCACCCGCAAUCCUGCUAACAAUGCUGCAAUCGUGCUACA ACUUCCUCAAGGAAAUUUUGGGGACCAGGAACUAAUCAGACAAGGAACUG AUUACAAACAUUGGCCGCAAAUUGCACAAUUUGCCCCCAGCGCUUCAGCG UUCUUCGGAAUGUCGCGCAUUGGCAUGGAAGUCACACCUUCGGGAACGUG GUUGACCUACACAGGUGCCAUCAAAUUGGAGUGUGACAUACCCAUUGGUG CAGGUAUAUGCGCUAGUUAUCAGACUCAGACUAAUUCUCCUCGGCGGGCA CGUAGUGUAGCUAGUCAACCUGCUUUUGCUCGCUUGGAUCCGAAUUCAAA GGUGAAAUUGUUAUCCGCUCACAAUUCCACACAACAUACGAGCCGGAAGC AUAAAGUGUAAAGCCUGGGGUGCCUAAUGA.
The second section for an influenzavirus had the following primers and probes:

TABLE-US-00002 A forward primer: CAA GA C C AA TCY TG T C AC CTC TG A C A reverse primer: GCA TT Y T GG ACA AA V C GT CTA CG fluorecent probe: [FAM ]TGC AGT CCT CGC TCA CTG GGC ACG [BHQ-1]
A positive control single strand RNA template:

TABLE-US-00003 CAA GAC CAA UCC UGU CAC CUC UGA CUA AGG GGA UUU UAG GGU UUG UGU UCA CGC UCA CCG UGC CCA GUG AGC GAG GAC UGC AGC GUA GAC GGU UUG UCC AAA ACG C.
A sample volume smaller than 5 μL has been applied onto each well. The sample holder has been placed under the optical detector and the excitation light source of the device. The excitation light source is composed of 8 commercial LEDs with a power rating of 3 W and a central wavelength of 460 nm. The light sources were directed to the sample holder for exciting the sample volumes captured in the wells of the sample holder array.

[0159] Detection was performed with a single-board computer (Raspberry Pi model 3B) equipped with a CCD camera (Raspberry Pi Camera Module v2) that was placed vertically above the center of the sample holder. A 12 mm lens was mounted onto the CCD camera and a long pass filter was placed in front of the lens (cut on frequency approximately at 580 nm). The signal was detected by recording the image produced by the CCD camera and saving it to an image file. Portion of the signal detected by the optical sensor is shown in FIG. 6b.

[0160] While there are shown and described presently preferred embodiments and examples of the invention, it is to be distinctly understood that the invention is not limited thereto but may be otherwise variously embodied and practised within the scope of the following claims.

Example 2

[0161] In a further example, the NAAT reaction system may include: a nucleic acid amplification enzyme such as a DNA polymerase or a RNA polymerase, a reverse transcriptase enzyme, trehalose, bovine serum albumin, Tris-Cl, dNTPs, MgSO.sub.4.

[0162] Advantageously, the nucleic acid detection probes are functionalized with a fluorophore, for example FAM or ROX at the 5′ end and a fluorescence quencher, for example BHQ-1 at the 3′ end. The NAAT reaction system includes: forward primer 0.335 μM, reverse primer 0.335 μM, TaqMan probe 0.085 μM, DNA polymerase 0.5 U/uL, reverse transcriptase 0.5 U/μL; dNTPs 0.3 mM; Mg.sup.2+ 3 mM; seaweed Sugar 5 μM; Tris-Cl 5 mM. The total volume is 40 μL and the volume for each well is 2 μL. The reaction mix is fixed in individual wells through a freeze drying process. Not all wells are filled with the same reaction mix. There are at least 4 wells with primer/probe combinations for N1, at least 4 wells with primer/probe combinations for N2, at least 4 wells with primer/probe combinations for a control such as RnaseP, at least 4 wells with primer/probe combinations for the first virus (e.g. an first influenza virus) and at least 4 wells with primer/probe combinations for the second virus (e.g. a second influenza virus). At least 1 well of each primer/probe combination contains a positive control which may be a plasmid construct with known concentration.

Example 3

[0163] In a further example, the NAAT reaction system may include: a nucleic acid amplification enzyme such as a DNA polymerase, a reverse transcriptase enzyme, trehalose, bovine serum albumin, Tris-Cl, dNTPs, MgSO.sub.4.

[0164] Advantageously, the nucleic acid detection probes are functionalized with a fluorophore, for example FAM or ROX at the 5′ end and a fluorescence quencher, for example BHQ-1 at the 3′ end. The NAAT reaction system includes: forward primer 0.335 μM, reverse primer 0.335 μM, TaqMan probe 0.085 μM, DNA polymerase 0.5 U/uL, reverse transcriptase 0.5 U/μL; dNTPs 0.3 mM; Mg2+ 3 mM; seaweed Sugar 5 μM; Tris-Cl 5 mM. The total volume is 40 μL and the volume for each well is 2 μL. The reaction mix is fixed in individual wells through an air drying process. The air drying was carried out at 70° C. for 600 seconds with an airflow of 10 l/s. Not all wells are filled with the same reaction mix. For example, in a sample holder with six wells in each row, wells 1-6 test for a gene from Plasmodium falciparum, wells 7-12 test for a gene from the dengue virus and wells 13-18 test for a gene of Salmonella Typhi. Wells 19 and 20 are negative control tests (NTCs).