COMPOSITIONS AND METHODS FOR THE TREATMENT OF DISEASES BY ENHANCING ARGINASE 2 IN MACROPHAGES
20230295634 · 2023-09-21
Assignee
Inventors
- Claire MCCOY (Dublin 2, IE)
- Chiara SANTI (Dublin 2, IE)
- Jennifer DOWLING (Dublin 2, IE)
- Sally-Ann CRYAN (Dublin 2, IE)
- Remsha AFZAL (Dublin 2, IE)
- Frances NALLY (Dublin 2, IE)
- Connor DUFFY (Dublin 2, IE)
Cpc classification
C12N2310/113
CHEMISTRY; METALLURGY
International classification
C12N15/113
CHEMISTRY; METALLURGY
Abstract
Target site blockers and their use in enhancing Arginase 2 in macrophages to maintain macrophages in an anti-inflammatory and tissue repair phenotype are disclosed herein. Further disclosed are compositions and the use of the compositions for the treatment and/or prophylaxis of diseases mediated by macrophages such as inflammatory diseases, autoimmune diseases, neurological diseases or reparative diseases.
Claims
1. A target site blocker for enhancing Arginase 2 expression in macrophages wherein the target site blocker is specific to miRNA binding sites in Arginase 2.
2. The target site blocker of claim 1, wherein the target site blocker is specific to miRNA binding sites in the 3′untranslated region of Arginase 2.
3. The target site blocker of claim 2, wherein the miRNA binding site is selected from the group consisting of miR-155, miR-1299, miR-199a, miR-199b, miR-10a, miR-10b, miR-1278, miR-570, miR-1252, miR-3202, let-7a, let-7b, let-7c, let-7e, let-7f, let-7g, let-7i, miR-98, miR-1294, or miR-9 binding sites.
4. The target site blocker of claim 1, wherein the target site blocker is specific to a miR-155 binding site in Arginase 2.
5. The target site blocker of claim 1, wherein the target site blocker is a nucleic acid molecule comprising the nucleotide sequence of SEQ ID NO:30, SEQ ID NO:31, SEQ ID NO:32, SEQ ID NO:33, SEQ ID NO:34, SEQ ID NO:35, SEQ ID NO:36, SEQ ID NO:37, SEQ ID NO:38, SEQ ID NO:39, SEQ ID NO:40, SEQ ID NO:41, or a fragment or variant thereof, or a combination thereof.
6. The target site blocker of claim 1, wherein the target site blocker is encapsulated or complexed in a biocompatible particle/nanoparticle.
7. A method for treatment and/or prophylaxis of a condition mediated by macrophages, the method comprising: administering to a subject in need thereof a therapeutically effective amount of a target site blocker for enhancing Arginase 2 expression in macrophages, wherein the target site blocker is specific to miRNA binding sites in Arginase 2.
8. The method of claim 7, wherein the target site blocker is specific to miRNA binding sites in the 3′untranslated region of Arginase 2.
9. The method of claim 7, wherein the target site blocker is specific to a miR-155 binding site in Arginase 2.
10. The method of claim 7, wherein the target site blocker is a nucleic acid molecule comprising the nucleotide sequence of SEQ ID NO:30, SEQ ID NO:31, SEQ ID NO:32, SEQ ID NO:33, SEQ ID NO:34, SEQ ID NO:35, SEQ ID NO:36, SEQ ID NO:37, SEQ ID NO:38, SEQ ID NO:39, SEQ ID NO:40, SEQ ID NO:41, or a fragment or variant thereof, or a combination thereof.
11. The method of claim 7, wherein the condition mediated by macrophages is selected from inflammatory conditions, autoimmune conditions, neurological conditions, or reparative conditions.
12. The method of claim 11, wherein the inflammatory condition or autoimmune condition mediated by macrophages is multiple sclerosis, rheumatoid arthritis, or colitis.
13. The method of claim 11, wherein: the neurological condition mediated by macrophages is a neurodegenerative condition selected from amyotrophic lateral sclerosis, Parkinson's disease, Huntington's disease, Alzheimer's disease, dementia, traumatic brain injury, epilepsy and all versions of epilepsy, Rett syndrome, leukocephalopathy, encephalopatmus, and Nasu-Hakola disease; and the inflammatory conditions are selected from pneumonia, acute respiratory distress syndrome, and Covid-19 related acute respiratory distress syndrome.
14. The method of claim 7, wherein the target site blocker is encapsulated or complexed to a particle carrier, microparticle, implantable scaffold, or biocompatible nanoparticle.
15. A pharmaceutical composition comprising: (i) a target site blocker for enhancing Arginase 2 expression in macrophages, wherein the target site blocker is specific to miRNA binding sites in Arginase 2; and (ii) a biocompatible carrier.
16. The target site blocker of claim 6, wherein the biocompatible nanoparticle is a poly(lactic-co-glycolic acid) nanoparticle (PLGA-NP).
