RECOMBINANT STRAIN FOR PRODUCING L-AMINO ACID AND CONSTRUCTION METHOD AND USE THEREOF

20230323412 · 2023-10-12

    Inventors

    Cpc classification

    International classification

    Abstract

    Taking Corynebacterium glutamicum YP97158 as the starting bacterium, introducing site-directed mutation and/or expression enhancement in the coding region of its NCgl1089 gene, the coding region of NCgl0761 gene, and/or the coding region of ptsS gene, the obtained mutant gene and the recombination comprising said gene has high-efficiency L-amino acids production capacity, which greatly increases the output of L-amino acids, and the strain has good stability, which reduces the production cost as an L-amino acids production strain.

    Claims

    1-10. (canceled)

    11. A microorganism or bacterium that generates an L-amino acid, wherein the microorganism or bacterium has an improved expression of the polynucleotide coding the amino acid sequence of SEQ ID NO: 3, an improved expression of the polynucleotide coding the amino acid sequence of SEQ ID NO: 35, and/or an improved expression of the polynucleotide coding the amino acid sequence of SEQ ID NO: 63, wherein preferably, the improved expression is an enhanced expression of the polynucleotide coding the amino acid sequence, or the polynucleotide coding the amino acid sequence has a point mutation, or the polynucleotide coding the amino acid sequence has a point mutation and the expression is enhanced.

    12. The microorganism or bacterium according to claim 11, wherein the point mutation of the polynucleotide coding the amino acid sequence of SEQ ID NO: 3 makes the glutamic acid at position 170 of the amino acid sequence of SEQ ID NO: 3 replaced by a different amino acid; preferably the glutamic acid at position 170 is replaced by lysine; the point mutation of the polynucleotide coding the amino acid sequence of SEQ ID NO: 35 makes the leucine at position 31 of the amino acid sequence of SEQ ID NO: 35 replaced by a different amino acid; preferably leucine at position 31 is replaced by arginine; the point mutation of the polynucleotide coding the amino acid sequence of SEQ ID NO: 63 makes the methionine at position 162 of the amino acid sequence of SEQ ID NO: 63 replaced by a different amino acid; preferably, the methionine at position 162 is replaced by threonine.

    13. The microorganism or bacterium according to claim 11, wherein the polynucleotide coding the amino acid sequence of SEQ ID NO: 3 comprises the nucleotide sequence of SEQ ID NO: 1; the polynucleotide coding the amino acid sequence of SEQ ID NO: 35 comprises the nucleotide sequence of SEQ ID NO: 33; and/or the polynucleotide coding the amino acid sequence of SEQ ID NO: 63 comprises the nucleotide sequence of SEQ ID NO: 61.

    14. The microorganism or bacterium according to claim 11, wherein the polynucleotide sequence with point mutation is formed by the mutation of the 508.sup.th base of the polynucleotide sequence shown in SEQ ID NO: 1; preferably, the mutation comprises the mutation of the 508.sup.th base of the polynucleotide sequence shown in SEQ ID NO: 1 from guanine (G) to adenine (A); preferably, the polynucleotide sequence with point mutation comprises the polynucleotide sequence shown in SEQ ID NO: 2; the mutation of the 92.sup.nd base of the polynucleotide sequence shown in SEQ ID NO: 33; preferably, the mutation comprises the mutation of the 92.sup.nd base of the polynucleotide sequence shown in SEQ ID NO: 33 from thymine (T) to guanine (G); preferably, the polynucleotide sequence with point mutation comprises the polynucleotide sequence shown in SEQ ID NO: 34; or the mutation of the 485.sup.th base of the polynucleotide sequence shown in SEQ ID NO: 61; preferably, the mutation comprises the mutation of the 485.sup.th base of the polynucleotide sequence shown in SEQ ID NO: 61 from thymine (T) to cytosine (C); preferably, the polynucleotide sequence with point mutation comprises the polynucleotide sequence shown in SEQ ID NO: 62.

    15. The microorganism or bacterium according to claim 11, wherein the microorganism is Corynebacterium glutamicum, preferably YP97158 or ATCC 13869.

    16. Any of the following substances: (1) a polynucleotide sequence comprising the polynucleotide coding the amino acid sequence shown in SEQ ID NO: 3, wherein the 170.sup.th glutamic acid is replaced by different amino acids; preferably the 170.sup.th glutamic acid is replaced by lysine; preferably the polynucleotide sequence comprises a polynucleotide coding the amino acid sequence shown in SEQ ID NO: 4; preferably the polynucleotide sequence is formed by the mutation of the 508.sup.th base of the polynucleotide sequence shown in SEQ ID NO: 1; preferably the mutation is the mutation of the 508.sup.th base of the polynucleotide sequence shown in SEQ ID NO: 1 from guanine (G) to adenine (A); preferably the polynucleotide sequence comprises the polynucleotide sequence shown in SEQ ID NO: 2; the polynucleotide coding the amino acid sequence shown in SEQ ID NO: 35, wherein the 31.sup.st leucine is replaced by different amino acids; preferably the 31.sup.st leucine is replaced by arginine; preferably, the polynucleotide sequence comprises a polynucleotide coding the amino acid sequence shown in SEQ ID NO: 36; preferably the polynucleotide sequence is formed by the mutation of the 92.sup.nd base of the polynucleotide sequence shown in SEQ ID NO: 33; preferably the mutation is the mutation of the 92.sup.nd base of the polynucleotide sequence shown in SEQ ID NO: 33 from thymine (T) to guanine (G); preferably the polynucleotide sequence comprises the polynucleotide sequence shown in ID NO: 34; or the polynucleotide coding the amino acid sequence shown in SEQ ID NO: 63, wherein the 162.sup.nd methionine is replaced by different amino acids; preferably the 162.sup.nd methionine is replaced by threonine; preferably the polynucleotide sequence comprises the polynucleotide sequence coding the amino acid shown in SEQ ID NO: 64; preferably the polynucleotide sequence is formed by the mutation of the 485.sup.th base of the polynucleotide sequence shown in SEQ ID NO: 61; preferably the mutation comprises the mutation of 485.sup.th base of the polynucleotide sequence shown in SEQ ID NO: 61 from thymine (T) to cytosine (C); preferably, the polynucleotide sequence comprises the polynucleotide sequence shown in SEQ ID NO: 62; (2) an amino acid sequence shown in SEQ ID NO: 4 or SEQ ID NO: 36 or SEQ ID NO: 64; (3) a recombinant vector, comprising the polynucleotide sequence; or (4) a recombinant strain, comprising the polynucleotide sequence.

    17. A method for producing an L-amino acid, comprising: culturing the microorganism or bacterium of claim 11; and recovering L-amino acids from the culture; wherein the L-amino acid is preferably L-glutamic acid or L-lysine.

    Description

    BEST WAY TO IMPLEMENT THE INVENTION

    [0256] The above and other features and advantages of the present invention are explained and illustrated in more detail below through the description of the embodiments of the present invention. It should be understood that the following embodiments are intended to illustrate the technical solutions of the present invention, but are not intended to limit the protection scope of the present invention defined by the claims and their equivalents.

    [0257] Unless otherwise specified, the raw materials and reagents used in the following examples are all commercially available products, or can be prepared by known methods; the operations performed are known in the art, or are carried out according to the user manuals of commercially available products.

    [0258] The basal medium used for culturing the strains in the following examples has the same composition, and correspondingly required sucrose, kanamycin or chloramphenicol and the like are added to this basal medium composition, and the basal medium composition is as follows:

    TABLE-US-00018 Ingredient Recipe Sucrose 10 g/L Polypeptone 10 g/L Beef extract 10 g/L Yeast powder 5 g/L Urea 2 g/L Sodium chloride 2.5 g/L Agar powder 20 g/L pH 7.0 Incubation temperature 32° C.

    [0259] The preparation and conditions of SSCP electrophoresis PAGE described in the following examples are as follows:

    TABLE-US-00019 Dosage (Configure acrylamide at a final Ingredient concentration of 8%) 40% Acrylamide 8 ml ddH.sub.2O 26 ml Glycerin 4 ml 10*TBE 2 ml TEMED 40 ul 10% AP 600 ul Electrophoresis Put the electrophoresis tank in ice, use 1× conditions TBE buffer, voltage 120 V, electrophoresis time 10 h

    Example 1

    [0260] (1) Construction of Transformation Vector pK18-NCgl1089.sup.G508A Containing the Coding Region of NCgl1089 Gene with Point Mutation

    [0261] According to the genome sequence of wild-type Corynebacterium glutamicum ATCC13032 published by NCBI, two pairs of primers for amplifying the coding region sequence of the NCgl1089 gene were designed and synthesized, a point mutation was introduced in the coding region (SEQ ID NO: 1) of the NCgl1089 gene in the background of strain YP97158 (preservation number: CGMCC No. 12856, preservation date: Aug. 16, 2016, depository unit: China General Microbiological Culture Collection Center. No. 3, Yard 1, West Beichen Road, Chaoyang District, Beijing, Tel: 010-64807355, the strain was recorded in Chinese patent application CN106367432A (application date Sep. 1, 2016, publication date Feb. 1, 2017)) by means of allelic replacement, the amino acid sequence corresponding to the coded protein was SEQ ID NO: 3, the 508.sup.th of the nucleotide sequence of the NCgl1089 gene was changed from G to A (SEQ ID NO: 2: NCgl1089.sup.G508A), and the 170.sup.th of the amino acid sequence corresponding to the coded protein was changed from glutamic acid to lysine (SEQ ID NO: 4: NCgl1089E170K).

