POROUS RESIN USED TO SOLID PHASE SYNTHESSIS AND PREPARATION METHOD THEREFOR

Abstract

A porous resin used to solid phase synthesis and a preparation method therefor, specifically being a porous resin having functional groups being an amino group or a hydroxyl group and a preparation method therefor. Using an olefin compound containing two cyano groups as a modified monomer, using a high internal phase emulsion as a pore-foaming agent, and performing suspension polymerization to prepare the porous resin. And then functionalizing the porous resin to obtain the porous resin having functional groups being an amino group or a hydroxyl group. Different from the existing preparation method, the modified monomer can make the distribution of the functional groups more uniform, and make the swelling degrees of the porous resin in different solvents close. The high internal phase emulsion pore-foaming agent can make the pore size distribution of the carrier narrower. The porous resin can be used as a solid phase synthesis carrier to prepare an oligonucleotide, and the use of the carrier is beneficial for improving the yield and purity of the oligonucleotide.

Claims

1. A porous resin for solid phase synthesis, wherein the porous resin has a polymer skeleton with functional groups which is represented by the following formula: ##STR00005## wherein, R1=—C— or —C—CH2—, R2=—OH, —CH2OH, —NH2, —CH2NH2, —CH2OOC—C6H4—OH, —CH2OOCCH2—C6H4—OH, —(CH2)4OOC—C6H4—OH, —(CH2)4OOCCH2—C6H4—OH, —COONH—C6H4—NH2, —CH2COONH—C6H4—NH2, —COO—C6H4—OH or —CH2COO—C6H4—OH; and R3=—H; or CH3(CH2)n—, n is an integer of 0-4; or(CH3)2CH(CH2)n, n is an integer of 0-2; or (CH3)3C—; or CH3CH2CH(CH3)—; or CH3CH2C(CH3)2—; or CH3CH2CH2CH(CH3)—; or CH3(CH2)n—O—, n is an integer of 0-4.

2. The porous resin for solid phase synthesis according to claim 1, wherein the porous resin has a content of hydroxyl group or amino group of 100-1000 μmmol/g, preferably, 400-700 μmmol/g.

3. (canceled)

4. The porous resin for solid phase synthesis according to claim 1, wherein the porous resin has a particle size in a range of 35-200 μm, preferably, 50-100 μm.

5. (canceled)

6. The porous resin for solid phase synthesis according to claim 1, wherein the porous resin has an average pore diameter of 10-200 nm, preferably, 40-100 nm.

7. (canceled)

8. A preparation method of the porous resin for solid phase synthesis according to claim 1, comprising following steps of: A, preparing an aqueous phase and an oil phase, respectively; the aqueous phase comprising: water, a dispersant and an inorganic salt; the oil phase comprising: a monovinyl compound, a crosslinking monomer, a functional monomer, a modified monomer, an oil-soluble surfactant, a diluent and an initiator, wherein, the monovinyl compound, the crosslinking monomer, the functional monomer and the modified monomer are monomers capable of polymerization; the oil-soluble surfactant and the diluent are incapable of polymerization but act as pore-forming agents for pore forming; B, adding the oil phase to the aqueous phase, stirring and heating to carry out reaction, and removing the pore-forming agents after the reaction is completed, obtaining a porous polymer resin.

9. The preparation method according to claim 8, wherein the porous polymer resin is capable of undergoing a further reaction to obtain a porous resin containing a hydroxyl group or an amino group as functional groups.

10. The preparation method according to claim 8, wherein the monovinyl compound is an aromatic monovinyl compound, preferably, the monovinyl compound is styrene, unsubstituted or substituted with C1-C5 alkyl or alkoxy on its benzene ring.

11. (canceled)

12. The preparation method according to claim 8, wherein the crosslinking monomer is a multifunctional monomer having two or more non conjugated vinyl groups,. preferably, the crosslinking monomer is divinylbenzene.

13. (canceled)

14. The preparation method according to claim 8, wherein the functional monomer has a double bond capable of free radical polymerization, and also has a hydroxyl group, an amino group, a halogenated group or other group capable of converting into a hydroxyl group and an amino group via reaction, preferably, the functional monomer is selected from the group consisting of hydroxystyrene and derivatives thereof, such as 4-hydroxystyrene; hydroxyalkyl styrene and derivatives thereof, such as 4-hydroxymethyl styrene; acyloxy styrene and derivatives thereof, such as 4-acetoxystyrene and benzoyloxy styrene; amino styrene and derivatives thereof, such as 4-amino styrene; aminoalkyl styrene and derivatives thereof, such as 4-aminomethyl styrene; haloalkyl styrene monomers, such as 4-(4-bromobutyl) styrene and p-chloromethyl styrene; 4-vinylphenyl ester monomers, such as methyl 4-vinylbenzoate and 4-ethenylbenzeneacetic acid ethyl ester.