17. The method of claim 8, wherein the miRNA binding site is selected from the group consisting of miR-155, miR-1299, miR-199a, miR-199b, miR-10a, miR-10b, miR-1278, miR-570, miR-1252, miR-3202, let-7a, let-7b, let-7c, let-7e, let-7f, let-7g, let-7i, miR-98, miR-1294, or miR-9 binding sites, or combinations thereof.
18. The method of claim 14, wherein the biocompatible nanoparticle is a poly(lactic-co-glycolic acid) nanoparticle (PLGA-NP).
19. The pharmaceutical composition of claim 15, wherein the biocompatible carrier is a biocompatible nanoparticle carrier.
20. The pharmaceutical composition of claim 19, wherein the biocompatible nanoparticle carrier is a poly(lactic-co-glycolic acid) nanoparticle (PLGA-NP).
Description
BRIEF DESCRIPTION OF THE FIGURES
[0137]
[0138]
[0139]
[0140]
[0141]
[0142]
[0143]
[0144]
[0145]
[0146]
[0147]
[0148]
[0149]
[0150]
[0151] Experimental Data
[0152] Material and Methods
[0153] Cell Culture and Treatments
[0154] Raw 264.7 murine macrophage cell line was obtained from ATCC and cultured in Dulbecco's Modified Eagle's Medium (Sigma-D5796) supplemented with 10% heat-inactivated Fetal Bovine Serum (FBS) (Sigma-F9665) and 1% Penicillin-Streptomycin (pen/strep, 100 U/ml) (Sigma-P4333). Cells were routinely tested to be Mycoplasma negative. Cells were passaged twice a week (1:10) in T75 flasks. All experiments were carried out in early passage numbers, with passage number not exceeding 15 at most.
[0155] Bone marrow was isolated from wild-type (WT) C57BL6/J mice 6-12 weeks old adult female littermates. Mice were euthanized in a CO.sub.2 chamber and death was confirmed by cervical dislocation. Femurs and tibias were isolated in sterile conditions, and the bone marrow was flushed out using Dulbecco's Phosphate Buffered Saline (DPBS). Marrow was spun and incubated with red blood cell (RBC) lysis buffer (Sigma) to remove red blood cells. A single cell suspension was prepared by passing the cells through a 70 m cell strainer (Corning). They were then plated in 10 cm petri dishes in complete DMEM supplemented with 10% heat-inactivated FBS and 1% pen/strep. 20% L929 cells supernatant was also added to the culture to induce bone-marrow derived macrophages (BMDM) differentiation, after which cells were incubated for 6 days. In experiments, BMDM were seeded and stimulated in complete DMEM supplemented with 10% L929 cell supernatant.
[0156] L929 murine fibroblast cell line was obtained by ATCC and maintained in RPMI medium supplemented with 10% FBS and 1% pen/strep. L929 cells supernatant was generated from 20×10.sup.6 L929 cells plated in 40 ml of complete RPMI-1640 in T175 flasks for 10 days after which the media was filtered and frozen at −20° C. until use.
[0157] All cells were incubated in 37° C. with 5% CO.sub.2 levels. Cell viability was determined using Trypan Blue and counted with a haemocytometer.
[0158] Fresh media was added to the cells before stimulation experiments. LPS (Sigma E. coli 0111:B4) was diluted from stock concentration of 1 mg/ml in complete DMEM, and used at a final concentration of 100 ng/ml. Cells were typically stimulated for 24 hours before conducting further assays.
[0159] Experiment 1: The Effect of Arg2 Target Site Blocker on miR-155-Mediated Repression of Arginase 2
[0160]
[0161] The present inventors designed a target site blocker to compete with miR-155-5p (now on referred as miR-155), binding to its specific site within the murine Arg2 3′UTR (MRE at position 30-37) and its sequence is GTAATGCTGTTGTGAA (SEQ ID NO: 14). A scrambled TSB (i.e. not targeting anywhere in the genome, sequence ACGTCTATACGCCCA (SEQ ID NO:15)) was used as negative control (NC) in all experiments.
[0162] The full length murine Arg2 3′UTR luciferase plasmid was amplified using Q5 High-Fidelity DNA Polymerase (NEB) and inserted into XhoI-digested pmirGLO vector (Promega) using the GenBuilder Cloning Kit (Genscript). Plasmids were isolated from bacterial cultures with the Plasmid Midi Kit (Qiagen). In order to prove the specificity of Arg2-TSB (SEQ ID NO:14) for that particular binding site, a mutagenesis reaction was performed to disrupt its MRE at position 30-37 within the 3′UTR region using QuikChange Lightning Site-Directed Mutagenesis Kit (Agilent) using the wt plasmid (i.e. pmir_Arg2_wt) as template. Presence of the mutation in the mutant plasmid (i.e. pmir_Arg2_mut) was subsequently checked by screening with allele-specific oligonucleotide PCR (ASO-PCR) and sequencing. The sequence of cloning, mutagenesis and sequencing primers is reported in Table 2.
