CORYNEBACTERIUM GLUTAMICUM VARIANT HAVING ENHANCED L-CITRULLINE PRODUCTION CAPACITY, AND METHOD FOR PRODUCING L-CITRULLINE USING SAME

20230332192 · 2023-10-19

Assignee

Inventors

Cpc classification

International classification

Abstract

The present invention relates to a Corynebacterium glutamicum mutant strain having increased L-citrulline productivity and a method of producing L-citrulline using the same. The Corynebacterium glutamicum mutant strain is capable of producing L-citrulline in high yield and high concentration because the activity of the transport protein that is expressed by the NCgl2816 gene therein has been weakened or inactivated.

Claims

1. A Corynebacterium glutamicum mutant strain in which an activity of a protein that is expressed by NCg12816 gene has been weakened or inactivated and which has increased L-citrulline productivity.

2. The Corynebacterium glutamicum mutant strain according to claim 1, wherein the NCg12816 gene consists of the nucleotide sequence of SEQ ID NO: 1.

3. The Corynebacterium glutamicum mutant strain according to claim 1, wherein all or a portion of the NCg12816 gene has been inserted, substituted or deleted.

4. A method for producing L-citrulline comprising steps of: a) culturing the Corynebacterium glutamicum mutant strain of claim 1 in a medium; and b) recovering L-citrulline from the cultured mutant strain or the medium in which the mutant strain has been cultured.

Description

0045 MODE FOR INVENTION

[0036] Hereinafter, the present invention will be described in more detail. However, these descriptions are provided for illustrative purposes only to aid in the understanding of the present invention, and the scope of the present invention is not limited by these illustrative descriptions.

Example 1. Analysis of Transcriptome-Level Changes in Citrulline-Producing Strains

1-1. Cell Collection

[0037] In order to analyze transcriptome-level changes in citrulline-producing strains, cell collection was performed at the time of change in the growth stage of each strain.

[0038] First, each of a Corynebacterium glutamicum mutant strain (see Korean Patent Application No. 10-2019-0151321, hereinafter referred to as “CT4”), which has enhanced activity of ornithine carbamoyltransferase and carbamoyl phosphate synthase to overproduce citrulline, and a wild-type Corynebacterium glutamicum strain (ATCC13032), was inoculated in a citrulline seed medium and cultured at 30° C. for 10 hours, and then 250 mL of each culture was inoculated in a 5-L culture medium. When the glucose contained in the initial medium was completely exhausted, an additional medium was added. At 13, 28, 35, and 68 hours of culture after seeding, cells were collected and used for preparation of transcriptome analysis samples. The compositions of the media used in this experiment are shown in Table 1 below.

TABLE-US-00001 Composition (/L) Citrulline seed medium 2.67% glucose, 3.14% YPA, 0.1% KH.sub.2PO.sub.4, 0.1% K.sub.2HPO.sub.4, 10 ppm MNSO.sub.4, 10 ppm FeSO.sub.4, 100 .Math.g/L biotin, 200 .Math.g/L thiamin-HCl 5-L culture medium 8% glucose, 0.08% MgSO.sub.4, 16 ppm FeSO.sub.4, 8 ppm MnSO.sub.4, 1.6 ppm CuSO.sub.4, 1.6 ppm ZnSO.sub.4, 32 ppm CaCl.sub.2, 160 ppb biotin, 8 ppm thiamine-HCl, 0.4% HVP, 0.08% NaCl, 0.22% KH.sub.2PO.sub.4, 2.4% (NH.sub.4) .sub.2SO.sub.4 Additional medium 52% glucose, 0.1% MgSO.sub.4, 120 ppm CaCl.sub.2, 160 ppb biotin, 16 ppm thiamine-HCl, 0.08% NH.sub.4H.sub.2PO.sub.4, 4.4% (NH.sub.4) .sub.2SO.sub.4

1-2. Preparation of Transcriptome Analysis Samples

[0039] After collecting cells in Example 1-1 above, the cultured cells were prepared at the same concentration, and RNAs were extracted therefrom using Rneasy Mini Kit (QIAGEN, Germany) according to the manufacturer’s instructions. The extracted RNAs were stored in liquid nitrogen and subjected to whole genome transcriptome analysis by Macrogen Co., Ltd.

1-3. Selection of Valid Gene Candidates

[0040] Based on the results of the whole genome transcriptome analysis of Corynebacterium glutamicum performed in Example 1-2 above, 40 candidate genes, which had an RPKM value of more than 1,000 and whose expression levels increased rapidly in the latter half of fermentation or were at least three times higher than those in the wild-type strain, were first selected from among permeases and transporters. For reference, it is known that the wild-type Corynebacterium glutamicum strain (ATCC13032) has little ability to produce citrulline.