    [0262] The primers were designed as follows (synthesized by Shanghai Invitrogen Company):

    TABLE-US-00020 P1: (SEQ ID NO: 5) 5′CAGTGCCAAGCTTGCATGCCTGCAGGTCGACTCTAGCGCGTGGGATCC ACGCCAG3′ P2: (SEQ ID NO: 6) 5′CAATGAGGGCTTTCGCCACCTCGCGGGC3′ P3: (SEQ ID NO: 7) 5′GCCCGCGAGGTGGCGAAAGCCCTCATTG3′ P4: (SEQ ID NO: 8) 5′CAGCTATGACCATGATTACGAATTCGAGCTCGGTACCCCATGCGTTGG CGATCTTC3′

    [0263] Construction method: Corynebacterium glutamicum ATCC13032 was used as a template to carry out PCR amplification with primers P1 and P2, P3 and P4, respectively.

    [0264] PCR system: 10×Ex Taq Buffer 5 μL, dNTP Mixture (2.5 mM each) 4 μL, Mg.sup.2+ (25 mM) 4 μL, primers (10 pM) 2 μL each, Ex Taq (5 U/μL) 0.25 μL, total volume 50 μL.

    [0265] The PCR amplification was performed as follows: pre-denaturation at 94° C. for 5 min, denaturation at 94° C. for 30 s, annealing at 52° C. for 30 s, extension at 72° C. for 40 s (30 cycles), and overextension at 72° C. for 10 min to obtain two DNA fragments (NCgl1089Up and NCgl1089Down) with sizes of 724 bp and 839 bp and containing the coding region of the NCgl1089 gene, respectively.

    [0266] After the above two DNA fragments were separated and purified by agarose gel electrophoresis, a fragment of about 1535 bp in length was amplified by overlap PCR using the above two DNA fragments as templates and P1 and P4 as primers.

    [0267] PCR system: 10×Ex Taq Buffer 5 μL, dNTP Mixture (2.5 mM each) 4 μL, Mg.sup.2+ (25 mM) 4 μL, primers (10 pM) 2 μL each, Ex Taq (5 U/μL) 0.25 μL, total volume 50 μL.

    [0268] The PCR amplification was performed as follows: pre-denaturation at 94° C. for 5 min, denaturation at 94° C. for 30 s, annealing at 52° C. for 30 s, extension at 72° C. for 90 s (30 cycles), and overextension at 72° C. for 10 min.

    [0269] This DNA fragment (NCgl1089.sup.G508A) causes the guanine (G) at position 508 of the coding region of the YP97158 NCgl1089 gene to be changed to adenine (A), and finally the amino acid at position 170 of the coded protein was changed from glutamic acid (E) to lysine amino acid (K).

    [0270] After the pK18mobsacB plasmid (purchased from Addgene) was digested with Xba I, the linearized pK18mobsacB plasmid and NCgl1089.sup.G508A were separated and purified by agarose gel electrophoresis, and then assembled by the NEBuider recombination system to obtain the vector pK18-NCgl1089.sup.G508A, which contains Kanamycin resistance marker. The vector pK18-NCgl1089.sup.G508A was sent to a sequencing company for sequencing identification, and the vector pK18-NCgl1089.sup.G508A containing the correct point mutation (G-A) was saved for future use.

    (2) Construction of Engineering Strain NCgl1089.SUP.G508A .Containing Point Mutation

    [0271] Construction method: The allelic replacement plasmid pK18-NCgl1089.sup.G508A was transformed into the patented strain YP97158 of L-lysine-producing bacteria by electric shock (for its construction method, please refer to WO2014121669A1; it was confirmed by sequencing that the coding region of the wild-type NCgl1089 gene was retained on the chromosome of this strain), the single colony produced by culture was identified by primer P1 and universal primer M13R respectively, and the strain that could amplify a 1542 bp size band was positive strain. The positive strains were cultured on the medium containing 15% sucrose, and the single colony produced by the culture was cultured on the medium containing kanamycin and without kanamycin, respectively, The strains that grew on the medium without kanamycin but did not grow on the medium containing kanamycin were further identified by PCR using the following primers (synthesized by Shanghai Invitrogen Company):

    TABLE-US-00021   P5: (SEQ ID NO: 9) 5′GGTGATTGATGCATTATGCGC3′ P6: (SEQ ID NO: 10) 5′CCTAGCCTTTCACCTCTTCTGT3′

    [0272] The above PCR amplification products were subjected to SSCP electrophoresis (the amplified fragment of plasmid pK18-NCgl1089.sup.G508A was used as a positive control, the amplified fragment of YP97158 was used as a negative control, and water was used as a blank control) after high temperature denaturation and ice bath. Due to the different fragment structures and electrophoresis positions, the strains whose electrophoresis positions were inconsistent with those of the negative control fragment and were consistent with the positive control fragment were the strains with successful allelic replacement. The target fragment of the strain with successful allelic substitution was amplified again by PCR with primers P5 and P6, and was linked to the PMD19-T vector for sequencing. The successful allelic substitution of the strain was verified by sequence alignment of the mutated base sequence, and was named YPL-4-017.

    (3) Construction of Engineering Strains Overexpressing NCgl1089 or NCgl1089.SUP.G508A .Gene on the Genome

    [0273] According to the genome sequence of wild-type Corynebacterium glutamicum ATCC13032 published by NCBI, four pairs of primers for amplifying the sequences of the upstream and downstream homology arm fragments, the coding region of the NCgl1089 gene, the coding region of the NCgl1089.sup.G508A gene, and the promoter region of the gene were designed and synthesized, and the NCgl1089 or NCgl1089.sup.G508A gene was introduced into strain YP97158 by homologous recombination.

    [0274] The primers were designed as follows (synthesized by Shanghai Invitrogen Company):

    TABLE-US-00022 P7: (SEQ ID NO: 11) 5′CAGTGCCAAGCTTGCATGCCTGCAGGTCGACTCTAGAATGCGTTCTGG ACTGAGG3′ P8: (SEQ ID NO: 12) 5′CATGAGTATAAAATCACTGTCGTGCACCGAGAACAGATG3′ P9: (SEQ ID NO: 13) 5′CATCTGTTCTCGGTGCACGACAGTGATTTTATACTCATG3′ P10: (SEQ ID NO: 14) 5′GACGTTTCCAGATGCTCATCACCGAACCCGCTGCACTGT3′ P11: (SEQ ID NO: 15) 5′ACAGTGCAGCGGGTTCGGTGATGAGCATCTGGAAACGTC3′ P12: (SEQ ID NO: 16) 5′CTTGATTTAATTGCGCCATCTCACCTCTTCTGTGGGCACG3′ P13: (SEQ ID NO: 17) 5′CGTGCCCACAGAAGAGGIGAGATGGCGCAATTAAATCAAG3′ P14: (SEQ ID NO: 18) 5′CAGCTATGACCATGATTACGAATTCGAGCTCGGTACCCGCTATGACAC CTTCAACGGATC3′

    [0275] Construction method: Corynebacterium glutamicum ATCC13032 was used as a template to carry out PCR amplification with primers P7/P8, P9/P10, P13/P14, respectively, to obtain an upstream homology arm fragment of 805 bp, NCgl1089 gene promoter fragment of 318 bp, and downstream homology arm fragment of 628 bp; Corynebacterium glutamicum ATCC13032 and YPL-4-017 were then used as templates respectively, and P11/P12 were used as primers, and the NCgl1089 or NCgl1089.sup.G508A gene fragment of 694 bp was obtained by PCR amplification; P9/P12 was then used as primers, and NCgl1089 gene promoter fragment and NCgl1089 or NCgl1089.sup.G508A were used as templates to obtain a 972 bp fragment of NCgl1089 or NCgl1089.sup.G508A with its own promoter; P7/P14 were then used as primers, and the above homology fragment, the lower homology fragment and the NCgl1089 or NCgl1089.sup.G508A fragments with their own promoters were mixed as templates for amplification, and the integrated homology arm fragment was obtained.

    [0276] After the PCR reaction, the amplified product was recovered by electrophoresis, and the required 2365 bp DNA fragment was recovered by using a column DNA gel recovery kit (TIANGEN), and was assembled with the shuttle plasmid PK18mobsacB recovered by Xba I digestion through the NEBuider recombination system to obtain the integrated plasmid PK18mobsacB-NCgl1089 or PK18mobsacB-NCgl1089.sup.G508A. The plasmid contained a kanamycin resistance marker, and the recombinant plasmid integrated into the genome can be obtained by kanamycin selection.

    [0277] PCR system: 10×Ex Taq Buffer 5 μL, dNTP Mixture (2.5 mM each) 4 μL, Mg.sup.2+ (25 mM) 4 μL, primers (10 pM) 2 μL each, Ex Taq (5 U/μL) 0.25 μL, total volume 50 μL.

    [0278] The PCR amplification was performed as follows: pre-denaturation at 94° C. for 5 min, denaturation at 94° C. for 30 s, annealing at 52° C. for 30 s, extension at 72° C. for 90 s (30 cycles), and overextension at 72° C. for 10 min.

    [0279] The two integrated plasmids were electro-transformed into the patented strain YP97158 of L-lysine-producing bacteria respectively, and the single colony produced by the culture was identified by PCR through the P15/P16 primers, and the strain that could amplify a 1332 bp size band was a positive strain, and those that fail to amplify the fragments were original strains. The positive strains were screened on the 15% sucrose medium and cultured on the medium containing kanamycin and without kanamycin, respectively. The strains that grew on the medium without kanamycin but did not grow on the medium containing kanamycin were further identified by PCR using P17/P18 primers, and the amplified strains with a size of 1187 bp were the strains whose genes were integrated into the YP97158 genome, which were named as YPL-4-018 (without point mutation) and YPL-4-019 (with point mutation) respectively.

