STAPHYLOCOCCUS AUREUS LEUKOCIDINS, THERAPEUTIC COMPOSITIONS, AND USES THEREOF
20230295248 · 2023-09-21
Inventors
Cpc classification
A61P29/00
HUMAN NECESSITIES
C07K2317/76
CHEMISTRY; METALLURGY
C12Q1/025
CHEMISTRY; METALLURGY
C07K16/1271
CHEMISTRY; METALLURGY
A61P17/02
HUMAN NECESSITIES
A61K39/00
HUMAN NECESSITIES
International classification
G01N33/50
PHYSICS
Abstract
Disclosed herein are isolated and purified Staphylococcus aureus bi-component leukocidin, referred to herein as LukAB, and its components LukA and LukB, antibodies specific to LukA, antibodies specific to LukB, therapeutic compositions containing LukA and/or LukB, or anti-LukA and/or anti-LukB antibodies, uses of the compositions to treat acute inflammatory conditions or S. aureus infection, methods for identifying inhibitors of LukAB-mediated cytotoxicity of human phagocytes, and methods for using LukAB as a marker to predict severity of S. aureus infection.
Claims
1. (canceled)
2. A pharmaceutical composition comprising: a leukocidin A (LukA) polypeptide, said polypeptide comprising an amino acid sequence having at least 85% sequence identity to the amino acid sequence of (i) amino acid residues 28-351 of any one of SEQ ID NOs: 1-3 and 7-14, or (ii) amino acid residues 28-350 of any one of SEQ ID NOs: 4-6.
3. The composition of claim 2, wherein said composition comprises: the LukA polypeptide comprising an amino acid sequence having at least 85% sequence identity to the amino acid sequence of amino acid residues 28-351 of SEQ ID NO: 10.
4. The composition of claim 3, wherein said LukA polypeptide does not comprise amino acid residues 342-351 of SEQ ID NO: 10.
5. The composition of claim 2, wherein said composition comprises: the LukA polypeptide comprising an amino acid sequence having at least 85% sequence identity to the amino acid sequence of amino acid residues 28-351 of SEQ ID NO: 2.
6. The composition of claim 5, wherein said LukA polypeptide does not comprise amino acid residues 342-351 of SEQ ID NO: 2.
7. The composition of claim 2, wherein the LukA polypeptide has at least 90% sequence identity to the amino acid sequence of amino acid residues 28-351 of any one of SEQ ID NOs: 1-3 and 7-14 or amino acid residues 28-350 of any one of SEQ ID NOs: 4-6.
8. The composition of claim 2, wherein the LukA polypeptide has at least 95% sequence identity to the amino acid sequence of amino acid residues 28-351 of any one of SEQ ID NOs: 1-3 and 7-14 or amino acid residues 28-350 of any one of SEQ ID NOs: 4-6.
9. The composition of claim 2 further comprising: a leukocidin B (LukB) polypeptide, said LukB polypeptide comprising an amino acid sequence having at least 85% sequence identity to the amino acid sequence of amino acid residues 30-338 of any one of SEQ ID NOs: 15, 18, 20, and 22-27 or amino acid residues 30-339 of any one of SEQ ID NOs: 16, 19, and 21.
10. The composition of claim 9, wherein said composition comprises the LukB polypeptide having at least 85% sequence identity to the amino acid sequence of amino acid residues 30-339 of SEQ ID NO: 16.
11. The composition of claim 9, wherein said composition comprises the LukB polypeptide having at least 85% sequence identity to the amino acid sequence of amino acid residues 30-338 of SEQ ID NO: 27.
12. The composition of claim 9, wherein the LukB polypeptide has at least 90% sequence identity to the amino acid sequence of amino acid residues 30-338 of any one of SEQ ID NOs: 15, 18, 20, and 22-27 or amino acid residues 30-339 of any one of SEQ ID NOs: 16, 19, and 21.
13. The composition of claim 9, wherein the LukB polypeptide has at least 95% sequence identity to the amino acid sequence of amino acid residues 30-338 of any one of SEQ ID NOs: 15, 18, 20, and 22-27 or amino acid residues 30-339 of any one of SEQ ID NOs: 16, 19, and 21.
14. The composition of claim 2 further comprising a pharmaceutically acceptable carrier.
15. The composition of claim 2 further comprising an adjuvant.
16. A method of generating an antibody response in a mammalian subject, said method comprising: administering to a mammalian subject the composition of claim 2 under conditions effective to induce an antibody response against the lukA polypeptide present in the composition.
17. The method of claim 16, wherein the LukA polypeptide comprises a deletion of amino acid residues 342-351 of SEQ ID NO: 10.
18. The method of claim 16, wherein said LukA polypeptide comprises a deletion of the amino acid residues 342-351 of SEQ ID NO: 2.
19. The method of claim 16, wherein the subject has an infection and wherein the infection is an MRSA infection.
Description
BRIEF DESCRIPTION OF THE DRAWINGS
[0019]
[0020]
[0021]
[0022]
[0023]
[0024]
[0025]
[0026]
[0027]
[0028]
[0029]
DETAILED DESCRIPTION
[0030] The following disclosure is directed, in successive order, to LukA polypeptides, LukB polypeptides, LukA and LukB polynucleotides, anti-LukA and anti-LukB antibodies, therapeutic compositions containing LukA and/or LukB, or anti-LukA and/or anti-LukB antibodies, methods of using the therapeutic compositions, methods of identifying inhibitors of LukAB-mediated cytotoxicity, and methods of predicting or assessing severity of an S. aureus infection.
LukA Polypeptides
[0031] Polypeptides native to Staphylococcus aureus have now been isolated and identified by Applicants as exhibiting the activity profile of known S-subunit leukocidins (e.g., LukS-PVL, LukE and HlgC). These polypeptides which are designated collectively herein as LukA, specifically target and bind human phagocytes (but not human epithelial or human endothelial cells, or murine cells), and once bound to the phagocyte membrane, LukA oligomerizes with an S. aureus F-subunit leukocidin (e.g., LukF-PVL, LukD and HlgB, and LukB as disclosed herein), and upon oligomerization forms a transmembrane pore (collectively referred to as LukA activity). The alignment illustrated in
[0032] The N-terminal 27 amino acid residues in each of SEQ ID NOS:1-14 represent the native secretion/signal sequence. Thus, the mature, secreted form of LukA, which is represented by amino acid residues 28-351 in each of SEQ ID NOS: 1-14, may be referred to herein as “LukA (28-351)” or “mature LukA”. Correspondingly, the immature form of LukA may be referred to herein as “LukA (1-351)”.
[0033] A LukA consensus sequence, based on SEQ ID NOS: 2-14 (which are not exhaustive with respect to native S. aureus LukA) would thus include variability at a minimum of 64 positions of LukA (wherein consecutive positions of variability are denoted X.sup.1-X.sup.64), designated as follows: 8 (X.sup.1=L or F), 16 (X.sup.2=A or V), 17 (X.sup.3=I or L), 24 (X.sup.4=T or N), 26 (X.sup.5=Q or E), 31 (X.sup.6=H or N), 38 (X.sup.7=N or T), 46 (X.sup.8=S or A), 50 (X.sup.9=E or D), 55 (X.sup.10=T or N), 56 (X.sup.11=N or D), 61 (X.sup.12=S or T), 62 (X.sup.13=T or P), 63 (X.sup.14=A, G or V), 73 (X.sup.15=I or V), 78 (X.sup.16=E or V), 77 (X.sup.17=T or S), 80 (X.sup.18=V or E), 83 (X.sup.19=E or K), 84 (X.sup.20=E or K), 105 (X.sup.21=V or I), 124 (X.sup.22=K or R), 125 (X.sup.23=E or N), 127 (X.sup.24=K, T or N), 129 (X.sup.25=S or A), 130 (X.sup.26=N or S), 135 (X.sup.27=K or Q), 146 (X.sup.28=R or S), 148 (X.sup.29=R or P), 173 (X.sup.30=S or N), 174 (X.sup.31=S or L), 181 (X.sup.32=T or V), 184 (X.sup.33=I or V), 195 (X.sup.34=T or S), 202 (X.sup.35=N or K), 208 (X.sup.36=S or I), 214 (X.sup.37=W or R), 221 (X.sup.38=I or V), 229 (X.sup.39=G or N), 231 (X.sup.40=V or I), 237 (X.sup.41=E or D), 239 (X.sup.42=L or F), 243 (X.sup.43=N or T), 246 (X.sup.44=I or L), 247 (X.sup.45=A or S), 278 (X.sup.46=L or I), 283 (X.sup.47=S or T), 285 (X.sup.48=E or D), 288 (X.sup.49=Q or R), 299 (X.sup.50=I or V), 303 (X.sup.51=R or K), 309 (X.sup.52=A or G), 310 (X.sup.53=P or Q), 315 (X.sup.54=K or Q), 318 (X.sup.55=D or E), 322 (X.sup.56=L or F), 325 (X.sup.57=T or V), 338 (X.sup.58=V or I), 339 (X.sup.59=D or E), 342 (X.sup.60=S or T), 344 (X.sup.61=D, E or Q), 347 (X.sup.62=P or S), 348 (X.sup.63=Y or F), and 349 (X.sup.64=K or R).
