SYSTEMS AND METHODS FOR ASSAYING A PLURALITY OF POLYPEPTIDES

20230287490 · 2023-09-14

    Inventors

    Cpc classification

    International classification

    Abstract

    The disclosure provides compositions and methods for assaying the function or properties of a plurality of polypeptides. In particular, the disclosure provides methods for high-throughput characterization of large population of polypeptides. Each polypeptide is displayed on a solid surface, such as a bead, where the solid surface also displays a nucleic acid that encodes the polypeptide. For example, each polypeptide may be covalently linked to a nucleic acid that encodes the polypeptide. In preferred embodiments, the polypeptide and nucleic acid are assayed in parallel, and with the same instrument.

    Claims

    1. A method of high-throughput analysis of a plurality of polypeptides, the method comprising: (a) providing a plurality of beads, wherein a bead of the plurality of beads is conjugated to a different nucleic acid molecule encoding a polypeptide; (b) processing the nucleic acid molecule encoding a polypeptide to produce the encoded polypeptide, wherein the bead of said plurality of beads is conjugated to the encoded polypeptide; (c) assaying the encoded polypeptide to identify one or more properties of the encoded polypeptide; (d) sequencing the nucleic acid molecule encoding the polypeptide to identify a sequence of the nucleic acid molecule encoding the polypeptide; and (d) linking the one or more properties of each polypeptide to the sequence of the nucleic acid molecule encoding the polypeptide.

    2. The method of claim 1, wherein the encoded polypeptide is conjugated directly to the bead.

    3. The method of claim 1, wherein the encoded polypeptide is conjugated to nucleic acid molecule, thereby conjugating the polypeptide to the bead.

    4. The method of claim 1, wherein (a) comprises conjugating each bead of the plurality of beads to a nucleic acid molecule, each nucleic acid molecule encoding a polypeptide of the plurality of polypeptides.

    5. The method of claim 1, wherein (b) comprises expressing the nucleic acid molecule to produce the polypeptide and conjugating the polypeptide to the bead or conjugating the polypeptide to the nucleic acid molecule.

    6. The method of claim 4, wherein step (a) is performed in a first microemulsion droplet.

    7. The method of claim 6, wherein step (a) further comprises amplifying each nucleic acid molecule within each microemulsion droplet, thereby producing a homogeneous population of a nucleic acid molecule on each bead.

    8. The method of any one of claims 4-7, wherein steps (b) and (c) are performed in a second microemulsion droplet.

    9. The method of any one of claims 4-8, wherein step (b) occurs in vitro in a cell free system.

    10. The method of any one of claims 1-9, wherein the nucleic acid is DNA, cDNA, or RNA.

    11. The method of any one of claims 1-10, wherein the nucleic acid molecule and the polypeptide are conjugated by expressed protein ligation or by protein trans-splicing.

    12. The method of any one of claims 1-11, wherein the bead or the nucleic acid molecule is conjugated to a capture moiety and the polypeptide comprises a linkage tag, wherein the capture moiety and the linkage tag are conjugated, thereby conjugating the bead to the polypeptide or conjugating the nucleic acid molecule to the polypeptide.

    13. The method of claim 12, wherein conjugation of the capture moiety and the linkage tag is catalyzed by a linking enzyme.

    14. The method of claim 13, wherein the linking enzyme is encoded by a second nucleic acid.

    15. The method of claim 13, wherein the linking enzyme is an isolated enzyme.

    16. The method of claim 13, wherein the linking enzyme is a sortase, a butelase, a trypsiligase, a peptiligase, a formylglycine generating enzyme, a transglutaminase, a tubulin tyrosine ligase, a phosphopantetheinyl transferase, a SpyLigase, or a SnoopLigase,

    17. The method of claim 16, wherein: the linking enzyme is sortase A; one of the capture moiety or linkage tag comprises a polypeptide which has a free N-terminal glycine residue; and the other of the capture moiety or linkage tag comprises a polypeptide comprising amino acid sequence LPXTG (SEQ ID NO: 1) where X is any amino acid.

    18. The method of claim 16, wherein: the linking enzyme is butelase-1; one of the capture moiety or linkage tag comprises a polypeptide comprising the amino acid sequence X.sub.1X.sub.2XX (SEQ ID NO: 2) where X.sub.1 is any amino acid except P, D, or E; X.sub.2 is I, L, V, or C; and X is any amino acid; and the other of the capture moiety or linkage tag comprises a polypeptide comprising the amino acid sequence DHV or NHV.

    19. The method of claim 16, wherein: the linking enzyme is trypsiligase; one of the capture moiety or linkage tag comprises a polypeptide comprising amino acid sequence RHXX (SEQ ID NO: 3) where X is any amino acid; and the other of the capture moiety or linkage tag comprises a polypeptide comprising the amino acid sequence YRH.

    20. The method of claim 16, wherein: the linking enzyme is omniligase; capture moiety comprises carboxamido-methyl (OCam); and the linkage tag comprises a polypeptide comprising a free N-terminal amino acid acting as an acyl-acceptor nucleophile.

    21. The method of claim 16, wherein: the linking enzyme is formylglycine generating enzyme; the capture moiety comprises an aldehyde reactive group; and the linkage tag comprises a polypeptide comprising the amino acid sequence CXPXR (SEQ ID NO: 4), wherein X is any amino acid.

    22. The method of claim 16, wherein: the linking enzyme is transglutaminase; one of the capture moiety or linkage tag comprises a polypeptide comprising a lysine residue or a free N-terminal amine group; and the other of the capture moiety or linkage tag comprises a polypeptide comprising the amino acid sequence LLQGA (SEQ ID NO: 5).

    23. The method of claim 16, wherein: the linking enzyme is a tubulin tyrosine ligase; one of the capture moiety or linkage tag comprises a polypeptide comprising a free N-terminal tyrosine residue; and the other of the capture moiety or linkage tag comprises a polypeptide comprising the C-terminal amino acid sequence VDSVEGEEEGEE (SEQ ID NO: 6).

    24. The method of claim 16, wherein: the linking enzyme is a tubulin phosphopantetheinyl transferase; the capture moiety comprises coenzyme A (CoA); and the linkage tag comprises a polypeptide comprising the amino acid sequence DSLEFIASKLA (SEQ ID NO: 7).

    25. The method of claim 16, wherein: the linking enzyme is SpyLigase; one of the capture moiety or linkage tag comprises a polypeptide comprising amino acid sequence ATHIKFSKRD (SEQ ID NO: 8); and the other of the capture moiety or linkage tag comprises a polypeptide comprising the amino acid sequence AHIVMVDAYKPTK (SEQ ID NO: 9).

    26. The method of claim 16, wherein: the linking enzyme is SnoopLigase; one of the capture moiety or linkage tag comprises a polypeptide comprising amino acid sequence DIPATYEFTDGKHYITNEPIPPK (SEQ ID NO: 10); and the other of the capture moiety or linkage tag comprises a polypeptide comprising the amino acid sequence KLGSIEFIKVNK (SEQ ID NO: 11).

    27. The method of claim 16, wherein the capture moiety comprises double-stranded DNA and the linkage tag comprises a polypeptide, wherein the capture moiety and the linkage tag form a leucine zipper.

    28. The method of claim 27, wherein: the capture moiety comprises the nucleic acid sequence TGCAAGTCATCGG (SEQ ID NO: 12); and the linkage tag comprises the amino acid sequence TABLE-US-00003 (SEQ ID NO: 13) DPAALKRARNTEAARRSRARKGGC

    29. The method of any one of claims 1-28, wherein each bead is conjugated to 100 or more copies of the nucleic acid molecule.

    30. The method of any one of claims 1-29, wherein each bead is conjugated to 100 or more copies of the encoded polypeptide.

    31. The method of any one of claims 1-30, wherein the plurality of beads of step (a) comprises between 1×10.sup.6 and 1×10.sup.10 beads, wherein each said bead is conjugated to a polypeptide having a unique amino acid sequence.

    32. The method of any one of claims 1-31, wherein one or more copies of the polypeptide having a unique amino acid sequence is conjugated to each of two or more beads within the plurality of beads of step (a).

    33. The method of claim 32, wherein the one or more copies of the polypeptide having a unique amino acid sequence is conjugated to each of between 2 and 15 beads within the plurality of beads of step (a).

    34. The method of any one of claims 1-33, wherein at least one of the one or more functions or properties of each said polypeptide is assayed at a temperature great than 40° C., at a pH greater than 8.0, and/or at a pH less than 6.0.

    35. The method of any one of claims 1-34, wherein the function or property of the polypeptide is a biological activity of the polypeptide.

    36. The method of any one of claims 1-34, wherein at least one of the one or more functions or properties of the polypeptide is a binding property of the polypeptide.

    37. The method of claim 36, wherein the binding property is quantified by a ligand binding assay, an equilibrium binding assay, and/or a kinetic binding assay.

    38. The method of any one of claims 1-34, wherein at least one of the one or more functions or properties of the polypeptide is an enzymatic activity of the polypeptide.

    39. The method any one of claims 1-34, wherein at least one of the one or more functions or properties of the polypeptide is the stability of the polypeptide.

    40. The method of claim 39, wherein the stability of the polypeptide is quantified by thermal denaturation assay, a chemical denaturation assay, or a pH denaturation assay.

    41. The method of any one of claims 1-40, wherein (b)(ii) comprises assaying two or more, three or more, four or more, or five or more properties or functions of the polypeptide.

    42. The method of claim 41, wherein assaying the two or more, three or more, four or more, or five or more properties or functions of the polypeptide is performed simultaneously or sequentially.

    43. The method of any one of claims 1-42, wherein at least one of the functions or properties is assayed at multiple temperatures, at multiple pH levels, in multiple salt concentrations, and/or in multiple buffers.