    TABLE-US-00023   P15: (SEQ ID NO: 19) 5′TCCAAGGAAGATACACGCC3′ P16: (SEQ ID NO: 20) 5′CTGCGATTCCCAACGCATCT3′ P17: (SEQ ID NO: 21) 5′GAGCAGCCAAAACATGCAGC3′ P18: (SEQ ID NO: 22) 5′CGTTGGAATCTTGCGTTG3′

    (4) Construction of Engineering Strains Overexpressing NCgl1089 or NCgl1089.SUP.G508A .Gene on a Plasmid

    [0280] According to the genome sequence of wild-type Corynebacterium glutamicum ATCC13032 published by NCBI, two pairs of primers for amplifying the sequence of the coding region and the promoter region of NCgl1089 or NCgl1089.sup.G508A gene were designed and synthesized. The primers were designed as follows (synthesized by Shanghai Invitrogen Company):

    TABLE-US-00024 P19: (SEQ ID NO: 23) 5′GCTTGCATGCCTGCAGGTCGACTCTAGAGGATCCCCGACAGTGATTTT ATACTCATG3′ P20: (SEQ ID NO: 24) 5′GACGTTTCCAGATGCTCATCACCGAACCCGCTGCACTGT3′ P21: (SEQ ID NO: 25) 5′ACAGTGCAGCGGGTTCGGTGATGAGCATCTGGAAACGTC3′ P22: (SEQ ID NO: 26) 5′ATCAGGCTGAAAATCTTCTCTCATCCGCCAAAACTCACCTCTTCTGTG GGCACG3′

    [0281] Construction method: YPL-4-018 was used as a template, and the NCgl1089 promoter fragment of 378 bp was obtained by PCR with primers P19/P20; Wild-type Corynebacterium glutamicum ATCC13032 and YPL-4-017 were then used as templates respectively, and the NCgl1089 or NCgl1089.sup.G508A gene fragment of 708 bp was obtained by PCR with primers P21/P22; the above promoter and gene fragment were used as templates, and the NCgl1089 or NCgl1089.sup.G508A gene fragment of 1066 bp with its own promoter was obtained by overlap PCR with primers P19/P22. The amplified product was recovered by electrophoresis, and the required 1066 bp DNA fragment was recovered using a column DNA gel recovery kit, and was assembled with the shuttle plasmid pXMJ19 recovered by EcoR I digestion through the NEBuider recombination system to obtain the overexpression plasmid pXMJ19-NCgl1089 or pXMJ19-NCgl1089.sup.G508A. The plasmid contained a chloramphenicol resistance marker, and the plasmid could be transformed into the strain by chloramphenicol screening.

    [0282] PCR system: 10×Ex Taq Buffer 5 μL, dNTP Mixture (2.5 mM each) 4 μL, Mg.sup.2+ (25 mM) 4 μL, primers (10 pM) 2 μL each, Ex Taq (5 U/μL) 0.25 μL, total volume 50 μL.

    [0283] The PCR amplification was performed as follows: pre-denaturation at 94° C. for 5 min, denaturation at 94° C. for 30 s, annealing at 52° C. for 30 s, extension at 72° C. for 90 s (30 cycles), and overextension at 72° C. for 10 min.

    [0284] The pXMJ19-NCgl1089 or pXMJ19-NCgl1089.sup.G508A were electro-transformed into the patented strain YP97158 of L-lysine-producing bacteria respectively, and the single colony produced by the culture was identified by M13 (−48) and P22 primers. The 1104 bp fragment was the transformed strain, which was named YPL-4-020 (without point mutation) or YPL-4-021 (with point mutation), respectively. The PCR amplified fragment containing a fragment of size 1104 bp was the transformed strain, which was named YPL-4-020 (without point mutation) or YPL-4-021 (containing a point mutation) respectively.

    (5) Construction of Engineering Strains that Lacks the NCgl1089 Gene on its Genome

    [0285] According to the genome sequence of Corynebacterium glutamicum ATCC13032 published by NCBI, two pairs of primers for amplifying the fragments at both ends of the coding region of the NCgl1089 gene were synthesized as upstream and downstream homology arm fragments. The primers were designed as follows (synthesized by Shanghai Yingjun company):

    TABLE-US-00025 P23: (SEQ ID NO: 27) 5′CAGTGCCAAGCTTGCATGCCTGCAGGTCGACTCTAGCACCGCATTCCC TTCATGAT3′ P24: (SEQ ID NO: 28) 5′ACGAATCCGCGCCTAGCCTTTTATCTACTTCCAAAAAACTGC3′ P25: (SEQ ID NO: 29) 5′GCAGTTTTTTGGAAGTAGATAAAAGGCTAGGCGCGGATTCGT3′ P26: (SEQ ID NO: 30) 5′CAGCTATGACCATGATTACGAATTCGAGCTCGGTACCCCGAGGGAAAG GATATCGA3′

    [0286] Corynebacterium glutamicum ATCC13032 was used as a template, PCR amplification was carried out with primers P23/P24 and P25/P26, respectively, to obtain an upstream homology arm fragment of 779 bp and a downstream homology arm fragment of 800 bp, and then the entire homology arm fragment of 1539 bp was obtained by overlap PCR with primers P23/P26. After the PCR reaction, the amplified product was recovered by electrophoresis, the required 1539 bp DNA fragment was recovered by a column DNA gel recovery kit, and was linked with the shuttle plasmid pk18mobsacB plasmid recovered by Xba I digestion through the NEBuider recombination system to obtain a knockout plasmid. This plasmid contained a kanamycin resistance marker.

    [0287] The knockout plasmid was electro-transformed into the patented strain YP97158 of producing lysine, and the single colony produced by the culture was identified by PCR with the following primers (synthesized by Shanghai Yingjun Company) respectively:

    TABLE-US-00026   P27: (SEQ ID NO: 31) 5′CACCGCATTCCCTTCATGAT3′ P28: (SEQ ID NO: 32) 5′CGAGGGAAAGGATATCGA3′

    [0288] The strains with 1429 bp and 2401 bp bands amplified by the above PCR were positive strains, and the strain with 2401 bp band amplified was the original strain. Positive strains were screened on 15% sucrose medium and cultured on kanamycin-containing and kanamycin-free medium, respectively. The strains that grew on the medium without kanamycin but did not grow on the medium containing kanamycin were further identified by PCR using P27/P28 primers, and the amplified strains with a size of 1429 bp were the genetic engineering strains in which the coding region of the NCgl1089 gene had been knocked out, which was named YPL-4-022.

    (6) L-Lysine Fermentation Experiment

    [0289] The strains constructed in the examples and the original strain YP97158 were subjected to fermentation experiments in the BLBIO-5GC-4-H fermentor (purchased from Shanghai Bailun Biotechnology Co., Ltd.) with the medium shown in Table 1 and the control process shown in Table 2. Each strain was repeated three times, and the results were shown in Table 3.

    TABLE-US-00027 TABLE 1 Formula of fermentation medium Ingredient Recipe Starch hydrolyzed sugar 30 g/L Ammonium sulfate 12 g/L Magnesium sulfate 0.87 g/L Molasses 20 g/L Acidified corn steep liquor 3 mL/L Phosphoric acid 0.4 mL/L Potassium chloride 0.53 g/L Defoamer (2% GPE) 4 mL/L Ferrous sulfate 120 mg/L Manganese sulfate 120 mg/L Niacinamide 42 mg/L Calcium pantothenate 6.3 mg/L Vitamin B 1 6.3 mg/L Copper and zinc salt solution 0.6 g/L Biotin 0.88 mg/L

    TABLE-US-00028 TABLE 2 Fermentation control process CorrectionD Temperature 37° C., air volume 4 L/min, O100% speed 1000 rpm, tank pressure 0 mpa, calibrate after 5min Inoculation 10% Culture 37° C. amount temperature ° C. pH pH6.9 ± 0.05 Dissolved 10-30% oxygen DO Initial Temperature 37° C., pH6.9, Tank conditions pressure 0 Mpa, Air volume 3 L/min, Speed 550 rpm Whole process Whole process control 1. When the control dissolved oxygen was less than 30%, increase the speed by 750 rpm.fwdarw.800 rpm.fwdarw.air volume 4 L/min.fwdarw.850 rpm.fwdarw.950 rpm; 2, Fermentation 6 h lift tank pressure 0.01 Mpa; 12 h lift tank pressure 0.02 Mpa.fwdarw.0.03 Mpa.fwdarw.0.04 Mpa.fwdarw.0.05 Mpa Residual sugar 0.1-0.2% before F12h; after F12h, control combined with DO, it was required to control residual sugar 0.1-0.05% Ammonia 0.1-0.15 before F12h; F12-F32h nitrogen control 0.15-0.25; 0.1-0.15 after F32h Feeding 25% ammonia water, 70% material concentrated sugar, 50% ammonium sulfate, 10% GPE Fermentation Around 48 h cycle

    TABLE-US-00029 TABLE 3 L-Lysine fermentation experiment results L-lysine production Strain (g/100 ml) OD(660 nm) YP97158 18.8 37.5 YPL-4-017 19.1 37.3 YPL-4-018 19.3 37.6 YPL-4-019 19.5 37.8 YPL-4-020 19.4 37.2 YPL-4-021 19.8 36.5 YPL-4-022 18.0 37.7

    [0290] The results were shown in Table 3. Overexpression of the NCgl1089 gene, or point mutation NCgl1089.sup.G508A and overexpression of the coding region of the NCgl11089 gene in Corynebacterium glutamicum contributed to the improvement of L-lysine production, while weakening or knocking out the gene was not conducive to the accumulation of L-lysine.