15. (canceled)

16. The preparation method of the porous resin for solid phase synthesis according to claim 8, wherein the modified monomer has a double bond capable of free radical polymerization and two cyano groups, preferably, the modified monomer is selected from the group consisting of fumaronitrile and 1,4-dicyano-2-butene.

17. (canceled)

18. The preparation method according to claim 8, wherein the initiator is selected from the group consisting of organic peroxides and azo compounds, preferably, the initiator is selected from the group consisting of benzoyl peroxide, lauroyl peroxide, tert butyl peroxy-2-ethylhexanoate, 2,2′-azobis(2-methylpropionitrile), 2,2′-azobis(2-methylbutyronitrile) and 2,2′-azobis(2,4-dimethyl)valeronitrile.

19. (canceled)

20. The preparation method according to claim 8, wherein the oil-soluble surfactant is not polymerizable but is insoluble or slightly soluble in water, preferably, the oil-soluble surfactant is selected from the group consisting of sorbitan trioleate, polyoxyethylene sorbitol beeswax derivative, sorbitan tristearate, polyoxyethylene sorbitol hexastearate, ethylene glycol fatty acid ester, propylene glycol fatty acid ester, propylene glycol monostearate, sorbitan sesquioleate, polyoxyethylene sorbitol oleate, monostearin, lanolin hydroxylated, sorbitol monooleate, propylene glycol laurate, and any combinations thereof.

21. (canceled)

22. The preparation method according to claim 8, wherein, the diluent is an organic solvent which is not polymerizable but is insoluble or slightly soluble in water, preferably, the diluent is selected from the group consisting of aromatic hydrocarbons such as benzene, toluene and ethylbenzene; aliphatic hydrocarbons, such as C6-C12 linear or branched alkanes or C6-C12 cycloalkanes, such as hexane, heptane, octane, dodecane, isooctane, isododecane and cyclohexane, etc; halogenated hydrocarbons such as chloroform and chlorobenzene; esters containing 4 or more carbon atoms, such as ethyl acetate, butyl acetate, dibutyl phthalate, etc; alcohols, such as C4-C12 linear or branched alkane alcohol or C4-C12 cycloalkane alcohol, such as hexanol, cyclohexanol, octanol, isooctanol, decanol and dodecanol.

23. (canceled)

24. The preparation method according to claim 8, wherein, the dispersant is present in the aqueous phase in an amount of 0.1-5% by weight, and the inorganic salt is present in the aqueous phase in an amount of 20% by weight or lower; a weight ratio of the oil phase to the aqueous phase is 1:3-1:20; the monovinyl compound in the oil phase accounts for 40-95.9%, preferably 60-88%, by weight based on a total weight of the monomers; the crosslinking monomer in the oil phase accounts for 2-20%, preferably 5-15%, by weight based on a total weight of the monomers; the functional monomer in the oil phase accounts for 2-20%, preferably 5-15%, by weight based on a total weight of the monomers; the modified monomer in the oil phase accounts for 0.1-20%, preferably 2-10%, by weight based on a total weight of the monomers; the pore-forming agents in the oil phase account for 15-70%, preferably 25-50%, by weight based on a total weight of the monomers; the oil-soluble surfactant in the pore-forming agents accounts for 0.1-15% by weight based on a total weight of the pore-forming agents; and the diluent in the pore-forming agents accounts for 85-99.9% by weight based on a total weight of the pore-forming agents.

25. (canceled)

26. The preparation method according to claim 8, wherein the polymerization is carried out at a temperature of 50-90° C., preferably, 60-85° C.

