RECOMBINANT STRAIN FOR PRODUCING L-AMINO ACID, CONSTRUCTION METHOD THEREFOR, AND APPLICATION THEREOF

Abstract

A bacterium for producing L-amino acid has improved expression of a polynucleotide encoding a protein represented by SEQ ID NO:3 and improved expression of a polynucleotide encoding a protein represented by SEQ ID NO:31, and/or has mutations in bases at positions −45 bp and −47 bp of a promotor region represented by SEQ ID NO:57. A polynucleotide, encodes proteins and can be included in a recombinant vector, which can be included in a recombinant strain. These are useful in a method for producing L-amino acid. The polynucleotide encodes a protein which is represented by SEQ ID NO:3 and has arginine at position 334 substituted by a terminator or encodes a protein which is represented by SEQ ID NO:31 and has tyrosine at position 592 substituted by phenylalanine, or is formed by mutations in bases at positions −45 bp and −47 bp of a promotor region represented by SEQ ID NO:57.

Claims

1. A bacterium producing L-amino acid, characterized in that, the bacterium has an improved expression of a polynucleotide encoding an amino acid sequence of SEQ ID NO: 3; and/or an improved expression of a polynucleotide encoding an amino acid sequence of SEQ ID NO:31, and/or mutations in bases at positions −45 bp and −47 bp of a promotor region shown in SEQ ID NO:5.

2. The bacterium as claimed in claim 1, wherein the point mutations of the polynucleotide encoding amino acid sequence of SEQ ID NO: 3 cause that arginine at position 334 of the amino acid sequence of SEQ ID NO: 3 is substituted by a terminator; or, the point mutations of the polynucleotide encoding the amino acid sequence of SEQ ID NO: 31 cause that tyrosine at position 592 of the amino acid sequence of SEQ ID NO: 31 is substituted by different amino acids.

3. The bacterium as claimed in claim 1, characterized in that, the polynucleotide encoding the amino acid sequence of SEQ ID NO: 3 contains the nucleotide sequence of SEQ ID NO: 1; or, the polynucleotide encoding the amino acid sequence of SEQ ID NO: 31 contains the nucleotide sequence of SEQ ID NO: 29.

4. The bacterium as claimed in claim 1, characterized in that, the polynucleotide sequence with point mutations encoding the amino acid sequence of SEQ ID NO: 3 is formed by a mutation of the 1000th base of the polynucleotide sequence shown in SEQ ID NO: 1.

5. The bacterium as claimed in claim 4, characterized in that, nucleotide guanine (G) at position −45 bp is mutated to adenine (A) and nucleotide guanine (G) at position −47 bp is mutated to thymine (T) in the promoter region shown in SEQ ID NO: 57.

6. The bacterium as claimed in claim 1, characterized in that, the microorganism is Corynebacterium glutamicum.

7. A product selected from the group consisting of: (I) a polynucleotide sequence, characterized in that, the polynucleotide sequence comprises a polynucleotide encoding an amino acid sequence shown in SEQ ID NO: 3 and arginine at position 334 thereof is substituted by a terminator; preferably, the polynucleotide sequence includes a polynucleotide encoding an amino acid sequence shown in SEQ ID NO: 4; preferably, the polynucleotide sequence is formed by a mutation in the 1000th base of a polynucleotide sequence shown in SEQ ID NO: 1; preferably, the mutation comprises a mutation in the 485th base of the polynucleotide sequence as shown in SEQ ID NO:1 from cytosine (C) to thymine (T); and preferably, the polynucleotide sequence includes a polynucleotide sequence shown in SEQ ID NO: 2; (II) a polynucleotide sequence, characterized in that, the polynucleotide sequence comprises a polynucleotide encoding an amino acid sequence shown in SEQ ID NO: 31, wherein tyrosine at position 592 is substituted by different amino acids; preferably tyrosine at position 592 is substituted by phenylalanine; preferably, the polynucleotide sequence includes a polynucleotide encoding an amino acid sequence shown in SEQ ID NO: 32; preferably, the polynucleotide sequence is formed by a mutation of 1775.sup.th base of the polynucleotide sequence shown in SEQ ID NO: 29; preferably, the mutation is a mutation of the 1775.sup.th base of the polynucleotide sequence shown in SEQ ID NO: 29 from adenine (A) to thymine (T); and preferably, the polynucleotide sequence includes a polynucleotide sequence shown in SEQ ID NO: 30; (III) an amino acid sequence, characterized in that, the sequence is shown in SEQ ID NO:4 or SEQ ID NO:32; (IV) a recombinant vector, characterized in that, the recombinant vector comprises the polynucleotide sequence of said (I) or (II); (V) a recombinant strain, characterized in that, the recombinant strain comprises the polynucleotide sequence of said (I) or (II); (VI) a promoter nucleotide sequence, comprising a nucleotide sequence formed by mutations in bases at positions −45 bp and −47 bp of a promoter region as shown in SEQ ID NO: 57; preferably, the nucleotide guanine (G) at position −45 bp is mutated to adenine (A) and the nucleotide guanine (G) at position −47 bp is mutated to thymine (T) in the promoter region shown in SEQ ID NO: 57; preferably further comprising (a) or (b): (a) a nucleotide sequence shown in SEQ ID NO:58; or (b) a nucleotide sequence having a sequence identity of more than 90%, preferably more than 95%, 98% to the nucleotide sequence shown in SEQ ID NO: 58, and retaining enhanced activity of the promoter of (a), with at position −45 bp remaining as adenine (A), and at position −47 bp remaining as thymine (T); (VII) an expression cassette, comprising the promoter nucleotide sequence of said (VI), and a coding sequence operably linked behind the promoter nucleotide sequence; preferably, the coding sequence is the coding sequence of lysC gene; (VIII) a recombinant vector, comprising the promoter nucleotide sequence of said (VI); preferably, the promoter nucleotide sequence is linked with a shuttle plasmid to construct the recombinant vector; preferably, the shuttle plasmid is pK18mobsacB plasmid; and (IX) a recombinant strain, comprising the promoter nucleotide sequence of said (VI) or the recombinant vector of said (VIII); preferably, the recombinant strain comprises a nucleotide sequence shown in SEQ ID NO: 58; preferably, the recombinant strain comprises a nucleotide sequence shown in SEQ ID NO: 58 linked to the lysC gene coding sequence.

8-16. (canceled)

17. A method for producing L-amino acid, the method comprises culturing the bacterium of claim 1, and recovering L-amino acid from the culture.

18. The bacterium as claimed in claim 1, wherein the improved expression is that the expression of the polynucleotide encoding the amino acid sequence of SEQ ID NO: 3 is enhanced or the polynucleotide encoding the amino acid sequence of SEQ ID NO: 3 has point mutations, or the polynucleotide encoding the amino acid sequence of SEQ ID NO: 3 has point mutations and the expression is enhanced.

19. The bacterium as claimed in claim 1, wherein the improved expression is that the expression of the polynucleotide encoding the amino acid sequence of SEQ ID NO: 31 is enhanced or the polynucleotide encoding the amino acid sequence of SEQ ID NO: 31 has point mutations, or the polynucleotide encoding the amino acid sequence of SEQ ID NO: 31 has point mutations and the expression is enhanced.

20. The bacterium as claimed in claim 4, wherein the mutation includes the mutation of the 1000th base of the polynucleotide sequence shown in SEQ ID NO: 1 from cytosine (C) to thymine (T).