    44. The method of any one of claims 1-43, wherein the plurality of polypeptides comprises a library of antigens, antibodies, enzymes, substrates, or receptors.

    45. The method of claim 44, wherein the library of antigens comprises viral protein epitopes for one or more viruses.

    46. A method of conjugating a polypeptide to a bead, the method comprising: (a) conjugating a nucleic acid molecule encoding the polypeptide to a bead in a first microemulsion droplet; and (b) processing the nucleic acid molecule in a second microemulsion droplet, wherein processing comprises: (i) expressing the nucleic acid molecule to produce the polypeptide; and (ii) conjugating the polypeptide to the nucleic acid molecule.

    47. The method of claim 46, wherein conjugation of the polypeptide to the nucleic acid molecule is catalyzed by a linking enzyme.

    48. The method of claim 46, wherein the polypeptide is conjugated to the nucleic acid molecule by expressed protein ligation or by protein trans-splicing.

    49. The method of claim 46, wherein the polypeptide is conjugated to the nucleic acid molecule by formation of a leucine zipper.

    50. The method of claim 46, wherein (a) further comprises amplifying the nucleic acid molecule within the first microemulsion droplet, thereby producing a clonal population of the nucleic acid molecule on the bead.

    51. The method of any one of claims 46-50, wherein (b)(i) occurs in vitro in a cell free system.

    52. The method of any one of claims 46-51, wherein the nucleic acid is DNA, cDNA, or RNA.

    53. The method of any one of claim 46-52, wherein conjugation of the polypeptide to the nucleic acid molecule in step b(ii) is catalyzed by a linking enzyme.

    54. The method of any one of claims 46-53, wherein the linking enzyme is encoded by a second nucleic acid.

    55. The method of any one of claims 46-54, wherein the linking enzyme is an isolated enzyme.

    56. The method of any one of claim 46-55, wherein the linking enzyme is a sortase, a butelase, a trypsiligase, a peptiligase, a formylglycine generating enzyme, a transglutaminase, a tubulin tyrosine ligase, a phosphopantetheinyl transferase, a SpyLigase, or a SnoopLigase,

    57. The method of any one of claims 46-56, wherein the nucleic acid molecule is conjugated to a capture moiety and the polypeptide comprises a linkage tag, wherein the capture moiety and the linkage tag are conjugated, thereby conjugating the nucleic acid molecule to the polypeptide.

    58. The method of claim 57, wherein the linking enzyme catalyzes the conjugation of the capture moiety and the linkage tag, thereby catalyzing the conjugation of the polypeptide to the nucleic acid.

    59. The method of claim 57, wherein the capture moiety comprises double-stranded DNA and the linkage tag comprises a polypeptide, wherein the capture moiety and the linkage tag form a leucine zipper.

    60. The method of any one of claims 46-52, wherein the polypeptide is conjugated to the nucleic acid molecule in b(ii) by expressed protein ligation or by protein trans-splicing.

    Description

    BRIEF DESCRIPTION OF THE DRAWINGS

    [0075] FIG. 1 is a diagram illustrating an exemplary method of assaying a plurality of polypeptides. On a bead surface modified with a short DNA oligo (step 1), emulsion PCR is performed to display the polypeptide gene of interest (GOI) and relevant capture moiety (CM) which is covalently linked to the reverse primer (step 2). Emulsion in vitro transcription translation (IVTT) is performed to yield a linking enzyme and the target protein of interest (POI) containing a linkage tag (LT, step 3). During this step, the linking enzyme covalently fuses the CM to the LT resulting in covalent attachment of the POI. Emulsions are broken and the plurality of beads localized and physically addressed on the instrument (step 4). Beads are incubated with a fluorescent target of interest (TOI) to assay POI binding (step 5) via fluorescence measurements. The beads then undergo denaturation to leave behind only single-stranded DNA (ssDNA, step 6). The ssDNA undergoes sequencing by synthesis (step 7) to determine its identity which is fixed to the address determined in step 4. Upon sequencing, analysis yields biophysical data for the entire plurality of polypeptides encoded in the starting DNA library.

    [0076] FIG. 2 is a schematic showing the structures and sequences of the biomolecules and/or peptide motifs on the DNA oligos (indicated by asterisks) and displayed on the proteins (indicated by arrowheads) used to covalently conjugate a protein of interest to its encoding DNA.

    [0077] FIGS. 3A and 3B show histograms of events recorded via flow cytometry in the APC (660±20 nm) fluorescence channel upon excitation with a red laser (633 nm). (FIG. 3A) 10,000 events were collected from SA beads upon incubation with Alexa Fluor 647-labeled DNA. (FIG. 3B) Beads returned to baseline fluorescence levels upon stripping the Alexa Fluor 647-labelled anti-sense DNA strand using 20 mM sodium hydroxide.

    [0078] FIGS. 4A and 4B are graphs showing the distribution of bead populations after fluorescent ddNTP incorporation (sequencing) in the 610±20 nm fluorescence channel upon excitation with a blue laser (488 nm) (FIG. 4A). Distribution of bead populations after sequencing in the 660±20 nm fluorescence channel upon excitation with a red laser (633 nm) (FIG. 4B).

    [0079] FIGS. 5A-C show exemplary flow cytometry results. FIG. 5A is a schematic summary of an exemplary flow cytometry analysis. A bead displaying double-stranded DNA, its encoded polypeptide, and any bound fluorescent anti-FLAG M2 antibody was directed through the flow cytometer and excited by three consecutive lasers (blue, red, and violet). The signals produced upon blue laser excitation yield information regarding the amount of binding to the M2 antibody (assay, FITC channel) and the amount of fluorescent ddUTP incorporation (U, PE channel). The signal produced by red excitation yields information on the amount of fluorescent ddCTP or ddGTP (C/G, APC channel) incorporation. The signal produced upon violet laser excitation yields information on the amount of fluorescent ddATP (A, AmCyan channel) incorporation.

    [0080] FIG. 5B is a plot showing the fluorescent signal of each bead in the relevant channels (APC, PE, AmCyan channels). The fluorescent signal in each channel was analyzed and the beads were assigned a base call which identifies the oligonucleotide being monoclonally displayed on the bead. Because of heterogenous signal generation, some beads do not yield sufficient fluorescence and their displayed oligonucleotide is undetermined. FIG. 5C is a set of graphs showing the fluorescent signal in the assay channel (FITC channel). The fluorescent signal was aggregated for each oligonucleotide population and the mean values were fit to obtain an accurate measurement of binding affinity (colored lines). Overlayed violin plots show the geometric mean (white circle), bars (thick lines) that extend from the first (25%) to the third (75%) quartile, and whiskers (thin lines) that extend to 1.5 times the interquartile range.

    DETAILED DESCRIPTION

    [0081] The disclosure provides compositions and methods for assaying the function or properties of a plurality of polypeptides. In particular, the disclosure provides methods for high-throughput characterization of a large population(s) of polypeptides. Each polypeptide is displayed on a solid surface, such as a bead, where the solid surface also displays a nucleic acid that encodes the polypeptide. For example, each polypeptide may be covalently linked to a nucleic acid that encodes the polypeptide. In preferred embodiments, the polypeptide and nucleic acid are assayed in parallel, and with the same instrument. This enables characterization of large libraries of polypeptides. Multiple assays may be performed, one after another or simultaneously, on the same library of polypeptides without the need for selection, thus allowing each member to be characterized across multiple parameters in a less-costly and time intensive manner as compared to prior art methods.

    Methods for High Throughput Polypeptide Assays on Beads

    [0082] Described herein are methods for high-throughput protein assays performed directly on beads. The high-throughput protein assay methods described herein include, in some embodiments, 1) generating a plurality of beads that each display a unique clonal population of protein encoding-DNA; 2) transcribing and translating the DNA displayed on each bead to generate a unique clonal population of protein variants corresponding to the clonal DNA population of each bead; 3) chemically linking the clonal protein molecules to the DNA molecules displayed on the beads to generate bead-DNA-protein conjugates; 4) characterizing in a common machine, and/or instrument, and/or device a plurality of physicochemical properties, and/or biochemical functions of the proteins of the bead-DNA-protein conjugates; 5) reading the sequences of the DNA molecules of the bead-DNA-protein conjugates to identify the DNA and thus protein sequence of the bead-DNA-protein conjugates; and 6) performing all steps with automation and/or with minimal user intervention. The successful implementation of the methods yields a high-throughput approach to protein assays eliminating the requirement for multiple rounds of conventional directed evolution. A more detailed overview of the steps and the uses of the methods is provided below.

    Displaying Polynucleotides on Beads

    [0083] Methods for displaying clonal populations of polynucleotides on the surface of a plurality of beads are described. In some embodiments, an aqueous solution containing a library of nucleic acids, preferably DNA or cDNA (e.g., of at least 1×10.sup.5 variants, at least 1×10.sup.6 variants, at least 1×10.sup.7 variants, at least 1×10.sup.8 variants, at least 1×10.sup.9 variants, or at least 1×10.sup.6 variants, such as 1×10.sup.5 to 1×10.sup.10 variants, 5×10.sup.5 to 5×10.sup.8 variants, 1×10.sup.6 to 1×10.sup.8 variants, 5×10.sup.6 to 5×10.sup.7 variants, 1×10.sup.7 to 4×10.sup.7 variants, or 2×10.sup.7 to 3×10.sup.7 variants), surface-functionalized beads (e. g., beads with chemical groups added to the surface of each bead to facilitate attachment of the nucleic acid templates), and reagents for linking the nucleic acid to the surface of the functionalized beads, are combined to generate a mixture. The mixture is preferably in an aqueous medium. In some embodiments, nucleic acid variants will have a terminal reactive group that facilitates the immobilization of the nucleic acid variants to the surface functionalized beads. For example, each bead can be functionalized with a polyacrylamide matrix on the surface for immobilization of DNA templates carrying a terminal acrylamide group.