[0041] Corynebacterium glutamicum strains deficient in each of the 40 genes were inoculated in flask titer medium (see Table 2 below) and cultured at 200 rpm at 30° C. for 30 hours. After completion of culture, each culture was diluted 100-fold with distilled water and filtered through a 0.45-.Math.m filter, and then the concentrations of L-citrulline and the by-product 6-acetylornithine in each strain culture were measured by using high-performance liquid chromatography (HPLC) equipped with a column (DionexIonPac™ CS12A) and an ultraviolet detector (195 mm). Five candidate strains with low concentrations of 6-acetylornithine were further selected from among the strains deficient in each of the 40 candidate genes. The concentrations of L-citrulline and 6-acetylornithine in the cultures of the wild-type strain and the five selected candidate strains are shown in Table 3 below.

TABLE-US-00002 Composition (/L) Flask titer medium 105.3 g (95%) glucose, 1 g MgSO.sub.4, 4 g YPA, 0.8 g KH.sub.2PO.sub.4, 1.2 g Na.sub.2HPO.sub.4, 30 g (NH.sub.4).sub.2SO.sub.4, 20 mg Fe.sub.SO.sub.4, 20 mg MnSO.sub.4, 10 mg ZnSO.sub.4, 100 mg arginine, 100 .Math.g biotin, 200 .Math.g thiamine

TABLE-US-00003 Strain L-citrulline (%) 6-acetylornithine (%) CT4 strain 2.10 0.36 NCgl2816-deficient strain 2.12 0.10 NCgl205-deficient strain 1.98 0.32 NCgl0397-deficient strain 0.80 0.08 NCgl0258-deficient strain 2.11 0.36 NCgl1095-deficient strain 2.00 0.35

[0042] As a result, it was shown that, in the NCgl2816 gene-deficient strain, the production of L-citrulline was the highest and, and at the same time, the production of 6-acetylornithine was the lowest. Accordingly, the NCgl2816 gene was selected as the gene to be deleted for increasing L-citrulline production in the strain.

Example 2. Construction of NCgl2816 Gene-Dleted Mutant Strain

2-1. Construction of Vector

[0043] A wild-type Corynebacterium glutamicum strain (ATCC13032) was used to construct a Corynebacterium glutamicum mutant strain.

[0044] First, chromosomal DNA was extracted from the wild-type strain using the Wizard Genomic DNA Purification Kit (Promega, USA). Using the extracted DNA as a template, PCR was performed using each of a set of primers 1 and 2 and a set of primers 3 and 4. The obtained PCR products were amplified again by crossover PCR using a set of primers 1 and 4 and then inserted into HindIII and XbaI restriction enzyme sites of the recombinant vector pK19mobSacB. The resulting vector was named vector pK19ms/ΔNCgl2816. For construction of the vector, the primers shown in Table 4 were used.

TABLE-US-00004 Primer Sequence (5′.fwdarw.3′) SEQ ID NO. Primer 1 tgatttacgccaagctccttatccg 3 Primer 2 ggaggggttttacttagattggtgacctcttctctgaaac 4 Primer 3 gtttcagagaagaggtcaccaatctaagtaaaacccctcc 5 Primer 4 ccggggatcctctagcgac 6

[0045] Using the above-described primers, PCR was performed under the following conditions. PCR was performed using a thermocycler (TP600, TAKARA BIO Inc., Japan) in a reaction solution containing 100 .Math.M of each deoxynucleotide triphosphate (dATP, dCTP, dGTP, dTTP), 1 pM oligonucleotide, 10 ng of the chromosomal DNA of Corynebacterium glutamicum ATCC13032 as a template, and 1 unit of PrimeSTAR Max DNA polymerase (Takara, Japan). PCR was performed for 25 to 30 cycles, each consisting of (i) denaturation at 94° C. for 30 sec, (ii) annealing at 58° C. for 30 sec, and (iii) extension at 72° C. for 1 to 2 min (a polymerization time of 2 min per kb).

[0046] The gene fragment prepared as described above was cloned into a pK19mobSacB vector by self-assembly cloning. The vector was transformed into E. coli DH5a which was then plated on an LB-agar plate containing 50 .Math.g/ml of kanamycin, and cultured at 37° C. for 24 hours. The finally formed colony was isolated and whether the insert was exactly present in the vector was checked. Next, the vector was isolated and used for recombination of the Corynebacterium glutamicum strain.

[0047] As a process commonly performed in the above method, the corresponding genes were amplified by PCR from the genomic DNA of Corynebacterium glutamicum ATCC13032 and inserted into the pK19mobSacB vector by the self-assembled cloning method according to the strategy, and the resulting plasmid was selected in E coli DH5a. In this case, in order to insert the amplified gene into the pK19mobSacB vector, a DNA ligation kit (Takara, Japan) and restriction enzymes HindIII and XbaI (NEB, England) were used according to the manufacturer’s provided buffers and protocols.

2-2. Construction of Mutant Strain

[0048] A Corynebacterium glutamicum mutant strain was constructed by introducing the pK19ms/ΔNCgl2816 vector constructed in Example 2-1 above into the mutant strain CT4 as a parent strain.

