SNP MOLECULAR MARKER RELATED TO SINIPERCA CHUATSI INFECTIOUS SPLEEN AND KIDNEY NECROSIS VIRUS RESISTANCE, DETECTION METHOD AND USE THEREOF

Abstract

The invention relates to an SNP molecular marker located on a Siniperca chuatsi IFN-α3 gene and related to S. chuatsi infectious spleen and kidney necrosis virus (ISNKNV) resistance. On the basis of known cDNA, cloning is further carried out, an intron and a gDNA sequence of the S. chuatsi IFN-α3 gene are obtained, a primer is designed according to the gDNA sequence of IFN-α3, and through product amplification, and sequencing and alignment, SNP sites related to the disease-resistant or disease-susceptible characteristic of S. chuatsi germplasm are determined. Whereby, disease-resistant or disease-susceptible S. chuatsi germplasm can be rapidly screened out. The invention solves the problem of lack of the fish IFN-α3 gene, and also provides a theoretical basis and an operation method for breeding of disease-resistant germplasm by utilizing the heredity of the SNP sites and the correlation between the SNP sites and the disease-resistant characteristic.

Claims

1. An SNP molecular marker related to Siniperca chuatsi infectious spleen and kidney necrosis virus (ISNKNV) resistance, wherein a nucleotide sequence of the SNP molecular marker is as shown in SEQ ID NO. 1 or SEQ ID NO. 2.

2. The SNP molecular marker according to claim 1, wherein Siniperca chuatsi containing the SEQ ID NO. 1 sequence is susceptible to ISNKNV; and S. chuatsi containing the SEQ ID NO. 2 sequence is resistant to ISNKNV.

3. Use of the SNP molecular marker of claim 1 in the preparation of a reagent for identification or screening of Siniperca chuatsi infectious spleen and kidney necrosis virus (ISNKNV) resistance.

4. Use of the SNP molecular marker of claim 1 in the preparation of a reagent for breeding of Siniperca chuatsi germplasm.

5. Use of the SNP molecular marker of claim 1 in improving Siniperca chuatsi infectious spleen and kidney necrosis virus (ISNKNV) resistance.

6. A primer pair for detecting the SNP molecular marker of claim 1, wherein nucleotide sequences of the primer pair are as shown in SEQ ID NO. 11 and SEQ ID NO. 12.

7. A kit for detecting the SNP molecular marker of claim 1, wherein the kit comprises the primer pair of claim 6.

8. Use of the primer pair of claim 6 in the preparation of a reagent for identification or screening of Siniperca chuatsi infectious spleen and kidney necrosis virus (ISNKNV) resistance.

9. Use of the primer pair of claim 6 in the preparation of a reagent for breeding of Siniperca chuatsi germplasm or in improving S. chuatsi infectious spleen and kidney necrosis virus (ISNKNV) resistance.

10. A germplasm breeding method for Siniperca chuatsi with resistance to infectious spleen and kidney necrosis virus (ISNKNV), comprising steps of: (1) extracting a genomic DNA of S. chuatsi to be tested; (2) performing PCR amplification on the genomic DNA of the Siniperca chuatsi using the primer pair of claim 6 to obtain a PCR amplification product; (3) sequencing the PCR amplification product, comparing a result of the sequencing with an SNP molecular marker, wherein a nucleotide sequence of the SNP molecular marker is as shown in SEQ ID NO. 1 or SEQ ID NO. 2, determining whether a base at a position corresponding to the result of the sequencing is A or G, and eliminating the Siniperca chuatsi with the base A at the corresponding position and maintaining the S. chuatsi with the base G at the corresponding position, to obtain the S. chuatsi with resistance to ISNKNV.

Description

BRIEF DESCRIPTION OF THE DRAWINGS

[0029] To make the content of the invention more comprehensible, the invention will be described in further detail below according to specific embodiments of the invention and in conjunction with the accompanying drawings, wherein:

[0030] FIG. 1 shows the results of gel electrophoresis after PCR amplification of the Siniperca chuatsi IFN-α3 gene with the addition of a primer for the intron;

[0031] FIG. 2 shows the results of gel electrophoresis after SNP site detection and PCR amplification of the Siniperca chuatsi IFN-α3 gene;

[0032] FIG. 3 is a screenshot of the results of comparison of IFN-α3 DNA sequences of 16 Siniperca chuatsi samples, where base A is mutated to base G in five samples;