21. The bacterium as claimed in claim 4, wherein the polynucleotide sequence with point mutations includes the polynucleotide sequence shown in SEQ ID NO: 2.

22. The bacterium as claimed in claim 4, wherein the polynucleotide sequence with point mutations encoding the amino acid sequence of SEQ ID NO: 31 is formed by a mutation of the 1775th base of the polynucleotide sequence shown in SEQ ID NO: 29.

23. The bacterium as claimed in claim 22, wherein the mutation includes the mutation of the 1775.sup.th base of the polynucleotide sequence shown in SEQ ID NO: 29 from adenine (A) to thymine (T).

24. The bacterium as claimed in claim 4, wherein the polynucleotide sequence with point mutations includes the polynucleotide sequence shown in SEQ ID NO: 30.

25. The bacterium as claimed in claim 5, wherein the nucleotide sequence of the promoter comprises: (a) the nucleotide sequence shown in SEQ ID NO:58; or (b) the nucleotide sequence having a sequence identity of more than 90%, preferably more than 95%, 98% to the nucleotide sequence shown in SEQ ID NO: 58, and retaining enhanced activity of the promoter of (a), with at position −45 bp remaining as adenine (A), and at position −47 bp remaining as thymine (T).

26. The bacterium as claimed in claim 2, wherein the tyrosine at position 592 is substituted by phenylalanine.

27. The bacterium as claimed in claim 6, wherein the Corynebacterium glutamicum is YP97158 or ATCC 13869.

Description

THE DETAILED EMBODIMENTS

[0192] Hereinafter, the technical solution of the present invention will be further described in detail in combination with specific examples. It should be understood that the following examples are merely illustrative and explanatory of the invention and should not be construed as limiting the scope of protection of the invention. All technologies realized based on the above contents of the present invention are fallen into the scope of the present invention. Unless otherwise stated, all raw materials and reagents used in the following examples are commercially available products or can be prepared by known methods. All operations are known in the art, or performed according to the user manual of commercially available products.

[0193] In the following examples, the basic medium used for culturing the strains have the same composition, and sucrose, kanamycin or chloramphenicol etc. are added to such basic medium composition when necessary. The basic medium composition is as follows:

TABLE-US-00014 Ingredients Formulation Sucrose  10 g/L Polypeptone  10 g/L Beef paste  10 g/L Yeast powder   5 g/L Urea   2 g/L Sodium chloride 2.5 g/L Agar powder  20 g/L pH 7.0 Culture temperature 32° C.

[0194] The preparation and conditions of SSCP electrophoresis PAGE in the following examples are as follows.

TABLE-US-00015 Amount (the final concentration of Ingredients acrylamide is configured as 8%) 40% acrylamide   8 ml ddH.sub.2O  26 ml glycerol   4 ml 10*TBE   2 ml TEMED  40 ul 10% AP 600 ul Electrophoresis The electrophoresis tank is placed in conditions ice and 1 × TBE buffer is used, voltage: 120 V, electrophoresis time: 10 h

[0195] In the following examples, the fermentation medium and fermentation process of L-lysine are shown in Table 1 and 2 below:

TABLE-US-00016 TABLE 1 L-lysine fermentation medium formulation Ingredients formulation Starch hydrolysis sugar   30 g/L Ammonium sulfate   12 g/L Magnesium sulfate 0.87 g/L Molasses   20 g/L Acidified corn steep liquor    3 mL/L Phosphoric acid  0.4 mL/L Potassium chloride 0.53 g/L Defoamer (2% GPE)    4 mL/L Ferrous sulfate  120 mg/L Manganese sulfate  120 mg/L Nicotinamide   42 mg/L Calcium pantothenate  6.3 mg/L Vitamin B1  6.3 mg/L Copper and zinc salt solutions  0.6 g/L Biotin 0.88 mg/L

TABLE-US-00017 TABLE 2 L-lysine fermentation control process Corrected Temperature: 37° C., air velocity: 4 L/min, rotational speed: 1000 rpm, tank DO100% pressure: 0 mpa, calibrated after 5 min Inoculation 10% Culture temperature ° C. 37° C. amount pH pH 6.9 ± 0.05 Dissolved oxygen DO 10-30% initial condition Temperature 37° C., pH 6.9, tank pressure: 0 Mpa, air elocity: 3 L/min, rotational speed: 550 rpm Full control Full range control: 1. When the dissolved oxygen is less than 30%, the rotational speed is increased to 750 rpm .fwdarw. 800 rpm .fwdarw. air velocity 4 l/min .fwdarw. 850 rpm .fwdarw. 950 rpm in turn; 2. Fermentation for 6 h, tank pressure is increased by 0.01 Mpa; 12 h tank pressure is increased by 0.02 MPa .fwdarw. 0.03 MPa .fwdarw. 0.04 MPa .fwdarw. 0.05 Mpa Residual sugar 0.1-0.2% before F12 h; After F12 h, in combination with DO, it is required to control control residual sugar as 0.1-0.05% Ammonia 0.1-0.15 before F12 h; 0.15-0.25 in F12-F32 h; 0.1-0.15 after F32 h nitrogen control Feed material 25% ammonia, 70% concentrated sugar, 50% ammonium sulfate, 10% PGE Fermentation About 48 h cycle

[0196] In the following examples, the fermentation medium and fermentation process of L-glutamate are shown in Table 3 and 4 below:

TABLE-US-00018 TABLE 3 L-glutamate fermentation medium formulation Reagent names proportioning glucose   5.0 g/L phosphoric acid  0.38 g/L Magnesium  1.85 g/L sulfate   potassium   1.6 g/L chloride   Biotin   550 μg/L Vitamin B1   300 μg/L ferrous sulfate    10 mg/L Manganese    10 g/dl sulfate   KH.sub.2PO.sub.4   2.8 g/L Vitamin C  0.75 mg/L Vitamin B12   2.5 μg/L P-aminobenzoic  0.75 mg/L acid Defoamer 0.0015 ml/dl betaine   1.5 g/L Cane Molasses     7 ml/L Corn steep    77 ml/L liquor Aspartic acid   1.7 g/L Hair powder     2 g/L

TABLE-US-00019 TABLE 4 L-glutamate fermentation control process conditions Culture Periods Revolutions Air velocity pressure temperature 0 h 400 rpm 3 L/min 0.05 MPA 32.5° C. OD 1.0 600 rpm 5 L/min 0.08 MPA   37° C. OD 1.4 700 rpm 7 L/min 0.11 MPA   38° C. 32 h~34 h At the end of fermentation, 50~20% dissolved oxygen is used as the standard for increasing and decreasing air velocity in the control process PH 0 h control: pH 7.0, 14 h control: pH 6.8 Feed sugar The concentration of feed sugar in the fermentation tank is 50~55%, control and the residual sugar in the fermentation tank is controlled to be 0.5~1.0%

Example 1: Construction of the Transformed Vector pk18-NCgl0609.SUP.R334.* Containing the Coding Region of NCgl0609 Gene with Point Mutation