    Example 2

    [0291] (1) Construction of Transformation Vector pK18-NCgl0761.sup.L31R Containing the Coding Region of NCgl0761 Gene with Point Mutation

    [0292] According to the genome sequence of the Corynebacterium glutamicum ATCC 13032 published by NCBI, two pairs of primers for amplifying the coding region sequence of the NCgl0761 gene were designed and synthesized, a point mutation was introduced in the coding region (SEQ ID NO: 33) of the NCgl0761 gene in the background of strain YP97158 (preservation number: CGMCC No. 12856, preservation date: Aug. 16, 2016, depository unit: China General Microbiological Culture Collection Center. No. 3, Yard 1, West Beichen Road, Chaoyang District, Beijing, Tel: 010-64807355, the strain is recorded in Chinese patent application CN106367432A (application date Sep. 1, 2016, publication date Feb. 1, 2017)) by means of allelic replacement, the amino acid sequence corresponding to the coded protein was SEQ ID NO: 35, the 92.sup.nd of the nucleotide sequence of the NCgl0761 gene was changed from T to G (SEQ ID NO: 34), and the 31u of the amino acid sequence corresponding to the coded protein was changed from leucine to arginine (SEQ ID NO: 36: NCgl0761.sup.L31R). The primers were designed as follows (synthesized by Shanghai Invitrogen Company):

    TABLE-US-00030 (SEQ ID NO: 37) P1: 5′ CAGTGCCAAGCTTGCATGCCTGCAGGTCGACTCTAGCTTGCAG CTAACCTATACCCC3′ (SEQ ID NO: 38) P2: 5′GCTTTTCAATATAATCACGTCCATCTGAGCCATC3′ (SEQ ID NO: 39) P3: 5′GATGGCTCAGATGGACGTGATTATATTGAAAAGC3′ (SEQ ID NO: 40) P4: 5′ CAGCTATGACCATGATTACGAATTCGAGCTCGGTACCCCTCCC AAATAATTGCCGC3′

    [0293] Construction method: Corynebacterium glutamicum ATCC13032 was used as a template to carry out PCR amplification with primers P1 and P2, P3 and P4, respectively. PCR system: 10×Ex Taq Buffer 5 μL, dNTP Mixture (2.5 mM each) 4 μL, Mg.sup.2+ (25 mM) 4 μL, primers (10 pM) 2 μL each, Ex Taq (5 U/μL) 0.25 μL, total volume 50 μL. The PCR amplification was performed as follows: pre-denaturation at 94° C. for 5 min, denaturation at 94° C. for 30 s, annealing at 52° C. for 30 s, extension at 72° C. for 40 s, 30 cycles, and overextension at 72° C. for 10 min to obtain two DNA fragments (NCgl0761Up and NCgl0761Down) with sizes of 636 bp and 681 bp and containing the coding region of the NCgl0761 gene, respectively. After the above two DNA fragments were separated and purified by agarose gel electrophoresis, a fragment of about 1283 bp in length was amplified by overlap PCR using the above two DNA fragments as templates and P1 and P4 as primers.

    [0294] PCR system: 10×Ex Taq Buffer 5 μL, dNTP Mixture (2.5 mM each) 4 μL, Mg.sup.2+ (25 mM) 4 μL, primers (10 pM) 2 μL each, Ex Taq (5 U/μL) 0.25 μL, total volume 50 μL. The PCR amplification was performed as follows: pre-denaturation at 94° C. for 5 min, denaturation at 94° C. for 30 s, annealing at 52° C. for 30 s, extension at 72° C. for 60 s, 30 cycles, and overextension at 72° C. for 10 min.

    [0295] This DNA fragment causes the thymine (T) at position 92 of the coding region of the YP97158 NCgl0761 gene to be changed to guanine (G), and finally the amino acid at position 31 of the coded protein was changed from leucine (L) to arginine (R). The DNA fragment was purified after agarose gel electrophoresis, and then ligated with the purified pK18mobsacB plasmid (purchased from Addgene Company, which was double digested with Xbal I/BamH I respectively) after double digestion with NEBuilder enzyme (purchased from NEB Company) at 50° C. for 30 min. The single clone grown after the transformation of the ligation product was identified by PCR to obtain the positive vector pK18-NCgl0761.sup.L31R, which contained the kanamycin resistance marker on this plasmid. The correctly digested vector pK18-NCgl0761.sup.L31R was sent to a sequencing company for sequencing identification, and the vector pK18-NCgl0761.sup.L31R containing the correct point mutation (T-G) was stored for future use.

    (2) Construction of Engineering Strain pK18-NCgl0761.sup.L31R Containing Point Mutation

    [0296] Construction method: The allelic replacement plasmid pK18-NCgl0761.sup.L31R was transformed into the patented strain YP97158 of L-lysine-producing bacteria by electric shock (for its construction method, please refer to WO2014121669A1; it was confirmed by sequencing that the coding region of the wild-type NCgl0761 gene was retained on the chromosome of this strain), the single colony produced by culture was identified by primer P1 and universal primer M13R respectively, and the strain that could amplify a 1369 bp size band was positive strain. The positive strains were cultured on the medium containing 15% sucrose, and the single colony produced by the culture was cultured on the medium containing kanamycin and without kanamycin, respectively, The strains that grew on the medium without kanamycin but did not grow on the medium containing kanamycin were further identified by PCR using the following primers (synthesized by Shanghai Invitrogen Company):

    TABLE-US-00031 (SEQ ID NO: 41) P5: 5′GAATGGAATAGGAGAATTGCG 3′ (SEQ ID NO: 42) P6: 5′CACCAGGCGTGGAAAGAG 3′

    [0297] The above PCR amplification product 267 bp was subjected to SSCP electrophoresis (the amplified fragment of plasmid pK18-NCgl0761.sup.L31R was used as a positive control, the amplified fragment of YP97158 was used as a negative control, and water was used as a blank control) after high temperature denaturation at 95° C. for 10 min and ice bath for 5 min. Due to the different fragment structures and electrophoresis positions, the strains whose electrophoresis positions were inconsistent with those of the negative control fragment and were consistent with the positive control fragment were the strains with successful allelic replacement. The fragment of the positive strain NCgl0761 was amplified by PCR with primers P5 and P6 again, and was linked to the PMD19-T vector for sequencing. Through sequence alignment, the strain with mutation (T-G) in the base sequence was a positive strain with successful allelic substitution, and was named YPL-4-029.

    (3) Construction of Engineering Strains Overexpressing NCgl0761 or NCgl0761.SUP.L31R .Gene on the Genome

    [0298] According to the genome sequence of wild-type Corynebacterium glutamicum ATCC13032 published by NCBI, three pairs of primers for amplifying the sequences of the upstream and downstream homology arm fragments, the coding region of the NCgl0761 or NCgl0761.sup.L31R gene, and the promoter region were designed and synthesized, and the NCgl0761 or NCgl0761.sup.L31R gene was introduced into strain YP97158 by homologous recombination.

    [0299] The primers were designed as follows (synthesized by Shanghai Invitrogen Company):

    TABLE-US-00032 (SEQ ID NO: 43) P7: 5′ CAGTGCCAAGCTTGCATGCCTGCAGGTCGACTCTAGAATGCGT TCTGGACTGAGG3′ (SEQ ID NO: 44) P8: 5′CCATCCATACCCCACTACATGTGCACCGAGAACAGATG 3′ (SEQ ID NO: 45) P9: 5′CATCTGTTCTCGGTGCACATGTAGTGGGGTATGGATGG 3′ (SEQ ID NO: 46) P10: 5′GATTTAATTGCGCCATCTGATTCTGGGTGAGGTTTCCGGCTCA G3′ (SEQ ID NO: 47) P11: 5′CTGAGCCGGAAACCTCACCC AGAATCAGATGGCGCAATTAAA TC 3′ (SEQ ID NO: 48) P12: 5′ CAGCTATGACCATGATTACGAATTCGAGCTCGGTACCCGCTA TGACACCTTCAACGGATC 3′

    [0300] Construction method: Corynebacterium glutamicum ATCC13032 or YPL-4-029 was used as a template to carry out PCR amplification with primers P7/P8, P9/P10, P11/P12, respectively, to obtain upstream homology arm fragment of 802 bp, NCgl0761 or NCgl0761.sup.L31R gene and its promoter fragment of 737 bp and the downstream homology arm fragment of 647 bp. After the PCR reaction, the three amplified fragments were recovered by electrophoresis using a column DNA gel recovery kit (TIANGEN). The recovered three fragments were ligated with purified pK18mobsacB plasmid (purchased from Addgene Company, which was double digested with Xbal I/BamH I respectively) after double digestion with NEBuilder enzyme (purchased from NEB Company) at 50° C. for 30 min, and the single clone grown after the transformation of the ligation product was identified by PCR with M13 primer to obtain the positive integrated plasmid and pK18mobsacB-NCgl0761 and pK18mobsacB-NCgl0761.sup.L31R. The plasmid contained a kanamycin resistance marker, and the recombinant plasmid integrated into the genome can be obtained by kanamycin selection.