LukB Polypeptides
[0034] Polypeptides native to Staphylococcus aureus have now been identified by Applicants as exhibiting the activity profile of known F-subunit leukocidins (e.g., LukF-PVL, LukD and HlgB). These polypeptides which are designated collectively herein as LukB, specifically oligomerize with an S. aureus S-subunit leukocidin (e.g., LukS-PVL, LukE and HlgC, and LukA as disclosed herein) which is bound to a human phagocyte; and upon oligomerization form a transmembrane pore in the phagocyte (collectively referred to as LukB activity). The alignment illustrated in
[0035] The N-terminal 29 amino acid residues in each of SEQ ID NOS:15-27 represent the secretion/signal sequence. Thus, the mature, secreted form of LukB, which is represented by amino acid residues 30-339 in each of SEQ ID NOS: 16-27, may be referred to herein as “LukB(30-339)” or “mature LukB”. Correspondingly, the immature form of LukB may be referred to herein as “LukA (1-339)”.
[0036] A LukB consensus sequence, based on SEQ ID NOS:15-28 (which are not exhaustive with respect to native S. aureus LukB) would thus include variability at a minimum of 49 positions of LukB (wherein consecutive positions of variability are denoted X.sup.1-X.sup.49), designated as follows: 5 (X.sup.1=L or V), 6 (X.sup.2=C or Y), 13 (X.sup.3=S or T), 15 (X.sup.4=A or T), 16 (X.sup.5=L or I), 19 (X.sup.6=A or T), 20 (X.sup.7=L or F), 23 (X.sup.8=F or L), 26 (X.sup.9=S or T), 28 (X.sup.10=Y or F), 34 (X.sup.11=E or K), 36 (X.sup.12=K or T), 37 (X.sup.13=Q, T or A), 46 (X.sup.14=D or E), 59 (X.sup.15=S or T), 60 (X.sup.16=Q or E), 62 (X.sup.17=N or K), 64 (X.sup.18=T or S), 75 (X.sup.19=P or K), 95 (X.sup.20=K or R), 98 (X.sup.21=N, d or E), 126 (X.sup.22=S or a deletion), 159 (X.sup.23=R or Q), 163 (X.sup.24=T or P), 170 (X.sup.25=S or K), 187 (X.sup.26=L or I), 190 (X.sup.27=S or P), 192 (X.sup.28=S or T), 193 (X.sup.29=S or T), 193 (X.sup.29=H or N), 197 (X.sup.30=G or A), 204 (X.sup.31=S or L), 222 (X.sup.32=D or N), 224 (X.sup.33=T or V), 247 (X.sup.34=N or D), 270 (X.sup.35=N or K), 272 (X.sup.36=K or E), 276 (X.sup.37=R, Q or K), 287 (X.sup.38=D or E), 290 (X.sup.39=L or I), 294 (X.sup.40=K or R), 309 (X.sup.41=Q or KO, 327 (X.sup.42=D or N), 329 (X.sup.43=L or F), 330 (X.sup.44=I or V), 332 (X.sup.45=t or V), 333 (X.sup.46=f, I or L), 336 (X.sup.47=K or N), and 338 (X.sup.48=K or Q).
[0037] LukA and LukB leukocidins may differ from the native polypeptides designated as SEQ ID NOS:2-14 and 16-27 respectively, in terms of one or more additional amino acid insertions, substitutions or deletions, e.g., one or more amino acid residues within SEQ ID NOS:2-14 or 16-27 may be substituted by another amino acid of a similar polarity, which acts as a functional equivalent, resulting in a silent alteration. That is to say, the change relative to the native sequence would not appreciably diminish the basic properties of native LukA and LukB. Examples include SEQ ID NOS:1 and 15. Any such analog of LukA or LukB may be screened in accordance with the protocols disclosed herein (e.g., the cell toxicity assay and the membrane damage assay) to determine if it maintains native LukA or LukB activity. Substitutions within these leukocidins may be selected from other members of the class to which the amino acid belongs. For example, nonpolar (hydrophobic) amino acids include alanine, leucine, isoleucine, valine, proline, phenylalanine, tryptophan and methionine. Polar neutral amino acids include glycine, serine, threonine, cysteine, tyrosine, asparagine, and glutamine. Positively charged (basic) amino acids include arginine, lysine and histidine. Negatively charged (acidic) amino acids include aspartic acid and glutamic acid.
[0038] In other embodiments, non-conservative alterations (e.g., one or amino acid substitutions, deletions and/or additions) can be made for purposes of inactivating or detoxifying LukA and LukB. In one embodiment, the nontoxic LukA analog differs from the native polypeptides in that the C-terminal amino acids in positions 342-351 are deleted. With the exception of SEQ ID NOs:4-6 (which contain 9 amino acids at these positions), the analog lacks the 10 C-terminal amino acid residues. Collectively, these analogs are referred to as LukAΔ10C. The detoxified LukA and LukB may be used in the active vaccine compositions described herein. Molecular alterations can be accomplished by methods well known in the art, including primer extension on a plasmid template using single stranded templates (Kunkel, Proc. Acad. Sci., USA 82:488-492 (1985)), double stranded DNA templates (Papworth, et al., Strategies 9(3):3-4 (1996)), and by PCR cloning (Braman, J. (ed.), IN VITRO MUTAGENESIS PROTOCOLS, 2nd ed. Humana Press, Totowa, N.J. (2002). Methods of determining whether a given molecular alteration in LukA or LukB reduces LukAB cytotoxicity are described herein.
[0039] Therefore, in view of the foregoing and for purposes of the present invention, LukA may be more broadly described in terms of any of SEQ ID NOS:1-14 (e.g., SEQ ID NO:2, which is the LukA polypeptide native to the Newman strain of S. aureus), or a (native or non-native) polypeptide having at least about 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% sequence similarity thereto.
[0040] Likewise, in view of the foregoing and for purposes of the present invention, LukB may be more broadly described in terms of any of SEQ ID NOS:15-27 (e.g., SEQ ID NO:27, which is the LukB polypeptide native to the Newman strain of S. aureus), or a (native or non-native) polypeptide having at least about 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% sequence similarity thereto.
[0041] Thus, unless indicated to the contrary, both the immature and the mature forms of native LukA and LukB, and the sequences having less than 100% similarity with native LukA (i.e., native sequences and analogs alike, collectively referred to herein as “LukA” and “LukB”) may be used in the compositions and methods, and for making the anti-LukA and the anti-LukB antibodies of the present invention.
Polynucleotides Encoding LukA and LukA and Methods of Synthesizing or Isolating LukA and LukB
[0042] The LukA and LukB leukocidins may be synthesized via recombinant DNA methodologies which are well known in the art. For example, a nucleotide sequence (designated SEQ ID NO:28) encoding LukA polypeptide of S. aureus (Newman)(SEQ ID NO:2), is set forth below. Degenerate sequences (e.g., that may be useful in view of codon preferences in hosts of choice for purposes of recombinant expression) that encode this polypeptide, and polynucleotides that encode other LukA polypeptides are known in the art, or may be designed by persons of skill in the art.
TABLE-US-00001 atgaaaaataaaaaacgtgttttaatagcgtcatcattatcatgtgcaa M K N K K R V L I A S S L S C A ttttattgttatcagcagcaacgactcaagcaaattcagctcataaaga I L L L S A A T T Q A N S A H K D ctctcaagaccaaaataagaaagaacatgttgataagtctcaacaaaaa S Q D Q N K K E H V D K S Q Q K gacaaacgtaatgttactaataaagataaaaattcaacagcaccggatg D K R N V T N K D K N S T A P D atattgggaaaaacggtaaaatcacaaaacgaactgaaacagtatatga D I G K N G K I T K R T E T V Y D tgagaaaacaaatatactccaaaatttacaattcgactttatcgatgat E K T N I L Q N L Q F D F I D D ccaacttatgacaagaatgtattacttgttaaaaaacaaggctcaattc P T Y D K N V L L V K K Q G S I attcaaatttaaagtttgaatctcataaagaagaaaaaaattcaaattg H S N L K F E S H K E E K N S N W gttaaagtatccaagtgagtaccatgtagattttcaagtaaaaagaaat L K Y P S E Y H V D F Q V K R N cgtaaaactgaaatattagaccaattgccgaaaaataaaatttcaactg R K T E I L D Q L P K N K I S T caaaagtagacagtacattttcatatagctcaggtggtaaattcgattc A K V D S T F S Y S S G G K F D S aacaaaaggtattggacgaacttcatcaaatagctactccaaaacgatt T K G I G R T S S N S Y S K T I agttataatcagcaaaattatgacacaattgccagcggtaaaaataata S Y N Q Q N Y D T I A S G K N N actggcatgtacactggtcagttattgcgaatgacttgaagtatggtgg N W H V H W S V I A N D L K Y G G agaagtgaaaaatagaaatgatgaattattattctatagaaatacgaga E V K N R N D E L L F Y R N T R attgctactgtagaaaaccctgaactaagctttgcttcaaaatatagat I A T V E N P E L S F A S K Y R acccagcattagtaagaagtggctttaatccagaatttttaacttattt Y P A L V R S G F N P E F L T Y L atctaatgaaaagtcaaatgagaaaacgcaatttgaagtaacatacaca S N E K S N E K T Q F E V T Y T cgaaatcaagatattttgaaaaacagacctggaatacattatgcacctc R N Q D I L K N R P G I H Y A P caattttagaaaaaaataaagatggtcaaagattaattgtcacttatga P I L E K N K D G Q R L I V T Y E agttgattggaaaaataaaacagttaaagtcgttgataaatattctgat V D W K N K T V K V V D K Y S D gacaataaaccttataaagaaggataa D N K P Y K E G
[0043] A nucleotide sequence (designated herein as SEQ ID NO:29) that encodes LukB polypeptide of S. aureus (Newman), (SEQ ID NO:27), is set forth below. Degenerate sequences (e.g., that may be useful in view of codon preferences in hosts of choice for purposes of recombinant expression) that encode this polypeptide, and polynucleotides that encode other LukB polypeptides are known in the art, or may be designed by persons of skill in the art.