[0197] Based on the genome sequence of Corynebacterium glutamicum ATCC13032 published by NCBI, two pairs of primers for amplifying the coding region sequence of NCgl0609 gene were designed and synthesized. Point mutation was introduced into the coding region of NCgl0609 gene (SEQ ID NO: 1, and the corresponding amino acid sequence encoding the proteins is SEQ ID NO: 3) in the background of strain YP97158 [Depositary No.: CGMCC No. 12856, Depositary date: Aug. 16, 2016, Depositary unit: Institute of Microbiology, Chinese Academy of Sciences, No. 3, Yard. 1, Beichen West Road, Chaoyang District, Beijing, Tel: 010-64807355, recorded in Chinese patent application CN106367432A (the filing date: Sep. 1, 2016, and the publication date: Feb. 1, 2017), and it is confirmed via sequencing that the wild type NCgl0609 gene was retained in the chromosome of the strain] by means of allelic replacement, and thus the nucleotide sequence of NCgl0609 gene at position 1000 was changed from C to T (SEQ ID NO: 2), and the corresponding amino acid sequence encoding proteins at position 334 was changed from arginine to a terminator (SEQ ID NO: 4: NCgl0609.sup.R334*). The primers were designed as follows (synthesized by Shanghai Invitrogen Company):

TABLE-US-00020 P1: (SEQ ID NO: 5) 5′ CAGTGCCAAGCTTGCATGCCTGCAGGTCGACTCTAG GGACGGCAACGTACATAAC3′; P2: (SEQ ID NO: 6) 5′ GTTGCCGGTGAGTCAAACAGTCATTTTGC 3′; P3: (SEQ ID NO: 7) 5′ GCAAAATGACTGTTTGACTCACCGGCAAC 3′; and P4: (SEQ ID NO: 8) 5′ CAGCTATGACCATGATTACGAATTCGAGCTCGGTACCC GCGGCTG GAAATGTGGAG3′.

[0198] Construction method: Corynebacterium glutamicum ATCC13032 was used as the template, and primers P1 and P2, P3 and P4 were used, respectively, for PCR amplification. PCR System: 10×Ex Taq Buffer 5 μL, dNTP Mixture (each 2.5 mM) 4 μL, Mg.sup.2+ (25 mM) 4 μL, primers (10 pM) each 2 μL, Ex Taq(5 U/μL) 0.25 μL, total volume 50 μL. The PCR amplification was carried out as follows: pre-denaturation for 5 min at 94° C., (denaturation for 30 s at 94° C., annealing for 30 s at 52° C., extension for 40 s at 72° C., 30 cycles), and over extension for 10 min at 72° C., and then two DNA fragments containing the coding region of NCgl0609 gene in sizes of 698 bp and 648 bp respectively (NCgl0609 Up and NCgl0609 Down) were obtained. After the two DNA fragments were separated and purified via agarose gel electrophoresis, the two DNA fragments as templates were amplified into 1317 bp fragments by overlap PCR with P1 and P4 as primers.

[0199] PCR system: 10×Ex Taq Buffer 5 μL, dNTP Mixture (each 2.5 mM) 4 μL, Mg.sup.2+ (25 mM) 4 μL, primers (10 pM) each 2 μL, Ex Taq(5 U/μL) 0.25 μL, total volume 50 μL. The PCR amplification was carried out as follows: pre-denaturation for 5 min at 94° C., (denaturation for 30 s at 94° C., annealing for 30 s at 52° C., extension for 60 s at 72° C., 30 cycles), and over extension for 10 min at 72° C. This DNA fragment resulted in the change of cytosine (C) at position 1000 in the coding region of YP97158 NCgl0609 gene into thymine (T), and finally resulted in the 334th amino acid encoding the protein changed from arginine (R) to a terminator. This DNA fragment was purified via agarose gel electrophoresis, and was linked with the pK18mobsacB plasmid (purchased from Addgene company, double enzyme digested with Xbal I/BamH I, respectively) which was double enzyme digested and then purified with NEBuilder enzyme (purchased from NEB company) at 50° C. for 30 min, and a positive vector pk18-NCgl0609.sup.R334* was obtained from the monoclone grown after the transformation of the linked product by per identification, and this plasmid contained a kanamycin resistance marker. The vector pk18-NCgl0609.sup.R334* with correct enzyme digestion was sent to the sequencing company for sequencing and identification, and the vector pk18-NCgl0609.sup.R334* containing correct point mutation (C-T) was stored for use.

Example 2: Construction of an Engineered Strains of NCgl0609.SUP.R334.* Containing Point Mutation

[0200] Construction method: the allelic replacement plasmid pk18-NCgl0609.sup.R334* was transformed into L-lysine production strain YP97158 by electric shock (See WO2014121669A1 for its construction method; it is confirmed by sequencing that the coding region of wild type NCgl0609 gene is reserved in the chromosome of the strain). The single colony produced by culturing was identified by primer P1 and universal primer M13R, and the strain that can amplify bands in size of 1375 bp was a positive strain. The positive strain was cultured on the medium containing 15% sucrose, the single colony produced by culturing was cultured on the medium containing kanamycin and the medium without kanamycin, respectively, and the strains that grew on the medium without kanamycin but did not grow on the medium containing kanamycin were further identified by PCR with the following primers (synthesized by Shanghai Invitrogen Company):

TABLE-US-00021 P5: (SEQ ID NO: 9) 5′ CTAGCCGGTTCCAGTCAG 3′; and P6: (SEQ ID NO: 10) 5′ GGACGTCTGTTCACCATTG 3′.

[0201] The above PCR amplification product was 264 bp, which was denatured at 95° C. for 10 min and subjected to ice bath for 5 min followed by sscp electrophoresis (the plasmid pk18-NCgl0609.sup.R334* amplification fragment was used as the positive control, YP97158 amplification fragment was used as the negative control, and the water was used as the blank control). Due to different fragment structures and electrophoresis positions, the strains whose electrophoresis positions are different from those of negative control fragments and are consistent with those of positive control fragments are the strains with successful allelic replacement. The NCgl0609 fragment of the positive strain was subjected to PCR amplification using primer P5/P6, and was linked to PMD19-T vector for sequencing. Through sequence alignment, the strain with mutation (C-T) of base sequence was the positive strain with successful allelic replacement, and was named as YPL-4-041.

Example 3: Construction of Engineering Strains Overexpressing NCgl0609 and NCgl0609.SUP.R334.* Genes in Genome

[0202] Based on the genome sequence of wild type Corynebacterium glutamicum ATCC13032 published by NCBI, three pairs of primers for amplifying the upstream and downstream homologous arm fragments and the coding region and promoter region sequences of NCgl0609 and NCgl0609.sup.R334* gene were designed and synthesized, and NCgl0609 or NCgl0609.sup.R334* gene was introduced into strain YP97158 by way of homologous recombination.

[0203] Primers were designed as follows (synthesized by Shanghai Invitrogen Company):

TABLE-US-00022 P7: (SEQ ID NO: 11) 5′ CAGTGCCAAGCTTGCATGCCTGCAGGTCGACTCTAG AATGCGTTCTG GACTGAGG 3′; P8: (SEQ ID NO: 12) 5′ CAGTGCCAAGCTTGCATGCCTGCAGGTCGACTCTAG AATGCGTTCTG GACTGAGG 3′; P9: (SEQ ID NO: 13) 5′ CATCTGTTCTCGGTGCACCAGCTGCGAGGATCATC TC 3′; P10: (SEQ ID NO: 14) 5′ GATTTAATTGCGCCATCTGATTCTGGCAACAACTC CTTCCTTGACC 3′; P11: (SEQ ID NO: 15) 5′ GGTCAAGGAAGGAGTTGTTGCCAGAATCAGATGGC GCAATTA AATC AAG 3′; and P12: (SEQ ID NO: 16) 5′ CAGCTATGACCATGATTACGAATTCGAGCTCGGT ACCCGCTATGACACCTTCAACGGATC 3′.