    [0301] PCR system: 10×Ex Taq Buffer 5 μL, dNTP Mixture (2.5 mM each) 4 μL, Mg.sup.2+ (25 mM) 4 μL, primers (10 pM) 2 μL each, Ex Taq (5 U/μL) 0.25 μL, total volume 50 μL. The PCR amplification was performed as follows: pre-denaturation at 94° C. for 5 min, denaturation at 94° C. for 30 s, annealing at 52° C. for 30 s, extension at 72° C. for 60 s (30 cycles), and overextension at 72° C. for 10 min.

    [0302] The two correctly sequenced integrated plasmids were electro-transformed into the patented strain YP97158 of L-lysine-producing bacteria respectively, and the single colony produced by the culture was identified by PCR through the P13/P14 primers, and the strain that could amplify a 1325 bp size band was positive strain, and those that fail to amplify the fragments were original strains. The positive strains were cultured on a medium containing 15% sucrose, and the single colony produced by the culture was further identified by PCR using P15/P16 primers. The amplified strains with a size of 1002 bp were positive strains with NCgl0761 or NCgl0761.sup.L31R gene integrated into the genome of YP97158, which were named YPL-4-030 (without mutation point) and YPL-4-031 (with mutation point).

    TABLE-US-00033 (SEQ ID NO: 49) P13: 5′TCCAAGGAAGATACACGCC 3′ (SEQ ID NO: 50) P14: 5′GCCTTGTTAATATCTTCCC 3′ (SEQ ID NO: 51) P15: 5′GGGAAGATATTAACAAGGC 3′ (SEQ ID NO: 52) P16: 5′CGTTGGAATCTTGCGTTG 3′

    (4) Construction of Engineering Strains Overexpressing NCgl0761 or NCgl0761.SUP.L31R .Gene on a Plasmid

    [0303] According to the genome sequence of wild-type Corynebacterium glutamicum ATCC13032 published by NCBI, one pair of primers for amplifying the sequence of the coding region and the promoter region of NCgl0761 or NCgl0761.sup.L31R gene were designed and synthesized. The primers were designed as follows (synthesized by Shanghai Invitrogen Company):

    TABLE-US-00034 (SEQ ID NO: 53) P17: 5′ GCTTGCATGCCTGCAGGTCGACTCTAGAGGATCCCCATGTAG TGGGGTATGGATGG 3′ (SEQ ID NO: 54) P18: 5′ ATCAGGCTGAAAATCTTCTCTCATCCGCCAAAAC GTGAGGT TTCCGGCTCAG3′

    [0304] Construction method: Corynebacterium glutamicum ATCC13032 and YPL-4-029 were used as templates to carry out PCR amplification with primers P17/P18, respectively, to obtain NCgl0761 or NCgl0761.sup.L31R gene and its promoter fragment of 737 bp, and the amplified products were electrophoresed and purified using a column DNA gel recovery kit. The recovered DNA fragment and the shuttle plasmid pXMJ19 recovered by EcoR I digestion were ligated with NEBuilder enzyme (purchased from NEB company) at 50° C. for 30 min, and the single clone grown after the transformation of the ligation product was identified by PCR with M13 primer to obtain the positive overexpression plasmid pXMJ19-NCgl0761 and pXMJ19-NCgl0761.sup.L31R, and the plasmid was sent for sequencing. Because the plasmid contained the chloramphenicol resistance marker, it could be used to screen whether the plasmid was transformed into the strain by chloramphenicol.

    [0305] PCR system: 10×Ex Taq Buffer 5 μL, dNTP Mixture (2.5 mM each) 4 μL, Mg.sup.2+ (25 mM) 4 μL, primers (10 pM) 2 μL each, Ex Taq (5 U/μL) 0.25 μL, total volume 50 μL.

    [0306] The PCR amplification was performed as follows: pre-denaturation at 94° C. for 5 min, denaturation at 94° C. for 30 s, annealing at 52° C. for 30 s, extension at 72° C. for 60 s (30 cycles), and overextension at 72° C. for 10 min.

    [0307] The correctly sequenced pXMJ19-NCgl0761 and pXMJ19-NCgl0761.sup.L31R plasmids were electro-transformed into the patented strain YP97158 of L-lysine-producing bacteria, respectively, and the single colony produced by the culture were identified by PCR with primers M13/P18. The PCR amplified fragment containing a fragment of size 745 bp was the positive strain, which were named as YPL-4-032 (without mutation point) and YPL-4-033 (with mutation point).

    (5) Construction of Engineering Strains that Lacks the NCgl0761 Gene on its Genome

    [0308] According to the genome sequence of Corynebacterium glutamicum ATCC13032 published by NCBI, two pairs of primers for amplifying the fragments at both ends of the coding region of the NCgl0761 gene were synthesized as upstream and downstream homology arm fragments. The primers were designed as follows (synthesized by Shanghai Yingjun company):

    TABLE-US-00035 (SEQ ID NO: 55) P19: 5′ CAGTGCCAAGCTTGCATGCCTGCAGGTCGACTCTAGGTATCT GGAGAGAAGAAGGAGC 3′ (SEQ ID NO: 56) P20: 5′GCCTTGTTAATATCTTCCCGAATACATGCCGCAATTCTCCTAT TC3′ (SEQ ID NO: 57) P21: 5′GAGAATTGCGGCATGTATTCGGGAAGATATTAACAAGGC 3′ (SEQ ID NO: 58) P22: 5′ CAGCTATGACCATGATTACGAATTCGAGCTCGGTACCCCCGC AGATTACTAAGGCTG 3′

    [0309] Construction method: Corynebacterium glutamicum ATCC13032 was used as a template, PCR amplification was carried out with primers P19/P20 and P21/P22, respectively, to obtain an upstream homology arm fragment of 658 bp and a downstream homology arm fragment of 716 bp, and then the entire homology arm fragment of 1335 bp was obtained by overlap PCR with primers P19/P22. The amplified product was electrophoresed and purified using a column DNA gel recovery kit, and the recovered DNA fragment was ligated with purified pK18mobsacB plasmid (purchased from Addgene Company, which was double digested with Xbal I/BamH I respectively) after double digestion with NEBuilder enzyme (purchased from NEB Company) at 50° C. for 30 min, and the single clone grown after the transformation of the ligation product was identified by PCR with M13 primer to obtain the positive knockout vector pK18-ΔNCgl0761, which was sent for sequencing. This plasmid contained kanamycin resistance as a selectable marker.

    [0310] PCR system: 10×Ex Taq Buffer 5 μL, dNTP Mixture (2.5 mM each) 4 μL, Mg.sup.2+ (25 mM) 4 μL, primers (10 pM) 2 μL each, Ex Taq (5 U/μL) 0.25 μL, total volume 50 μL.

    [0311] The PCR amplification was performed as follows: pre-denaturation at 94° C. for 5 min, denaturation at 94° C. for 30 s, annealing at 52° C. for 30 s, extension at 72° C. for 90 s (30 cycles), and overextension at 72° C. for 10 min.

    [0312] The correctly sequenced knockout plasmid pK18-ΔNCgl0761 was electro-transformed into the patented strain YP97158 of producing lysine, and the single colony produced by the culture was identified by PCR with the following primers (synthesized by Shanghai Yingjun Company):

    TABLE-US-00036 (SEQ ID NO: 59) P23: 5′GTATCTGGAGAGAAGAAGGAGC 3′ (SEQ ID NO: 60) P24: 5′CCGCAGATTACTAAGGCTG 3′

    [0313] The strains with 1374 bp and 1520 bp bands simultaneously amplified by the above PCR were positive strains, and the strain with 1520 bp band only amplified was the original strains. Positive strains were screened on 15% sucrose medium and cultured on kanamycin-containing and kanamycin-free medium, respectively. The strains that grew on the medium without kanamycin but did not grow on the medium containing kanamycin were further identified by PCR using P23/P24 primers, and the amplified strains with a size of 1374 bp were the positive strain in which the coding region of the NCgl0761 gene had been knocked out. The positive strain NCgl0761 fragment was amplified by PCR with P23/P24 primers again, and ligated to the PMD19-T vector for sequencing. The correctly sequenced strain was named YPL-4-034.

    (6) L-Lysine Fermentation Experiment

    [0314] The strains constructed in the examples and the original strain YP97158 were subjected to fermentation experiments in the BLBIO-5GC-4-H fermentor (purchased from Shanghai Bailun Biotechnology Co., Ltd.) with the medium shown in Table 4 and the control process shown in Table 5. Each strain was repeated three times, and the results were shown in Table 6.