27. (canceled)

28. The preparation method according to claim 8, comprising following steps of: adding a certain amount of purified water to a reactor, adding the dispersant in an amount which is 0.1-5% by weight of the aqueous phase and the inorganic salt in an amount which is not more than 20% by weight of the aqueous phase, and dissolving to obtain the aqueous phase; weighing out the monovinyl compound, crosslinking monomer, functional monomer, modified monomer, pore-forming agents and initiator according to a weight ratio of the oil phase to the aqueous phase being 1:3-1:20; wherein, the monovinyl compound accounts for 40-95.9%1 preferably 60-88%, of the total weight of the monomers; the crosslinking monomer accounts for 2-20%, preferably 5-15%, of the total weight of the monomers, the functional monomer accounts for 2-20%, preferably 5-15%, of the total weight of the monomers, and the modified monomer accounts for 0.1-20%, preferably 2-10%, of the total weight of the monomers; the pore-forming agents account for 15-70%, preferably 25-50%, of the total weight of the monomers; the oil-soluble surfactant in the pore-forming agents accounts for 0.1-15% of the weight of the pore-forming agents; and the diluent accounts for 85-99.9% of the weight of the pore-forming agents, and mixing well to obtain the oil phase; adding the oil phase to the reactor, stirring and heating to 50-90° C., preferably 60-85° C., to carry out reaction; removing the pore-forming agents after the reaction is completed, screening and collecting the resin with appropriate particle size, and vacuum drying to obtain a porous polymer resin; carrying out a further reaction with the resin to obtain a porous resin having amino group or carboxyl group.

29. (canceled)

30. The preparation method according to claim 8, comprising the following steps of: adding 2L purified water, 20 g polyvinyl alcohol and 60 g sodium chloride to a 3L reactor equipped with a condenser, an agitator and a thermometer, and dissolving to obtain an aqueous phase; weighing out 110 g styrene, 10 g divinylbenzene (80% by weight), 12 g p-chloromethyl styrene, 8 g fumaronitrile, 5 g sorbitol monooleate, 45 g isooctanol and 2.5 g benzoyl peroxide, and mixing well to obtain an oil phase; adding the oil phase to the reactor, stirring, and heating to 80° C. to carry out polymerization for 4 h; washing with hot water after the polymerization is completed, removing the pore-forming agents by ethanol reflux extraction, screening and collecting resin with a particle size of 50-100 μm and vacuum drying to obtain a polymer porous resin with a chlorine content of 550 μmol/g; adding 50 g of the polymer porous resin and 500 ml N,N-dimethylformamide to a 1L reactor equipped with a condenser, an agitator and a thermometer, and stirring; then adding 30 g potassium phthalimide and raising the temperature to 95° C. to carry out reaction for 16 hours; cooling to room temperature after reaction is completed, washing twice with N,N-dimethylformamide, washing to neutral with purified water, washing three times with absolute ethanol, and filtering and drying the resin; adding 200 g absolute ethanol and 50 g hydrazine hydrate to the reactor, raising the temperature to 75° C. and reacting for 16 hours; thereafter washing three times with ethanol/purified water solution with a volume ratio of 50:50, washing with purified water to neutral, washing three times with absolute ethanol, and filtering and drying, adding 200 g absolute ethanol and 50 g concentrated hydrochloric acid to the reactor, raising the temperature to 60° C. and reacting for 6 h, thereafter cooling to room temperature, washing to neutral with water, and then vacuum drying to obtain a solid phase synthesis carrier with an amino content of 543 μmol/g and an average pore diameter of 48 nm measured by mercury intrusion method.

31. The preparation method according to claim 8, comprising the following steps of: adding 2L purified water, 20 g polyvinyl alcohol and 60 g sodium chloride to a 3L reactor equipped with a condenser, an agitator and a thermometer and dissolving to obtain an aqueous phase; weighing out 111 g styrene, 11 g divinylbenzene (80% by weight), 13 g 4-acetoxystyrene, 5 g fumaronitrile, 8 g sorbitol monooleate, 40 g isooctanol, 20 g isododecane and 2.5 g benzoyl peroxide, and mixing well to obtain an oil phase; adding the oil phase to the reactor, stirring, and raising the temperature to 78° C. to carry out polymerization for 6 h; thereafter washing the resin with hot water, removing the pore-forming agents by ethanol reflux extraction, screening and collecting the resin with a particle size of 50-100 μm and vacuum drying to obtain a polymer porous resin; adding 50 g of the polymer porous resin and 300 ml acetonitrile to a 1L reactor equipped with a condenser, an agitator and a thermometer, and stirring; adding 7.5 ml hydrazine hydrate slowly and reacting for 3 h at room temperature; thereafter washing to neutral with water, and then vacuum drying to obtain a solid phase synthesis carrier having a hydroxyl group content of 550 pmol/g and an average pore diameter of 64 nm measured by mercury intrusion method.

32. A method for the solid phase synthesis of oligonucleotides, comprising using the porous resin of claim 1 as carriers.