TABLE-US-00003 Name Sequence Cloning primers Arg2_clon_F Aacgagctcgctagcctcgaggaaa tactgtactctggcac (SEQ ID NO: 16) Arg2_clon_R Caggtcgactctagactegagtatg atatactaaggtaataaatg (SEQ ID NO: 17) Mutagenesis primers Arg2_TSB_ ctctggcacctttcacaacagcTAA MUT_F Tcagagttgcaaggcattcgaag (SEQ ID NO: 18) Arg2_TSB_ cttcgaatgccttgcaactctgATT MUT_R Agctgttgtgaaaggtgccagag (SEQ ID NO: 19) ASO-PCR primers ASO_Arg2_wt cacctttcacaacagcATTA (SEQ ID NO: 20) ASO_Arg2_mut cacctttcacaacagcTAAT (SEQ ID NO: 21) Sequencing primers pmir_seq_F Gtggtgttgtgttcgtggac (SEQ ID NO: 22) pmir_seq_R Cagccaactcagcttccttt (SEQ ID NO: 23)
[0163] Mutagenesis primers: the mutant nucleotides are reported in capital letter, bold. ASO-PCR primers: Allele-Specific Oligonucleotide primers (wild type and mutant nucleotides in capital letter, bold) were designed to screen mutant from non-mutant colonies after mutagenesis. ASO-forward primers were used in combination with pmir_seq_R. Sequencing primers: pmir_seq_F and pmir_seq_R primers were designed on the plasmid sequence and they were employed for post-cloning screening and sequencing check.
[0164] In the luciferase assay experiments, Raw 264.7 cells were seeded in a 96-wells plate at a final density of 80,000 cells/well and incubated for 24 hours. Cells were then co-transfected with 100 ng of pmir_Arg2_wt or pmir_Arg2_mut and 100 nM of Arg2-TSB (SEQ ID NO:14) or NC-TSB (SEQ ID NO:15). Transfection mixes were prepared in serum free DMEM using TransIT-X2® Transfection Reagent (Myrus). Luciferase activity was assessed at 24 hours after transfection using Dual-Luciferase Reporter Assay (Promega) according to the manufacturer's instructions. RLU (relative luciferase units) expressed as mean value of the firefly luciferase/Renilla luciferase ratio of at least three independent experiments performed in triplicate were used for statistical analyses.
[0165]
[0166] Experiment 2: Arg2 Gene and Protein Expression Analysis
[0167] For Arg2 mRNA expression, Raw 264.7 cells were seeded in a 24-wells plate at a final density of 375000 cells/well and after 24 hours they were transfected with 100 nM of Arg2-TSB (SEQ ID NO:14) or NC-TSB (SEQ ID NO:15) in DMEM serum free medium and Lipofectamine 3000 transfection reagent (ThermoFisher Scientific). At 24 hours post-transfection, cells were stimulated with 100 ng/mL LPS as previously stated for further 24 h. Total RNA was then extracted using TriReagent, and equal quantities were reverse transcribed into cDNA using High Capacity cDNA reverse transcription kit (Applied Biosystems) following the manufacturer's protocol. qRT-PCR was performed on the 7900 HT and 7500 Real-Time PCR System. Primers for Arg2 (forward 5′-GGATCCAGAAGGTGATGGAA-3′ (SEQ ID NO:24), reverse 5′-AGAGCTGACAGCAACCCTGT-3′ (SEQ ID NO:25)) and two housekeeping genes (Rplp0: forward 5-GGACCGCCTGGTTCTCCTAT-3′ (SEQ ID NO:26), reverse 5′-ACGATGTCACTCCAACGAGG-3′ (SEQ ID NO:27); Tbp: forward 5′-GAATTGTACCGCAGCTTCAAAAT-3′ (SEQ ID NO:28) and reverse 5′-CAGTTGTCCGTGGCTCTCTT-3′ SEQ ID NO:29)) were obtained from Sigma. Expression of Arg2 relative to the housekeeping genes was determined using the 2.sup.(-ΔΔCt) method.