[0204] Construction method: Corynebacterium glutamicum ATCC13032 or YPL-4-041 was used as template, respectively, for PCR amplification with primers P7/P8, P9/P10, P11/P12, to obtain the upstream homologous arm fragment of 768 bp, NCgl0609 or NCgl0609.sup.R334* gene and its promoter fragment of 1626 bp and the downstream homologous arm fragment of 623 bp. After the completion of PCR reaction, the three amplified fragments were electrophoretically recovered using a column DNA gel recovery kit, respectively. The recovered three fragments were linked with the pK18mobsacB plasmid (purchased from Addgene Company, double enzyme digested with Xbal I/BamH I, respectively) which was double enzyme digested and then purified with NEBuilder enzyme (purchased from NEB Company) at 50° C. for 30 minutes, and a positive integrated plasmid was obtained from the monoclone grown after the transformation of the linked product by per identification. This plasmid contained a kanamycin resistance marker, and the recombinant with plasmid integrated into the genome can be obtained through kanamycin screening.

[0205] PCR system: 10×Ex Taq Buffer 5 μL, dNTP Mixture (each 2.5 mM) 4 μL, Mg.sup.2+ (25 mM) 4 μL, primers (10 pM) each 2 μL, Ex Taq(5 U/μL) 0.25 μL, total volume 50 μL. The PCR amplification was carried out as follows: pre-denaturation for 5 min at 94° C., denaturation for 30 s at 94° C., annealing for 30 s at 52° C., extension for 60 s at 72° C. (30 cycles), and over extension for 10 min at 72° C. The correctly sequenced integrated plasmid was electrotransformed into the L-lysine production strain YP97158. The single colony produced by culturing was identified by PCR with primers P13/P14. The strain that amplified fragment with 1317 bp by PCR was a positive strain, and the strain without fragment by amplified was original strain. The positive strain was cultured on the medium containing 15% sucrose, and the single colony produced by culturing was further identified by PCR with primers P15/P16. The bacteria amplifying fragment of 1352 bp were positive strains with NCgl0609 or NCgl0609.sup.R334* gene integrated into the YP97158 genome, which were named YPL-4-042 (without mutation site) and YPL-4-043 (with mutation site).

TABLE-US-00023 P13: (SEQ ID NO: 17) 5′ TCCAAGGAAGATACACGCC 3′; P14: (SEQ ID NO: 18) 5′ CGAAATGGAAGTTGTGCG 3′; P15: (SEQ ID NO: 19) 5′ CGATGATGCCGATTACCTC 3′; P16: (SEQ ID NO: 20) 5′ CGTTGGAATCTTGCGTTG 3′.

Example 4: Construction of Engineering Strains Overexpressing NCgl0609 or NCgl0609.SUP.R334.*Genes in Plasmid

[0206] Based on the genome sequence of wild type Corynebacterium glutamicum ATCC13032 published by NCBI, a pair of primers for amplifying the coding region and promoter region sequences of NCgl0609 or NCgl0609.sup.R334* gene were designed and synthesized. The primers were designed as follows (synthesized by Shanghai Invitrogen Company):

TABLE-US-00024 P17: (SEQ ID NO: 21) 5′GCTTGCATGCCTGCAGGTCGACTCTAGAGGATCCCC CAGCTGCGAGG A TCATCTC 3′; and P18: (SEQ ID NO: 22) 5′ATCAGGCTGAAAATCTTCTCTCATCCGCCAAAAC CAACAACTCCTTCCTTGACC3′.

[0207] Construction method: Corynebacterium glutamicum ATCC13032 and YPL-4-041 were used as template, respectively, for PCR amplification with primers P17/P18 to obtain NCgl0609 and NCgl0609.sup.R334* genes and their promoter fragments of 1582 bp. The amplified products were subjected to electrophoresis and purified using a column DNA gel recovery kit. The recovered DNA fragment and a shuttle plasmid pXMJ19 recovered by EcoR I enzyme digestion were linked at 50° C. with NEBuilder enzyme (purchased from NEB) for 30 min, and the positive overexpression plasmids pXMJ19-NCgl0609 and pXMJ19-NCgl0609.sup.R334* were obtained from the monoclones grown after the transformation of the linker products by per identification with primer M13, and then these plasmids were sent to sequencing. Because the plasmid contained a chloramphenicol resistance marker, chloramphenicol can be used to screen whether the plasmid was transformed into the strain.

[0208] PCR system: 10×Ex Taq Buffer 5 μL, dNTP Mixture (each 2.5 mM) 4 μL, Mg.sup.2+ (25 mM) 4 μL, primers (10 pM) each 2 μL, Ex Taq(5 U/μL) 0.25 μL, total volume 50 μL. The PCR amplification was carried out as follows: pre-denaturation for 5 min at 94° C., denaturation for 30 s at 94° C., annealing for 30 s at 52° C., extension for 60 s at 72° C. (30 cycles), and over extension for 10 min at 72° C.

[0209] The correctly sequenced pXMJ19-NCgl0609 and pXMJ19-NCgl0609.sup.R334* plasmids were electrotransformed into the L-lysine production strain YP97158, respectively. The single colony produced by culturing was identified by PCR with primers M13F/P18. The strains amplifying fragment with 1585 bp by PCR were positive strains, which was named YPL-4-044 (without mutation site) and YPL-4-045 (with mutation site).

Example 5: Construction of Engineered Strains with NCgl0609 Gene Deleted in Genome

[0210] Based on the genome sequence of Corynebacterium glutamicum ATCC13032 published by NCBI, two pairs of primers for amplifying the fragments at two ends of the coding region of NCgl0609 gene were designed and synthesized, as upstream and downstream homologous arm fragments The primers were designed as follows (synthesized by Shanghai Invitrogen Company):

TABLE-US-00025 P19: (SEQ ID NO: 23) 5′ CAGTGCCAAGCTTGCATGCCTGCAGGTCGACTCTAG AATGAA TGG GATGGGTCG 3′; and P20: (SEQ ID NO: 24) 5′ CATCATCGGTTACTCTGGCCGAAATGGAAGTTGTGCG 3′; P21: (SEQ ID NO: 25) 5′ CGCACAACTTCCATTTCGGCCAGAGTAACCGATGATG 3′; P22: (SEQ ID NO: 26) 5′CAGCTATGACCATGATTACGAATTCGAGCTCGGTACCC TCAACAACTCCTCCTTGACC3′.

[0211] Construction method: Corynebacterium glutamicum ATCC13032 was used as template for PCR amplification with primers P19/P20 and P21/P22, respectively, to obtain upstream homologous arm fragment of 661 bp and downstream homologous arm fragment of 692 bp. Then primers P19/P22 were used for OVERLAP PCR to obtain the whole homologous arm fragment of 1334 bp. The amplified products were subjected to electrophoresis and purified using a column DNA gel recovery kit. The recovered DNA fragments were linked with the pK18mobsacB plasmid (purchased from Addgene Company, double enzyme digested with Xbal I/BamH I, respectively) which were double enzyme digested and then purified with NEBuilder enzyme (purchased from NEB Company) at 50° C. for 30 minutes. Positive knockout vector pK18-ΔNCgl0609 were obtained from the monoclones grown after the transformation of the linker products by per identification with primer M13, and then these plasmids were sent to sequencing. The plasmid contained kanamycin resistance as a screening marker.