    [0084] In some embodiments, nucleic acid variants will have a terminal small molecule moiety that facilitates immobilization to surface-functionalized beads. For example, each bead can be functionalized with streptavidin for immobilization of DNA templates containing a terminal biotin moiety. In some embodiments, each bead may be functionalized with carboxylic acid functional groups for covalent immobilization of DNA templates containing a terminal amine group. In some embodiments, DNA templates may be fully or partially synthesized on the bead surface via phosphoramidite chemistry as in, e.g., Diamante et al (2013) Protein Engineering Design and Selection 26 (10): 713-724, Sepp et al (2002) FEBS Letters 532 (2002): 455-458, and Griffiths and Tawfik (2003) EMBOJ 22(1): 24-35, herein incorporated by reference in their entireties. The mixture may be emulsified, e.g., in a first microemulsion, to create a large number (e. g., more than 1×10.sup.5, 1×10.sup.6, 1×10.sup.7, 1×10.sup.8, 1×10.sup.9, or 1×10.sup.10, such as 1×10.sup.5-1×10.sup.12) of water-in-oil droplets. The components of the mixture can be tuned, as described herein, to ensure that each droplet contains on average one bead and one or fewer nucleic acid template copies.

    [0085] In some embodiments, the beads can be composed of any one of various materials, including glass, quartz, silica, metal, ceramic, plastic, nylon, polyacrylamide, resin, hydrogel, and, composites thereof. The bead may be a gel bead (e.g., a hydrogel bead). The bead may be formed of a polymeric material. The bead may be magnetic or non-magnetic. In particular embodiments, the beads are substantially homogeneous in size (plus/minus 5% variance) and contain sufficient functional handles to display, e.g., about 10.sup.3-10.sup.6 DNA molecules per bead.

    [0086] In some embodiments, the nucleic acid in each droplet is amplified directly on the surface of the bead via extension of immobilized DNA oligos. In some embodiments, the nucleic acid may be separately amplified in a droplet containing no bead and then fused in a microfluidic channel with a separate droplet containing a bead. In some embodiments, upon generation of the emulsion droplets, the nucleic acid in each droplet is amplified via polymerase chain reaction to create a clonal population of each nucleic acid variant. Physical immobilization of the amplified nucleic acid in each microemulsion droplet can be achieved, e.g., via ligation or extension of immobilized DNA oligos to generate nucleic acid-coated beads (e.g., DNA-coated beads).

    Displaying Polypeptides on Beads

    [0087] Methods for displaying polypeptides on the surface of a plurality of beads are described herein. Starting with nucleic acid-coated beads (e.g., DNA-coated beads), prepared using the methods for displaying polynucleotides on beads, the encoded polypeptide can be expressed and conjugated to the bead (e.g., via conjugation to the nucleic acid which is conjugated to the bead). Conjugation of the polypeptide to the bead (e.g., directly or via attachment to the nucleic acid) may be performed in a second microemulsion step.

    [0088] For example, DNA-coated beads are emulsified in a second microemulsion, along with a mixture that includes reagents for cell-free in vitro transcription and translation (IVTT) methods resulting in the transcription and translation of the DNA on the beads and the production of the encoded polypeptide and/or protein. In some embodiments, the second microemulsion contains reagents for IVTT as well as a catalytic enzyme or solution-phase DNA which codes for a catalytic enzyme and catalyzes the attachment of the polypeptide to the capture moiety on the nucleic acid. The components of the mixture can be tuned, as described herein, to ensure on average one DNA-coated bead and sufficient IVTT reagents.

    [0089] Protein expression may be carried out using an in vitro cell-free expression system. Translation can be performed in vitro using a crude lysate from any organism that provides all the components needed for translation, including, enzymes, tRNA and accessory factors (excluding release factors), amino acids and an energy supply (e.g., GTP). Cell-free expression systems derived from Escherichia coli, wheat germ, and rabbit reticulocytes are commonly used. E. coli-based systems provide higher yields, but eukaryotic-based systems are preferable for producing post-translationally modified proteins. Alternatively, artificial reconstituted cell-free systems may be used for protein production. For optimal protein production, the codon usage in the ORF of the DNA template may be optimized for expression in the particular cell-free expression system chosen for protein translation. In addition, labels or tags can be added to proteins to facilitate high-throughput screening. See, e.g., Katzen et al. (2005) Trends Biotechnol. 23:150-156; Jermutus et al. (1998) Curr. Opin. Biotechnol. 9:534-548; Nakano et al. (1998) Biotechnol. Adv. 16:367-384; Spirin (2002) Cell-Free Translation Systems, Springer; Spirin and Swartz (2007) Cell-free Protein Synthesis, Wiley-VCH; Kudlicki (2002) Cell-Free Protein Expression, Landes Bioscience; herein incorporated by reference in their entireties. In some embodiments the cell-free expression system uses a prokaryotic IVTT mix reconstituted from purified components (e.g., PURExpress). In some embodiments the IVTT includes an E. coli lysate-based system (e.g., S30) to facilitate increased scale (e.g., 10.sup.9 to 10.sup.10 beads). In some embodiments in vitro cell expression is performed using a eukaryotic system (e.g., wheat germ, rabbit reticulocyte, HeLa cell lysate-based,) in order to achieve proper folding or post-translational modification (PTM) of the proteins to be displayed. In some embodiments, the polynucleotides expressed using IVTT methods include non-natural amino acids.

    [0090] In other embodiments, the plurality of polypeptides can be linked to the DNA-bead conjugates to produce protein-DNA-bead conjugates. In some embodiments, linking of the protein to the DNA-coated bead is achieved using a three-part enzymatic linkage system. In some embodiments, the three-part enzymatic linkage system is composed of 1) a linking enzyme; 2) a capture moiety (e.g., a small molecule or peptide capture moiety) of the DNA on the DNA-coated beads; and 3) a linkage tag (e.g., a peptide linkage tag) of the protein (see, e.g., FIG. 2). Use of a three-part enzymatic linkage system may require a modification to the sequence of a polynucleotide encoding the protein to include the polynucleotide sequence encoding a capture moiety. In parallel, inclusion of a linkage tag moiety may be achieved by performing a modification to the sequence encoding the protein.

    [0091] The disclosure also provides methods for conjugating polypeptides to beads (e.g., via conjugation to a nucleic acid which is further conjugated to a bead). Such methods produce smaller and/or more stable methods for linking a polypeptide and a nucleic acid to a bead. This allows assays to be performed at an increased range of conditions (e.g., temperature, pH, or salt concentration). Furthermore, a smaller assembly on the bead decreases off-target effects allowing for a more accurate characterization of the plurality of polypeptides.

    [0092] In some embodiments, the method for conjugating a polypeptide to a bead (e.g., via conjugation to a nucleic acid which is further conjugated to a bead) includes: in a first microemulsion droplet, conjugating a nucleic acid molecule encoding the polypeptide to a bead; and in a second microemulsion droplet, expressing the nucleic acid molecule to produce the polypeptide, and concurrently conjugating the polypeptide to the nucleic acid molecule, thereby conjugating the polypeptide to the bead.

    [0093] In other embodiments, conjugation of the polypeptide to the nucleic acid displayed on the bead is catalyzed by a linking enzyme. For example, the linking enzyme may be selected from a sortase, a butelase, a trypsiligase, a peptiligase, a formylglycine generating enzyme, a transglutaminase, a tubulin tyrosine ligase, a phosphopantetheinyl transferase, a SpyLigase, or a SnoopLigase.

    [0094] Enzymatic linkage of a protein to a DNA molecule displayed on beads may be accomplished using Sortase A as the linking enzyme. In this embodiment, one of the capture moiety or linkage tag can include a polypeptide which has a free N-terminal glycine residue and the other of the capture moiety or linkage tag can include a polypeptide which has an amino acid sequence LPXTG (SEQ ID NO: 1), where X is any amino acid (see, e.g., Schmidt et al (2017) Current Opinion in Chemical Biology 38: 1-7, Falck and Muller (2018) Antibodies 7(1): 4 and Massa and Devoogdt (2019) Bioconjugation: Methods and Protocols, herein incorporated by reference in their entireties).

    [0095] Enzymatic linkage of a protein to a DNA molecule displayed on beads may be accomplished using Butelase-1 as the linking enzyme. In this embodiment, one of the capture moiety or linkage tag can include a polypeptide including the amino acid sequence X.sub.1X.sub.2XX (SEQ ID NO: 2), where X.sub.1 is any amino acid except P, D, or E; X.sub.2 is I, L, V, or C; X is any amino acid, and the other of the capture moiety or linkage tag can include a polypeptide including the amino acid sequence DHV or NHV (see e.g., Schmidt et al (2017) Current Opinion in Chemical Biology 38: 1-7, Falck and Muller (2018) Antibodies 7(1): 4 and Massa and Devoogdt (2019) Bioconjugation: Methods and Protocols, herein incorporated by reference in their entireties).

    [0096] Enzymatic linkage of a protein to a DNA molecule displayed on beads may be accomplished using Trypsiligase as the linking enzyme. In this embodiment, one of the capture moiety or linkage tag can include a polypeptide including amino acid sequence RHXX (SEQ ID NO: 3), where X is any amino acid, and the other of the capture moiety or linkage tag can include a polypeptide including the amino acid sequence YRH (see e.g., Schmidt et al (2017) Current Opinion in Chemical Biology 38: 1-7, Falck and Muller (2018) Antibodies 7(1): 4 and Massa and Devoogdt (2019) Bioconjugation: Methods and Protocols, herein incorporated by reference in their entireties).