TABLE-US-00002 atgattaaacaactatgtaaaaatatcacaatttgtacgttagcactat M I K Q L C K N I T I C T L A L cgactactttcactgtattaccagctacttcatttgcaaagattaattc S T T F T V L P A T S F A K I N S tgaaatcaaacaagtttctgagaagaatcttgatggtgatactaaaatg E I K Q V S E K N L D G D T K M tatacacgtacagctacaacaagtgatagtcaaaaaaatattactcaaa Y T R T A T T S D S Q K N I T Q gcttacaatttaatttcttaactgaacctaattatgataaagaaacagt S L Q F N F L T E P N Y D K E T V atttattaaagcaaaaggtacaattggtagtggtttgagaattttagac F I K A K G T I G S G L R I L D ccaaatggttattggaatagtacattaagatggcctggatcttattcag P N G Y W N S T L R W P G S Y S tttcaattcaaaatgttgatgacaacaacaatacaaatgtgactgactt V S I Q N V D D N N N T N V T D F tgcaccaaaaaatcaggatgaatcaagagaagttaaatatacgtatggt A P K N Q D E S R E V K Y T Y G tataaaacaggtggagatttttcgattaatcgtggaggcttaactggaa Y K T G G D F S I N R G G L T G atattacaaaagagagtaattattcagagacgattagttatcaacaacc N I T K E S N Y S E T I S Y Q Q P atcatatcgtacattacttgatcaatctacgtcacataaaggtgtaggt S Y R T L L D Q S T S H K G V G tggaaagtagaagcacatttgataaataatatgggacatgaccatacga W K V E A H L I N N M G H D H T gacaattaactaatgatagtgataatagaactaaaagtgaaattttttc R Q L T N D S D N R T K S E I F S tttaacacgaaatggaaatttatgggcgaaagataatttcacacctaaa L T R N G N L W A K D N F T P K gacaaaatgcctgtaactgtgtctgaagggtttaatccagaatttttag D K M P V T V S E G F N P E F L ctgttatgtcacatgataaaaaagacaaaggtaaatcacaatttgttgt A V M S H D K K D K G K S Q F V V tcattataaaagatcaatggatgagtttaaaatagattggaatcgccat H Y K R S M D E F K I D W N R H ggtttctggggctattggtctggtgaaaaccatgtagataaaaaagaag G F W G Y W S G E N H V D K K E aaaaattatcagcattatatgaagttgattggaagacacataatgtgaa E K L S A L Y E V D W K T H N V K gtttgtaaaagtacttaatgataatgaaaagaaataa F V K V L N D N E K K -
[0044] The LukA- and LukB-encoding polynucleotides may be expressed in a host such as bacteria (E. coli), plants and or yeast and then isolated and purified. Alternatively, LukA and LukB leukocidins may be isolated from S. aureus bacteria (e.g., the Newman strain) in accordance with standard techniques. Thus, these leukocidins may be isolated (from a native or non-native environment). They may also be purified in that they are substantially free from other proteins and cell components with which S. aureus LukA and LukB are associated in their native state (i.e., proteins and cell components present in S. aureus cells) or a non-native state (i.e., proteins and cell components of a recombinant cellular host). Suitable purification schemes, which typically entail a combination of at least two successive procedures, are known in the art. See, Deutscher, Methods in Enzymology, 182 (1990); and Scopes, Protein Purification: Principles and Practice, Springer-Verlag, N.Y. (1982), using one or a combination of two or more standard techniques such as affinity column chromatography and cation-exchange liquid chromatography.
Anti-LukA Antibodies and Anti-LukB Antibodies
[0045] Aspects of the present invention are directed to anti-LukA antibodies that specifically bind LukA, and anti-LukB antibodies that specifically bind LukB, therapeutic compositions containing the antibodies, and methods of use thereof. For purposes of the present invention, the term “antibody” includes monoclonal antibodies, polyclonal antibodies, antibody fragments, and genetically engineered forms of the antibodies, and combinations thereof. More specifically, the term “antibody”, which is used interchangeably with the term “immunoglobulin”, includes full-length (i.e., naturally occurring or formed by normal immunoglobulin gene fragment recombinatorial processes) immunoglobulin molecules (e.g., an IgG antibody) and immunologically active fragments thereof (i.e., including the specific binding portion of the full-length immunoglobulin molecule), which again may be naturally occurring or synthetic in nature. Accordingly, the term “antibody fragment” includes a portion of an antibody such as F(ab).sub.2, F(ab).sub.2, Fab′, Fab, Fv, scFv and the like. Regardless of structure, an antibody fragment binds with the same antigen that is recognized by the full-length antibody, and, in the context of the present invention, specifically binds LukA, LukB or a LukAB complex. Methods of making and screening antibody fragments are well-known in the art.
[0046] In some embodiments, the anti-LukA antibodies of the present invention may have some degree of cross-reactivity with other Staphylococcus leukocidin S-subunits such as HlgC, LukS-PVL, HlgA, LukS-I, LukE, LukEv, and LukM. Likewise, in some embodiments, the anti-LukB antibodies of the present invention may have some degree of cross-reactivity with other Staphylococcus leukocidin F-subunits such as LukF′-PV, LukF-PV, LukDv, LukD, LukF-I, and HlgB. Anti-LukA and/or anti-LukB antibodies may inhibit or reduce LukA activity and LukB activity, respectively. In some embodiments, the anti-LukA and/or anti-LukB antibodies neutralize (e.g., substantially eliminate) LukA and LukB activity, respectively.
[0047] Naturally occurring antibodies typically have two identical heavy chains and two identical light chains, with each light chain covalently linked to a heavy chain by an inter-chain disulfide bond and multiple disulfide bonds further link the two heavy chains to one another. Individual chains can fold into domains having similar sizes (110-125 amino acids) and structures, but different functions. The light chain can comprise one variable domain (VL) and/or one constant domain (CL). The heavy chain can also comprise one variable domain (VH) and/or, depending on the class or isotype of antibody, three or four constant domains (CHI, CH 2, CH3 and CH4). In humans, the isotypes are IgA, IgD, IgE, IgG, and IgM, with IgA and IgG further subdivided into subclasses or subtypes (IgA1-2 and IgG1-4).
[0048] Generally, the variable domains show considerable amino acid sequence variability from one antibody to the next, particularly at the location of the antigen-binding site. Three regions, called hyper-variable or complementarity-determining regions (CDRs), are found in each of VL and VH, which are supported by less variable regions called framework variable regions. The inventive antibodies include IgG monoclonal antibodies but the antibodies of the present invention also include antibody fragments or engineered forms. These are, for example, Fv fragments, or proteins wherein the CDRs and/or variable domains of the exemplified antibodies are engineered as single-chain antigen-binding proteins.
[0049] The portion of an antibody consisting of the VL and VH domains is designated as an Fv (Fragment variable) and constitutes the antigen-binding site. A single chain Fv (scFv or SCA) is an antibody fragment containing a VL domain and a VH domain on one polypeptide chain, wherein the N terminus of one domain and the C terminus of the other domain are joined by a flexible linker. The peptide linkers used to produce the single chain antibodies are typically flexible peptides, selected to assure that the proper three-dimensional folding of the VL and VH domains occurs. The linker is generally 10 to 50 amino acid residues, and in some cases is shorter, e.g., about 10 to 30 amino acid residues, or 12 to 30 amino acid residues, or even 15 to 25 amino acid residues. An example of such linker peptides includes repeats of four glycine residues followed by a serine residue.
[0050] Single chain antibodies lack some or all of the constant domains of the whole antibodies from which they are derived. Therefore, they can overcome some of the problems associated with the use of whole antibodies. For example, single-chain antibodies tend to be free of certain undesired interactions between heavy-chain constant regions and other biological molecules. Additionally, single-chain antibodies are considerably smaller than whole antibodies and can have greater permeability than whole antibodies, allowing single-chain antibodies to localize and bind to target antigen-binding sites more efficiently. Furthermore, the relatively small size of single-chain antibodies makes them less likely to provoke an unwanted immune response in a recipient than whole antibodies.
[0051] Fab (Fragment, antigen binding) refers to the fragments of the antibody consisting of the VL, CL, VH, and CH1 domains. Those generated following papain digestion simply are referred to as Fab and do not retain the heavy chain hinge region. Following pepsin digestion, various Fabs retaining the heavy chain hinge are generated. Those fragments with the interchain disulfide bonds intact are referred to as F(ab′)2, while a single Fab′ results when the disulfide bonds are not retained. F(ab′)2 fragments have higher avidity for antigen that the monovalent Fab fragments.
[0052] Fc (Fragment crystallization) is the designation for the portion or fragment of an antibody that comprises paired heavy chain constant domains. In an IgG antibody, for example, the Fc comprises CH2 and CH3 domains. The Fc of an IgA or an IgM antibody further comprises a CH4 domain. The Fc is associated with Fc receptor binding, activation of complement-mediated cytotoxicity and antibody-dependent cellular-cytotoxicity (ADCC). For antibodies such as IgA and IgM, which are complexes of multiple IgG-like proteins, complex formation requires Fc constant domains.