[0212] PCR system: 10×Ex Taq Buffer 5 μL, dNTP Mixture (each 2.5 mM) 4 μL, Mg.sup.2+ (25 mM) 4 μL, primers (10 pM) each 2 μL, Ex Taq(5 U/μL) 0.25 μL, total volume 50 μL.

[0213] The PCR amplification was carried out as follows: pre-denaturation for 5 min at 94° C., denaturation for 30 s at 94° C., annealing for 30 s at 52° C., extension for 90 s at 72° C. (30 cycles), and over extension for 10 min at 72° C.

[0214] The correctly sequenced knockout plasmid pK18-ΔNCgl0609 was electrotransformed into lysine producing strain YP97158, and the single colony produced by culturing was identified by PCR with the following primers (synthesized by Shanghai Invitrogen Company):

TABLE-US-00026 P23: (SEQ ID NO: 27) 5′ AATGAATGG GATGGGTCG 3′; and P24: (SEQ ID NO: 28) 5′ CAACAACT CCT TCCTTGACC 3′.

[0215] The strains simultaneously amplifying 1334 bp and 1788 bp bands by the above PCR were positive strains, and the strains only amplifying 1788 bp band were original strains. After screening on the 15% sucrose medium, the positive strains were cultured on the medium containing kanamycin and the medium without kanamycin, respectively. The strains that grew on the medium without kanamycin but did not grow on the medium containing kanamycin were further identified by PCR using primers P23/P24. The strains amplifying 1334 bp band were the positive strains whose NCgl0609 gene coding region was knocked out. Again, the positive strain NCgl0609 fragment was PCR amplified with primers P23/P24 and linked to PMD19-T vector for sequencing. The correctly sequenced strain was named YPL-4-046.

Example 6: L-Lysine Fermentation Experiment

[0216] The strains constructed from Examples 2-5 and the original strain YP97158 were performed a fermentation experiment in the BLBIO-5GC-4-H fermentation tank (purchased from Shanghai Bailun Biotechnology Co., Ltd.) with the culture medium shown in Table 1 and the control process shown in Table 2. Each strain was repeated three times, and the results are shown in Table 5.

TABLE-US-00027 TABLE 5 Results of L-lysine fermentation experiment Strains L-Lysine production (g/100 ml) OD(660 nm) YP97158 18.9 37.3 YPL-4-041 19.3 38.1 YPL-4-042 19.2 37.8 YPL-4-043 19.5 38.4 YPL-4-044 19.4 37.7 YPL-4-045 19.7 38.3 YPL-4-046 18.0 36.8

[0217] The results are as shown in Table 5. Point mutation NCgl0609.sup.R334* and overexpression of NCgl0609 gene coding region in Corynebacterium glutamicum contribute to the increase of L-lysine production and growth rate, while weakening or knocking out the gene is not conducive to the accumulation of L-lysine, and will reduce the growth rate of the strain.

Example 7: Introduction of NCgl0609 Gene Overexpression in Glutamate Production Strain, or Point

[0218] mutation NCgl0609.sup.R334* and overexpression in the coding region of NCgl0609 gene, and preformation of fermentation experiments

[0219] According to the methods of Examples 1-5, using the same primers and experimental conditions, Corynebacterium ATCC13869 was used as the starting bacterium, and the bacterium of ATCC 13869 was used as expression bacterium to obtain the glutamate production engineering strains YPG-013 containing point mutated NCgl0609.sup.R334*, the glutamate production engineering strains YPG-014 and YPG-015 overexpressing NCgl0609 and NCgl0609.sup.R334* genes in the genome, the glutamate production engineering strains YPG-016 and YPG-017 overexpressing NCgl0609 and NCgl0609.sup.R334* genes in the plasmid, and the glutamate production engineering strain YPG-018 that lacks NCgl0609 gene in the genome.

[0220] The strains constructed in Examples and the original strain were performed a fermentation experiment (with bacterium of ATCC 13869 as expression bacterium) in the BLBIO-5GC-4-H fermentation tank (purchased from Shanghai Bailun Biotechnology Co., Ltd.) with the culture medium shown in Table 3 and the control process shown in Table 4. Each strain was repeated three times, and the results are shown in Table 6.

TABLE-US-00028 TABLE 6 Results of L-glutamate fermentation experiment Strains L-glutamate production (g/l) OD(660 nm) ATCC13869 101.0 42.3 YPG-013 103.5 43.4 YPG-014 103.9 42.8 YPG-015 103.2 43.7 YPG-016 103.6 42.6 YPG-017 103.8 43.6 YPG-018 98.5 40.5

[0221] The results are as shown in Table 6. Point mutation NCgl0609.sup.R334* and overexpression of NCgl0609 gene coding region in Corynebacterium glutamicum contribute to the increase of L-glutamate production and growth rate, while weakening or knocking out the gene is not conducive to the accumulation of L-glutamic acid, and will reduce the growth rate of the strain.

Example 8: Construction of Transformation Vector pK18-NCgl1575.SUP.A1775T .Containing the Coding Region of NCgl1575 Gene with Point Mutation

[0222] Based on the genome sequence of wild type Corynebacterium glutamicum ATCC13032 published by NCBI, two pairs of primers for amplifying the coding region sequence of NCgl1575 gene were designed and synthesized. Point mutation was introduced into the coding region of NCgl1575 gene (SEQ ID NO:29) in the background of strain YP97158 (it was confirmed by sequencing that wild type NCgl1575 gene was retained in the chromosome of the strain) by means of allelic replacement.

[0223] The corresponding amino acid sequence encoding the proteins was SEQ ID NO:31, and the nucleotide sequence of NCgl1575 gene at position 1775 was changed from A to T (SEQ ID NO:30: NCgl1575.sup.A1775T) and in the corresponding amino acid sequence encoding the proteins at position 592 was changed from tyrosine to phenylalanine (SEQ ID NO:32: NCgl1575 Y592F).

[0224] Primers were designed as follows (synthesized by Shanghai Invitrogen Company):

TABLE-US-00029 P1′: (SEQ ID NO: 33) 5′CAGTGCCAAGCTTGCATGCCTGCAGGTCGACTCTAG TGCGTTCGTCTGCGGTTTCG 3′; P2′: (SEQ ID NO: 34) 5′ ATCGACGCCGCCCCATTCACCCTTCTGATG 3′; P3′: (SEQ ID NO: 35) 5′ CATCAGAAGGGTGAATGGGGCGGCGTCGAT 3′; and P4′: (SEQ ID NO: 36) 5′CAGCTATGACCATGATTACGAATTCGAGCTCGGTACCC AAGCCTCGACCCCTACATC 3′.

[0225] Construction method: Corynebacterium glutamicum ATCC13032 was used as template for PCR amplification with primers P1′ and P2′, P3′ and P4′, respectively.

[0226] PCR system: 10×Ex Taq Buffer 5 μL, dNTP Mixture (each 2.5 mM) 4 μL, Mg.sup.2+ (25 mM) 4 μL, primers (10 pM) each 2 μL, Ex Taq(5 U/μL) 0.25 μL, total volume 50 μL.