33. The porous resin for solid phase synthesis according to claim 1, wherein the porous resin is a copolymer comprising repeating structural units represented by formula (I), formula (II), formula (III), and formula (IV) in its skeleton: ##STR00006## wherein, R.sub.4=—C— or —C—CH2—; ##STR00007## wherein, R.sub.5 is selected from the group consisting of —OH, —CH.sub.2OH, —NH.sub.2, —CH.sub.2NH.sub.2, —CH.sub.2OOC—C.sub.6H.sub.4—OH, H.sub.2OOCCH.sub.2—C.sub.6H.sub.4—OH, —(CH.sub.2).sub.4OOC—C.sub.6H.sub.4—OH, —(CH.sub.2).sub.4OOCCH.sub.2—C.sub.6H.sub.4—OH, —COONH—C.sub.6H.sub.4—NH.sub.2, —CH.sub.2COONH—C.sub.6H.sub.4—NH.sub.2, —COO—C.sub.6H.sub.4—OH and —CH.sub.2COO—C.sub.6H.sub.4—OH; ##STR00008## wherein, R6 is —H; or CH3(CH2)n—, n is an integer of 0-4; or (CH3)2CH(CH2)n—, n is an integer of 0-2; or (CH3)3C—; or CH3CH2CH(CH3)—; or CH3CH2C(CH3)2—; or CH3CH2CH2CH(CH3)—; or CH3(CH2)n—O—, n is an integer of 0-4.

Description

BRIEF DESCRIPTION OF THE DRAWINGS

[0048] FIG. 1 shows a scanning electron microscope image of the carrier in Example 1;

[0049] FIG. 2 shows a scanning electron microscope image of the carrier in Example 2;

[0050] FIG. 3 shows a scanning electron microscope image of the carrier in Example 6;

[0051] FIG. 4 shows a scanning electron microscope image of the carrier in Example 9;

[0052] FIG. 5 shows the pore size distribution of the carrier in Example 1 measured by mercury intrusion method;

[0053] FIG. 6 shows the pore size distribution of the carrier in Example 2 measured by mercury intrusion method;

[0054] FIG. 7 shows the pore size distribution of the carrier in Example 6 measured by mercury intrusion method;

[0055] FIG. 8 shows the pore size distribution of the carrier in Example 9 measured by mercury intrusion method;

DETAILED DESCRIPTION OF THE EMBODIMENTS

[0056] The present application will be further illustrated with reference to following embodiments. However, these embodiments are only for illustrating, rather than limitations to the present invention detailed in the claims.

EXAMPLE 1

[0057] 2L purified water, 20 g polyvinyl alcohol and 60 g sodium chloride are added to a 3L reactor equipped with a condenser, an agitator and a thermometer, and dissolved to obtain an aqueous phase. 110 g styrene, 10 g divinylbenzene (80% by weight), 12 g p-chloromethyl styrene, 8 g fumaronitrile, 5 g sorbitol monooleate, 45 g isooctanol and 2.5 g benzoyl peroxide are weighed out and mixed well to obtain an oil phase. The oil phase is added to the reactor, stirred and heated to 80° C. to carry out polymerization for 4 h. Wash with hot water after the polymerization is completed. The pore-forming agents are removed by ethanol reflux extraction. Resin with a particle size of 50-100 μm is screened out and collected, and thereafter vacuum dried to obtain a polymer porous resin with a chlorine content of 550 μmmol/g.
50 g of the polymer porous resin and 500 ml N,N-dimethylformamide are added to a 1L reactor equipped with a condenser, an agitator and a thermometer, and stirred. Then 30 g potassium phthalimide is added and the temperature is raised to 95° C. to carry out reaction for 16 hours. Cool to room temperature after reaction is completed, wash twice with N,N-dimethylformamide, wash to neutral with purified water, and wash three times with absolute ethanol, and then filter and dry the resin. 200 g absolute ethanol and 50 g hydrazine hydrate are added to the reactor and heated to a temperature of 75° C. to carry out reaction for 16 hours. Thereafter wash three times with ethanol/purified water solution with a volume ratio of 50:50, wash with purified water to neutral, wash three times with absolute ethanol, and filter and dry the resin. 200 g absolute ethanol and 50 g concentrated hydrochloric acid are added to the reactor and heated to a temperature of 60° C. to carry out reaction for 6 h. Thereafter cool to room temperature, wash to neutral with water, and then vacuum dry to obtain a solid phase synthesis carrier with an amino content of 543 μmmol/g and an average pore diameter of 48 nm measured by mercury intrusion method.