[0168] For Arg2 protein expression, Raw 264.7 cells were seeded in a 6-wells plate at a final density of 1.25×10.sup.6 cells/well and after 24 hours they were transfected with 100 nM of Arg2-TSB (SEQ ID NO:14) or NC-TSB (SEQ ID NO:15) in DMEM serum free medium and Lipofectamine 3000 transfection reagent (ThermoFisher Scientific). At 48 hours post-transfection, cells were stimulated with 100 ng/mL LPS as previously stated for further 24 h. Total protein was then extracted using low-stringency lysis buffer (50 mM HEPES (pH 7.5), 100 mM NaCl, 10% glycerol (v/v), 0.5% Nonidet P-40 (v/v), 1 mM EDTA, 1 mM sodium orthovanadate, 0.1 mM PMSF, 1 mg/ml aprotinin, and 1 mg/ml leupeptin). The resulting suspension was centrifuged at 12,000 rpm for 20 min at 4° C., and supernatants were collected and used for SDS-PAGE. Protein samples were normalised by BCA protein assay (Pierce), and denatured by the addition of 4×SDS sample buffer containing 0.2 M DTT and heated at 95° C. for 10 min. Equal volumes of whole-cell lysates from were separated on 4-12% Bis-Tris acrylamide gels (Thermo Fisher Scientific), transferred to polyvinylidene difluoride membranes (Roche), and probed with mouse anti-Arg2 (1:1000, Invitrogen, Cat #MA5-27815) or anti-actin antibodies. Goat anti-mouse IgG, HRP-linked antibody (1:2500, Jackson Immunoresearch, Cat #115-035-003) was used as a secondary antibody for one hour at RT for both Arg2 and p-actin antibodies. Detection was achieved using 20×LumiGLO® Reagent and 20×Peroxide (Cell Signaling Technology, Cat #7003) at the Amersham imager. For quantitative analysis, the signal
[0169] Experiment 3: Cytokine and Nitric Oxide Measurements
[0170] For cytokine measurements, cells were stimulated with LPS as indicated and supernatants removed and analysed for mouse IL-6, TNFα, and IL-1β using Enzyme-linked Immunosorbent Assay (ELISA) (DuoSet, R&D, respectively Cat #DY406, DY410 and DY401) according to manufacturers' instructions. NO production was measured from the same supernatants using the Griess Reagent (Sigma) by addition of reagent to sample in a 1:1 ratio. Absorbance in culture media was detected by a plate reader at 540 nm and compared against a standard curve.
[0171] Experiment 4: Polylactide-Co-Glycolic Acid Nanoparticles (PLGA NPs) Preparation
[0172] Arg2-TSB (SEQ ID NO:14) and NC-TSB (SEQ ID NO:15) (Qiagen) were encapsulated in DOTAP/PLGA NPs using the double emulsion solvent evaporation (DESE) method as previously described. To improve encapsulation efficiency TSBs were condensed with a cationic lipid DOTAP at an N/P (defined as the molar ratio of amine to phosphate groups) ratio of 4:1. Briefly, CFTR-specific LNAs were diluted in 200 μL of RNA-free water and DOTAP was dissolved in 200 μL of Tert-butanol. The TSB solution was added dropwise to the lipid mixture, mixed, and lyophilized overnight. 50 mg of PLGA Resomer® RG 502 H (Sigma Cat #719897) was dissolved in 2.5 mL of chloroform and briefly sonicated. Lyophilized TSB/DOTAP was resuspended in RNase-free water, added to the PLGA solution dropwise with a glass Pasteur pipette and sonicated for a total of 3 bursts of 5 s in continuous pulses mode at 70% amplitude to form the primary water-in-oil emulsion. The primary emulsion was added dropwise to a 2% poly(vinyl alcohol) (PVA) solution and sonicated on ice for 10 min in continuous pulses mode at 70% amplitude to form a secondary water-in-oil-in-water emulsion and then added to 2% PVA. The emulsion was mechanically stirred in the fume hood over night to allow the solvent to evaporate and allow NPs formation. NPs were then collected by centrifugation at 20,000 g for 15 min at 4° C. and washed three times with NaCl 1.13% in deionised water to remove residual PVA. Following this, TSB-PLGA NPs were resuspended in RNase-free water and freeze-dried for 24 h.
[0173] Experiment 5: PLGA NPs Characterisation and Morphology
[0174] Size and zeta-potential of the TSB-PLGA NPs were measured by dynamic light scattering and by Laser Doppler Electrophoresis (LDE), respectively, on a Zetasizer Nano Series (Malvern Instruments). Measurements were made at 25° C. PLGA NPs were prepared at a concentration of 0.5 mg/ml and 1 ml was used for measurement in the instrument. At least three independent batches of NPs, each prepared in triplicate, were used to determine the size distributions and the surface charge of the TSB-PLGA NPs.
[0175] Nanoparticles were visualised by transmission electron microscopy (TEM) in order to further confirm size and determine the morphology. Briefly, TSB-PLGA NPs were prepared at a concentration of 1 mg/ml in deionised water. 5μL of NPs suspension was placed on a Silicon Monoxide/Formvar coated grid (Mason technologies). Samples were allowed to air dry for approximately 10-15 min before being negative stained with 2% uranyl acetate alternative (URA) solution. Excess stain was removed using filter paper and the grids allowed to air dry fully before analysis. Imaging was performed using a Hitachi H-7650 Transmission Electron Microscope (Hitachi High Technologies, Berkshire, UK) at 120 kV.