    TABLE-US-00037 TABLE 4 Formula of fermentation medium Ingredient Recipe Starch hydrolyzed sugar 30 g/L Ammonium sulfate 12 g/L Magnesium sulfate 0.87 g/L Molasses 20 g/L Acidified corn steep liquor 3 mL/L Phosphoric acid 0.4 mL/L Potassium chloride 0.53 g/L Defoamer (2% GPE) 4 mL/L Ferrous sulfate 120 mg/L Manganese sulfate 120 mg/L Niacinamide 42 mg/L Calcium pantothenate 6.3 mg/L Vitamin B 1 6.3 mg/L Copper and zinc salt solution 0.6 g/L Biotin 0.88 mg/L

    TABLE-US-00038 TABLE 5 Fermentation control process Correction Temperature 37° C., air volume 4 L/min, DO100% speed 1000 rpm, tank pressure 0 mpa, calibrate after 5min Inoculation 10% Culture 37° C. amount temperature° C. pH pH6.9 ± 0.05 Dissolved 10-30% oxygen DO Initial Temperature 37° C., pH6.9, Tank pressure conditions 0 Mpa, Air volume 3 L/min, Speed 550 rpm Whole process Whole process control 1. When control the dissolved oxygen was less than 30%, increase the speed by 750 rpm.fwdarw.800 rpm.fwdarw.air volume 4 L/min.fwdarw.850 rpm.fwdarw.950 rpm; 2, Fermentation 6 h lift tank pressure 0.01 Mpa; 12 h lift tank pressure 0.02 Mpa.fwdarw.0.03 Mpa.fwdarw.0.04 Mpa.fwdarw.0.05 Mpa Residual sugar 0.1-0.2% before F12h; after F12h, control combined with DO, it was required to control residual sugar 0.1-0.05% Ammonia 0.1-0.15 before F12h; F12-F32h nitrogen control 0.15-0.25; 0.1-0.15 after F32h Feeding material 25% ammonia water, 70% concentrated sugar, 50% ammonium sulfate, 10% GPE Fermentation Around 48h cycle

    TABLE-US-00039 TABLE 6 L-lysine fermentation experiment results L-lysine production Transformation rate Strain (g/100 ml) (%) YP97158 18.9 65.2 YPL-4-029 19.6 65.8 YPL-4-030 19.4 65.6 YPL-4-031 19.8 66.0 YPL-4-032 19.3 65.7 YPL-4-033 19.7 66.2 YPL-4-034 18.0 63.8

    [0315] The results were shown in Table 6. Overexpression of the NCgl076J gene, or point mutation NCgl0761.sup.L31R and overexpression of the coding region of the NCgl0761 gene in Corynebacterium glutamicum contributed to the improvement of L-lysine production and transformation rate, while weakening or knocking out the gene was not conducive to the accumulation of L-lysine, and at the same time reduced the transformation rate.

    (7) The NCgl0761 Gene was Introduced into the Glutamic Acid-Producing Strain and Overexpressed, or the Coding Region of the NCgl0761 Gene was Subjected to Point Mutation NCgl0761.sup.L31R and Overexpression, and Fermentation Experiments were Carried Out.

    [0316] According to the method of Examples (1)-(5), the same primers and experimental conditions were used, and Corynebacterium ATCC13869 was used as the starting bacterium, and the bacterium of ATCC 13869 was used as the expression bacterium to obtain a glutamic acid-producing engineering strain of pK18-NCgl0761.sup.L31R containing the point mutation (YPG-001), a glutamic acid-producing engineering strain overexpressing the NCgl0761 (YPG-002) or NCgl0761.sup.L31R(YPG-003) gene on the genome, and a glutamic acid-producing engineering strain overexpressing NCgl0761 (YPG-004) or NCgl0761.sup.L31R(YPG-005) gene on plasmids, and a glutamic acid-producing engineering strain lacking the NCgl0761 gene on the genome (YPG-006).

    [0317] The strains constructed in the examples and the original strain ATCC 13869 were subjected to fermentation experiments in the BLBIO-5GC-4-H fermentor (purchased from Shanghai Bailun Biotechnology Co., Ltd.) with the medium shown in Table 7 and the control process shown in Table 8. Each strain was repeated three times, and the results were shown in Table 9.

    TABLE-US-00040 TABLE 7 Formula of fermentation medium Reagent name Proportion Glucose 5.0 g/L Phosphoric acid 0.38 g/L Magnesium 1.85 g/L sulfate Potassium 1.6 g/L chloride Biotin 550 ug/L Vitamin B1 300 ug/L Ferrous 10 mg/L sulfate Manganese 10 g/dl sulfate KH.sub.2PO.sub.4 2.8 g/L Vitamin C 0.75 mg/L Vitamin B12 2.5 ug/L Para 0.75 mg/L aminobenzoic acid Defoamer 0.0015 ml/dl Betaine 1.5 g/L Cane 7 ml/L molasses Corn syrup 77 ml/L Aspartic acid 1.7 g/L Hair powder 2 g/L

    TABLE-US-00041 TABLE 8 Fermentation control process Conditions Air Culture Cycles Revolutions Volume Pressure Temperature 0 h 400 rpm 3 L/min 0.05 MPA 32.5° C. OD1.0 600 rpm 5 L/min 0.08 MPA   37° C. OD1.4 700 rpm 7 L/min 0.11 MPA   38° C. 32 h-34 h When the fermentation was over, the control process took dissolved oxygen 50-20% as the standard for raising and lowering the air volume PH 0 h controlled 7.0, 14 h controlled 6.8 Feed sugar The sugar concentration of the fermentor flow control was 50-55%, and the residual sugar of the fermenter was controlled by 0.5-1.0%

    TABLE-US-00042 TABLE 9 L-glutamic acid fermentation experiment results L-glutamic acid Transformation Strain production (g/l) rate (%) ATCC13869 101.0 45.8 YPG-001 106.5 46.3 YPG-002 106.9 46.6 YPG-003 106.2 46.2 YPG-004 106.6 46.5 YPG-005 105.8 46.2 YPG-006 97.5 45.3

    [0318] The results were shown in Table 9. Overexpression of the NCgl0761 gene, or point mutation NCgl0761.sup.L31R and overexpression of the coding region of the NCgl0761 gene in Corynebacterium glutamicum contributed to the improvement of L-lysine production and transformation rate, while weakening or knocking out the gene was not conducive to the accumulation of L-lysine, and at the same time reduced the transformation rate.

    Example 3

    [0319] (1) Construction of Transformation Vector pK18-ptsS.sup.M162T Containing the Coding Region of ptsS Gene with Point Mutation

    [0320] According to the genome sequence of wild-type Corynebacterium glutamicum ATCC13032 published by NCBI, two pairs of primers for amplifying the coding region sequence of the ptsS gene were designed and synthesized, a point mutation was introduced in the coding region (SEQ ID NO: 61) of the ptsS gene in the background of strain YP97158 (preservation number: CGMCC No. 12856, preservation date: Aug. 16, 2016, depository unit: China General Microbiological Culture Collection Center. No. 3, Yard 1, West Beichen Road, Chaoyang District, Beijing, Tel: 010-64807355, the strain is recorded in Chinese patent application CN106367432A (application date Sep. 1, 2016, publication date Feb. 1, 2017)) by means of allelic replacement, the amino acid sequence corresponding to the coded protein was SEQ ID NO: 63, the 485th of the nucleotide sequence of the ptsS gene was changed from thymine T to cytosine C (SEQ ID NO: 62), and the 162nd of the amino acid sequence corresponding to the coded protein was changed from methionine to threonine (SEQ ID NO: 64: ptsS.sup.M162T). The primers were designed as follows (synthesized by Shanghai Invitrogen Company):

    TABLE-US-00043 (SEQ ID NO: 65) P1: 5′ CAGTGCCAAGCTTGCATGCCTGCAGGTCGACTCTAGGACACCT GAAGCACCTGC3′ (SEQ ID NO: 66) P2: 5′GAGATGATCAACCTCACGGCATCTGCGC 3′ (SEQ ID NO: 67) P3: 5′GCGCAGATGCCGTGAGGTTGATCATCTC 3′ (SEQ ID NO: 68) P4: 5′ CAGCTATGACCATGATTACGAATTCGAGCTCGGTACCCGATGG ACAGGTTTCATTCGC3′

    [0321] Construction method: Corynebacterium glutamicum ATCC13032 was used as a template, PCR amplification was carried out with primers P1 and P2, P3 and P4, respectively. PCR system: 10×Ex Taq Buffer 5 μL, dNTP Mixture (2.5 mM each) 4 μL, Mg.sup.2+ (25 mM) 4 μL, primers (10 pM) 2 μL each, Ex Taq (5 U/μL) 0.25 μL, total volume 50 μL, The PCR amplification was performed as follows: pre-denaturation at 94° C. for 5 min, (denaturation at 94° C. for 30 s, annealing at 52° C. for 30 s, extension at 72° C. for 40 s, 30 cycles), and overextension at 72° C. for 10 min, two DNA fragments (ptsS Up and ptsS Down) containing the coding region of the ptsS gene were obtained with sizes of 666 bp and 703 bp, respectively. After the above two DNA fragments were separated and purified by agarose gel electrophoresis, the above two DNA fragments were used as templates, and P1 and P4 were used as primers, and a fragment with a length of 1341 bp was amplified by Overlap PCR.

    [0322] PCR system: 10×Ex Taq Buffer 5 μL, dNTP Mixture (2.5 mM each) 4 μL, Mg.sup.2+ (25 mM) 4 μL, primers (10 pM) 2 μL each, Ex Taq (5 U/μL) 0.25 μL, total volume 50 μL. The PCR amplification was performed as follows: pre-denaturation at 94° C. for 5 min (denaturation at 94° C. for 30 s, annealing at 52° C. for 30 s, extension at 72° C. for 90 s, 30 cycles), and overextension at 72° C. for 10 min.

    [0323] This DNA fragment changed the thymine (T) at position 485 of the coding region of the YP97158ptsS gene into cytosine (C), and finally caused the 162nd amino acid of the coded protein to change from methionine (M) to threonine (T). This DNA fragment was purified by agarose gel electrophoresis, and was ligated with the pK18mobsacB plasmid purified after double digestion (purchased from Addgene, and double digestion with Xbal I/BamH I respectively) with NEBuilder enzyme at 50° C. for 30 min. After the transformation of the ligation product, the monoclonal PCR was used to identify the vector pK18-ptsS.sup.M162T, which contained a kanamycin resistance marker. The correctly digested vector pK18-ptsS.sup.M162T was sent to a sequencing company for sequencing identification, and the vector pK18-ptsS.sup.M162T containing the correct point mutation (T-C) was stored for future use.