[0053] Finally, the hinge region separates the Fab and Fc portions of the antibody, providing for mobility of Fabs relative to each other and relative to Fc, as well as including multiple disulfide bonds for covalent linkage of the two heavy chains.
[0054] Antibody “specificity” refers to selective recognition of the antibody for a particular epitope of an antigen. The term “epitope” includes any protein determinant capable of specific binding to an immunoglobulin or T-cell receptor or otherwise interacting with a molecule. Epitopic determinants generally consist of chemically active surface groupings of molecules such as amino acids or carbohydrate or sugar side chains and generally have specific three dimensional structural characteristics, as well as specific charge characteristics. An epitope may be “linear” or “conformational”. In a linear epitope, all of the points of interaction between the protein and the interacting molecule (such as an antibody) occur linearly along the primary amino acid sequence of the protein. In a conformational epitope, the points of interaction occur across amino acid residues on the protein that are separated from one another, i.e., noncontiguous amino acids juxtaposed by tertiary folding of a protein. Epitopes formed from contiguous amino acids are typically retained on exposure to denaturing solvents, whereas epitopes formed by tertiary folding are typically lost on treatment with denaturing solvents. An epitope typically includes at least 3, and more usually, at least 5 or 8-10 amino acids in a unique spatial conformation. Antibodies that recognize the same epitope can be verified in a simple immunoassay showing the ability of one antibody to block the binding of another antibody to a target antigen.
[0055] Monoclonal antibodies of the present invention may be murine, human, humanized or chimeric. A humanized antibody is a recombinant protein in which the CDRs of an antibody from one species; e.g., a rodent, rabbit, dog, goat, horse, or chicken antibody (or any other suitable animal antibody), are transferred from the heavy and light variable chains of the rodent antibody into human heavy and light variable domains. The constant domains of the antibody molecule are derived from those of a human antibody. Methods for making humanized antibodies are well known in the art. Chimeric antibodies preferably have constant regions derived substantially or exclusively from human antibody constant regions and variable regions derived substantially or exclusively from the sequence of the variable region from a mammal other than a human. The chimerization process can be made more effective by also replacing the variable regions—other than the hyper-variable regions or the complementarity—determining regions (CDRs), of a murine (or other non-human mammalian) antibody with the corresponding human sequences. The variable regions other than the CDRs are also known as the variable framework regions (FRs). Yet other monoclonal antibodies of the present invention are bi-specific, in that they have specificity for both LukA and LukB. Bispecific antibodies are preferably human or humanized.
[0056] The above-described antibodies can be obtained in accordance with standard techniques. For example, LukA, LukB (which as these terms are used herein, include nontoxic analogs thereof such as LukAΔ10C) or an immunologically active fragment of LukA or LukB can be administered to a subject (e.g., a mammal such as a human or mouse). The leukocidins can be used by themselves as immunogens or they can be attached to a carrier protein or other objects, such as beads such as sepharose beads. After the mammal has produced antibodies, a mixture of antibody producing cells, such as splenocytes, are isolated, from which polyclonal antibodies may be obtained. Monoclonal antibodies may be produced by isolating individual antibody-producing cells from the mixture and immortalizing them by, for example, fusing them with tumor cells, such as myeloma cells. The resulting hybridomas are preserved in culture and the monoclonal antibodies are harvested from the culture medium.
[0057] Techniques for making recombinant monoclonal antibodies are well known in the art. Recombinant polyclonal antibodies can be produced by methods analogous to those described in U.S. Patent Application Publication 2002/0009453, using LukA, LukB or LukAB as the immunogen(s).
Therapeutic Compositions
[0058] LukA and LukB may be formulated into a therapeutic composition for use as an anti-inflammatory agent in the treatment of acute inflammatory conditions, including localized acute inflammatory conditions. LukA and LukB may also be formulated into a therapeutic composition for use as an active vaccine. Anti-LukA and anti-LukB antibodies may be formulated into a therapeutic composition for use as a passive vaccine. The passive and active vaccines may be used prophylactically to inhibit onset of a S. aureus infection, or therapeutically to treat S. aureus infection, particularly S. aureus infections such as MRSA that are known to be refractory or in the case of the specific subject, have proven refractory to treatment with other conventional antibiotic therapy.
[0059] In embodiments wherein the therapeutic composition is intended for use as an active vaccine, the LukA and/or LukB may be altered so as to exhibit reduced toxicity. Molecular alterations are described above. Thus, nontoxic analogs thereof such as LukAΔ10C may be used. Applicants believe that antibodies produced in response to the nontoxic immunogen will neutralize the toxic, native LukA or LukAB. Other alterations for purposes of reducing toxicity of LukA and LukB include chemical treatment (e.g., modification of specific amino acid residues) or conjugation to another moiety (e.g., to another bacterial antigen, such as a bacterial polysaccharide or a bacterial glycoprotein). Chemical alterations to other S. aureus toxins for purposes of inactivation or detoxification (or reducing toxicity) are known. Methods of determining whether a given alteration reduces LukA or LukB toxicity are known in the art and/or described herein.
[0060] The therapeutic compositions of the present invention are prepared by formulating LukA and LukB, or anti-LukA and anti-LukB antibodies, with a pharmaceutically acceptable carrier and optionally a pharmaceutically acceptable excipient. As used herein, the terms “pharmaceutically acceptable carrier” and “pharmaceutically acceptable excipient” (e.g., additives such as diluents, immunostimulants, adjuvants, antioxidants, preservatives and solubilizing agents) are nontoxic to the cell or mammal being exposed thereto at the dosages and concentrations employed. Examples of pharmaceutically acceptable carriers include water, e.g., buffered with phosphate, citrate and another organic acid. Representative examples of pharmaceutically acceptable excipients that may be useful in the present invention include antioxidants such as ascorbic acid; low molecular weight (less than about 10 residues) polypeptides; proteins, such as serum albumin, gelatin, or immunoglobulins; adjuvants (selected so as to avoid adjuvant-induced toxicity, such as a β-glucan as described in U.S. Pat. No. 6,355,625, or a granulocyte colony stimulating factor (GCSF)); hydrophilic polymers such as polyvinylpyrrolidone; amino acids such as glycine, glutamine, asparagine, arginine or lysine; monosaccharides, disaccharides, and other carbohydrates including glucose, mannose, or dextrins; chelating agents such as EDTA; sugar alcohols such as mannitol or sorbitol; salt forming counterions such as sodium; and/or nonionic surfactants such as TWEEN®, polyethylene glycol (PEG), and PLURONICS®.
[0061] As described elsewhere herein, the therapeutic compositions of the present invention may further contain at least one additional active agent.
[0062] Therapeutic compositions of the present invention may be prepared for storage by mixing the active ingredient(s) having the desired degree of purity with the pharmaceutically acceptable carrier and optional excipient and/or additional active agent, in the form of lyophilized formulations or aqueous solutions.
Uses of the Therapeutic Compositions—Indications
Acute Inflammatory Conditions
[0063] Inflammation is generally understood as the protective biological response to remove harmful invading stimuli such as pathogens (e.g., bacteria and viruses), damaged cells and irritants, and to initiate healing. Inflammation is understood more specifically as the reaction of vascularized living tissue to injury. As such, inflammation is a fundamental, stereotyped complex of cytological and chemical reactions of affected blood vessels and adjacent tissues in response to an injury or abnormal stimulation caused by a physical, chemical or biological agent. Inflammation usually leads to the accumulation of fluid and blood cells at the site of injury, and is usually a healing process. Without the inflammatory process, wounds and infections would not heal, and progressive destruction of the tissue would become life-threatening. Acute inflammation refers to the initial response of the body to invading stimuli and involves the recruitment of plasma and white blood cells (leukocytes) to the injured or infected tissues. Prolonged inflammation, also referred to as chronic inflammation, involves a progressive shift in the type of immune cells which are present at the site of inflammation, and is characterized by simultaneous destruction and healing of the tissue from the inflammatory process.
[0064] However, inflammation sometimes causes harm, usually through a dysfunction of the normal progress of inflammation. Inflammatory diseases are those pertaining to, characterized by, causing, resulting from, or becoming affected by inflammation. “Acute inflammatory conditions” as the term is used herein, and in accordance with normal medical parlance, refers to inflammatory conditions having a rapid onset and severe symptoms. The duration of the onset, from a normal condition of the patient to one in which symptoms of inflammation are seriously manifested, generally lasts up to about 72 hours. Acute inflammatory conditions are to be contrasted with chronic inflammatory conditions, which are inflammatory conditions of long duration, denoting a disease showing little change or of slow progression. The distinction between acute and chronic conditions is well known to those in the medical professions.
[0065] The major immune cells involved in the acute stage of inflammation, as well as in acute inflammatory disorders, include mononuclear cells (e.g., monocytes, which in response to inflammation differentiate into macrophages), dendritic cells, and neutrophils (which migrate to the inflammatory site). These immune cells aid in the inflammatory response by releasing inflammatory mediators such as histamine, interferon-gamma, interleukin-8, leukotriene B4, nitric oxide, etc., and by ingesting bacteria, viruses and cellular debris (a process known as phagocytosis). These cells are known in the art collectively as phagocytes.