[0176] Experiment 6: TSB-PLGA NPs Effect on Macrophage Viability and Polarisation Raw 264.7 cells and BMDM were seeded in 96-well plates at a final density of 80000 and 40000 cells/well, respectively, and incubated for 24 hours. Cells were then transfected with Arg2-TSB PLGA NPs or NC-TSB PLGA NPs resuspended in serum-free DMEM at a final concentration of 3 mg/ml. In parallel, cells were also transfected with naked Arg2-TSB (SEQ ID NO:14) and NC-TSB (SEQ ID NO:15) using Lipofectamine 3000 transfection reagent in serum-free DMEM. At 24 hours post-transfection, cells were stimulated with 100 ng/mL LPS as previously stated for further 24 h. Supernatants were collected and used for NO and cytokines measurements using Greiss assay and ELISA respectively, as previously described. The impact of PLGA NPs on cell viability was assessed using CellTiter 96® AQueous One Solution Cell Proliferation MTS Assay (Promega). In order to check the cytotoxicity of TSB-PLGA NPs, supernatants from control wells (i.e. from unstimulated cells) were also employed to measure lactate dehydrogenase (LDH) release from dying cells using CytoTox 96 Non-Radioactive Cytotoxicity Assay (Promega).
[0177]
[0178]
[0179] Overall, lipofectamine transfection reagent showed significant reduction of cell viability and lead to the highest release of LDH in both Raw 264.7 and BMDM cells. PLGA NPs did not decrease cell viability and were not toxic compared to untransfected cells. Triton-X is used as positive control of cell death.
[0180]
[0181]
[0182] Experiment 7: Arg2 TSB and LPS Challenge In Vivo
[0183] Given the efficacy of Arg2 TSB (targeting miR-155 binding site on murine Arg2 3′UTR) in vitro in murine macrophages an in vivo experiment was performed to confirm its ability in increasing Arg2 expression and decreasing pro-inflammatory cytokines secretion. All mice were on a C57BL/6J background and they were housed in the BRF unit at the Royal College of Surgeons in Ireland. Mice were used at 8-12 weeks of age. Animals were maintained according to the regulations of the Health Products Regulatory Authority (HPRA). Age matched female mice were injected by the intraperitoneal (i.p.) route with 10 mg/kg of Arg2 or NC TSB (n=7 per group) for 24 hours, then injected i.p. with 5 mg/kg of LPS (E. coli 0111:B4, Invivogen, n=4 per TSB group) or PBS (n=3 per TSB group) and culled after 8 h. To detect cytokines, peritoneal fluid and sera were collected 8 h following i.p. injection of LPS and stored at −80° C. IL-6, IL-1β and TNF-α levels were measured by ELISAs (R&D Systems). Peritoneal exudate cells (PECs) were isolated by flushing the peritoneum cavity with PBS containing 5 mM EDTA. Cells were centrifuged and total RNA isolated using the RNeasy Plus Mini kit (Qiagen) and stored at −80° C. Equal quantities of RNA were reverse transcribed into cDNA using High Capacity cDNA reverse transcription kit (Applied Biosystems) following the manufacturer's protocol. qRT-PCR was performed on the 7900 HT and 7500 Real-Time PCR System. Primers for Arg2 (forward 5′-GGATCCAGAAGGTGATGGAA-3′, reverse 5′-AGAGCTGACAGCAACCCTGT-3′) and two housekeeping genes (Hprt: forward 5-GAGGAGTCCTGTTGATGTTGCCAG-3′ (SEQ ID NO: 44), reverse 5′-GGCTGGCCTATAGGCTCATAGTGC-3′ (SEQ ID NO: 45); Tbp: forward 5′-GAATTGTACCGCAGCTTCAAAAT-3′ and reverse 5′-CAGTTGTCCGTGGCTCTCTT-3′) were obtained from Sigma. Expression ofArg2 relative to the housekeeping genes was determined using the 2&AAc0 method. Spleens were excised, cut in half, snap-frozen in liquid nitrogen, and stored at −80° C. until time of assay. Spleens were homogenised using Low Stringency Protein Lysis Buffer (LSLB) (Supplemental Methods 1), assayed for protein quantification by BCA assay (Pierce) and western blotting (primary antibodies as follow: Arg2 Invitrogen Cat #MA527815; Arg1 Invitrogen Cat #PA5-85267; Hif-1a CST Cat #PA5-85267; β-actin Sigma Cat #A5441).
[0184] Human Cells Tissue Culture
[0185] THP-1 Human Monocytes
[0186] THP-1 cells were cultured in complete RPMI 1640 (Sigma) supplemented with 2 mM L-glutamine, 10% FBS, and 1% penicillin/streptomycin. They were plated at a density of 2.5×10.sup.5 cells/ml and differentiated using 10 ng/ml phorbol-12-myristate-13-acetate (PMA) (Sigma) for 7 h, after which the media was replaced with PMA-free medium.