EXAMPLE 2

[0058] 2L purified water, 20 g polyvinyl alcohol and 60 g sodium chloride are added to a 3L reactor equipped with a condenser, an agitator and a thermometer, and dissolved to obtain an aqueous phase. 70 g methyl styrene, 28 g divinylbenzene (80% by weight), 14 g p-chloromethyl styrene, 28 g 1,4-dicyano-2-butene, 6 g sorbitan trioleate, 45 g isooctanol, 30 g toluene and and 1 g benzoyl peroxide are weighed out and mixed well to obtain an oil phase. The oil phase is added to the reactor, stirred and heated to 70° C. to carry out polymerization for 8 h. Wash with hot water after the polymerization is completed. The pore-forming agents are removed by ethanol reflux extraction. Resin with a particle size of 50-100 μm is screened out and collected, and thereafter vacuum dried to obtain a polymer porous resin with a chlorine content of 660 μmmol/g.
50 g of the polymer porous resin and 500 ml N,N-dimethylformamide are added to a 1L reactor equipped with a condenser, an agitator and a thermometer, and stirred. Then 35 g potassium phthalimide is added and the temperature is raised to 95° C. to carry out reaction for 16 hours. Cool to room temperature after reaction is completed, wash twice with N,N-dimethylformamide, wash to neutral with purified water, and wash three times with absolute ethanol, and then filter and dry the resin. 200 g absolute ethanol and 50 g hydrazine hydrate are added to the reactor and heated to a temperature of 75° C. to carry out reaction for 16 hours. Thereafter wash three times with ethanol/purified water solution with a volume ratio of 50:50, wash with purified water to neutral, and wash three times with absolute ethanol, and then filter and dry the resin. 200 g absolute ethanol and 50 g concentrated hydrochloric acid are added to the reactor and heated to a temperature of 60° C. to carry out reaction for 6 h. Thereafter cool to room temperature, wash to neutral with water, and then vacuum dry to obtain a solid phase synthesis carrier with an amino content of 650 μmmol/g and an average pore diameter of 132 nm measured by mercury intrusion method.

EXAMPLE 3

[0059] 2L purified water, 20 g polyvinyl alcohol and 60 g sodium chloride are added to a 3L reactor equipped with a condenser, an agitator and a thermometer, and dissolved to obtain an aqueous phase. 127 g ethyl styrene, 4 g divinylbenzene (80% by weight), 8.8 g 4-(4-bromobutyl) styrene, 0.2 g fumaronitrile, 1 g polyoxyethylene sorbitol beeswax derivative, 12 g isooctanol, 12 g dibutyl phthalate and 2.5 g benzoyl peroxide are weighed out and mixed well to obtain an oil phase. The oil phase is added to the reactor, stirred and heated to 65° C. to carry out polymerization for 10 h. Wash with hot water after the polymerization is completed. The pore-forming agents are removed by ethanol reflux extraction. Resin with a particle size of 50-100 μm is screened out and collected, and thereafter vacuum dried to obtain a polymer porous resin with a bromine content of 265 μmmol/g.
50 g of the polymer porous resin and 600 ml N,N-dimethylformamide are added to a 1L reactor equipped with a condenser, an agitator and a thermometer, and stirred. Then 5.4 g p-hydroxybenzoic acid, 5.4 g anhydrous potassium carbonate and 0.3 g potassium iodide are added and heated to a temperature of 75° C. to carry out reaction for 6 hours. Cool to room temperature after reaction is completed, wash to neutral with purified water, and then vacuum dry to obtain a solid phase synthesis carrier having a hydroxyl group content of 250 μmmol/g and an average pore diameter of 23 nm measured by mercury intrusion method.