[0227] The PCR amplification was carried out as follows: pre-denaturation for 5 min at 94° C., denaturation for 30 s at 94° C., annealing for 30 s at 52° C., extension for 40 s at 72° C. (30 cycles), and over extension for 10 min at 72° C. Two DNA fragments containing NCgl1575 gene coding region in sizes of 766 bp and 759 bp, respectively, were obtained (NCgl1575 Up and NCgl1575 Down).

[0228] After separation and purification of the above two DNA fragments by agarose gel electrophoresis, the above two DNA fragments were used as templates, and P1′ and P4′ were used as primers, to amplify a fragment in length of about 1495 bp by overlap PCR.

[0229] PCR system: 10×Ex Taq Buffer 5 μL, dNTP Mixture (each 2.5 mM) 4 μL, Mg.sup.2+ (25 mM) 4 μL, primers (10 pM) each 2 μL, Ex Taq(5 U/μL) 0.25 μL, total volume 50 μL.

[0230] The PCR amplification was carried out as follows: pre-denaturation for 5 min at 94° C., denaturation for 30 s at 94° C., annealing for 30 s at 52° C., extension for 90 s at 72° C. (30 cycles), and over extension for 10 min at 72° C.

[0231] This DNA fragment (NCgl1575.sup.A1775T) resulted in the change of adenine (A) at position 1775 in the coding region of YP97158 NCgl1575 gene into thymine (T), and finally resulted in the change of amino acid at position 592 of the coding protein from tyrosine (Y) to phenylalanine (F).

[0232] The NCgl1575.sup.A1775T separated and purified by agarose gel electrophoresis and the pK18mobsacB plasmid (purchased from Addgene) recovered by Xba I enzyme digestion were assembled with the NEBuider recombination system to obtain vector pK18-NCgl1575.sup.A1775T, and the plasmid contained a kanamycin resistance marker. The vector pK18-NCgl1575.sup.A1775T was sent to the sequencing company for sequencing and identification, and the vector pK18-NCgl1575.sup.A1775T containing the correct point mutation (A-T) was stored for use.

Example 9: Construction of Engineering Strains Containing NCgl1575.SUP.A1775T .with Point Mutation

[0233] Construction method: The allelic replacement plasmid pK18-NCgl1575.sup.A1775T was transformed into L-lysine production strain YP97158 by electric shock. The single colony produced by culturing was identified by primer P1′ and universal primer M13R, respectively. The strain that can amplify 1502 bp band was a positive strain. The positive strains were cultured on the medium containing 15% sucrose, and the single colony produced by culturing was cultured on the medium containing kanamycin and the medium without kanamycin, respectively. The strains that grew on the medium without kanamycin, but did not grow on the medium containing kanamycin were further identified by PCR with the following primers (synthesized by Shanghai Invitrogen Company):

TABLE-US-00030 P5′: (SEQ ID NO: 37) 5′ CACATC AGCTTGATTT CTGC 3′; and P6′: (SEQ ID NO: 38) 5′ GGTCATTGCC GATGAAGCCC 3′.

[0234] The above PCR amplification product was 256 bp, which was denatured at high temperature and subjected to ice bath, followed by sscp electrophoresis (the plasmid pK18-NCgl1575.sup.A1775T amplification fragment was used as the positive control, YP97158 amplification fragment was used as the negative control, and the water was used as the blank control). Due to different fragment structures and electrophoresis positions, the strains whose electrophoresis positions are different from those of negative control fragments and are consistent with those of positive control fragments are the strains with successful allelic replacement. The fragment of interest of the strains with successful allelic replacement was subjected to PCR amplification using primer P5′ and P6′ again, and was linked to PMD19-T vector for sequencing. Through sequence alignment, the sequence in which base sequence is mutated verifies that the allelic replacement of the strain is successful, and it is named YPL-4-023.

Example 10: Construction of Engineering Strains Overexpressing NCgl1575 or NCgl1575.SUP.A1775T .Gene in Genome

[0235] Based on the genome sequence of wild type Corynebacterium glutamicum ATCC13032 published by NCBI, three pairs of primers for amplifying the upstream and downstream homologous arm fragments and the sequences of NCgl1575 or NCgl1575.sup.A1775T gene coding region and promoter region were designed and synthesized, and NCgl1575 or NCgl1575.sup.A1775T gene was introduced into strain YP97158 by homologous recombination.

[0236] Primer was designed as follows (synthesized by Shanghai Invitrogen Company):

TABLE-US-00031 P7′: (SEQ ID NO: 39) 5′ CAGTGCCAAGCTTGCATGCCTGCAGGTCGACTCTAGAATG CGTTCTGGACTGAGG 3′; P8′: (SEQ ID NO: 40) 5′ GAAACGGCCTTAAGCTAGGTGCACCGAG AACAGATG 3′; P9′: (SEQ ID NO: 41) 5′ CATCTGTTCTCGGTGCAC CTAGCTTAAG GCCGTTTC 3′; P10′: (SEQ ID NO: 42) 5′ CTTGATTTAATTGCGCCATCAAGCTTTTCC CGCCCGGTT 3′; P11′: (SEQ ID NO: 43) 5′ AACCGGGCGG GAAAAGCTTGATGGCGCAATTAAATCAAG 3′; and P12′: (SEQ ID NO: 44) 5′CAGCTATGACCATGATTACGAATTCGAGCTCGGTACCC GCTAT GACACCTTCAACGGATC 3′.

[0237] Construction method: Corynebacterium glutamicum ATCC13032 or YPL-4-023 was used as templates, respectively, for PCR amplification with primers P7′/P8′, P9′/P10′, P11′/P12′, to obtain upstream homologous arm fragment of 802 bp, NCgl1575 gene and its promoter fragment of 2737 bp, or NCgl1575.sup.A1775T gene and its promoter fragment of 2737 bp, and downstream homologous arm fragment of 647 bp. Then, the above three amplified fragments (upstream homologous arm fragment, NCgl1575 gene and its promoter fragment, and downstream homologous arm fragment; or upstream homologous arm fragment, NCgl1575.sup.A1775T gene and its promoter fragment, and downstream homologous arm fragment) were mixed as template for amplification with primers P7′/P12′ to obtain integrated homologous arm fragment of 4111 bp.

[0238] After the completion of PCR reaction, the amplified product is electrophoretically recovered, and the 4111 bp DNA fragment required was recovered with a column DNA gel recovery kit (TIANGEN), and was linked with the shuttle plasmid PK18mobsacB recovered by Xba I enzyme digestion using NEBBuider recombination system, to obtain the integrated plasmid PK18mobsacB-NCgl1575 or PK18mobsacB-NCgl1575.sup.A1775T. The plasmid contained a kanamycin resistance marker, and the recombinant with plasmid integrated into the genome can be obtained through kanamycin screening.

[0239] PCR system: 10×Ex Taq Buffer 5 μL, dNTP Mixture (each 2.5 mM) 4 μL, Mg.sup.2+ (25 mM) 4 μL, primers (10 pM) each 2 μL, Ex Taq(5 U/μL) 0.25 μL, total volume 50 μL.

[0240] The PCR amplification was carried out as follows: pre-denaturation for 5 min at 94° C., denaturation for 30 s at 94° C., annealing for 30 s at 52° C., extension for 180 s at 72° C. (30 cycles), and over extension for 10 min at 72° C.