[0187] PBMC Isolation and Differentiation to Macrophages
[0188] Human buffy coat whole blood bags were obtained from the Irish Blood Transfusion Service. Peripheral blood mononuclear cells (PBMCs) were isolated using Histopaque-1077 (Sigma, Ireland, Cat. #10771-500ML). CD14 MicroBeads (Miltenyi Biotec Ltd, Surrey, UK Cat. #130-050-201) were used to isolate the CD14 positive monocytes using the LS Columns (Miltenyi Biotec Ltd, Surrey, UK Cat. #130-042-401) and MidiMACS™ Separator attached to a MultiStand (Miltenyi Biotec Ltd, Surrey, UK). Between 1-1.5×10.sup.5 CD14 monocytes were seeded per well in a Falcon®48 well Polystyrene Microplate (Corning, Cat. #351178) in 500 uL of complete RPMI consisting of RPMI 1640 Medium containing GlutaMAX™ Supplement (Gibco, Cat. #61870010) further supplemented with 10% human serum (Sigma Aldrich Ltd, Germany, Cat. #H4522-100ML) and 1% penicillin-streptomycin (Sigma, Cat. #P4333). On day 4 the media was changed (500 uL of complete RPMI) and on Day 10 treatments were applied to the macrophages.
[0189] Transfection with Target Site Blockers
[0190] Several miRCURY LNA miRNA Power Target Site Blockers (TSBs) in vivo ready (5 nmol) (Qiagen, Cat. #339199) were specifically designed to target the 3′UTR of human Arginase-2 messenger RNA (Table 1). Human macrophages were transfected with the TSBs (100 nM) and NC TSB (100 nM) in serum free RPMI 1640 Medium containing GlutaMAX™ using 0.5% Lipofectamine™ 3000 Transfection Reagent (ThermoFisher Scientific, Cat. #L3000008) for 5 hr. Macrophages were rested overnight in fresh complete RPMI and then stimulated the next day with Lipopolysaccharides from Escherichia coli LPS (Sigma E. coli 0111:B4) (100 ng/mL) (Sigma, Cat. #L5543-2ML) in complete RPMI for 24 hr. Supernatants were harvested and stored at −20° C. for ELISA. Macrophages were washed in cold PBS and Low Stringency Protein Lysis Buffer (LSLB) (Supplemental Methods 1) and Tri-Reagent (Sigma, Cat. #T9424) were used was used to harvest proteins and RNA, respectively.
TABLE-US-00004 TABLE 3 Target Site Blocker (TSB) Sequences specifically designed to inhibit the binding of specific microRNAs to the microRNA Response Element (MRE) on the 3′UTR region of human Arginase-2. TSB SEQ ID MicroRNA name TSB Sequence NO: hsa-miR-1299 TSB-1299 TTCTGGAATGCCTGTTG 30 TGAA hsa-miR-199a, TSB-199 TACAGTAGTATTGGTCA 31 hsa-miR-199b hsa-miR-10b, TSB-10 ATACCCTGTGAACTGCA 32 has-miR-10a hsa-miR-1278 TSB-1278 TAGTACTGTAGCATATT 33 hsa-miR-570 TSB-570 CAAGGTAATAAATGCTG 34 TTT hsa-miR-1252 TSB-1252 TGAAGGAACAACAGCAA 35 C hsa-miR-3202 TSB-3202 GGGAAGGGTTTGTGGAC 36 CA hsa-let- TSB- GTGAGGTAGACAGTGTT 37 7a,-7b, Let-7 -7c,-7e, -7f, -7g,-7i, hsa-miR-98 hsa-miR-1294 TSB-1294 TGTGAGGTAGACAGTG 38 TT hsa-miR-9 TSB-9 GCTTTGGTTTTTATTGT 39 hsa-miR-155 TSB- CATAATTCTGGAATGCC 40 155(1) TGT hsa-miR-155 TSB- ATATTGCTGCTGTGGG 41 155(2) CT
[0191] Enzyme-Linked Immunosorbent Assay (ELISA)
[0192] Macrophage supernatants were analysed by enzyme-linked immunosorbent assay (ELISA) using the human TNF-alpha DuoSet ELISA (5 plates) (R&D Systems, Cat. #DY210-05) and the Human IL-6 DuoSet ELISA (5 plates) (R&D Systems, Cat. #DY206-05) according to the manufacturer's instructions.
[0193] Real Time Polymerase Chain Reaction (RT-PCR)
[0194] RNA was extracted from macrophages using Tri-Reagent® as per manufacturer's instructions. 400 ng of RNA was reverse transcribed using the Applied Biosystems™ High-Capacity cDNA Reverse Transcription Kit (Applied Biosystems, Cat. #4368814). Primers were designed using the NCBI database (https://ncbi.nlm.nih.gov/tools/primer-blast) and acquired from Eurofins and Sigma. Primers were designed as outlined in Table 2. Several genes of interest were investigating using Applied Biosystems™ PowerUp™ SYBR@ Green Master Mix. RT-PCR analysis was performed using the 7900HT Fast Real Time PCR System (Applied Biosystems, Cat #4351405). Fold change was calculated using the Delta delta (ΔΔ) Ct method using TBP as the endogenous control. In THP-1 experiments, Rplp0 was also used as endogenous control in addition to TBP. Fold changes were then normalised to the untreated NC TSB.