    [0097] Enzymatic linkage of a protein to a DNA molecule displayed on beads may be accomplished using a Subtilisin-derived enzyme (e. g., Omniligase) as the linking enzyme. In this embodiment, the capture moiety can include carboxamido-methyl (OCam) and the linkage tag can include a polypeptide including a free N-terminal amino acid acting as an acyl-acceptor nucleophile (see e.g., Schmidt et al (2017) Current Opinion in Chemical Biology 38: 1-7, Falck and Muller (2018) Antibodies 7(1): 4 and Massa and Devoogdt (2019) Bioconjugation: Methods and Protocols, herein incorporated by reference in their entireties).

    [0098] Enzymatic linkage of a protein to a DNA molecule displayed on beads may be accomplished using a Formylglycine generating enzyme (FGE) as the linking enzyme. In this embodiment, the capture moiety can include an aldehyde reactive group and the linkage tag can include a polypeptide including the amino acid sequence CXPXR (SEQ ID NO: 4), where X is any amino acid (see e.g., Schmidt et al (2017) Current Opinion in Chemical Biology 38: 1-7, Falck and Muller (2018) Antibodies 7(1): 4 and Massa and Devoogdt (2019) Bioconjugation: Methods and Protocols, herein incorporated by reference in their entireties).

    [0099] Enzymatic linkage of a protein to a DNA molecule displayed on beads may be accomplished using transglutaminase as the linking enzyme. In this embodiment, one of the capture moiety or linkage tag can include a polypeptide including a lysine residue or a free N-terminal amine group and the other of the capture moiety or linkage tag can include a polypeptide including the amino acid sequence LLQGA (SEQ ID NO: 5) (see e.g., Schmidt et al (2017) Current Opinion in Chemical Biology 38: 1-7, Falck and Muller (2018) Antibodies 7(1): 4 and Massa and Devoogdt (2019) Bioconjugation: Methods and Protocols, herein incorporated by reference in their entireties).

    [0100] Enzymatic linkage of a protein to a DNA molecule displayed on beads may be accomplished using tubulin tyrosine ligase as the linking enzyme. In this embodiment, one of the capture moiety or linkage tag can include a polypeptide including a free N-terminal tyrosine residue and the other of the capture moiety or linkage tag can include a polypeptide including the C-terminal amino acid sequence VDSVEGEEEGEE (SEQ ID NO: 6) (see e.g., Schmidt et al (2017) Current Opinion in Chemical Biology 38: 1-7, Falck and Muller (2018) Antibodies 7(1): 4 and Massa and Devoogdt (2019) Bioconjugation: Methods and Protocols, herein incorporated by reference in their entireties).

    [0101] Enzymatic linkage of a protein to a DNA molecule displayed on beads may be accomplished using tubulin phosphopantetheinyl transferase as the linking enzyme. In this embodiment, the capture moiety can include coenzyme A (CoA) and the linkage tag can include polypeptide including the amino acid sequence DSLEFIASKLA (SEQ ID NO: 7) (see e.g., Schmidt et al (2017) Current Opinion in Chemical Biology 38: 1-7, Falck and Muller (2018) Antibodies 7(1): 4 and Massa and Devoogdt (2019) Bioconjugation: Methods and Protocols, herein incorporated by reference in their entireties).

    [0102] Enzymatic linkage of a protein to a DNA molecule displayed on beads may be accomplished using SpyLigase as the linking enzyme. In this embodiment, one of the capture moiety or linkage tag can include a polypeptide including amino acid sequence ATHIKFSKRD (SEQ ID NOL 8) and the other of the capture moiety or linkage tag can include a polypeptide including the amino acid sequence AHIVMVDAYKPTK (SEQ ID NO: 9) (see e.g., Schmidt et al (2017) Current Opinion in Chemical Biology 38: 1-7, Falck and Muller (2018) Antibodies 7(1): 4 and Massa and Devoogdt (2019) Bioconjugation: Methods and Protocols, herein incorporated by reference in their entireties).

    [0103] Enzymatic linkage of a protein to a DNA molecule displayed on beads may be accomplished using SnoopLigase as the linking enzyme. In this embodiment, one of the capture moiety or linkage tag can include a polypeptide including amino acid sequence DIPATYEFTDGKHYITNEPIPPK (SEQ ID NO: 10) and the other of the capture moiety or linkage tag can include a polypeptide including the amino acid sequence KLGSIEFIKVNK (SEQ ID NO: 11) (see e.g., Schmidt et al (2017) Current Opinion in Chemical Biology 38: 1-7, Falck and Muller (2018) Antibodies 7(1): 4 and Massa and Devoogdt (2019) Bioconjugation: Methods and Protocols, herein incorporated by reference in their entirety).

    [0104] In an embodiment, the capture moiety includes double-stranded DNA and the linkage tag includes a polypeptide, in which the capture moiety and the linkage tag form a leucine zipper. In another embodiment, the capture moiety includes the nucleic acid sequence TGCAAGTCATCGG (SEQ ID NO: 12) and the linkage tag includes the amino acid sequence DPAALKRARNTEAARRSRARKGGC (SEQ ID NO: 13) (see e.g., Stanojevic and Verdine (1995) Nat Struct Biol 2(6): 450-7, herein incorporated by reference in its entirety.

    [0105] In some embodiments the linking enzyme is introduced into the mixture of the second microemulsion as a purified component. In some embodiments the linking enzyme is introduced into the second microemulsion in the form of a supplemental gene that is expressed concurrently with the protein variant library. Linking of the DNA on the DNA-coated beads to the linkage tag of the protein is performed to achieve a protein density of 10.sup.3 to 10.sup.6 molecules per μm.sup.2 of bead surface area.

    [0106] In other embodiments, the protein-DNA-bead conjugates display antigens, antibodies, enzymes, substrates or, receptors. In some embodiments the library of antigens displayed on the protein-DNA-bead conjugates includes protein epitopes for one or more pathogenic agents or cancers (e.g., 1-10 epitope variants, 1-9 epitope variants, 1-8 epitope variants, 1-7 epitope variants, 1-6 epitope variants, 1-5 epitope variants, 1-4 epitope variants, 1-3 epitope variants, 1-2 epitope variants, 1 epitope variant, 2 epitope variants, 3 epitope variants, 4 epitope variants, 5 epitope variants, 6 epitope variants, 7 epitope variants, 8 epitope variants, 9 epitope variants, or 10 epitope variants).

    [0107] In some embodiments, the protein-DNA-bead conjugates display proteins associated with cancer. For example, the conjugates may display proteins associated with a cancer selected from acute lymphoblastic leukemia, acute myeloid leukemia, adrenocortical carcinoma, an AIDS-related cancer, an AIDS-related lymphoma, anal cancer, appendix cancer, an astrocytoma, basal cell carcinoma, bile duct cancer, bladder cancer, bone cancers, brain tumors, such as cerebellar astrocytoma, cerebral astrocytoma/malignant glioma, ependymoma, medulloblastoma, supratentorial primitive neuroectodermal tumors, visual pathway and hypothalamic glioma, breast cancer, a bronchial adenoma, Burkitt lymphoma, carcinoma of unknown primary origin, central nervous system lymphoma, cerebellar astrocytoma, cervical cancer, a childhood cancer, chronic lymphocytic leukemia, chronic myelogenous leukemia, a chronic myeloproliferative disorder, colon cancer, cutaneous T-cell lymphoma, desmoplastic small round cell tumor, endometrial cancer, ependymoma, esophageal cancer, Ewing's sarcoma, a germ cell tumor, gallbladder cancer, gastric cancer, gastrointestinal carcinoid tumor, gastrointestinal stromal tumor, a glioma, hairy cell leukemia, head and neck cancer, heart cancer, hepatocellular (liver) cancer, Hodgkin lymphoma, Hypopharyngeal cancer, intraocular melanoma, islet cell carcinoma, Kaposi sarcoma, kidney cancer, laryngeal cancer, lip and oral cavity cancer, liposarcoma, liver cancer, a lung cancer, such as non-small cell and small cell lung cancer, a lymphoma, a leukemia, macro globulinemia, malignant fibrous histiocytoma of bone/osteosarcoma, medulloblastoma, melanomas, mesothelioma, metastatic squamous neck cancer with occult primary, mouth cancer, multiple endocrine neoplasia syndrome, myelodysplasia syndromes, myeloid leukemia, nasal cavity and paranasal sinus cancer, nasopharyngeal carcinoma, neuroblastoma, non-Hodgkin lymphoma, non-small cell lung cancer, oral cancer, oropharyngeal cancer, osteosarcoma/malignant fibrous histiocytoma of bone, ovarian cancer, ovarian epithelial cancer, ovarian germ cell tumor, pancreatic cancer, pancreatic cancer islet cell, paranasal sinus and nasal cavity cancer, parathyroid cancer, penile cancer, pharyngeal cancer, pheochromocytoma, pineal astrocytoma, pineal germinoma, pituitary adenoma, pleuropulmonary blastoma, plasma cell neoplasia, primary central nervous system lymphoma, prostate cancer, rectal cancer, renal cell carcinoma, renal pelvis and ureter transitional cell cancer, retinoblastoma, rhabdomyosarcoma, salivary gland cancer, sarcomas, a skin cancer, skin carcinoma merkel cell, small intestine cancer, soft tissue sarcoma, squamous cell carcinoma, stomach cancer, T-cell lymphoma, throat cancer, thymoma, thymic carcinoma, thyroid cancer, trophoblastic tumor (gestational), cancers of unknown primary site, urethral cancer, uterine sarcoma, vaginal cancer, vulvar cancer, Waldenstrom macro globulinemia, and Wilms tumor.

    [0108] In some embodiments, the protein-DNA-bead conjugates display proteins associated with an infectious agent (e.g., viral proteins, bacterial proteins, fungal proteins, or parasitic proteins). For example, the conjugates may display proteins associated with a virus selected from COVID-19, HIV, Dengue, West Nile Virus (WNV), Syphilis, Hepatitis B Virus (HBV), Normal Blood, Valley Fever, and Hepatitis C Virus.