[0241] The two integrated plasmids were electrotransformed into the L-lysine production strain YP97158, respectively, and the single colony produced by culturing was identified by PCR with primers P13′/P14′. The strain amplifying fragments in size of 1778 bp by PCR was a positive strain, and the strain without fragments amplified was an original strain. The positive strains were screened on 15% sucrose medium and then cultured on the medium containing kanamycin and the medium without kanamycin, respectively. The strains that grew on the medium without kanamycin, but did not grow on the medium containing kanamycin were further identified by PCR with primers P15′/P16′. The bacteria amplifying fragment in size of 1756 bp were strains with NCgl1575 or NCgl1575.sup.A1775T gene integrated into the YP97158 genome, which were named YPL-4-024 (without mutation site) and YPL-4-025 (with mutation site), respectively.

TABLE-US-00032 P13′: (SEQ ID NO: 45) 5′ TCCAAGGAAGATACACGCC 3′; P14′: (SEQ ID NO: 46) 5′ CTTCTGATGA CCGGCACACC 3′; P15′: (SEQ ID NO: 47) 5′ TAGTCGATGA CGCGGGTGCG 3′; and P16′: (SEQ ID NO: 48) 5′ CGTTGGAATCTTGCGTTG 3′.

Example 11: Construction of Engineering Strains Overexpressing NCgl1575 or NCgl1575.SUP.A1775T .Gene on Plasmid

[0242] Based on the genome sequence of wild type Corynebacterium glutamicum ATCC13032 published by NCBI, a pair of primers for amplifying the coding region and promoter region sequences of NCgl1575 or NCgl1575.sup.A1775T gene were designed and synthesized. The primers were design as follows (synthesized by Shanghai Invitrogen Company):

TABLE-US-00033 P17′: (SEQ ID NO: 49) 5′GCTTGCATGCCTGCAGGTCGACTCTAGAGGATCCCC CTAGCT TAAG GCCGTTTC 3′; and P18′: (SEQ ID NO: 50) 5′ATCAGGCTGAAAATCTTCTCTCATCCGCCAAAAC AAGCTTT TCC CGCCCGGTT 3′

[0243] Construction method: ATCC13032 and YPL-4-023 were used as templates, respectively, for PCR amplification with primers P17′/P18′, to obtain NCgl1575 or NCgl1575.sup.A1775T gene and their promotor fragments of 2749 bp. The amplified products were recovered by electrophoresis. The desired 2749 bp DNA fragments were recovered by a column DNA gel recovery kit, and were linked with the shuttle plasmid pXMJ19 recovered by EcoR I enzyme digestion using the NEBuider recombination system to obtain the overexpression plasmids pXMJ19-NCgl1575 and pXMJ19-NCgl1575.sup.A1775T. Plasmids containing chloramphenicol resistance markers can be obtained through chloramphenicol screening and transformed into strains.

[0244] PCR system: 10×Ex Taq Buffer 5 μL, dNTP Mixture (each 2.5 mM) 4 μL, Mg.sup.2+ (25 mM) 4 μL, primers (10 pM) each 2 μL, Ex Taq(5 U/μL) 0.25 μL, total volume 50 μL.

[0245] The PCR amplification was carried out as follows: pre-denaturation for 5 min at 94° C., denaturation for 30 s at 94° C., annealing for 30 s at 52° C., extension for 120 s at 72° C. (30 cycles), and over extension for 10 min at 72° C.

[0246] The plasmids pXMJ19-NCgl1575 and pXMJ19-NCgl1575.sup.A1775T were electrotransformed into the L-lysine production strain YP97158, respectively. The single colony produced by culturing was identified by PCR with primers M13 (−48) and P18′. The single colony amplifying fragment in size of 2752 bp by PCR was transformed strains which were named YPL-4-026 (without mutation site) and YPL-4-027 (with mutation site).

Example 12: Construction of Engineering Strains with NCgl1575 Gene Deleted in Genome

[0247] Based on the genome sequence of Corynebacterium glutamicum ATCC13032 published by NCBI, two pairs of primers for amplifying fragments at two ends of the coding region of NCgl1575 gene were synthesized as upstream and downstream homologous arm fragments. Primers were design as follows (synthesized by Shanghai Invitrogen Company):

TABLE-US-00034 P19′: (SEQ ID NO: 51) 5′CAGTGCCAAGCTTGCATGCCTGCAGGTCGACTCTAGACCG GCGCAG ATGCCAACGC 3′; P20′: (SEQ ID NO: 52) CCCAGAACTGAAGGTCTAATTGCCTAAGG CCGGAATT 3′; P21′: (SEQ ID NO: 53) AATTCCGGCCTTAGGCAATTAGACCTTC AGTTCTGGG 3′; and P22′: (SEQ ID NO: 54) 5′ CAGCTATGACCATGATTACGAATTCGAGCTCGGTACCC GCT TGATGAA GGCTCCAG 3′.

[0248] Corynebacterium glutamicum ATCC13032 was used as a template for PCR amplification with primers P19′/P20′ and P21′/P22′, respectively, so as to obtain upstream homologous arm fragment of 775 bp and downstream homologous arm fragments of 807 bp. Then, they were subjected to overlap PCR with primers P19′/P22′ to obtain a whole homologous arm fragment of 1545 bp. After the completion of PCR reaction, the amplified product was electrophoretically recovered, and the desired 1545 bp DNA fragment was recovered using a column DNA gel recovery kit, and was linked with shuttle plasmid pk18mobsacB recovered by Xba I enzyme digestion through the NEbuider recombination system to obtain knockout plasmid. The plasmid contained a kanamycin resistant marker.

[0249] The knockout plasmid was electrotransformed into a lysine producing strain YP97158, and the single colony produced by culturing was identified by PCR with the following primers (synthesized by Shanghai Invitrogen Company):

TABLE-US-00035 P23′: (SEQ ID NO: 55) 5′ ACCGGCGCAG ATGCCAACGC 3′; and P24′: (SEQ ID NO: 56) 5′ GCTTGATGAA GGCTCCAG 3′.

[0250] The strains amplifying bands in size of 1471 bp and 4150 bp by above PCR were positive strains, and the strains only amplifying a band in size of 4150 were original bacteria. After screening on 15% sucrose medium, the positive strains were cultured on the medium containing kanamycin and the medium without kanamycin, respectively, and the strains that grew on the medium without kanamycin but did not grow on the medium containing kanamycin were further identified by PCR using primers P23′/P24′. The strain amplifying a band in size of 1471 bp was the engineering strain with the coding sequence of NCgl1575 gene deleted, which was named YPL-4-028.

Example 13: L-Lysine Fermentation Experiment

[0251] The strains constructed from Examples 9-12 and the original strain YP97158 were performed a fermentation experiment in the BLBIO-5GC-4-H fermentation tank (purchased from Shanghai Bailun Biotechnology Co., Ltd.) with the culture medium shown in Table 1 and the control process shown in Table 2. Each strain was repeated three times, and the results are shown in Table 7.

TABLE-US-00036 TABLE 7 Results of L-Lysine fermentation experiment Strains L-lysine production (g/100 ml) OD(660 nm) YP97158 18.8 37.3 YPL-4-023 19.6 36.8 YPL-4-024 19.6 37.0 YPL-4-025 19.8 35.5 YPL-4-026 19.3 36.3 YPL-4-027 19.7 37.2 YPL-4-028 18.0 36.8

[0252] The results are as shown in Table 7. Overexpression of NCgl1575 gene in Corynebacterium glutamicum, or point mutation NCgl1575.sup.A1775T and overexpression of NCgl1575 gene coding region are conducive to the increase of L-lysine production, while weakening or knocking out the gene is not conducive to the accumulation of L-lysine.