EXAMPLE 4

[0060] 2L purified water, 20 g polyvinyl alcohol and 60 g sodium chloride are added to a 3L reactor equipped with a condenser, an agitator and a thermometer, and dissolved to obtain an aqueous phase. 110 g styrene, 11 g divinylbenzene (80% by weight), 9 g p-chloromethyl styrene, 10 g fumaronitrile, 0.5 g sorbitan tristearate, 20 g toluene and, 40 g dibutyl phthalate and 1 g benzoyl peroxide are weighed out and mixed well to obtain an oil phase. The oil phase is added to the reactor, stirred and heated to 60° C. to carry out polymerization for 7 h. Wash with hot water after the polymerization is completed. The pore-forming agents are removed by ethanol reflux extraction. Resin with a particle size of 50-100 μm are screened out and collected, and thereafter vacuum dried to obtain a polymer porous resin with a chlorine content of 425 μmol/g. 50 g of the polymer porous resin and 300 ml absolute ethanol are added to a 1L reactor equipped with a condenser, an agitator and a thermometer, and stirred. 30 g of sodium hydroxide are weighed in a beaker, dissolved with 300 ml of deionized water and slowly added to the reactor. The temperature is raised to 65° C. to carry out reaction for 6 hours. Cool to room temperature after reaction is completed, wash to neutral with purified water, and then vacuum dry to obtain a solid phase synthesis carrier having a hydroxyl group content of 420 μmmol/g and an average pore diameter of 43 nm measured by mercury intrusion method.

EXAMPLE 5

[0061] 2L purified water, 20 g polyvinyl alcohol and 60 g sodium chloride are added to a 3L reactor equipped with a condenser, an agitator and a thermometer, and dissolved to obtain an aqueous phase. 83 g styrene, 25 g divinylbenzene (80% by weight), 18 g N-(4-vinyl-phenyl)-acetamide, 14 g fumaronitrile, 3 g sorbitan tristearate, 16 g isooctanol, 8 g isododecane and 2 g benzoyl peroxide are weighed out and mixed well to obtain an oil phase. The oil phase is added to the reactor, stirred and heated to 55° C. to carry out polymerization for 10 h. Wash with hot water after the polymerization is completed. The pore-forming agents are removed by ethanol reflux extraction. Resin with a particle size of 50-100 μm is screened out and collected, and thereafter vacuum dried to obtain a polymer porous resin.
50 g of the polymer porous resin and 300 ml absolute ethanol are added to a 1L reactor equipped with a condenser, an agitator and a thermometer, and stirred. 30 g of sodium hydroxide are weighed in a beaker, dissolved with 300 ml of deionized water and slowly added to the reactor. The temperature is raised to 65° C. to carry out reaction for 6 hours. Cool to room temperature after reaction is completed, wash to neutral with purified water, and then vacuum dry to obtain a solid phase synthesis carrier having an amino group content of 840 μmmol/g and an average pore diameter of 43 nm measured by mercury intrusion method.

EXAMPLE 6

[0062] 2L purified water, 20 g polyvinyl alcohol and 60 g sodium chloride are added to a 3L reactor equipped with a condenser, an agitator and a thermometer, and dissolved to obtain an aqueous phase. 111 g styrene, 11 g divinylbenzene (80% by weight), 13 g 4-acetoxystyrene, 5 g fumaronitrile, 8 g sorbitol monooleate, 40 g isooctanol, 20 g isododecane and 2.5 g benzoyl peroxide are weighed out and mixed well to obtain an oil phase. The oil phase is added to the reactor, stirred and heated to 78° C. to carry out polymerization for 6 h. Wash with hot water after the polymerization is completed. The pore-forming agents are removed by ethanol reflux extraction. Resin with a particle size of 50-100 μm is screened out and collected, and thereafter vacuum dried to obtain a polymer porous resin.
50 g of the polymer porous resin and 300 ml acetonitrile are added to a 1L reactor equipped with a condenser, an agitator and a thermometer, and stirred. 7.5 ml hydrazine hydrate is added slowly to carry out reaction for 3 h at room temperature. Thereafter wash to neutral with water, and then vacuum dry to obtain a solid phase synthesis carrier having a hydroxyl group content of 550 μmmol/g and an average pore diameter of 64 nm measured by mercury intrusion method.

EXAMPLE 7

[0063] 2L purified water, 20 g polyvinyl alcohol and 60 g sodium chloride are added to a 3L reactor equipped with a condenser, an agitator and a thermometer, and dissolved to obtain an aqueous phase. 130 g styrene, 5 g divinylbenzene (80% by weight), 4 g 4-acetoxystyrene, 1 g fumaronitrile, 1 g propylene glycol fatty acid ester, 40 g isooctanol, 10 g toluene and 3.5 g benzoyl peroxide are weighed out and mixed well to obtain an oil phase. The oil phase is added to the reactor, stirred and heated to 70° C. to carry out polymerization for 6 h. Wash with hot water after the polymerization is completed. The pore-forming agents are removed by ethanol reflux extraction. Resin with a particle size of 50-100 μm is screened out and collected, and thereafter vacuum dried to obtain a polymer porous resin.
50 g of the polymer porous resin and 300 ml acetonitrile are added to a 1L reactor equipped with a condenser, an agitator and a thermometer, and stirred. 7.5 ml hydrazine hydrate is added slowly to carry out reaction for 3 h at room temperature. Thereafter wash to neutral with water, and then vacuum dry to obtain a solid phase synthesis carrier having a hydroxyl group content of 175 μmmol/g and an average pore diameter of 53 nm measured by mercury intrusion method.