    [0109] In some embodiments, the protein-DNA-bead conjugates display proteins associated with an inflammatory and/or autoimmune disease. In some embodiments, the inflammatory or autoimmune disease is selected from HIV, rheumatoid arthritis, diabetes mellitus type 1, systemic lupus erythematosus, scleroderma, multiple sclerosis, severe combined immunodeficiency (SCID), DiGeorge syndrome, ataxia-telangiectasia, seasonal allergies, perennial allergies, food allergies, anaphylaxis, mastocytosis, allergic rhinitis, atopic dermatitis, Parkinson's disease, Alzheimer's disease, hypersplenism, leukocyte adhesion deficiency, X-linked lymphoproliferative disease, X-linked agammaglobulinemia, selective immunoglobulin A deficiency, hyper IgM syndrome, autoimmune lymphoproliferative syndrome, Wiskott-Aldrich syndrome, chronic granulomatous disease, common variable immunodeficiency (CVID), hyperimmunoglobulin E syndrome, Hashimoto's thyroiditis, and/or a breakdown in cellular signaling processes.

    Microemulsion Droplets

    [0110] Methods for producing microemulsion droplets for the purpose of chemical and biochemical reactions are known to those of skill in the art. In general, microemulsion droplets contain an aqueous phase suspended in an oil phase (e.g. a water-in-oil emulsion). In an embodiment, the oil phase is comprised of 95% mineral oil, 4.5% Span-80, 0.45% Tween-80, and 0.05% Triton X-100. In some embodiments, the microemulsions are formed via direct mixing and/or vortexing of aqueous and oil phases. In some embodiments, the microemulsions are formed via a piezoelectric pump extruding the aqueous phase in a microfluidic channel containing oil phase. In some embodiments, the microemulsions are formed via mechanical mixing of aqueous and oil phases using a dispersing instrument or homogenizer. In an embodiment, each emulsion droplet contains on average a single primer-coated bead, one template DNA molecule, and a plurality of PCR primer molecules. Temperature cycling can be used to produce clonal DNA amplified from the template on the beads.

    High-Throughput Characterization of Protein Properties and Functions

    [0111] Methods for high-throughput assays of large pluralities of protein variants (e. g., at least 1×10.sup.5 variants, at least 1×10.sup.6 variants, 1×10.sup.7 variants, 1×10.sup.8 variants, or 1×10.sup.9 variants, such as between 1×10.sup.5 and 1×10.sup.10 variants, between 1×10.sup.6 and 1×10.sup.10 variants, or between 10×10.sup.7 and 1×10.sup.10 variants) on one automated instrument are described herein.

    [0112] In particular embodiments, after protein generation and display in the second microemulsion, the emulsion can be broken, leaving the population of beads displaying many copies of a protein and many clonal copies of the DNA encoding the protein. Then, the beads can be introduced into an instrument that is configured to sequence the DNA of each bead and also analyze the properties and/or function of the displayed proteins in a high-throughput manner. In an embodiment, the beads can be immobilized onto a solid surface (e.g., collected into nanowells). The immobilized library of polypeptides can then be presented with various reagents (e.g., target drugs, epitopes, paratopes, or antigens) that can be flowed over the beads, the function and/or property of the polypeptides can be assayed via a fluorescence signal that is detected (e.g., fluorescence imaging) and quantified. In several embodiments, the reagents are then washed out and the process can be repeated (e.g., 2 times, 3 times, 4 times, 5 times, 6 times, 7 times, 8 times, 9 times, or 10 times). In some embodiments, a single assay run can include a first step of measuring equilibrium binding to a first target (target “A”), a second step of measuring binding kinetics to target A, a third step of measuring the equilibrium binding to a second target (target “B”), a fourth step of measuring the binding kinetics to target B, followed by a fifth step of measuring protein stability (e.g., denaturation) in a variety of environmental conditions (e.g., temperature, pH, and/or tonicity). In some cases, the order of assays can be selected to ensure that any resulting changes to the polypeptide (e.g., irreversible changes to the polypeptide, such as, e.g., denaturation) will not affect the readout. In some embodiments, a regeneration step can be performed after each assay to prepare the beads for subsequent assays. Regeneration steps can be configured to incubate the beads in a low pH solution (e.g., pH=4.5) to cause any bound molecules to dissociate, followed by, e.g., a washing step, and step that returns the beads to a state (e.g., neutral pH) that can be used in the next assay. Regeneration via low pH presents an advantage of the methods of the present disclosure and an advancement over the prior art methods due to the nature of the covalent bonding between the constituents of the protein-DNA-bead conjugates. Regeneration with low pH in methods previously established in the field is not possible, given that such exposure to low pH results in the irreversible disruption of protein-DNA conjugates that limits or precludes the possibility of performing subsequent assays.

    [0113] In some embodiments, the methods described herein can be configured to perform a wide variety of assays to characterize a polypeptide (e.g., equilibrium binding assay (K.sub.d), kinetic binding assay (association, k.sub.on), kinetic binding assay (dissociation, k.sub.off), limit of detection assay (LoD), thermal denaturation (equilibrium unfolding, Tm), and/or chemical denaturation (equilibrium unfolding, C.sub.1/2)). In some embodiments, the kinetic stability of a polypeptide is measured by a first step of adding a reagent (e.g., a target drug, antigen, epitope, paratope, or orthogonal antibody) to a displayed protein and a second step of increasing the temperature and/or increasing the concentration of a denaturant until a binding signal (e.g., fluorescence signal) disappears.

    [0114] In some embodiments the protein variants of the protein-DNA-bead conjugates are evaluated for properties including, e.g., thermal stability and pH stability.

    [0115] In some embodiments, the thermal stability of protein variants of the protein-DNA-bead conjugates is performed by characterizing the denaturation of the protein variants in response to elevated temperatures (e. g., greater than 45° C., between 45° C.-100° C., between 55° C.-90° C., between 65° C.-80° C., between 45° C.-90° C., between 55° C.-80° C., between 65° C.-70° C., between 45° C.-55° C. between 55° C.-65° C., between 65° C.-75° C., between 75° C.-85° C., between 85° C.-95° C. between 95° C.-100° C., between 40° C.-45° C., between 46° C.-50° C., between 50° C.-55° C., between 55° C.-60° C., between 60° C.-65° C., between 65° C.-70° C., between 70° C.-75° C., between 75° C.-80° C., between 80° C.-85° C., between 85° C.-90° C., between 90° C.-95° C., between 95° C.-100° C., or at or above 46° C., 47° C., 48° C., 49° C., 50° C., 51° C., 52° C., 53° C., 54° C., 55° C., 56° C., 57° C., 58° C., 59° C., 60° C., 61° C., 62° C., 63° C., 64° C., 65° C., 66° C., 67° C., 68° C., 69° C., 70° C., 71° C., 72° C., 73° C., 74° C., 75° C., 76° C., 77° C., 78° C., 79° C., 80° C., 81° C., 82° C., 83° C., 84° C., 85° C., 86° C., 87° C., 88° C., 89° C., 90° C., 91° C., 92° C., 93° C., 94° C., 95° C., 96° C., 97° C., 98° C., 99° C., or 100° C.). In some embodiments, the denaturation of the protein variants in response to elevated temperatures is evaluated using fluorescent detection of denatured proteins (e. g., FACS sorting).

    [0116] In some embodiments, the pH stability of protein variants of the protein-DNA-bead conjugates is performed by characterizing the denaturation of the protein variants in response to a low pH (e. g., below pH 6.0, such as between pH 3.0-6.0, or between pH 4.0-5.0, or between pH 3.0-3.5, or between pH 3.5-4.0, or between pH 4.0-4.5, or between pH 4.5-5.0, or between pH 5.0-5.5, or between pH 5.5-6.0, or pH 3.1, 3.2, 3.3, 3.4, 3.5, 3.6, 3.7, 3.8, 3.9, 4.0, 4.1, 4.2, 4.3, 4.4, 4.5, 4.6, 4.7, 4.8, 4.9, 5.0, 5.1, 5.2, 5.3, 5.4, 5.5, 5.6, 5.7, 5.8, 5.9, or 6.0). In some embodiments, the denaturation of the protein variants in response to low pH is evaluated using fluorescent detection of denatured proteins (e. g., FACS sorting).

    [0117] In some embodiments, the pH stability of protein variants of the protein-DNA-bead conjugates is performed by characterizing the denaturation of the protein variants in response to high pH (e. g., above pH 8.0, such as between pH 8.0-10.0, or between pH 8.0-8.5, or between pH 8.5-9.0, between pH 9.0-9.5, or between pH 9.5-10.0, or pH 8.1, 8.2, 8.3, 8.4, 8.5, 8.6, 8.7, 8.8, 8.9, 9.0, 9.1, 9.2, 9.3, 9.4, 9.5, 9.6, 9.7, 9.8, 9.9, or 10.0). In some embodiments, the denaturation of the protein variants in response to high pH is evaluated using fluorescent detection of denatured proteins (e. g., FACS sorting).

    [0118] In some embodiments, biological activity (e. g., binding affinity, binding specificity, and/or enzymatic activity) of a large plurality of protein variants, displayed on protein-DNA-bead conjugates, is characterized on one automated instrument. In an embodiment, the binding affinity of protein variants is determined using fluorescent detection of binding between protein variants and fluorescently-labeled target molecules (e. g., agonists, antagonists, competitive inhibitors and or, allosteric inhibitors). In another embodiment, the binding specificity of protein variants is determined using fluorescent detection of binding between protein variants and fluorescently-labeled target molecules (e. g., agonists, antagonists, competitive inhibitors and/or, allosteric inhibitors). In some embodiments the binding affinity and binding specificity are determined for a large plurality of protein variants sequentially in any order on one automated instrument. In some embodiments, the enzymatic activity of a large plurality of protein variants, displayed on protein-DNA-bead conjugates, is characterized on one automated instrument. In an embodiment, the enzymatic activity is determined using fluorescent detection of the increase of reaction product(s) and/or using fluorescent detection of the decrease of reactant reagent(s).