Example 14: Construction of a Transformation Vector pK18-PlysC.SUP.(G(−45)A,G(−47)T) .Containing the Promoter Region of lysC Gene with Point Mutation

[0253] Based on the genome sequence of Corynebacterium glutamicum ATCC13032 published by NCBI, two pairs of primers for amplifying the sequences of lysC gene promoter region were designed and synthesized, and point mutation was introduced into the lysC gene promoter region (SEQ ID NO: 57) in the background of strain YP97158 by means of allelic replacement. The G at position −45 bp of lysC gene promoter region nucleotide sequence was changed to A, and the G at position −47 bp was changed to T (SEQ ID NO: 58).

[0254] Primers were designed as follows (synthesized by Shanghai Invitrogen Company):

TABLE-US-00037 P1″: (SEQ ID NO: 59) 5′ CCGGAATTCG ACCAAGGATG AGGGCTTTG 3′; (EcoR I) P2″: (SEQ ID NO: 60) 5′ AGTTACCCGC TCAATTATAC CTTTATAAAC 3′; P3″: (SEQ ID NO: 61) 5′ GTTTATAAAG GTATAATTGAGCGGGTAACT 3′; and P4″: (SEQ ID NO: 62) 5′ ACATGCATGCGCGTACGCGAAGTGGCACAT 3′. (Sph I)

[0255] Construction method: Corynebacterium glutamicum ATCC13032 was used as a template for PCR amplification with primers P1″ and P2″, P3″ and P4″, respectively. PCR system: 10×Ex Taq Buffer 5 μL, dNTP Mixture (each 2.5 mM) 4 μL, Mg.sup.2+ (25 mM) 4 μL, primers (10 pM) each 2 μL, Ex Taq(5 U/μL) 0.25 μL, total volume 50 μL. The PCR amplification was carried out as follows: pre-denaturation for 5 min at 94° C., denaturation for 30 s at 94° C., annealing for 30 s at 52° C., extension for 40 s at 72° C. (30 cycles), and over extension for 10 min at 72° C. Two DNA fragments with point mutation in size of 729 bp and 760 bp, respectively, were obtained (lysC promotor Up and lysC promotor Down fragments). After the above two DNA fragments were separated and purified by agarose gel electrophoresis, the purified two DNA fragments were used as templates, and P1″ and P4″ were used as primers to amplify a fragment with a length of about 1459 bp (Up Down fragment) by Overlap PCR. PCR system: 10×Ex Taq Buffer 5 μL, dNTP Mixture (each 2.5 mM) 4 μL, Mg.sup.2+ (25 mM) 4 μL, primers (10 pM) each 2 μL, Ex Taq(5 U/μL) 0.25 μL, total volume 50 μL. The PCR amplification was carried out as follows: pre-denaturation for 5 min at 94° C., denaturation for 30 s at 94° C., annealing for 30 s at 52° C., extension for 90 s at 72° C. (30 cycles), and over extension for 10 min at 72° C. The above Up-Down fragment was separated and purified by agarose gel electrophoresis, and the fragment contained lysC gene promoter region and its upstream and downstream sequences, and both ends of the fragment contained EcoR I and Sph I enzyme digestion sites, respectively. This DNA fragment causes the change of nucleotide guanine (G) at position −45 bp in the promoter region of YP97158 lysC gene to adenine (A), and the nucleotide guanine (G) at position −47 bp to thymine (T). The fragment was purified and recovered after double enzyme digestion (EcoR I/Sph I), and was linked with the shuttle plasmid pK18mobsacB (purchased from Addgene) after the same double enzyme digestion (EcoR I/Sph I) to obtain an allelic replacement plasmid pK18-PlysC.sup.(G(−45)A,G(−47)T), which contained a Kanamycin resistance marker. The vector pK18-PlysC.sup.(G(−45)A,G(−47)T) was sent to the sequencing company for sequencing and identification, and the vector pK18-PlysC.sup.(G(−45)A,G(−47)T) containing the correct point mutation was stored for use.

Example 15: Construction of Engineering Strains Containing PlysC.SUP.(G(−45)A,G(−47)T) .with Point Mutation

[0256] The allelic replacement plasmid pK18-PlysC.sup.(G(−45)A,G(−47)T) was transformed into L-lysine production strain YP97158 by electric shock. The single colony produced by culturing was identified by primer P1″ and universal primer M13F, respectively, and the strains that can amplify a band in size of 1500 bp were positive strains. The positive strains were cultured on the medium containing 15% sucrose, and the single colony produced by culturing was cultured on the medium containing kanamycin and the medium without kanamycin, respectively; the strains that grew on the medium without kanamycin but did not grow on the medium containing kanamycin were further identified by PCR using the following primers (synthesized by Shanghai Invitrogen Company):

TABLE-US-00038 P5″: (SEQ ID NO: 63) 5′ ATCAATATATGGTCTGTTTA 3′; and P6″: (SEQ ID NO: 64) 5′ CTTGGTGGCAACGATCCGTT 3′

[0257] The above PCR amplification product was denatured at high temperature and subjected to ice bath followed by sscp electrophoresis (the plasmid pK18-PlysC.sup.(G(−45)A,G(−47)T) amplification fragment was used as the positive control, YP97158 amplification fragment was used as the negative control, and the water was used as the blank control). Due to different fragment structures and electrophoresis positions, the strains whose electrophoresis positions are different from those of negative control fragments and are consistent with those of positive control fragments are the strains with successful allelic replacement. The target fragment of the positive strain was amplified by PCR again, and linked to the PMD19-T vector for sequencing. Through sequence alignment, the sequence in which base sequence is mutated verifies that the allelic replacement of the strain is successful, and it is named YPL-4-009.

Example 16: L-Lysine Fermentation Experiment

[0258] The strain YPL-4-009 constructed in Example 15 and the original strain YP97158 were performed a fermentation experiment in the BLBIO-5GC-4-H fermentation tank (purchased from Shanghai Bailun Biotechnology Co., Ltd.) with the culture medium shown in Table 1 and the control process shown in Table 2. Each strain was repeated three times, and the results are shown in Table 8.

TABLE-US-00039 TABLE 8 L-Lysine fermentation experiment results L-Lysine production Conversion Strains (g/100 ml) rate (%) YP97158 batch 1 18.7 64.1 batch 2 18.8 64.0 batch 3 18.8 63.7 mean 18.8 63.9 YPL-4-009 batch 1 21.0 64.7 batch 2 20.9 64.6 batch 3 20.9 64.7 mean 20.9 64.7 increased folds 11.17% 1.25% The above conversion rate = total mass of lysine/total consumption of glucose *100%

[0259] The results are shown in Table 8. The point mutation PlysC.sup.(G(−45)A,G(−47)T) of lysC gene promoter in Corynebacterium glutamicum is contributive to the increase of the L-lysine production.

[0260] The embodiment of the invention has been described above. However, the present invention is not limited to the above embodiments. Any modification, equivalent replacement, improvement, etc. made within the spirit and principle of the invention shall be included in the protection scope of the invention.