[0066] Applicants have discovered that LukAB targets and kills human phagocytes and that this LukAB-mediated cytotoxicity is substantially specific to these cells but not other nucleated mammalian cells. Without intending to be bound by any particular theory of operation, Applicants believe that the LukA/LukB complex forms pores on the plasma membrane of infiltrating phagocytes, causing cell death, thus reducing the inflammation. Thus, the anti-inflammatory compositions of the present invention may be useful in treating acute inflammatory conditions in mammals such as humans, regardless of the cause, e.g., any bacterial or viral infection, and in preferred embodiments, localized acute inflammatory conditions. Other examples of such conditions include allergic contact dermatitis, acute hypersensitivity, acute neurological inflammatory injury (e.g., caused by acute infection), acute myocardial infarction, acute neuronal injury resulting from cardiopulmonary bypass surgery, and acute, localized anti-inflammatory conditions caused by bacterial or viral infection.
[0067] In preferred embodiments, the acute inflammatory condition is an infected wound in the skin or soft tissue. Wounds amenable to treatment with the invention may be in the form of punctures, cuts or tears of the living tissues. Wounds of the skin can penetrate the epidermis, dermis or in the case of full-thickness wounds, the subcutaneous tissue. Thus, wounds treatable with the therapeutic compositions of the present invention include deep sternal wounds, e.g., following open heart surgery and post-operative wounds following abdominal and any other types of surgery. Other wounds are those which result from trauma such as by gun shots, knives, or any other object able to cause a cut or tear in the skin. Wounds that arise as a side-effect of medication or as a symptom of various pathologies (e.g., sores associated with Kaposi's Sarcoma), as well as internal wounds (e.g. anal fissures, and wounds or lesions to the gastrointestinal tract, such as ulcers in the stomach or intestines) may also be amenable to treatment with the present invention.
[0068] Yet other acute inflammatory conditions that may be amenable to treatment with the therapeutic compositions of the present invention include conjunctivitis, iritis, uveitis, central retinitis, external otitis, acute suppurative otitis media, mastoiditis, labyrinthitis, chronic rhinitis, acute rhinitis, sinusitis, pharyngitis, tonsillitio, contact dermatitis, dermonecrosis, diabetic polyneuritis, polymyositis, myositis ossificans, degenerative arthritis, rheumatoid arthritis, periarthritis scapulohumeralis, and osteitis deformans.
S. aureus Infections
[0069] The present invention also provides a method of inhibiting onset of or treating S. aureus infection by administering the antibody compositions to a mammalian subject in need thereof. For purposes of the present invention, the target subject population includes mammals, such as humans, who are infected with, or at risk of being infected by S. aureus. In some embodiments, the subject to be treated is infected with S. aureus including MRSA, and/or has already been treated with antibiotics or other therapeutic agents, but the treatment has failed.
Therapeutically Effective Amounts
[0070] In the context of treatment of acute inflammatory conditions, the amounts of LukA and LukB are therapeutically effective in the sense that treatment is capable of achieving any one or more of a reduction in the number of symptoms, a decrease in the severity of at least one symptom, or a delay in the further progression of at least one symptom, or even a total alleviation of the acute inflammatory condition.
[0071] In the context of use of the therapeutic compositions as passive or active vaccines in connection with S. aureus infection, the therapeutically effective amounts of LukA and LukB, or anti-LukA and anti-LukB antibodies, are also prophylactically effective in the sense that administration of the composition is capable of achieving any one or more of inhibition or prevention of an S. aureus infection in those who are at risk, and in terms of mammalian subjects infected with S. aureus, a reduction in the number of symptoms, a decrease in the severity of at least one symptom, or a delay in the further progression of at least one symptom, or even a total alleviation of the infection.
[0072] Broadly, the therapeutically effective amounts of LukA, LukB, and anti-LukA and anti-LukB antibodies can be determined in accordance with standard procedures, which take numerous factors into account, including, for example, the concentrations of these active agents in the composition, the mode and frequency of administration, the severity of the acute inflammatory condition or S. aureus infection to be treated (or prevented), and subject details, such as age, weight and overall health and immune condition. General guidance can be found, for example, in the publications of the International Conference on Harmonization and in REMINGTON'S PHARMACEUTICAL SCIENCES (Mack Publishing Company 1990). A clinician may administer LukA and LukB or anti-LukA and anti-LukB antibodies, until a dosage is reached that provides the desired or required prophylactic or therapeutic effect. The progress of this therapy can be easily monitored by conventional assays.
[0073] Therapeutically effective amounts of LukA and LukB typically range from 1-400 μg of each of LukA and LukB, per dose or on a daily basis. Preferably, the amounts of LukA and LukB are substantially the same. Therapeutically effective amounts of the antibody compositions typically are at least 50 mg composition per kilogram of body weight (mg/kg), including at least 100 mg/kg, at least 150 mg/kg, at least 200 mg/kg, at least 250 mg/kg, at least 500 mg/kg, at least 750 mg/kg and at least 1000 mg/kg, per dose or on a daily basis. Dosages for monoclonal antibody compositions might tend to be lower, such as about one-tenth of non-monoclonal antibody compositions, such as at least about 5 mg/kg, at least about 10 mg/kg, at least about 15 mg/kg, at least about 20 mg/kg, or at least about 25 mg/kg.
Modes of Administration
[0074] Prior to administration, the therapeutic compositions of the present invention may be sterilized which can be readily accomplished by filtration through sterile filtration membranes, prior to or following lyophilization and reconstitution. Therapeutic compositions may be placed into a container having a sterile access port, for example, an intravenous solution bag or vial having a stopper pierceable by a hypodermic injection needle.
[0075] The anti-inflammatory composition may be administered by any number of routes in accordance with accepted medical practice. Preferred modes include intravenous, intramuscular, subcutaneous and percutaneous administration, using techniques that are known in the art. Other routes of administration may be envisioned. In the case of treatment of acute inflammatory conditions that are localized, non-systemic administration may be preferred in which case the administration of the therapeutic composition is at or around the site of the acute inflammation.
Combination Therapy
[0076] In some embodiments, the therapeutic composition is administered as part of a combination therapy in conjunction with another active agent, depending upon the nature of the acute inflammatory condition or the S. aureus infection that is being treated. Such additional active agents include anti-infective agents, antibiotic agents, and antimicrobial agents. Representative anti-infective agents that may be useful in the present invention include vancomycin and lysostaphin. Representative antibiotic agents and antimicrobial agents that may be useful in the present invention include penicillinase-resistant penicillins, cephalosporins and carbapenems, including vancomycin, lysostaphin, penicillin G, ampicillin, oxacillin, nafcillin, cloxacillin, dicloxacillin, cephalothin, cefazolin, cephalexin, cephradine, cefamandole, cefoxitin, imipenem, meropenem, gentamycin, teicoplanin, lincomycin and clindamycin. Dosages of these antibiotics are well known in the art. See, e.g., MERCK MANUAL OF DIAGNOSIS AND THERAPY, Section 13, Ch. 157, 100.sup.th Ed. (Beers & Berkow, eds., 2004). The anti-inflammatory, anti-infective, antibiotic and/or antimicrobial agents may be combined prior to administration, or administered concurrently (as part of the same composition or by way of a different composition) or sequentially with the inventive therapeutic compositions of the present invention.
[0077] In some embodiments, the anti-LukA and/or anti-LukB antibody composition is multivalent in that it also contains an antibody that specifically binds another bacterial antigen (and that optionally neutralizes the other bacterial antigen). The antibodies may specifically bind any of the antigens described herein in the context of the vaccine compositions. Thus, for example, the other antibody may specifically bind polysaccharides or glycoproteins, including S. aureus Type 5, S. aureus Type 8, S. aureus 336, leukocidin components such as PVL (including the individual PVL subunits, LukS-PV and LukF-PV) gamma-hemolysin subunits (HlgA, HlgB, and HlgC), LukE or LukD from S. aureus, LukM or LukF′-PV from S. aureus, lipoteichoic acid (LTA) and microbial surface components recognizing adhesive matrix molecule (MSCRAMM) proteins.
Treatment Regimens
[0078] Therapeutic compositions of the present invention may be administered in a single dose, or in accordance with a multi-dosing protocol. For example, relatively few doses of the therapeutic composition are administered, such as one or two doses. In embodiments that include conventional antibiotic therapy, which generally involves multiple doses over a period of days or weeks, the antibiotics can be taken one, two or three or more times daily for a period of time, such as for at least 5 days, 10 days or even 14 or more days, while the antibody composition is usually administered only once or twice. However, the different dosages, timing of dosages and relative amounts of the therapeutic composition and antibiotics can be selected and adjusted by one of ordinary skill in the art.
Methods of Identifying Inhibitors of LukAB-mediated Cytotoxicity and Altered Forms of LukA and LukB that have Less Toxicity
[0079] The anti-LukA and anti-LukB antibodies, and fragments thereof, as well as other potential therapeutic moieties (e.g., small organic molecules) may be used in various methods (including assay formats or screens) to evaluate their ability to inhibit LukAB-mediated cytotoxicity. As described below, these methods are designed to identify agents that inhibit some aspect of the cascade of events that leads to LukAB-mediated cytotoxicity and lysis of human phagocytes. The methods are also designed to identify altered forms of LukA and LukB that possess reduced toxicity relative to their native counterparts. The targeted events that are part of the cascade include for example, binding of LukA to phagocyte membranes, binding of LukB to LukA (LukAB oligomerization), and blockage of the membrane pore formed by the LukAB oligomer. The assay formats generally require human phagocytes (or LukAB membrane-binding portion thereof), suitable culture medium, and purified LukA or purified LukA and LukB.
[0080] The person of skill will appreciate that the following protocols are merely illustrative and that various operating parameters such as reaction conditions, choice of detectable label and apparati (e.g., instrumentation for detection and quantification) may be varied as deemed appropriate.