    [0119] The protein-DNA-bead conjugates can be used to interrogate the interaction of a biologic molecule (e.g., an antibody, a paratope, an antigen, an enzyme, a substrate, or a receptor) and a drug (e.g., an antiviral drug, Abciximab, Adalimumab, Alefacept, Alemtuzumab, Basiliximab, Belimumab, Bezlotoxumab, Canakinumab, Certolizumab pegol, Cetuximab, Daclizumab, Denosumab, Efalizumab, Golimumab, Inflectra, Ipilimumab, Ixekizumab, Natalizumab, Nivolumab, Olaratumab, Omalizumab, Palivizumab, Panitumumab, Pembrolizumab, Rituximab, Tocilizumab, Trastuzumab, Secukinumab, Ustekinumab, or Cabliv).

    [0120] In other embodiments, the protein-DNA-bead conjugates can be used in a diagnostic and/or a companion diagnostic process. In some embodiments the protein-DNA-bead conjugates may display a variety of patient-specific drug targets to test effectiveness of a drug that is bound to the protein-DNA-bead conjugates as part of a companion diagnostic for the drug. In some embodiments the protein-DNA-bead conjugates can be used to display patient-specific cancer epitope variants (e.g., neoantigens) in order to test drug effectiveness against the patient's cancer-specific variants. In some embodiments, the protein-DNA-bead conjugates can be used to display patient- or population-specific epitopes associated with an infectious agent to characterize bacterial or viral drug resistance and drug effectiveness.

    [0121] In some embodiments the protein-DNA-bead conjugates can be used to display a biomarker or other diagnostic epitope, then incubated with a patient's serum, in which the patient's antibodies in the serum bind to the protein-DNA-bead conjugates and are detected with a secondary anti-human antibody to assay a patient's antibody responses as a diagnostic. In some embodiments, the protein-DNA-bead conjugates can be configured to display allergen epitopes in order to diagnose and characterize a subject's allergic response. In some embodiments, the protein-DNA-bead conjugates can be configured to display a wide variety and of epitopes from a broad group of infectious agents to test the serum of a patient and diagnose active infections and also to characterize immune protection (e.g., immunization).

    [0122] In some embodiments, the function or property of the polypeptide is binding to a target (e.g., ligand binding, equilibrium binding, or kinetic binding as described herein). In some embodiments, the function or property is enzymatic activity or specificity (e.g., enzyme activity or enzyme inhibition as described herein). In some embodiments, the function or property is the level of protein expression (e.g., the expression level of a given gene). In some embodiments, the function or property of the polypeptide is stability (e.g., thermostability measured by thermal denaturation or chemical stability measured by chemical denaturation). In some embodiments, the function or property of the polypeptide is aggregation of the polypeptide.

    [0123] In some embodiments, more than one assay is performed on the same instrument (e.g., 2 or more, 3 or more, 4 or more, or 5 or more assays). Multiple assays may be performed simultaneously or sequentially on the same instrument. This provides an advantage of simultaneously assaying an entire library of polypeptides with high efficiency. For example, the method may include a determination of competitive binding to a target in the presence of a competitive molecule; measuring binding to multiple different targets; measuring equilibrium binding and binding kinetics; measuring binding and protein stability; or any combination thereof. The present methods may also include assaying multiple functions or properties of each polypeptide under varying conditions, e.g., binding under multiple pH conditions; binding under multiple temperature conditions; and/or binding under multiple buffer conditions.

    [0124] Exemplary assays of properties or functions of polypeptides are provided in Table 1. One or more of these assays may be performed on the same library of polypeptide. Where more than one assay is performed, the assays may be performed simultaneously or sequentially.

    TABLE-US-00001 TABLE 1 Assays for properties or functions of polypeptides Property Property being Exemplary or function Assay measured Reference Binding Ligand Limit of Armbruster, binding Detection David A., and (LoD) Terry Pry. or Limit of “Limit of blank, Quantitation limit of detection (LoQ) and limit of quantitation.” The clinical biochemist reviews 29. Suppl 1 (2008): S49. Equilibrium Equilibrium Hulme, Edward binding binding C., and Mike A. constant Trevethick. (KD) “Ligand binding assays at equilibrium: validation and interpretation.” British journal of pharmacology 161.6 (2010): 1219-1237. Kinetic binding on Rich, Rebecca binding rate (kon) L., and David G. and/or off Myszka. rate (koff) “Survey of the year 2007 commercial optical biosensor literature.” Journal of Molecular Recognition: An Interdisciplinary Journal 21.6 (2008): 355-400. Competitive Half-maximal Cox, Karen L., binding inhibitory et al. concentration “Immunoassay (IC50), half- methods.” Assay maximal Guidance effective Manual concentration [Internet]. (EC50), or Eli Lilly & inhibition Company and constant (Ki) the National Center for Advancing Translational Sciences, 2019. Enzymatic Enzyme Maximum rate Robinson, Peter activity activity of reaction K. “Enzymes: (Vmax), principles and Michaelis biotechnological constant (Km), applications.” turnover Essays in number (Kcat), biochemistry 59 Catalytic (2015): 1-41. efficiency (Kcat/Km) Enzyme Half-maximal Copeland, inhibition inhibitory Robert A. concentration Evaluation of (IC50), half- enzyme maximal inhibitors in effective drug discovery: concentration a guide for (EC50), medicinal or inhibition chemists and constant (Ki) pharmacologists. John Wiley & Sons, 2013. Stability Protein Thermal Sancho, Javier thermal denaturation “The stability of denaturation midpoint (Tm) 2-state, 3-state and more-state proteins from simple spectroscopic techniques . . . plus the structure of the equilibrium intermediates at the same time.” Archives of biochemistry and biophysics 531.1-2 (2013): 4-13. Protein Chemical Sancho, Javier. chemical denaturation “The stability of denaturation midpoint (Cm) 2-state, 3-state and more-state proteins from simple spectroscopic techniques . . . plus the structure of the equilibrium intermediates at the same time.” Archives of biochemistry and biophysics 531.1-2 (2013): 4-13.

    High-Throughput Sequencing of DNA on Beads

    [0125] Methods for high-throughput determination of the sequence of large pluralities of DNA variants displayed on beads is described herein. The methods described herein can allow high-throughput analysis of proteins in large pluralities of protein-DNA-bead conjugates on one automated instrument as the sequencing of the DNA in said protein-DNA-bead conjugates. In other embodiments, the methods can be used for high-throughput protein analysis and high-throughput sequencing on one automated instrument. In still other embodiments, the plurality of peptide-displaying beads are loaded and immobilized on a solid surface prior to sequencing. Sequencing of large pluralities of DNA variants displayed on protein-DNA-bead conjugates can be achieved using high-throughput sequencing methods and technologies (e. g., sequencing by synthesis (e.g., ILLUMINA™ dye sequencing, ion semiconductor sequencing, or pyrosequencing) or sequencing by ligation (e.g., oligonucleotide ligation and detection (SOLiD™) sequencing or polony-based sequencing), long-read or single-molecule sequencing (e.g., Helicos™ sequencing, single-molecule real-time (SMRT™) sequencing, and nanopore sequencing) and Sanger sequencing)). In yet other embodiments, high-throughput sequencing is achieved via fluorescence detection of incorporated bases on each immobilized bead (sequencing by synthesis).

    Single-Instrument Sequencing of Polynucleotides and Assaying of Polypeptides

    [0126] Single-instrument sequencing and assaying of polynucleotides, as described herein, can start with introducing protein-DNA-bead conjugates into an instrument (e.g., into microwells or randomly arrayed onto a flow-cell surface). In some embodiments the sequencer/analyzer instrument can be configured to include the following components: a flow-cell to (1) immobilize beads allowing the analysis at a single bead level and to (2) introduce liquid phase reagents in an automated manner; and a high-throughput mechanism to measure signals for both sequencing and protein assays (e.g., automated fluorescence microscopy instrument) where fluorescence signals from sequencing and binding are recorded across all beads. In some embodiments, sequencing and/or binding events produce a change in pH that is detected across all beads, for example as described in U.S. Pat. No. 8,936,763, herein incorporated by reference in its entirety.

    [0127] In some embodiments varying concentrations of reagents are introduced into the sequence and analysis instrument and the fluorescence or pH signals report the binding of the reagents to the protein-DNA-bead conjugates. Following protein and/or polypeptide assaying, in some embodiments, the sequencing of the DNA encoding the protein is performed by stripping the complementary strand of the DNA (e.g., formamide or NaOH), removing the linked protein, and leaving a plurality of clonal single-stranded DNA (ssDNA) molecules bound to the bead. A primer can then be annealed to the ssDNA molecule and sequencing can be performed (e.g., sequencing-by-synthesis or sequencing by ligation) to determine the sequence of the DNA and the identity of the assayed protein. In some embodiments, assaying a protein and sequencing of the protein-encoding DNA can be performed in any order. In some embodiments, DNA sequencing is performed first and can require that a pre-annealed primer is present prior to the start of the sequencing process.

    EXAMPLES

    [0128] The following examples are put forth so as to provide those of ordinary skill in the art with a description of how the compositions and methods described herein may be used, made, and evaluated, and are intended to be purely exemplary of the invention and are not intended to limit the scope of what the inventors regard as their invention.