    (2) Construction of Engineering Strain ptsS.sup.M162T Containing Point Mutation

    [0324] Construction method: The allelic replacement plasmid pK18-ptsS.sup.M162T was transformed into the patented strain YP97158 of L-lysine-producing bacteria by electric shock (for its construction method, please refer to WO2014121669A1; it was confirmed by sequencing that the coding region of the wild-type ptsS gene was retained on the chromosome of this strain, the single colony produced by culture was identified by primer P1 and universal primer M13R respectively, and the strain that could amplify a 1393 bp size band was positive strain. The positive strains were cultured on the medium containing 15% sucrose, and the single colony produced by the culture was cultured on the medium containing kanamycin and without kanamycin, respectively. the strains that grew on the medium without kanamycin but did not grow on the medium containing kanamycin were further identified by PCR using the following primers (synthesized by Shanghai Invitrogen Company):

    TABLE-US-00044 (SEQ ID NO: 69) P5: 5′CCACATTGGCATTTCGCC 3′ (SEQ ID NO: 70) P6: 5′CGCTGATTCCAATCTTGG 3′

    [0325] The above PCR amplification product 311 bp was subjected to sscp electrophoresis (the amplified fragment of plasmid pK18-ptsS.sup.M162T was used as a positive control, the amplified fragment of YP97158 was used as a negative control, and water was used as a blank control) after high temperature denaturation at 95° C. for 10 min and ice bath for 5 min. Due to the different fragment structures and electrophoresis positions, the strains whose electrophoresis positions were inconsistent with those of the negative control fragment and were consistent with the positive control fragment were the strains with successful allelic replacement. The fragment of the positive strain ptsS was amplified by PCR with primers P5 and P6 again, and was linked to the PMD19-T vector for sequencing. Through sequence alignment, the strain with mutation (A-G) in the base sequence was a positive strain with successful allelic substitution, and was named YPL-4-035.

    (3) Construction of Engineering Strains Overexpressing PtsS or PtsS.SUP.M162T .Gene on the Genome

    [0326] According to the genome sequence of wild-type Corynebacterium glutamicum ATCC13032 published by NCBI, three pairs of primers for amplifying the sequences of the upstream and downstream homology arm fragments, the coding region of the PtsS or PtsS.sup.M162T gene, and the promoter region were designed and synthesized, and the PtsS.sup.M162T gene was introduced into strain YP97158 by homologous recombination.

    [0327] The primers were designed as follows (synthesized by Shanghai Invitrogen Company):

    TABLE-US-00045 (SEQ ID NO: 71) P7: 5′ CAGTGCCAAGCTTGCATGCCTGCAGGTCGACTCTAGAATGCGT TCTGGACTGAGG3′ (SEQ ID NO: 72) P8: 5′GTGACTCTACGCATCTTTGACAGTGCACCG AGAACAGATG 3′ (SEQ ID NO: 73) P9: 5′CATCTGTTCTCGGTGCACTGTCAAAGATGCGTA GAGTCAC 3′ (SEQ ID NO: 74) P10: 5′CTTGATTTAATTGCGCCATCTGATTCTGGGTCTGTGGATCGTG G TGGTG 3′ (SEQ ID NO: 75) P11: 5′CACCACCACGATCCACAGACCCAGAATCAGATGGCGCAATTAA AT CAAG 3′ (SEQ ID NO: 76) P12: 5′ CAGCTATGACCATGATTACGAATTCGAGCTCGGTACCCGCTA TGACACCTTCAACGGATC 3′

    [0328] Construction method: Corynebacterium glutamicum ATCC13032 or YPL-4-035 was used as a template to carry out PCR amplification with primers P7/P8, P9/P10, P11/P12, respectively, to obtain upstream homology arm fragment of 802 bp, PtsS or PtsS.sup.M162T gene and its promoter fragment of 2354 bp and the downstream homology arm fragment of 647 bp. After the PCR reaction, the three amplified fragments were recovered by electrophoresis using a column DNA gel recovery kit (TIANGEN). The recovered three fragments were ligated with purified pK18mobsacB plasmid (purchased from Addgene Company, which was double digested with Xbal I/BamH I respectively) after double digestion with NEBuilder enzyme (purchased from NEB Company) at 50° C. for 30 min. The single clone grown after the transformation of the ligation product was identified by PCR to obtain the positive integrated plasmid and pK18mobsacB-PtsS or PtsS.sup.M162T and pK18mobsacB-PtsS.sup.M162T. The plasmid contained a kanamycin resistance marker, and the recombinant plasmid integrated into the genome can be obtained by kanamycin selection.

    [0329] PCR system: 10×Ex Taq Buffer 5 μL, dNTP Mixture (2.5 mM each) 4 μL, Mg.sup.2+ (25 mM) 4 μL, primers (10 pM) 2 μL each, Ex Taq (5 U/μL) 0.25 μL, total volume 50 μL. The PCR amplification was performed as follows: pre-denaturation at 94° C. for 5 min, denaturation at 94° C. for 30 s, annealing at 52° C. for 30 s, extension at 72° C. for 60 s (30 cycles), and overextension at 72° C. for 10 min.

    [0330] The two correctly sequenced integrated plasmids were electro-transformed into the patented strain YP97158 of L-lysine-producing bacteria respectively, and the single colony produced by the culture was identified by PCR through the P13/P14 primers, and the strain that could amplify a 1298 bp size band was positive strain, and those that fail to amplify the fragments were original strains. The positive strains were cultured on a medium containing 15% sucrose, and the single colony produced by the culture was further identified by PCR using P15/P16 primers. The amplified strains with a size of 1133 bp were positive strains with PtsS or PtsS.sup.M162T gene integrated into the genome of YP97158, which were named YPL-4-036 (without mutation point) and YPL-4-037 (with mutation point).

    TABLE-US-00046 (SEQ ID NO: 77) P13: 5′TCCAAGGAAGATACACGCC 3′ (SEQ ID NO: 78) P14: 5′GTGGAAAGATTGTGGTGGC 3′ (SEQ ID NO: 79) P15: 5′CATCCAGACTTTGGCGATC 3′ (SEQ ID NO: 80) P16: 5′CGTTGGAATCTTGCGTTG 3′

    (4) Construction of Engineering Strains Overexpressing PtsS or PtsS.SUP.M162T .Gene on a Plasmid

    [0331] According to the genome sequence of wild-type Corynebacterium glutamicum ATCC13032 published by NCBI, one pair of primers for amplifying the sequence of the coding region and the promoter region of PtsS or PtsS.sup.M162T gene were designed and synthesized. The primers were designed as follows (synthesized by Shanghai Invitrogen Company):

    TABLE-US-00047 (SEQ ID NO: 81) P17: 5′ GCTTGCATGCCTGCAGGTCGACTCTAGAGGATCCCCTGTCA AAGATGCGTAGAGTCAC 3′ (SEQ ID NO: 82) P18: 5′ ATCAGGCTGAAAATCTTCTCTCATCCGCCAAAACGTCTGTGG ATCGTGGTGGTG3′

    [0332] Construction method: ATCC13032 and YPL-4-035 were used as templates to carry out PCR amplification with primers P17/P18, to obtain PtsS or PtsS.sup.M162T gene and its promoter fragment of 2354 bp, and the amplified products were electrophoresed and purified using a column DNA gel recovery kit. The recovered DNA fragment and the shuttle plasmid pXMJ19 recovered by EcoR I digestion were ligated with NEBuilder enzyme (purchased from NEB company) at 50° C. for 30 min, and the single clone grown after the transformation of the ligation product was identified by PCR with M13 primer to obtain the positive overexpression plasmid pXMJ19-PtsS and pXMJ19-PtsS.sup.M162T, and the plasmid was sent for sequencing. Because the plasmid contained the chloramphenicol resistance marker, it could be used to screen whether the plasmid was transformed into the strain by chloramphenicol.

    [0333] PCR system: 10×Ex Taq Buffer 5 μL, dNTP Mixture (2.5 mM each) 4 μL, Mg.sup.2+ (25 mM) 4 μL, primers (10 pM) 2 μL each, Ex Taq (5 U/μL) 0.25 μL, total volume 50 μL.

    [0334] The PCR amplification was performed as follows: pre-denaturation at 94° C. for 5 min, denaturation at 94° C. for 30 s, annealing at 52° C. for 30 s, extension at 72° C. for 60 s (30 cycles), and overextension at 72° C. for 10 min.

    [0335] The correctly sequenced pXMJ19-PtsS and pXMJ19-PtsS.sup.M162T plasmids were electro-transformed into the patented strain YP97158 of L-lysine-producing bacteria, and the single colony produced by the culture were identified by PCR with primers M13/P18. The PCR amplified fragment containing a fragment of size 2362 bp was the positive strain, which were named as YPL-4-038 (without mutation point) and YPL-4-039 (with mutation point).