[0081] The following methods are generally directed to identifying agents that inhibit LukAB cytotoxicity, without necessarily revealing the exact event in the cascade that is affected.
[0082] To identify inhibitors of LukAB cytotoxicity, human phagocytes (e.g., PMN-HL60 cells) may be plated in 384-well clear-bottom black tissue culture treated plate (Corning) at 5×10.sup.3 cells/well in a final volume of 50 μl of RPMI (Gibco) supplemented with 10% of heat inactivated fetal bovine serum (FBS). Cells may then be contacted/mixed/reacted/treated with the test compound/molecule (˜5 μl/different concentrations) and then intoxicated with LukA and LukB, which in preferred embodiments are substantially purified (5 ul of a 0.001-2 μM solution), preferably added together, under culture conditions to allow for intoxication of the phagocytes by LukA and LukB, e.g., for 1 hr at 37° C., 5% CO.sub.2. As controls, cells may be treated with culture medium (100% viable) and with 0.1% v/v Triton X100 (100% death).
[0083] In these embodiments, cells treated as described above may then be incubated with a dye to monitor cell viability (which enables determination of cell viability via absorbance by measuring the number of viable cells in a culture by quantification of the metabolic activity of the cells) and incubated for an additional time period (e.g., about 2 hrs at 37° C., 5% CO.sub.2). Cell viability may then be determined such as by measuring the colorimetric reaction at 492 nm using a plate reader e.g., Envision 2103 Multi-label Reader (Perkin-Elmer). Percent viable cells may be calculated such as by using the following equation: % Viability=100×[(Ab.sub.492Sample−Ab.sub.492Triton X)/(Ab.sub.492Tissue culture media). An increase in the 100% viability suggests inhibition of LukAB cytotoxicity.
[0084] A variation of this assay is referred to as a membrane damage assay. In these embodiments, cells treated as described above (e.g., up to and including treating of the cells with test compound/molecule and then intoxicating the cells with purified LukA may then be incubated with a cell-impermeable fluorescent dye such as SYTOX green (0.1 μM; Invitrogen)(in accordance with manufacturer's instructions) and incubated e.g., for an additional 15 minutes at room temperature in the dark. Fluorescence, as an indicator of membrane damage, may then be measured using a plate reader such as Envision 2103 Multilabel Reader (Perkin-Elmer) at Excitation 485 nm, Emission 535 nm. A decrease in fluorescence suggests inhibition of LukAB cytotoxicity.
[0085] Together these assays facilitate the identification of compounds that inhibit or reduce LukAB cytotoxic effects towards human phagocyte cells.
[0086] Additional methods may be used, independently or in conjunction with the methods described above, particularly if the above methods reveal inhibitory activity, that will enable a person skilled in the field to determine more precisely what event in the biochemical cascade is being affected or targeted by the agent. These events include binding of LukA to phagocyte membranes, binding of LukB to LukA (LukAB oligomerization), and blockage of the membrane pore formed by the LukAB oligomer.
Screen for Inhibitors of LukA Binding to Target Cells
[0087] To screen for inhibitors that block or reduce LukA binding to target cells, which is believed to be the first step in the intoxication process, human phagocytes (e.g., PMN-HL60 cells) may be plated in 384-well flat-bottom tissue culture treated plates (Corning) at 2.5×10.sup.3 cells/well in a final volume of 50 μl of RPMI (Gibco) supplemented with 10% of heat inactivated fetal bovine serum (FBS). Cells may then be treated with the test compound/molecule (˜5 μl/different concentrations) and intoxicated with purified, fluorescently labeled LukA (e.g., FITC, Cy3, Cy5, APC, PE) 5 ul of a ˜0.01-2 μM solution for 1 hr at 37° C., 5% CO.sub.2. To evaluate the efficacy of the tested compounds/molecules, the cell-associated fluorescence may be measured as an indicator of LukA binding to cells e.g., using an automated fluorescence microscopic imaging system designed for high content screening and high content analysis (e.g., Cellomics ArrayScan HCS Reader (Thermo Scientific) (Excitation 485 nm, Emission 535 nm)).
Screen for Inhibitors of LukA-LukB Oligomerization/Interaction
[0088] To screen for inhibitors that block or reduce LukA/LukB interaction, which is believed to be the second step in the intoxication process, human phagocytes (e.g., PMN-HL60 cells) may be plated in 384-well flat-bottom tissue culture treated plates (Corning) at 2.5×10.sup.3 cells/well in a final volume of 50 μl of RPMI (Gibco) supplemented with 10% of heat inactivated fetal bovine serum (FBS). Cells may then be treated with the test compound/molecule and then intoxicated with a mixture of purified LukA and purified LukB where LukB is fluorescently-labeled with a fluorescence molecule such as FITC, Cy3, Cy5, APC, and PE, and allowed to stand to complete the intoxication process (e.g., for 1 hr at 37° C., 5% CO.sub.2). To evaluate the efficacy of the tested compounds/molecules, cell-associated LukB-FITC fluorescence may be measured as an indicator of LukA/LukB-FITC interaction, using for example, an automated fluorescence microscopic imaging system designed for high content screening and high content analysis (e.g., a Cellomics ArrayScan HCS Reader (Thermo Scientific) (Excitation 485 nm, Emission 535 nm)).
Screen for Inhibitors of LukAB pore formation
[0089] To screen for inhibitors that block or inhibit formation of the LukAB pore, the effector molecule that leads to cell lysis, human phagocytes (e.g., PMN-HL60 cells) may be plated in 384-well clear-bottom black tissue culture treated plate (Corning) at 2.5×10.sup.3 cells/well in a final volume of 50 μl of RPMI (Gibco) supplemented with 10% of heat inactivated fetal bovine serum (FBS). Cells may then be treated with the test compound/molecule (˜5 μl containing different concentrations) and then intoxicated with purified LukAB (0.001-2 μM) for 10 minutes at 37° C., 5% CO.sub.2. As controls, PMN-HL60 cells may be treated with culture medium (negative control) and with 0.1% v/v Triton X100 (positive control).
[0090] To directly evaluate LukAB pores on the surface of host cells, an ethidium bromide (EB) influx assay may be used. EB is a small-cationic dye that is impermeable into healthy host cells. Upon formation of cationic pores by LukAB, EB enters the cells and binds to DNA, which results in fluorescence. Cell treated in this fashion may then be incubated with EB (5 μM) for an additional 5 minutes at room temperature in the dark. To evaluate the efficacy of the tested compounds/molecules in inhibiting LukAB pore-formation the fluorescence may be measured as an indicator of pore-formation, using a plate-reader such as the Envision 2103 Multilabel Reader (Perkin-Elmer) at Excitation 530 nm, Emission 590 nm. This assay facilitates the identification of molecules that can block or inhibit the LukAB pore, which will alleviate LukAB-mediated toxicity.
Method to Determine the Production of LukAB by S. aureus Clinical Isolates to Predict Severity of Infection
[0091] An even further aspect of the present invention is directed to a method of predicting or assessing severity of an S. aureus infection which entails detecting presence or amount of LukA and/or LukB, or their corresponding genes, in a biological sample obtained from an infected subject. Thus, detection of presence or relatively high amounts of LukA and/or LukB, or detection of their corresponding genes (e.g., as exhibited by S. aureus strain Newman, 4645, and MRSA strains USA300 and USA500) relative to a control (e.g., S. aureus strains USA100 and USA400) which produces little or undetectable amounts of LukA and/or LukB, is indicative of a severe infection. In regard to detection or presence of relative amounts of LukA and/or LukB, reference may be made to the illustrations in
Immunoblot Analysis to Determine LukA and LukB Levels
[0092] To determine LukAB levels (i.e., LukAB production), the biological sample e.g., a fluid (e.g., blood) or tissue sample, is obtained from the infected subject, followed by exposing the culture to suitable culture conditions to allow for growth of the S. aureus, obtaining culture supernatant, separating bacterial proteins therefrom, identifying LukA and/or LukB, and then quantifying LukA and/or LukB. More specifically, in one embodiment, the clinical isolate strains may be selected and grown in a suitable culture medium, e.g., Royal Park Memorial Institute culture medium 1640 (RPMI; Invitrogen) supplemented with 1% casamino acids (RPMI+CAS) under suitable culture conditions, e.g., for 12-18 hours at 37° C. with shaking at 180 rpm. Bacteria may then be precipitated via centrifugation and culture supernatants collected. Culture supernatants (˜30 μl) may then be mixed with 10 μl of SDS-Laemmli buffer and boiled at 95° C. for 10 minutes. Proteins may then then be separated e.g., using 15% SDS-PAGE gels and then transferred to a solid support, e.g., a nitrocellulose membrane. The membranes may then be incubated with antibodies directed against LukA or LukB (e.g., rabbit polyclonal antibodies), and the presence of LukA or LukB may be visualized by detecting the antibody-LukA/antibody-LukB complexes with a secondary antibody conjugated to a fluorophore (e.g., anti-rabbit antibody conjugated to AlexaFluor-680; Invitrogen). Membranes may then be dried and scanned e.g., using an Odyssey infrared imaging system (LI-COR Biosciences) to determine the amounts of LukA and LukB. Polymerase chain reaction (PCR) to determine the presence of the LukA and/or LukB genes.