    Example 1. Parallel Identification and Functional Characterization of a Library of Polypeptides on a Single Instrument

    [0129] A library of approximately 3×10.sup.7 beads was produced by conjugating each bead to a DNA molecule encoding a polypeptide (Example 1, Step a). As described in detail herein, DNA-linked beads were produced by PCR-amplifying each nucleic acid molecule where one primer is bead-linked to produce a homogeneous population of approximately 10.sup.5 copies of the nucleic acid molecule on each bead. Each bead was identified by single-base sequencing by incorporation of a fluorophore into the nucleic acid sequence (Example 1, Step b). The polypeptide encoded by the nucleic acid on each bead was expressed by cell-free transcription and translation and the resulting polypeptide was subsequently conjugated to the bead in an enzymatic reaction catalyzed by Sortase A (Example 1, Step c). Each bead, in parallel, was (1) identified by the sequence of the nucleic acid molecule conjugated to the bead; and (2) assayed to determine the binding of the conjugated polypeptide to a fluorescently-labeled antibody; where the identification by sequence and the functional characterization was performed on a single instrument (Example 1, Step d).

    [0130] The present example demonstrates the ability to link the binding properties of each polypeptide to the sequence of the nucleic acid molecule encoding the polypeptide, thereby determining the identity and the binding function of each polypeptide of the plurality of polypeptides in parallel on the same instrument. The present example is not meant to limit what the inventors consider to be the scope of the present invention. The order of steps, methods of nucleic acid identification, and/or methods of functional characterization of the polypeptides may be modified according to the methods described herein and based on the knowledge of one of skill in the art.

    Materials and Reagents

    DNA Oligonucleotides

    [0131] Gene blocks (gBlocks) and oligonucleotides (oligos) used in the methods herein described are provided in Table 2.

    TABLE-US-00002 TABLE 2 List of oligonucleotides used for expressing  polypeptide epitopes. Name (SEQ ID Modifi-  NO.) Nucleic acid sequence cation 3x- GGGCTACTACTATAATACGACTCACTATAGGGT None OKmFLAG AAGTGTGGAAGGAGATATACATATGGATTATAA (SEQ ID  ATTAGATGATGGCGATTACAAGCTCGACGATAT NO: 14) TGACTATAAACTGGATGACGACAAGGGTTCCGG AAGTTACCCTTATGATGTGCCTGACTATGCCGGA TCTGGCAGTGATTATAAACTCGATGATGGAGAC TATAAATTAGACGACATCGACTATAAACTGGAC GACGACAAGGGGTCCGGCTCGTTACCTGAAACA GGATGATGAGCGGGCCGCAGGGTTTTTTGCTGC CGTATGACTCATATGC 3x- GGGCTACTACTATAATACGACTCACTATAGGGT None super- AAGTGTGGAAGGAGATATACATATGGATTATAA FLAG AGATGAAGATGGAGACTACAAAGACGAAGACA (SEQ ID TTGACTACAAAGACGAGGACCTTCTCGGGAGTG NO: 15) GTTCTTATCCTTACGATGTGCCCGACTACGCCGG GAGCGGCTCAGATTACAAAGATGAGGACGGAG ATTACAAAGATGAAGATATTGACTATAAAGACG AAGATCTCTTAGGGTCCGGCTCGTTACCTGAAAC AGGATGATGAGCGAGCCGCAGGGTTTTTTGCTG CCGTATGACTCATATGC 3x- GGGCTACTACTATAATACGACTCACTATAGGGT None wtFLAG AAGTGTGGAAGGAGATATACATATGGATTATAA (SEQ ID AGATCATGATGGTGATTACAAGGACCATGATAT NO: 16) CGACTATAAAGACGACGACGACAAGGGATCGG GTAGCTATCCATATGACGTGCCGGACTATGCTG GATCAGGCAGTGACTATAAAGACCACGATGGCG ACTACAAAGACCACGACATCGATTACAAAGACG ACGACGATAAAGGGTCCGGCTCGTTACCTGAAA CAGGATGATGAGCGCGCCGCAGGGTTTTTTGCT GCCGTATGACTCATATGC Sortase  GGGCTACTACTATAATACGACTCACTATAGGGT None A AAGTGTGGAAGGAGATATACATATGAAGAAGTG (SEQ ID GACCAACCGTCTGATGACGATCGCTGGTGTGGT NO: 17) ACTGATCCTGGTAGCAGCATATCTGTTCGCTAAA CCACATATCGATAACTACCTGCACGATAAAGAT AAGGATGAAAAGATCGAACAATACGATAAAAA CGTAAAGGAACAGGCAAGTAAAGATAAAAAGC AGCAGGCTAAGCCTCAAATCCCGAAAGACAAGT CGAAAGTGGCAGGTTACATCGAAATCCCAGATG CTGATATCAAAGAACCAGTATACCCAGGTCCAG CAACGCCTGAACAACTGAATCGTGGTGTAAGCT TCGCAGAAGAAAACGAAAGTCTGGATGATCAAA ATATTAGCATTGCAGGCCACACTTTCATTGACCG TCCGAACTATCAATTTACAAATCTGAAAGCAGC AAAGAAAGGTAGTATGGTGTACTTCAAAGTTGG TAATGAAACACGTAAGTATAAAATGACCAGCAT TCGTGATGTTAAACCTACAGATGTTGGTGTTCTG GATGAACAAAAGGGTAAAGATAAACAACTGAC ACTGATCACTTGTGATGATTACAATGAAAAGAC AGGTGTATGGGAAAAACGTAAGATCTTCGTGGC AACCGAGGTCAAGTGATAGCATAACCCCTTGGG GCCTCTAAACGGGTCTTGAGGGGTTTTTTGCTGC CGTATGACTCATATGC Bead_FP GGGCTACTACTATAATACGACTCACTATAGGG None (SEQ ID  NO: 18) bt-Bead_ GGGCTACTACTATAATACGACTCACTATAGGG 5′  FP Biosg (SEQ ID  NO: 19) Bead_RP GCATATGAGTCATACGGCAGCAAAAAACCCTGC None (SEQ ID  GGC NO: 20) AF647- GCATATGAGTCATACGGCAGCAAAAAAC 5′  Bead_RP Alexa (SEQ ID  Fluor  NO: 21) 647 DBCO- GCATATGAGTCATACGGCAGCAAAAAACCCTGC 5′ Bead_RP GGC DBCO// (SEQ ID  iSp18 NO: 22) Bead_ GCTCATCATCCTGTTTCAGGTAACGAGCCGGACC None up- stream- RP (SEQ ID  NO: 23)

    Peptides

    [0132] The following peptide was used in the methods described herein. [0133] GLSSK-N3 synthesized by CPC Scientific (Sunnyvale, Calif., USA)

    Buffers

    [0134] The following buffers were used in the methods herein described. [0135] Streptavidin Binding Buffer (SABB): 1M NaCl, 5 mM Tris pH 8, 1 mM EDTA, 0.05% [0136] Tween-20 [0137] TNaTE: 140 mM NaCl, 10 mM Tris pH 8, 0.05% Tween-20, 1 mM EDTA [0138] Phosphate buffered saline (PBS): 1×PBS pH 7.4 [0139] TE: 10 mM Tris, 1 mM EDTA pH 7.2 [0140] 10× Sortase Buffer: 500 mM Tris pH 8, 100 mM CaCl.sub.2), 1.5M NaCl [0141] Antibody binding buffer (ABB): 10 mM Tris pH 8, 140 mM NaCl, 2 mM MgCl.sub.2, 5 mM KCl, 0.02% Tween-20 [0142] Incubation Buffer: 1×PBS pH 7.4, 10 mM MgCl.sub.2, 0.02% (v/v) Tween-20, 0.01% (w/v) bovine serum albumin (BSA)

    Sequencing Nucleotides

    [0143] The following custom dideoxynucleotides (ddNTPs) were used in the methods herein described. [0144] 7-Propargylamino-7-deaza-ddATP-ATTO-425 [0145] 7-Propargylamino-7-deaza-ddGTP-Cy5 [0146] 5-Propargylamino-ddCTP-ATTO-647N [0147] 5-Propargylamino-ddUTP-DY-480XL

    In Vitro Transcription Translation (IVTT Mix)

    [0148] The following IVTT mix was used in the methods herein described. [0149] PURExpress® In Vitro Protein Synthesis Kit (New England Biolabs (NEB), Ipswich, Massachusetts, USA)

    DNA Polymerases

    [0150] The following polymerases were used in the methods herein described. [0151] Bsm DNA Polymerase, Large Fragment (ThermoFisher Scientific. Waltham, Massachusetts, USA) [0152] Therminator DNA Polymerase (NEB. Ipswich, Mass., USA) [0153] Sequenase Version 2.0 DNA Polymerase (ThermoFisher Scientific. Waltham, Massachusetts, USA) [0154] Phire HotStart II DNA Polymerase (ThermoFisher Scientific. Waltham, Mass., USA)
    Step a. Display of DNA on Beads

    [0155] DNA-linked beads were produced by PCR amplification of each nucleic acid molecule (Table 2) where one primer is bead-linked to produce a homogeneous population of approximately 10.sup.5 nucleic acid molecules on each bead. The beads were divided into three tubes, each tube containing a different polypeptide-coding DNA template. The compartmentalization in separate tubes is analogous to compartmentalizing each bead in a microemulsion. After PCR, this resulted in a population of approximately 3×10.sup.7 beads, each displaying one of the three polypeptide-coding templates. This tube-compartmentalized PCR on beads may also be accomplished using a microemulsion-compartmentalized PCR to generate many unique sequences displayed on beads, according to methods known to those of skill in the art. A flow cytometer was used to sequence the DNA with reading one base of sequence through single-based extension. A theoretical maximum of 4 polypeptides (identified by A, C, T, or G on the single base read) could be read using the flow cytometer. Three unique sequences were displayed on each bead of the plurality of beads. Expansion of the throughput for characterizing large populations of unique proteins can be achieved using existing sequencing platforms and microemulsion methods known to a person of skill in the art.