[0033] FIG. 4 is a DNA peak map generated by sequencing of IFN-α3 DNA of a Siniperca chuatsi sample using a gene sequencing instrument, where in the IFN-α3 DNA of the Siniperca chuatsi sample in the figure,the site 297 was mutated to G homozygote;

[0034] FIG. 5 is a DNA peak map generated by sequencing of IFN-α3 DNA of a Siniperca chuatsi sample using a gene sequencing instrument, where in the IFN-α3 DNA of the Siniperca chuatsi sample in the figure, the site 297 was A homozygote; and

[0035] FIG. 6 is a DNA peak map generated by sequencing of IFN-α3 DNA of a Siniperca chuatsi sample using a gene sequencing instrument, where in the IFN-α3 DNA of the Siniperca chuatsi sample in the figure, the site 297 was A heterozygote.

DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

[0036] The invention will be further described below in conjunction with the accompanying drawings and specific embodiments, so that those skilled in the art can better understand and implement the invention, but the embodiments described are not intended to limit the invention.

Example 1 Amplification of the Full-Length Sequence of the Siniperca chuatsi IFN-α3 Gene

1. Amplification of Intron of Siniperca chuatsi IFN-α3 Gene

[0037] Specific primers were designed with reference to the complete fragment of the known Siniperca chuatsi IFN-α3 cDNA to amplify the intron of the IFN-α3 gene (see Table 1). The Siniperca chuatsi genome DNA was used as a template for fragmented PCR amplification of the gene. The amplification procedure is shown in Table 2. The PCR products were sequenced. The obtained sequences were spliced by manual alignment and DNAMAN software to obtain the full length of the Siniperca chuatsi IFN-α3 gDNA gene, as shown in SEQ ID NO. 1. The results of gel electrophoresis after PCR amplification of the Siniperca chuatsi IFN-α3 gene with the addition of the primer for the intron are shown in FIG. 1, where a is an electrophoretogram of an amplification product of IFN-α3-4F,4R, b is an electrophoretogram of an amplification product of IFN-a3-3F,3R, c is an electrophoretogram of an amplification product of IFN-a3-1F,1R, and d is an electrophoretogram of an amplification product of IFN-a3-2F,2R.

TABLE-US-00002 TABLE 1 Sequences of primers used to amplify the intron of the IFN-α3 gene Primer name Primer sequence (5′-3′) IFN-α3-1F AGATCATGGGCGGTCAGATG IFN-α3-1R TGCTACCTGGGATACCGACA IFN-α3-2F ACACTACGGTCATGTGAGCA IFN-α3-2R TCCCTCGCTCTTCAAATGCTT IFN-α3-3F CCTGGGATACCGACAAGACG IFN-α3-3R AAGCACTCTGTACCGCACTG IFN-α3-4F GACTAACAAGCAAGCAAACTACAAA IFN-α3-4R CCCCCATAGCTACAACACTTCATCA

TABLE-US-00003 TABLE 2 Amplification procedure Procedure name Temperature Time Pre-denaturization 94° C. 5 min Denaturization 94° C. 30 s Anneal 52° C. 30 s Extension 72° C. 1 min ×35 cycle Final extension 72° C. 10 min

2. Detection of Disease-Resistant SNP Marker

[0038] (1) Primers were designed by using the sequence of Siniperca chuatsi IFN-α3 gDNA as a template (see Table 3), and PCR amplification was carried out. The reaction system is shown in Table 4. The reaction procedure is shown in Table 5.

TABLE-US-00004 TABLE 3 Primer sequences for amplification of Siniperca chuatsi IFN-α3 gene to obtain disease-resistant SNP sites Primer name Primer sequence (5′-3′) IFN-α3-SNP-1F AGCATGTTGGAGACAGCGAC IFN-α3-SNP-1R GAAGCTTCCTCTGCTCGTCC

TABLE-US-00005 TABLE 4 PCR reaction system for amplification of Siniperca chuatsi IFN-α3 gene to obtain disease-resistant SNP sites Component Volume (μL) Template (DNA) 2 Primer R (10 μL) 1 Primer F (10 μL) 1 2 × Easy Taq PCR Super Mix 25 ddH.sub.2O 21 In total 50

TABLE-US-00006 TABLE 5 PCR reaction procedure for amplification of Siniperca chuatsi IFN-α3 gene to obtain disease-resistant SNP sites Procedure name Temperature Time Pre-denaturization 94° C. 5 min Denaturization 94° C. 30 s Anneal 53° C. 30 s Extension 72° C. 1 min ×35 cycle Final extension 72° C. 10 min

[0039] (2) The PCR products were detected by 1.5% agarose gel electrophoresis. The PCR product with obvious lanes was selected and sequenced.