EXAMPLE 8

[0064] 2L purified water, 20 g polyvinyl alcohol and 60 g sodium chloride are added to a 3L reactor equipped with a condenser, an agitator and a thermometer, and dissolved to obtain an aqueous phase. 72 g styrene, 28 g divinylbenzene (80% by weight), 27 g benzoyloxy styrene, 13 g fumaronitrile, 5 g lanolin hydroxylated, 10 g toluene and 20 g dibutyl phthalate and 3 g benzoyl peroxide are weighed out, and mixed well to obtain an oil phase. The oil phase is added to the reactor, stirred and heated to 80° C. to carry out polymerization for 6 h. Wash with hot water after the polymerization is completed. The pore-forming agents are removed by ethanol reflux extraction. Resin with a particle size of 50-100 μm is screened out and collected, and thereafter vacuum dried to obtain a polymer porous resin.
50 g of the polymer porous resin and 300 ml acetonitrile are added to a 1L reactor equipped with a condenser, an agitator and a thermometer, and stirred. 7.5 ml hydrazine hydrate is added slowly to carry out reaction for 3 h at room temperature. Thereafter wash to neutral with water, and then vacuum dry to obtain a solid phase synthesis carrier having a hydroxyl group content of 852 μmmol/g and an average pore diameter of 47 nm measured by mercury intrusion method.

EXAMPLE 9

[0065] 2L purified water, 20 g polyvinyl alcohol and 60 g sodium chloride are added to a 3L reactor equipped with a condenser, an agitator and a thermometer, and dissolved to obtain an aqueous phase. 85 g styrene, 24 g divinylbenzene (80% by weight), 18 g methyl 4-vinylbenzoate, 13 g fumaronitrile, 4 g polyoxyethylene sorbitol oleate, 40 g isododecane, 40 g dibutyl phthalate and 2.5 g benzoyl peroxide are weighed out and mixed well to obtain an oil phase. The oil phase is added to the reactor, stirred and heated to 70° C. to carry out polymerization for 6 h. Wash with hot water after the polymerization is completed. The pore-forming agents are removed by ethanol reflux extraction. Resin with a particle size of 50-100 μm is screened out and collected, and thereafter vacuum dried to obtain a polymer porous resin.
50 g of the polymer porous resin and 300 ml acetonitrile are added to a 1L reactor equipped with a condenser, an agitator and a thermometer, and stirred. 8.8 g of hydroquinone, 23 g of HBTU and 13 ml of DIEA are added to carry out reaction for 2 h at room temperature. Thereafter wash to neutral with water, and then vacuum dry to obtain a solid phase synthesis carrier having a hydroxyl group content of 735 μmmol/g and an average pore diameter of 143 nm measured by mercury intrusion method.

EXAMPLE 10

[0066] Swelling properties of the solid phase synthesis carriers prepared in Examples 1-9 in acetonitrile and toluene are measured, respectively. The method is as follows: About 1.5 g of the sample are weighed and put into a stoppered measuring cylinder. Toluene or acetonitrile are added to the corresponding scale. Then the resins and solvent are stirred with a glass rod to make it fully swell and tighten the stopper. 2-3 hours later, the resins are stirred slowly with a glass rod to remove the air bubbles and make the resin uniformly dispersed without caking. The glass rod is removed and the measuring cylinder is placed on a table with a rubber mat and vibrates to make the resin packed compactly. After standing for 24 hours, the volume is recorded and swelling degree is calculated.
The results are shown in Table 1:

TABLE-US-00001 TABLE 1 Swelling degree tests of resin Ex- Ex- Ex- Ex- Ex- Ex- Ex- Ex- Ex- ample ample ample ample ample ample ample ample ample 1 2 3 4 5 6 7 8 9 Swelling 3.7 3.9 3.4 3.7 3.6 3.8 3.8 3.7 3.9 degree in acetoni- trile (ml/g) Swelling 5.5 6.2 4.9 5.1 5.0 5.4 5.4 5.4 5.9 degree in toluene (ml/g)