[0049] Specifically, the parent strain was first cultured in 100 ml of RG medium (containing 10 g/L beef extract, 40 g/L BHI and 30 g/L sorbitol), and 2.5 g/L glycine, 400 mg/L isoniazid and 0.1 ml/L Tween80 were added to the same medium. Next, the seed culture was inoculated so that the OD.sub.610 value reached 0.3, and then it was cultured at 180 rpm at 30° C. for 3 to 5 hours so that the OD.sub.610 value reached 1.6 to 1.8. The culture was kept on ice for 30 minutes and then centrifuged at 3500 rpm at 4° C. for 15 minutes. Next, the supernatant was discarded, and the precipitated parent strain was washed 4 times with a 10% glycerol solution, and finally resuspended in 0.5 ml of a 10% glycerol solution. Electroporation was performed using a Bio-Rad electroporator. The competent cells prepared by the above method were placed in an electroporation cuvette (0.2 mm), and the pK19ms/ΔNCgl2816 vector was added thereto, followed by electroporation under the conditions of 2.5 kV, 200 Ω and 12.5 .Math.F. Immediately after completion of the electroporation, 1 ml of a regeneration medium (containing 18.5 g/l brain heart infusion and 0.5 M sorbitol) was added to the cells which were then heat-treated at 46° C. for 6 minutes. Next, the cells were cooled at room temperature, transferred into a 15-ml cap tube, incubated at 30° C. for 2 hours, and plated on a solid medium (containing 40 g/L brain heart infusion, 30 g/L D-sorbitol, 10 g/L beef extract, and 20 g/L agar) containing 30 .Math.g/ml kanamycine. The cells were cultured at 30° C. for 2 days to obtain colonies. Among the colonies in which primary homologous recombination was induced, colonies in which amplification was confirmed by PCR using primers 1 and 4 of Table 4 above under the same conditions as in Example 2-1 above were selected as primary recombinant strains and cultured in 2YT liquid medium (containing 16 g/L tryptone, 10 g/L yeast extract and 5 g/L NaCl) for 12 hours. Next, the cultured colonies were plated on 2YT-10% sucrose solid medium (containing 16 g/L tryptone, 10 g/L yeast extract, 5 g/L NaCl and 100 g/L sucrose) to induce secondary homologous recombination, thus removing the antibiotic marker. The colonies cultured on the 2YT-10% sucrose solid medium were patched on 2YT-Km medium (containing 16 g/L tryptone, 10 g/L yeast extract, 5 g/L NaCl and 30 .Math.g/ml kanamycine), and a strain that was not resistant to kanamycin and could grow in the 10% sucrose medium was finally selected. Whether the NCgl2816 gene was removed was finally checked by performing PCR using primers 1 and 4 shown in Table 4 above under the same conditions as in Example 2-1, and the NCgl2816 gene-deleted strain was named CT5.

Example 3. Evaluation of L-Ctrulline Productivity of NCgl2816 Gene-Deleted Mutant Strain

[0050] The L-citrulline productivities of the citrulline-overproducing Corynebacterium glutamicum mutant strain (CT4) used as the parent strain and the NCgl2816 gene-deleted strain (CT5) constructed in Example 2 were compared.

[0051] Each strain was inoculated into citrulline seed medium and cultured at 30° C. for 10 hours. Then, 250 mL of each culture was inoculated into 5-L culture medium. When the glucose contained in the initial medium was completely exhausted, an additional medium was added. The compositions of the media used in this experiment are shown in Table 1 above. After completion of culture, each culture was diluted 100-fold with distilled water and filtered through a 0.45-.Math.m filter, and then the concentrations of L-citrulline and the by-product 6-acetylornithine in each strain culture were measured using high-performance liquid chromatography (HPLC) equipped with a column (DionexIonPac™ CS12A) and an ultraviolet detector (195 mm). The results are shown in Table 5 below.

TABLE-US-00005 Strain L-citrulline (%) 6-acetylornithine (%) CT4 8.56 1.6 CT5 8.73 0.7

[0052] As shown in Table 5 above, it was confirmed that the L-citrulline productivity of the NCgl2816 gene-deleted Corynebacterium glutamicum mutant strain CT5 increased by about 2% compared to that of the previously developed mutant strain CT4, whereas the production of the by-product 6-acetylornithine decreased by about 44%. These results suggest that, when the activity of the protein that is expressed by the NCgl2816 gene is weakened or inactivated, the L-citrulline productivity of the strain can be increased and the production of by-products can also be decreased, and thus the strain is capable of producing L-citrulline with high purity.

[0053] So far, the present invention has been described with reference to the preferred embodiments. Those of ordinary skill in the art to which the present invention pertains will appreciate that the present invention may be embodied in modified forms without departing from the essential characteristics of the present invention. Therefore, the disclosed embodiments should be considered from an illustrative point of view, not from a restrictive point of view. The scope of the present invention is defined by the claims rather than the foregoing description, and all differences within the scope equivalent thereto should be construed as being included in the present invention.