[0040] (3) Multiple sequence alignment was carried out using DNAMAN software, SNPs sites correlated to the virus resistance were found, and the DNA peak map was checked using Chromas software to determine the SNP sites.

Example 2 Detection Results Based on Disease-Resistant SNP Markers of Siniperca chuatsi IFN-α3 Gene

[0041] Siniperca chuatsi in the same group were cultured according to the same feeding conditions. After about two months of culture, 100 fishes were randomly selected from the cultured group for a challenge test. Each fish in each group was given 200 μL of infectious spleen and kidney necrosis virus (ISKNV, also known as iridovirus) (10.sup.3.68 TCID50/mL) by intraperitoneal injection, and observed for 10 consecutive days. The observation showed that the symptoms of some fishes were the same as those of fished infected with ISKNV in the natural environment within the 10 days, the diseased fishes swam slowly on the water surface or even directly floated on the water surface, with the body surface being not damaged, the body color being white, and the fish gills being ischemic white. The anatomy showed that: there was a lot of ascites in the abdominal cavity; the liver, stomach wall, and intestinal wall were engorged with blood, and yellow fluid was found in the intestine. These fishes were determined to be disease-susceptible Siniperca chuatsi. The fishes exhibiting no abnormality on the 10th day were determined to be disease-resistant Siniperca chuatsi. Siniperca chuatsi whose conditions cannot be judged were not used as samples. PCR-based detection showed that the head kidney of the diseased Siniperca chuatsi was positive for ISKNV, indicating that the cause of death was due to infection with ISKNV.

[0042] 12 fishes of disease-susceptible Siniperca chuatsi and 8 fishes of disease-resistant Siniperca chuatsi were selected respectively (with the disease-resistant Siniperca chuatsi being marked as A08, B08, C08, D08, E08, F08, G08, and H08), from which a small amount of tail fin was cut off and put into absolute ethanol for cryopreservation at 4° C. PCR amplification was carried out according to the disease-resistant SNP marker detection method in the above example. The result of electrophoresis is shown in FIG. 2. After sequencing of 20 samples, clear and complete nucleic acid sequences of 11 disease-susceptible Siniperca chuatsi samples and 5 disease-resistant Siniperca chuatsi samples were obtained. Multiple sequence alignment was carried out using DNAMAN software, and SNP sites correlated to disease resistance were found at the 297 bp in this nucleic acid fragment, as shown in FIG. 3.

[0043] Peak maps where the suspected mutated base in the above sequence is at 297 bp in the nucleic acid fragment were checked using Chromas software, as shown in FIG. 4, FIG. 5, and FIG. 6. The peaks obtained at the bases G and A corresponding to each other are all single peaks obviously without any stray peaks. Therefore, it can be concluded that the base is mutated at 297 bp of the nucleic acid fragment, and is converted from A to G, that is, A297G. As can be seen from comparison with the original DNA sequence, the mutation occurred at 376 bp of the original DNA sequence, which is located in the intron, where the base at the 376 bp is A for disease-susceptible Siniperca chuatsi and is G for disease-resistant Siniperca chuatsi, that is, the SNP site is A376G. The 5 samples with base mutation (D08, E08, F08, G08, H08) were all disease-resistant Siniperca chuatsi. The base was not mutated in disease-susceptible Siniperca chuatsi. Therefore, the SNP of the IFN-α3 gene of the disease-resistant Siniperca chuatsi is a mutation of the base from A to G at 376 bp. By this method, the disease-resistant Siniperca chuatsi and the disease-susceptible Siniperca chuatsi can be identified.

[0044] Apparently, the above-described embodiments are merely examples provided for clarity of description, and are not intended to limit the implementations of the invention. Other variations or changes can be made by those skilled in the art based on the above description. The embodiments are not exhaustive herein. Obvious variations or changes derived therefrom also fall within the protection scope of the invention.