EXAMPLE 11

[0067] Properties of the solid phase synthetic carriers prepared in the examples and the NittoPhase HL solid phase synthetic carriers are evaluated. To better show the advantages of the present invention, the loading amount (g) of carriers=synthetic column volume (ml)/swelling degree of carrier in toluene (ml/g), and the wash volume is limited to the volume of one synthetic column during the synthesis of oligonucleotides.
10 g of the solid phase synthesis carrier is weighed in a reactor and swollen in 50 ml of acetonitrile for 10 min, and then an appropriate amount of DMT-dT-3′-succinic acid, HBTU and DIEA are added thereto to carry out reaction at room temperature for 12 h. After the reaction is completed, wash 5 times with acetonitrile. Then Cap A (consisting of 20 ml of acetonitrile, 7.5 ml of pyridine and 5.0 ml of N-methylimidazole) and Cap B (consisting of 10 ml of acetonitrile and 4 ml of acetic anhydride) are added to carry out reaction at room temperature for 30 min. After the reaction is completed, the resin is washed 5 times with acetonitrile and dried under vacuum to obtain the carrier loaded with DMT-dT. The loaded DMT groups are removed using p-toluenesulfonic acid/acetonitrile solution. Contents of the DMT group loaded in the carrier are determined by spectrophotometry at 412 nm, and the results are shown in Table 2.
The carriers loaded with DMT-dT are weighed and filled in a synthesis column (32 ml). The synthesis column is mounted on AKTA OligoPilot 100 to synthesize an oligonucleotide with 20 bases in length having a sequence of d[ACGTACGTACGTACGTACGT]. The synthesis process is as follows: 1. Swell the resin in dichloromethane; 2. Remove DMT groups with 10% DCA/DCM; 3. Wash with anhydrous acetonitrile; 4. Add phosphoramidite monomer and activating reagent to carry out condensation; 5. Wash with anhydrous acetonitrile; 6. Add oxidizing agent to carry out oxidation; 7. Wash with anhydrous acetonitrile; 8. Add capping reagent to carry out end capping; 9. Wash with anhydrous acetonitrile; and 10. Repeat the step 2 to start the next cycle.
After the synthesis is completed, the carriers are taken out for drying. Then they are put into a glass bottle, and an appropriate amount of concentrated ammonia water is added thereto to carry out reaction at 55° C. for 16 h, so that the oligonucleotides are cleaved from the carriers while the protecting groups on the bases are removed. The carrier and oligonucleotide are separated via filtration, and the filtrate is dried to obtain a crude powder of oligonucleotide. Purity of the oligonucleotide is measured by HPLC and yield of the oligonucleotide is calculated. The results are shown in Table 2.

TABLE-US-00002 Ex- Ex- Ex- Ex- Ex- Ex- Ex- Ex- Ex- Nitto ample ample ample ample ample ample ample ample ample Phase 1 2 3 4 5 6 7 8 9 HL Amount 2.8 2.2 1.4 2.8 3.5 2.8 0.8 3.5 2.8 — of DMT- dT-3′- succinic acid (g) Amount 1.4 1.1 0.7 1.4 1.8 1.4 0.4 1.8 1.4 of HBTU (g) Amount 1.3 1.0 0.7 1.3 1.6 1.3 0.4 1.6 1.3 of DIEA (ml) Content 318 241 133 298 408 315 72 392 328 321*   of DMT group (μmmol/ g) Swelling 5.5 6.2 4.9 5.1 5.0 5.4 5.4 5.4 5.9  5.8 degree in toluene (ml/g) Loading 5.8 5.1 6.5 6.3 6.4 5.9 5.9 5.9 5.4  5.5 amount of the carrier (g) HPLC 85.4 86.2 81.9 82.3 81.4 86.3 84.2 83.0 83.5 79.5 Purity (%) Yield 65.1 64.9 60.9 62.7 63.2 66.3 64.1 63.5 64.3 60.3 (%) Note: *NittoPhase HL loading UnyLinker.

[0068] As can be seen from Table 2, the use of the oligonucleotide solid phase synthesis carrier of the present invention can improve the yield and purity of oligonucleotides and thus help reduce the production cost of oligonucleotides.

[0069] The above examples and technical solutions are only for preferred embodiments of the present invention. It should be pointed out that for those skilled in the art, any changes or alterations derived from the spirit of the present invention are still within the protection scope of the present invention.