[0093] To determine the presence of the genes encoding for LukAB, the biological sample is obtained from the infected subject, followed by exposing the culture to suitable culture conditions to allow for growth of the S. aureus, extracting nucleic acid from the cultured S. aureus, and then conducting at least one round of nucleic acid amplification using PCR or other suitable amplification protocol, using LukA and/or LukB-specific primers, and detecting LukA and/or LukB. Thus, in one representative embodiment, following initial sample preparation, the clinical isolate strains may be grown in grown on solid medium e.g., tryptic soy broth (TSB) solidified with 1.5% agar at 37° C. S. aureus colonies may then be selected and enzymatically digested, e.g., with 2 mg/ml lysostaphin (AMBI PRODUCTS LLC) in TSM buffer (100 mM TRIS pH7, 500 mM sucrose, 10 mM MgCl.sub.2)] for 10 minutes at 37° C. Samples may then be centrifuged, the supernatant discarded, and the pellet resuspended with 100 μl sterile water, followed by boiling for five minutes at 100° C., and centrifugation The supernatant provides the starting material and the DNA template for an amplification reaction such as PCR using LukA and/or LukB-specific primers.
WORKING EXAMPLES
[0094] The invention will now be described by reference to the following non-limiting examples. Unless specified otherwise, all parts are by weight.
Example 1: Expression and Purification of Recombinant LukA and LukB Under Native Conditions: pMAL Expression System
[0095] The LukA and LukB genes were amplified from S. aureus DNA with Taq polymerase under standard PCR settings with an annealing temperature of 55° C. using the following primers: 5′-ccc-GTCGAC-tta-TCCTTCTTTATAAGGTTTATTGTC-3′ (SEQ ID NO:30) and 5′-ccc-GAAGGATTTCACATCATCATCATCATCACAATTCAGCTCATAAAGACTCTC-3′ (SEQ ID NO:31) for LukA and 5′-CCCCGAAGGATTTCaCATCATCATCATCATCACAAGATTAATTCTGAAATCAA ACAAG-3′ (SEQ ID NO:32) and 5′-ccc-GTCGAC-tta-TTTCTTTTCATTATCATTAAGTACTT-3′ (SEQ ID NO:33) for LukB. The LukA and LukB gene products were digested with Nde1 and Sal1 (New England BioLabs) and ligated into the pMAL-c4X vector (New England BioLabs). The constructs were transformed into the E. coli strain DH5a and the plasmid inserts were confirmed through sequencing. The transformants were grown in Terrific Broth with 100 ug/ml of ampicillin and 0.2% glucose at 37° C. until cultures reached an A600 of −0.5. The expression of 6-his-tagged MBP-LukA or 6-his-tagged MBP-LukB was induced with 0.3 mM isopropyl β-D-1-thiogalactopyranoside (IPTG) at 16° C., overnight, with 180 rpm shaking.
[0096] After the induction, the cells were harvested through centrifugation at 4000 rpm at 4° C. for 20 min and resuspended in ice cold Column Buffer (20 mM Tris-HCL, 200 mM NaCl, and 1 mM EDTA) supplemented with EDTA-free protease inhibitor (Roche). The bacterial cells were sonicated on ice for 1 min (10 sec pulses). The samples were centrifuged at 10,000 rpm at 4° C. for 30 min and the supernantant was collected and applied to an amylose resin column. The columns were washed two times with Column Buffer and purified 6-his-tagged MBP-LukA or 6-his-tagged MBP-LukB was eluted in 10 fractions with Column Buffer supplemented with 10 mM maltose.
Example 2: Expression and Purification of Recombinant Active LukA, LukAΔ10C, Δ33NLukA and LukB Toxins: pET14b Expression System
[0097] The LukA, LukAΔ10C, Δ33NLukA and LukB genes were amplified from S. aureus DNA with Vent polymerase (New England BioLabs) under standard PCR settings with an annealing temperature of 55° C. using the following primers: 5′-cccc-CTCGAG-AATTCAGCTCATAAAGACTCTCAAG-3′ (SEQ ID NO:34) and 5′-cccc-GGATCC-tta-TCCTTCTTTATAAGGTTTATTGTC-3′ (SEQ ID NO:35) for LukA; 5′-cccc-CTCGAG-AATTCAGCTCATAAAGACTCTCAAG (SEQ ID NO:34) and 5′-cccc-GGATCC-tta-ATATTTATCAACGACTTTAACTG (SEQ ID NO:36) for LukAΔ10C; 5′-cccc-CTCGAG-TCAACAGCACCGGATGATATTG (SEQ ID NO:37) and 5′-cccc-GGATCC-tta-TCCTTCTTTATAAGGTTTATTGTC (SEQ ID NO:35) for Δ33NLukA; 5′-cccc-CTCGAG-AAGATTAATTCTGAAATCAAACAAG-3′ (SEQ ID NO:38) and 5′-cccc-GGATCC-tta-TTTCTTTTCATTATCATTAAGTACTTT-3′ (SEQ ID NO:39) for LukB. The gene products were digested with Xho1 and BamH1 (New England BioLabs) and ligated into the pET14b vector (Novagen) fusing the coding sequence of a histidine-tag to the 5′-region of the genes. The expression plasmids were transformed into the E. coli strain DH5α and the plasmid inserts were confirmed through sequencing. The plasmids were purified and transformed into the expression E. coli strain T7 lysY/lq (New England BioLabs).
[0098] For purification under denaturing conditions the transformants were grown in Terrific Broth with 100 μg/ml of ampicillin at 37° C. until cultures reached an A600 of ˜0.5. The expression of 6-his-tagged LukA or 6-hisLukB was induced with 0.4 mM IPTG at 37° C., for 3 hrs, with 180 rpm shaking. After the induction, the cells were harvested through centrifugation at 4000 rpm at 4° C. for 15 min and then resuspended in 1×TBS (50 mM Tris, 150 mM NaCl, pH 7.5). The bacterial cells were sonicated on ice for 2 min (10 sec pulses). The sonicated bacteria were ultracentrifuged for 30 min at 50,000 rpm. The pellets were resuspended in lysis buffer (100 mM NaH2PO4, 10 mM Tris, 8M urea, pH 8.0) and incubated at room temperature for 30 min on a rotisserie. The samples were centrifuged at 13,000 rpm for 30 min and the supernatants were applied to a column containing Ni-NTA resin (Qiagen). The column was washed two times with wash buffer (100 mM NaH.sub.2PO.sub.4, 10 mM Tris, 8M urea, pH 6.3) and the protein was eluted from the column using elution buffer (100 mM NaH.sub.2PO.sub.4, 10 mM Tris, 8M urea) at pH 5.9 and at pH 4.5. The fractions containing purified protein, as determined by SDSPAGE, were pooled, diluted 1:1 in tris buffered saline (TBS; 500 mM Tris, 1.5M NaCl, pH 7.5), and dialyzed in TBS at 4° C. overnight to remove the urea and allow refolding. Purified 6-his-tagged LukA and LukB were quantified using the Thermo Scientific Pierce BCA Protein Assay Kit.
[0099] For purification under native conditions the transformants were grown in Luria-Bertani broth with 100 μg/ml of ampicillin at 37° C. until cultures reached an A600 of −0.5. The expression of 6-his-tagged LukA, 6-his-tagged LukAΔ10C, 6-his-tagged A33NLukA or 6-hisLukB was induced with 0.05-0.1 mM IPTG at 25-30° C., for 3 hrs, with 220 rpm shaking. After the induction, the cells were harvested through centrifugation at 4000 rpm at 4° C. for 15 min and then resuspended in 1×TBS (50 mM Tris, 600 mM NaCl, pH 7.5) with 10 mM imidazole and HALT EDTA-free protease inhibitor cocktail (Thermo Scientific). The bacterial cells were sonicated on ice. The sonicated bacteria were centrifuged for 20 min at 20,000 rpm. The supernatants were incubated with Ni-NTA resin (Qiagen) for 1 hr at 4° C. on a rotisserie. The samples were applied to a column and the column was washed with wash buffer 1×TBS (50 mM Tris, 600 mM NaCl, pH 7.5) with 25 mM imidazole. The protein was eluted from the column using 50-500 mM imidazole in elution buffer 1×TBS (50 mM Tris, 600 mM NaCl, pH 7.5). The fractions containing purified protein, as determined by SDS-PAGE, were pooled, diluted 1:1 in 1×TBS (50 mM Tris, 150 mM NaCl, pH 7.5), and dialyzed in 1×TBS at 4° C. overnight. Purified 6-his-tagged LukA and LukB were quantified using the Thermo Scientific Pierce BCA Protein Assay Kit.
Example 3: Expression and Purification of Denatured Recombinant LukA and LukB
[0100] The LukA and LukB genes were amplified from S. aureus DNA with Vent polymerase (New England BioLabs) under standard PCR settings with an annealing temperature of 55° C. using the following primers: 5′-ggg-CATATG-AATTCAGCTCATAAAGACTCTCAA-3′ (SEQ ID NO:40) and 5′-ccc-GTCGAC-TCCTTCTTTATAAGGTTTATTGTC-3′ (SEQ ID NO:41) for LukA and 5′-ggg-CATATG-AAGATTAATTCTGAAATCAAACAAG-3′ (SEQ ID NO:42) and 5′-ccc-GTCGAC-TTTCTTTTCATTATCATTAAGTACTT-3′ (SEQ ID NO:43) for LukB. The LukA and LukB gene products were digested with Nde1 and Sal1 (New England BioLabs) and ligated into the pET41b vector (Novagen). The constructs were first transformed into DH5α cells and then transformed into the E. coli expression strain ER2566 (New England BioLabs). The transformants were grown in Terrific Broth with kanamycin, 25 ug/ml, for 2.5 hrs at 37° C. and expression of LukA and LukB was induced with 0.3 mM IPTG at 37° C. for 2 hrs with 180 rpm shaking. The cells were pelleted and resuspended in 1×TBS (500 mM Tris, 1.5M NaCl, pH 7.5) and sonicated on ice for 1 min (10 sec pulses). The sonified bacteria were ultra-centrifuged for 30 min at 50,000 rpm.