TABLE-US-00005 TABLE 4 Forward (F) and reverse (R) Sequences of human primers. Concentration Probe Sequence (μM) TNF-α F-5′-CTC GAA CCC CGA GTG ACA-3′ 10 (SEQ ID NO: 46) R-5′-GCT GCC CCT CAG CTT GAG-3′ 10 (SEQ ID NO: 47) CD163 F-5′-CGA GTT AAC GCC AGT AAG-3′ 10 (SEQ ID NO: 48) R-5′-GAA CAT GCT ACG CCA GC-3′ 10 (SEQ ID NO: 49) CCL2 F-5′-TGG AAT CCT GAA CCC ACT TC-3′ 10 (SEQ ID NO: 50) R-5′-CCC CAG TCA CCT GCT GTT AT-3′ 10 (SEQ ID NO: 51) IL-1β F-5′-GCT GGA GAG TGT AGA TCC C-3′ 5 (SEQ ID NO: 52) R-5′-AGA CGG GCA TGT TTT CTG CT-3′ 5 (SEQ ID NO: 53) IL-10 F-5′-CCA GAC ATC AAG GCG CAT GT-3′ 5 (SEQ ID NO: 54) R-5′-GAT GCC TTT CTC TTG GAG C-3′ 5 (SEQ ID NO: 55) MRC1 F-5′-GCT GCC AAC AAC AGA ACG CT-3′ 5 (SEQ ID NO: 56) (CD206) R-5′-TCA GCT GAT GGA CTT CCT GGT-3′ 5 (SEQ ID NO: 57) Arg-2 F-5′-TCA GTG CTG CGG ATC ATG T-3′ 2 (SEQ ID NO: 58) R-5′-CAC TCC TTT TCT TTT CTG CC-3′ 2 (SEQ ID NO: 59) TBP F-5′-GCG GTT TGC TGC GGT AAT C-3′ 2 (SEQ ID NO: 60) R-5′-TCT GGA CTG TTC TTC ACT CT-3′ 2 (SEQ ID NO: 61) Rplp0 F-5′-CCTCATATCCGGGGGAATGTG-3′ 2 (SEQ ID NO: 62) R-5′-GCAGCAGCTGGCACCTTATTG-3′ 2 (SEQ ID NO: 63)
[0195] Western Blot
[0196] Protein was quantified using a BCA Assay according to the manufacturer's instructions. Proteins were separated by sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) using a 10% resolving gel. Gels were transferred to a nitrocellulose membrane (GE Healthcare Amersham™ Protran™, Life Sciences, Thermo Fisher Scientific, Ireland). Membranes were blocked in 5% milk and incubated with diluted primary antibody overnight at 4° C. Details of primary antibodies are outlined in Table 3. β-actin (Santa Cruz Biotechnology Inc., Cat. #SC-47778) and glyceraldehyde 3-phosphate dehydrogenase (GAPDH) (EMD Millipore Corp, USA, Cat. #MAB374, Lot.3481966), were used as loading/housekeeping controls. Enhanced chemiluminescence blots were developed using a Fusion Fx (Vilber) while blots incubated with fluorescent secondary antibody were developed using an Odyssey@ CLx (LiCor). Densitometry analysis was performed using ImageJ Software (National Institutes of Health, US). All targets of interest were normalized to the control treatment or control group and then normalized to the loading/housekeeping control and represented as protein expression relative to control.
TABLE-US-00006 TABLE 5 Western Blot Primary Human Antibodies Antibody Company Catalogue Code Dilution β-Actin (C4) Santa Cruz SC-47778 1:2000 CD68 Santa Cruz SC-20060 1:500 MR (CD206) Cell Signalling 12981 1:500 Arg-2 Abcam Ab137069 1:500 GAPDH EMD Milipore Corp MAB374 1:3000
[0197] Metabolic Flux Analysis
[0198] For metabolic flux analysis THP-1 were plated in a 6-well plate and PMA-differentiated, they were then transfected as per above and after 24 hours scraped, counted and seeded at 5×10.sup.4 cells/well density onto an XFe96-well plate (Agilent Seahorse) in 100 uL of complete RPMI. After 6-8 hours, THP-1 cells were stimulated with LPS (10n/ml) prior to Seahorse analysis. After the 24 hr LPS stimulation, the media was discarded, cells were washed once in Seahorse XF DMEM Medium, pH7.4 (Agilent Tech, Cat. #103575-100) (supplemented with 2 mM glutamine, 1 mM pyruvate and 10 mM glucose (Sigma)) and then 175 uL of Seahorse XF DMEM Medium was added per well to the cell culture plate. The plate was incubated at 37° C. in a C02 free incubator for 45 min. The utility plate was prepared by adding Oligomycin (ATPase inhibitor, 1 μM), Carbonyl cyanide-p-trifluoromethoxyphenylhydrazone (FCCP) (0.9 μM) and Rotenone/Antimycin A (0.5 μM) to the appropriate ports according to the manufacturer's instructions for a standard Mito Stress Test (Agilent, Cat. #103015-100). The utility plate was then loaded into the real time Seahorse XFe96 Analyzer Machine for calibration. Upon completion, the cell culture plate was analysed for 90 min on the real time Seahorse XFe96 Analyzer Machine using the MitoStress template program. The oxygen consumption rate (OCR) and extracellular acidification rate (ECAR) of each well from the cell culture plate were normalised to protein content per well using a BCA Assay (Pierce). Data was analysed using Wave® Software and graphed using Graphpad Prism 8.