    (5) Construction of Engineering Strains that Lacks the PtsS Gene on its Genome

    [0336] According to the genome sequence of Corynebacterium glutamicum ATCC13032 published by NCBI, two pairs of primers for amplifying the fragments at both ends of the coding region of the PtsS gene were synthesized as upstream and downstream homology arm fragments. The primers were designed as follows (synthesized by Shanghai Yingjun company):

    TABLE-US-00048 (SEQ ID NO: 83) P19: 5′ CAGTGCCAAGCTTGCATGCCTGCAGGTCGACTCTAGGCCGTT AT C AATCAAGCGC3′ (SEQ ID NO: 84) P20: 5′CGCCAAAGTCTGGATGATGGTGGAAAGATTGTGGTGGC 3′ (SEQ ID NO: 85) P21: 5′GCCACCACAATCTTTCCACCATCATCCAGACTTTGGCGATCC 3′ (SEQ ID NO: 86) P22: 5′ CAGCTATGACCATGATTACGAATTCGAGCTCGGTACCCGCAG TA AACGGTTCTGATGC3′

    [0337] Construction method: Corynebacterium glutamicum ATCC13032 was used as a template, PCR amplification was carried out with primers P19/P20 and P21/P22, respectively, to obtain an upstream homology arm fragment of 794 bp and a downstream homology arm fragment of 703 bp, and then the entire homology arm fragment of 1459 bp was obtained by OVERLAP PCR with primers P19/P22. The amplified product was electrophoresed and purified using a column DNA gel recovery kit, and the recovered DNA fragment was ligated with purified pK18mobsacB plasmid (purchased from Addgene Company, which was double digested with Xbal I/BamH I respectively) after double digestion with NEBuilder enzyme (purchased from NEB Company) at 50° C. for 30 min, and the single clone grown after the transformation of the ligation product was identified by PCR with M13 primer to obtain the positive knockout vector pK18-ΔPtsS, which was sent for sequencing. This plasmid contained kanamycin resistance as a selectable marker.

    [0338] PCR system: 10×Ex Taq Buffer 5 μL, dNTP Mixture (2.5 mM each) 4 μL, Mg.sup.2+ (25 mM) 4 μL, primers (10 pM) 2 μL each, Ex Taq (5 U/μL) 0.25 μL, total volume 50 μL. The PCR amplification was performed as follows: pre-denaturation at 94° C. for 5 min, denaturation at 94° C. for 30 s, annealing at 52° C. for 30 s, extension at 72° C. for 90 s (30 cycles), and overextension at 72° C. for 10 min.

    [0339] The correctly sequenced knockout plasmid pK18-ΔPtsS was electro-transformed into the patented strain YP97158 of producing lysine, and the single colony produced by the culture was identified by PCR with the following primers (synthesized by Shanghai Yingjun Company):

    TABLE-US-00049 (SEQ ID NO: 87) P23: 5′TGTCAAAGATGCGTAGAGTCAC 3′ (SEQ ID NO: 88) P24: 5′GGTTTCATTCGCTTTCCG 3′

    [0340] The strains with 758 bp and 2249 bp bands simultaneously amplified by the above PCR were positive strains, and the strain with 2249 bp band only amplified was the original strains. Positive strains were screened on 15% sucrose medium and cultured on kanamycin-containing and kanamycin-free medium, respectively. The strains that grew on the medium without kanamycin but did not grow on the medium containing kanamycin were further identified by PCR using P23/P24 primers, and the amplified strains with a size of 758 bp were the positive strain in which the coding region of the PtsS gene had been knocked out. The positive strain PtsS fragment was amplified by PCR with P23/P24 primers again, and ligated to the PMD19-T vector for sequencing. The correctly sequenced strain was named YPL-4-040.

    (6) L-Lysine Fermentation Experiment

    [0341] The strains constructed in the examples and the original strain YP97158 were subjected to fermentation experiments in the BLBIO-5GC-4-H fermentor (purchased from Shanghai Bailun Biotechnology Co., Ltd.) with the medium shown in Table 10 and the control process shown in Table 11. Each strain was repeated three times, and the results were shown in Table 12.

    TABLE-US-00050 TABLE 10 Formula of fermentation medium Ingredient Recipe Starch hydrolyzed sugar 30 g/L Ammonium sulfate 12 g/L Magnesium sulfate 0.87 g/L Molasses 20 g/L Acidified corn steep liquor 3 mL/L Phosphoric acid 0.4 mL/L Potassium chloride 0.53 g/L Defoamer (2% GPE) 4 mL/L Ferrous sulfate 120 mg/L Manganese sulfate 120 mg/L Niacinamide 42 mg/L Calcium pantothenate 6.3 mg/L Vitamin B1 6.3 mg/L Copper and zinc salt solution 0.6 g/L Biotin 0.88 mg/L

    TABLE-US-00051 TABLE 11 Fermentation control process Correction Temperature 37° C., air volume 4 L/min, speed DO 100% 1000 rpm, tank pressure 0 mpa, calibrate after 5 min Inoculation 10% Culture 37° C. amount temperature° C. pH pH6.9 ± 0.05 Dissolved 10-30% oxygen DO Initial conditions Temperature 37° C., pH6.9, Tank pressure 0 Mpa, Air volume 3 L/min, Speed 550 rpm Whole process Whole process control 1. When the control dissolved oxygen was less than 30%, increase the speed by 750 rpm.fwdarw.800 rpm.fwdarw.air volume 4 L/min.fwdarw.850 rpm.fwdarw.950 rpm; 2, Fermentation 6 h lift tank pressure 0.01 Mpa; 12 h lift tank pressure Residual sugar 0.1-0.2% before F12h; after F12h, control combined with DO, it was required to control residual sugar 0.1-0.05% Ammonia nitrogen 0.1-0.15 before F12h; F12-F32h control 0.15-0.25; 0.1-0.15 after F32h Feeding material 25% ammonia water, 70% concentrated sugar, 50% ammonium sulfate, 10% GPE Fermentation cycle Around 48 h

    TABLE-US-00052 TABLE 12 L-lysine fermentation experiment results L-lysine production Transformation rate Strain (g/100 ml) (%) YP97158 18.9 65.2 YPL-4-035 19.6 66.4 YPL-4-036 19.4 65.8 YPL-4-037 19.8 66.7 YPL-4-038 19.5 66.2 YPL-4-039 19.9 66.3 YPL-4-040 18.0 63.8

    [0342] The results were shown in Table 12. Point mutation PtsS.sup.M162T and overexpression of the coding region of the PtsS gene in Corynebacterium glutamicum contributed to the improvement of L-lysine production and transformation rate, while weakening or knocking out the gene was not conducive to the accumulation of L-lysine, and at the same time reduced the transformation rate.

    (7) The PtsS Gene was Introduced into the Glutamic Acid-Producing Strain and Overexpressed, or the Coding Region of the PtsS Gene was Subjected to Point Mutation ptsS.sup.M162T and Overexpression, and Fermentation Experiments were Carried Out.

    [0343] According to the method of this examples (1)-(5), the same primers and experimental conditions were used, and Corynebacterium ATCC13869 was used as the starting bacterium, and the bacterium of ATCC 13869 was used as the expression bacterium to obtain a glutamic acid-producing engineering strain of ptsS.sup.M16T2 containing the point mutation, a glutamic acid-producing engineering strain overexpressing the ptsS and ptsS.sup.M16T2 genes on the genome, and a glutamic acid-producing engineering strain overexpressing ptsS and ptsS.sup.M162T genes on plasmids, and a glutamic acid-producing engineering strain lacking the ptsS gene on the genome.

    [0344] The strains constructed in the examples and the original strain ATCC 13869 were subjected to fermentation experiments in the BLBIO-5GC-4-H fermentor (purchased from Shanghai Bailun Biotechnology Co., Ltd.) with the medium shown in Table 13 and the control process shown in Table 14. Each strain was repeated three times, and the results were shown in Table 15.

    TABLE-US-00053 TABLE 13 Formula of fermentation medium Reagent name Proportion Glucose 5.0 g/L Phosphoric acid 0.38 g/L Magnesium 1.85 g/L sulfate Potassium 1.6 g/L chloride Biotin 550 ug/L Vitamin B1 300 ug/L Ferrous sulfate 10 mg/L Manganese 10 g/dl sulfate KH.sub.2PO.sub.4 2.8 g/L Vitamin C 0.75 mg/L Vitamin B12 2.5 ug/L para aminobenzoic 0.75 mg/L acid Defoamer 0.0015 ml/dl Betaine 1.5 g/L cane molasses 7 ml/L corn syrup 77 ml/L aspartic acid 1.7 g/L hair powder 2 g/L

    TABLE-US-00054 TABLE 14 Fermentation control process Conditions Air Culture Cycles Revolutions Volume Pressure Temperature 0 h 400 rpm 3 L/min 0.05 MPA 32.5° C. OD1.0 600 rpm 5 L/min 0.08 MPA   37° C. OD1.4 700 rpm 7 L/min 0.11 MPA   38° C. 32 h-34 h When the fermentation was over, the control process took dissolved oxygen 50-20% as the standard for raising and lowering the air volume PH 0 h controlled 7.0, 14 h controlled 6.8 Feed sugar The sugar concentration of the fermentor flow was 50-55%, control and the residual sugar of the fermenter was controlled by 0.5-1.0%

    TABLE-US-00055 TABLE 15 L-glutamic acid fermentation experiment results L-glutamic acid Transformation Strain production (g/l) rate(%) ATCC13869 101.0 45.8 YPG-007 107.5 46.4 YPG-008 107.9 46.8 YPG-009 107.2 46.3 YPG-010 107.6 46.7 YPG-011 107.8 46.2 YPG-012 96.5 45.2

    [0345] The results were shown in Table 15. Point mutation PtsS.sup.M162T and/or overexpression of the coding region of the PtsS gene in Corynebacterium glutamicum contributed to the improvement of L-lysine production and transformation rate, while weakening or knocking out the gene was not conducive to the accumulation of L-lysine, and at the same time reduced the transformation rate.

    [0346] The embodiments of the present invention have been described above. However, the present invention is not limited to the above-described embodiments. Any modification, equivalent replacement, improvement, etc. within the spirit and principle of the present invention should be included within the protection scope of the present invention.