[0101] In order to purify the C-terminal 6-his-tagged LukA and LukB under denaturing conditions, the pellets were resuspended in lysis buffer (100 mM NaH.sub.2PO.sub.4, 10 mM Tris, 8M urea, pH 8.0) and incubated at room temperature for 30 min on a rotisserie. The samples were centrifuged at 13,000 rpm for 30 min and the supernantants were applied to a Ni-NTA column. The columns were washed two times with wash buffer (100 mM NaH.sub.2PO.sub.4, 10 mM Tris, 8M urea, pH 6.3) and LukA and LukB were eluted from the columns using elution buffer (100 mM NaH.sub.2PO.sub.4, 10 mM Tris, 8M urea) at pH 5.9 and at pH 4.5. Purified 6-his-tagged LukA and LukB were quantified using the BioRad DC Protein Assay.
Example 4: Production of Anti-LukA and Anti-LukB Polyclonal Antibodies
[0102] Denatured-recombinant LukA (250 μg) emulsified in Freund's Complete Adjuvant (FCA) was injected into New Zealand White rabbits. Animals were boosted with recombinant LukA (125 μg) emulsified in Incomplete Freund's Adjuvant (FCA) at day twenty one (21) and at day forty-nine (49).
[0103] Denatured-recombinant LukB (250 μg) emulsified in Freund's Complete Adjuvant (FCA) was injected into New Zealand White rabbits. Animals were boosted with recombinant LukB (125 μg) emulsified in Incomplete Freund's Adjuvant (FCA) at day twenty one (21) and at day forty-nine (49).
Example 5: Leukocidin AB is Predominantly Responsible for the Cytotoxin-Mediated Killing of Human Phagocytes Through Membrane Disruption
Cell Lines Used
[0104] As a model to study how LukAB targets and kills human phagocytes HL-60 cells (ATCC CCL-240, a human promyelocytic cell line), were used. HL-60 cells were grown in RPMI medium (Gibco) supplemented with 10% of heat-inactivated fetal bovine serum (FBS) at 37° C. with 5% CO.sub.2. To differentiate HL-60 into neutrophil-like cells (PMN-HL60), cultures were supplemented with 1.5% (v/v) dimethylsulfoxide (DMSO) and grown for 4 days.
Methods/Assays Used
Cell Toxicity Assay
[0105] To evaluate the viability of mammalian cells after intoxication with Staphylococcus aureus leukocidin AB (LukAB), PMN-HL60 cells were plated in 96-well flat-bottom tissue culture treated plates (Corning) at 1×10.sup.5 cells/well in a final volume of 100 ul of RPMI (Gibco) supplemented with 10% of heat inactivated fetal bovine serum (FBS). Cells were intoxicated for 2 hrs at 37° C., 5% CO.sub.2 with serial 2-fold dilutions of culture filtrate from Staphylococcus aureus strain Newman ranging from 20% to 0.16% v/v in triplicate. Experiments were performed using exoproteins from a wild-type strain and exoproteins from a strain lacking LukAB (mutant strain). Controls for 100% viability included 20% v/v tissue culture media (RPMI+10% heat-inactivated fetal bovine serum), and 20% v/v S. aureus growth media (RPMI+Cas amino acids). 0.1% v/v Triton X100 was used as a control for 100% cell death. After the intoxication, 10 μl of a dye suitable for monitoring cell viability was added to each well and the cells were incubated for an additional 3 hrs at 37° C., 5% CO.sub.2. This dye monitors metabolically active cells (color change), a property lost in dead cells. The colorimetric reaction was measured at 492 nm using a Perkin Elmer Envision 2103 Multilabel Reader. Percent viable cells were calculated using the following equation: % Viability=100×[(Ab.sub.492Sample−Ab.sub.492Triton X)/(Ab.sub.492Tissue culture media).
Membrane Damage Assay
[0106] An alternative assay to measure LukAB-mediated cytotoxicity is to evaluate the integrity of host cell membranes. To this end, a SYTOX green (Invitrogen) permeability assay was employed. Healthy cells are impermeable to SYTOX green, but become permeable to the dye once the cell membrane integrity has been compromised. Inside the cells, SYTOX green binds to DNA and exhibits strong fluorescence.
[0107] To evaluate the integrity of host cell membranes after intoxication with LukAB or ex vivo infection with S. aureus strains, PMN-HL60 cells were plated in 96-well flat-bottom tissue culture treated plates (Corning) at 1×10{circumflex over ( )}5 cells/well in a final volume of 100 ul of RPMI (Gibco) supplemented with 10% of heat inactivated fetal bovine serum (FBS). Cells were either intoxicated with dilutions of culture filtrate from S. aureus strain Newman ranging from 20% to 0.16% v/v or infected with MOIs ranging from 1-100 in triplicate for 2 hrs at 37° C., 5% CO.sub.2. Experiments were performed using a wild-type strain and a strain lacking LukAB (mutant strain). Controls for background fluorescence included 20% v/v tissue culture media (RPMI+10% heat-inactivated fetal bovine serum) and 20% v/v S. aureus growth media (RPMI+Cas Amino acids). After the intoxication or infection, the cells were transferred to 96-well v-bottom plate (Corning) and centrifuged at 1500 rpm for 5 min. The supernatant was discarded and the pellets were resuspended in 100 ul of PBS+SYTOX green (0.111M; Invitrogen). The cells were then transferred to 96-well clear-bottom black tissue culture treated plate (Corning) and incubated at room temperature in the dark for 10 min. Fluorescence was measured using a Perkin Elmer Envision 2103 Multilabel Reader (Excitation 485 nm, Emission 535 nm).
Results
LukAB Targets and Kills Human Primary Phagocytes
[0108] Intoxication of primary human peripheral mononuclear cells (PBMCs) (
LukAB Preferentially Kills Human Phagocytic Cells.
[0109] Intoxication of the neutrophil-like cell line (PMN-HL60) and the macrophage-like cell line (THP1+PMA) with filtered culture supernatants from the S. aureus strain Newman resulted in potent cell death as examined by the Cell Toxicity Assay (
[0110] To further rule out the contribution of other factors present in S. aureus culture supernatant, PMN-HL60 cells were intoxicated with purified-recombinant LukA or LukB. Individual subunits exhibited no detectable cytotoxicity towards PMN-HL60 (
LukAB is Produced by Clinical Relevant Strains of S. aureus
[0111] Immunoblot analyses with a polyclonal antibody raised against LukB revealed that LukB is produced by a series of staphylococcal strains including MRSA strains associated with hospital- and community-acquired infections (USA300, 400, and 500;
LukAB Damages the Membranes of Human Phagocytes
[0112] Intoxication of PMN-HL60 with exoproteins from S. aureus resulted in cell rounding and nuclear swelling, a phenotype dependent on LukAB (
LukAB Protects S. aureus from Host-Mediated Killing, by Targeting and Killing Phagocytes.
[0113] Infection of PMN-HL60 cells with S. aureus WT, ΔlukAB and the ΔlukAB harboring the lukAB expression plasmid (ΔlukAB/pLukAB) revealed that LukAB is required for the ability of S. aureus to disrupt the membrane of phagocytes during staph-phagocyte interaction (
LukAB Contributes to the Pathogenesis of S. aureus In Vivo
[0114] Mice infected retro-orbitally with S. aureus containing a luciferase reporter construct with the LukAB promoter fused to it (pLukAB-Xen1) showed LukAB promoter activity in kidney abscesses, where as a promoterless reporter (pXen1) showed no activity (
LukAB Forms Pores on the Target Cell Membrane that can be Blocked with Polyethylene Glycol
[0115] Intoxication of PMN-HL60 cells with recombinant LukAB (rLukAB) revealed that both rLukA and rLukB bind to target cells as determined via immunoblot with LukA and LukB specific antibodies (
Neutralization of S. aureus Culture Filtrate Cytotoxicity with an α-LukA Polyclonal Antibody.
[0116] Intoxication of PMN-HL60s with S. aureus culture filtrate pre-incubated with various amounts of α-LukA polyclonal antibodies generated in two different rabbits resulted in decreased toxicity of the culture filtrate in a dose-dependent manner (
Identification of a Non-Cytotoxic LukA Truncation Mutant that is Still Recognized by the α-LukA Polyclonal Antibody.
[0117] LukA differs from the other staphylococcal leukotoxin S-subunits in that it has an extension at both the N- and C-terminus. This extension consists of 33 amino acids at the N-terminus and 10 amino acids at the C-terminus (
[0118] All patent publications and non-patent publications are indicative of the level of skill of those skilled in the art to which this invention pertains. All these publications are herein incorporated by reference to the same extent as if each individual publication were specifically and individually indicated as being incorporated by reference.
[0119] Although the invention herein has been described with reference to particular embodiments, it is to be understood that these embodiments are merely illustrative of the principles and applications of the present invention. It is therefore to be understood that numerous modifications may be made to the illustrative embodiments and that other arrangements may be devised without departing from the spirit and scope of the present invention as defined by the appended claims.