[0199] Statistical Analysis
[0200] GraphPad Prism 8.0.0 (GraphPad Software) was used for statistical analysis. A one-way ANOVA test was used for the comparison of more than two groups, with Tukey's test for multiple comparisons. Analysis of data with two or more factors were analysed by a two-way ANOVA with the Sidak's test for multiple comparison. A two-tailed Student's t-test was used when there were only two groups for analysis. All error bars represent standard deviation of the mean (SEM). Significance was defined as *p<0.05, **p<0.01, ***p<0.001, ****p<0.0001. Any specific statistical tests and details of ‘n’ numbers done for experiments are listed under the corresponding figures.
[0201]
[0202]
[0203] Supernatants were analysed for TNF-α and IL-6 using ELISA. The percentage of cytokine detected was expressed relative to the negative control (NC) TSB. Graphs were generated using Graphpad Prism 9.1.0. Graphs are representative of 9 independent experiments performed in triplicate. Statistical analysis was performed using a 2 way ANOVA where *p<0.05, **p<0.01, ***p<0.001, ****p<0.0001. None of the TSBs were able to decrease IL-6 secretion (data not shown). TSB-155(2), TSB-199 and TSB-3202 significantly decreased TNF-α secretion from PBMCs compared to NC TSB and were therefore brought forward for further analyses.
[0204]
[0205]
[0206]
[0207]
[0208]
[0209]
[0210] Supplemental Methods
[0211] Supplemental Method 1:
[0212] Low Stringency Protein Lysis Buffer [100 ml] (for Long Term). [0213] 5 ml of 1 M HEPES Stock solution (made by mixing 23.83g of HEPES powder in 100 ml dH2O) [0214] 2 ml of 5M NaCl stock solution (made by mixing 29.22 g of NaCl powder in 100 ml dH2O) [0215] 10 ml Glycerol solution [0216] 500 ul 0.5% Triton-X [0217] 500 ul of 0.2 M (pH 7) EDTA solution (made by mixing 7.445g EDTA powder in 80 ml dH2O and bringing up pH to ˜7 by adding in sodium hydroxide. Finally brought up to [0218] 100 ml mark by adding more dH2O) Makeup to 100 ml by adding distilled water, mix thoroughly, and store in fridge
TABLE-US-00007 SUPPLEMENTAL TABLE 1 microRNAs with the sequence specificity to bind to the microRNA response element (MRE) on the human Arginase-2 (hArg2) three prime untranslated region (3′UTR) and their respective binding sites. MRE position on hArg2 MicroRNA 3′UTR Binding sites for TSB design hsa-miR- 36-43 Gtttcacaacaggcattccagaattatgaggcattga (SEQ ID NO: 2) 1299 hsa-miR- 163-169 Attttggtgaccaatactactgtaaatgtatttggtt (SEQ ID NO: 3) 199a, hsa- miR-199b hsa-miR-10b, 196-203 Ggttttttgcagttcacagggtattaatatgctacag (SEQ ID NO: 4) has-miR-10a hsa-miR- 215-222 Ggtattaatatgctacagtactatgtaaatttaaaga (SEQ ID NO: 5) 1278 hsa-miR-570 255-261 Cataaacagcatttattaccttggtatatcatactgg (SEQ ID NO: 6) hsa-miR- 291-298 Gtcttgttgctgttgttccttcacatttaagtggttt (SEQ ID NO: 7) 1252 hsa-miR- 448-454 Gttctggtccacaaacccttccctatagaagttcaat (SEQ ID NO: 8) 3202 hsa-let-7a, 739-746 Tagggataacactgtctacctcacagaaatgttaaac (SEQ ID NO: 9) -7b, -7c, -7e, -7f, -7g, -7i, hsa-miR-98 hsa-miR- 741-748 Gggataacactgtctacctcacagaaatgttaaactg (SEQ ID 1294 NO: 10) hsa-miR-9 774-780 Actgagacaataaaaaccaaagcataa (SEQ ID NO: 11) hsa-miR-155 39-46 Cacaacaggcattccagaattatgaggcattgagggg (SEQ ID NO: 12) hsa-miR-155 379-386 Ctgtcagcccacagcagcaatatgcttattctatcca (SEQ ID NO: 13)
[0219] Various modifications and variations to the described embodiments of the inventions will be apparent to those skilled in the art without departing from the scope of the invention. Although the invention has been described in connection with specific preferred embodiments, it should be understood that the invention as claimed should not be unduly limited to such specific embodiments. Indeed, various modifications of the described modes of carrying out the invention which are obvious to those skilled in the art are intended to be covered by the present invention.