    [0156] Specifically, three oligonucleotides encoding functionally distinct FLAG peptide epitopes (3×-OKFLAG, 3× wtFLAG, and 3×-superFLAG) were PCR amplified using Phire HotStart II polymerase in separate reaction vials containing standard buffer and 1 μM of primers bt-Bead FP and AF647-Bead_RP. These gene blocks were subjected to thermocycling conditions (98° C. for 2 minutes; followed by 18 cycles of 98° C. for 15 seconds, 57° C. for 15 seconds, and 72° C. for 30 seconds; followed by a final 2-minute extension at 72° C.). Ligation-ready reverse primer was prepared by incubating 40 μM of DBCO-Bead_RP with a 40× excess (1.6 mM) of GLSSK-N3 peptide overnight at room temperature in PBS buffer to yield GLSSK-BA RP. The purified PCR products of 3×-OKFLAG, 3×-wtFLAG, and 3×-superFLAG were separately incubated with −10.sup.7 Dynabeads® MyOne Streptavidin C1 microspheres (ThermoFisher Scientific, Waltham, Mass., USA) at 500 μM in 25 μL SABB for 30 minutes at room temperature. Beads from the previous step were then washed twice with SABB and resuspended in TNaTE. An aliquot of beads was then analyzed via flow cytometry to confirm DNA capture via high signal in the APC (660±20 nm) channel upon excitation with red laser (618 nm, FIG. 3A). All beads were then washed consecutively with the following to remove the Alexa Fluor 647-labeled anti-sense DNA strand: [0157] 1. PBS (one wash) [0158] 2. TNaTE (one wash) [0159] 3. 20 mM sodium hydroxide (NaOH, three washes)

    [0160] Washed beads were then suspended in TNaTE and removal of the reverse strand was confirmed via flow cytometry (FIG. 3B). Populations are indistinguishable from uncoated beads, confirming removal of the second strand. At this point, three separate populations of beads display clonal populations of ssDNA encoding their respective FLAG epitope (3×-OKFLAG, 3×-wtFLAG, 3×-superFLAG). The beads were spatially isolated in a manner similar to how they would be during emulsion PCR.

    Step b. Single-Base Sequencing of DNA on Beads

    [0161] Beads displaying three DNA templates encoding three variants of the FLAG peptide in the coding region (3×-OKFLAG, 3× wtFLAG, and 3×-superFLAG) were then prepared for sequencing-by-synthesis. The DNA templates were specifically designed to differ in sequence at the nucleotide immediately following the sequencing primer hybridization site. A flow cytometer was used as the DNA sequencer limiting the reading throughput to a single base. After single-base extension with different fluorescently-labeled nucleotides (ATTO647N-ddCTP, Cy5-ddGTP, and DY480XL-ddUTP), the beads were prepared to be read by the cytometer to distinguish the sequence of the DNA on the beads based on the fluorescence signal in different channels.

    [0162] DNA oligos were designed to differ from one another by a single base immediately upstream of the Bead_RP (see underlined base for 3×-OKFLAG, 3×-wtFLAG, and 3×-superFLAG in Table 2). Thus, the identity of the DNA can be determined by identifying which modified ddNTP is displayed on each bead after sequencing. Specifically, incorporation of ddGTP indicates a cytosine (C) on the complementary (sense) strand, incorporation of ddUTP indicates an adenosine (A) on the sense strand, incorporation of ddCTP indicates a guanosine (G) on the sense strand, and incorporation of ddATP indicates a thymine (T) on the sense strand. Beads displaying clonal populations of ssDNA encoding their respective FLAG epitope were washed once with 100 uL SABB and resuspended in 20 μL of SABB containing 500 nM of GLSSK-BA_RP. Then the beads were incubated with 500 nM of GLSSK-BA_RP in 20 uL SABB, heated to 63° C. for 45 s, and flash cooled on ice. Then the beads were washed with 50 μL of 1× Therminator buffer and suspended in 50 μL of cold Jena Sequencing Buffer containing 1× Therminator (Sigma Aldrich) buffer, 1 μM/ea Jena ddNTPs, 10 nM of GLSSK-RP, 0.032 U/μL of Bsm Enzyme (Fisher Scientific) and 0.008 U/μL of Therminator enzyme (Sigma Aldrich). Then the beads were heated to 65° C. for 5 minutes, 63° C. for 20 minutes, and cooled on ice. At this point, the beads were physically separated into three populations, each clonally displaying one of three DNA sequences (3×-OKFLAG, 3×-wtFLAG, or 3×-superFLAG) encoding a FLAG epitope and a terminated nucleotide whose attached fluorophore dictates which epitope is displayed. This step did not require spatial isolation via microemulsions as each bead only picked up a fluorophore-labelled ddNTP that is dependent on the DNA sequence already displayed. Specifically, 3×-OKFLAG recruited ATTO647N-ddCTP (644/669 nm excitation/emission), 3×-wtFLAG recruited Cy5-ddGTP (647/665 nm excitation/emission), and 3×-superFLAG recruited DY480XL-ddUTP (500/630 nm excitation/emission). While ATTO647N and Cy5 have similar fluorescence spectra, the FACS instrument is sensitive enough to distinguish one from another based on the relative intensities in the APC channel (FIGS. 4A and 4B).

    Step c. Covalent Attachment of Peptides to Encoding Gene on DNA-Coated Beads

    [0163] Expression of the bead-conjugated DNA molecules to produce polypeptides was accomplished using IVTT followed by the covalent conjugation of the produced polypeptides to the bead-conjugated DNA molecules with Sortase A. To establish this linkage, the nucleic acid molecules on the beads have a 5′-GLSSK peptide that is the capture moiety (with a free N-terminal glycine), and the polypeptides are genetically encoded in the DNA with an N-terminal LPETG sequence that is the linkage tag. Analogous to dividing the beads into a second microemulsion compartmentalization, the beads were compartmentalized into three separate tubes, each containing the three different DNA constructs. In these tubes, IVTT expression of the bead-linked DNA produces polypeptide which is linked by Sortase A to the nucleic acid, yielding beads linked to both DNA. Sortase A was encoded by exogenous DNA added to the IVTT reaction to produce the enzyme concurrently with the polypeptide.

    [0164] For compatibility with biological machinery during IVTT, the DNA of a bead population containing partially double-stranded DNA encoding their respective polypeptide epitopes must be made fully double-stranded through annealing and extending an upstream reverse primer. Beads were extended for 20 minutes at 60° C. in buffer containing 1×Bsm buffer, 250 μM/ea dNTPs, 500 nM Bead upstream-RP, and 0.06 U/μL Bsm enzyme. Then the beads from were washed twice with TNaTE and once with water. Then the beads were resuspended in 10 μL of NEB PURExpress® In Vitro Protein Synthesis mix (IVTT mix) following manufacturers protocols and incubated at 37° C. for 2 hours. dsDNA (200 ng) encoding Sortase A was added to 20 μL of NEB IVTT mix and incubated at 37° C. for 2 hours. After incubation, 4 μL of Sortase IVTT mix were added to 10 μL of each bead IVTT mix. 10× sortase buffer (1.55 μL) was added to each tube (three tubes total) and incubated overnight at 4° C. Then beads are spatially separated in different tubes.

    Step d. Parallel Determination of Sequence and Binding Activity of Discrete Peptide Epitopes Displayed on DNA-Coated Beads

    [0165] A binding assay was performed on the population of beads displaying polypeptides and nucleic acids. Beads that were previously compartmentalized (to facilitate faithful display of polypeptide on identifying DNA) were mixed and subjected to a binding incubation with a series of concentrations of peptide-binding antibody. The antibody had varying affinities for the bead-displayed polypeptides. The beads, displaying DNA with a fluorescently incorporated base (sequencing by synthesis) and polypeptide bound to fluorescently-labeled antibody (assay of polypeptide binding function) are then put on the sequencing instrument, here a flow cytometer, in order to read the sequence and the binding of each bead on the same instrument.

    [0166] To determine the sequence and binding activity of discrete peptide epitopes on DNA-coated beads a washing step (repeated 2×) with Incubation Buffer and resuspension in Incubation Buffer is performed to remove spent IVTT mix and any non-covalently-attached polypeptides. Then three bead populations were mixed at equal ratios in a new tube. FITC-labelled M2 anti-FLAG antibody (ThermoFisher Scientific. Waltham, Mass., USA) was diluted in incubation buffer and a 1:2 dilution series was prepared containing the following concentrations of M2 anti-FLAG antibody: 200 nM, 100 nM, 50 nM, 25 nM, 12.5 nM, 6.25 nM, 3.125 nM and 0 nM (no target control). Then the bead mixture was split into 8 tubes, the supernatant removed, and 100 uL of M2 anti-FLAG antibody dilution series at the given concentrations was added to each tube. Then the beads were incubated for one hour at room temperature. The beads then underwent two 15 minute washes using 100 uL of PBS and were resuspended in 200 uL of PBS and were assayed using a flow cytometer (FIGS. 5A-5C). At this point, each bead assayed using flow cytometry had a fluorescence value associated with it in each of 15 possible excitation/emission channels. The distribution of values from all beads across these channels allowed us to ascertain with high certainty which FLAG epitope each bead displayed. Then, we gated these beads and plot trends of these discrete populations across various concentrations of the FITC-labelled M2 anti-FLAG antibody to ascertain binding characteristics of these epitopes. The fluorescence of each bead across multiple channels was used, where possible, to determine the identity of the incorporated ddNTP and thus the identity of the oligonucleotide and peptide displayed on each bead. Beads containing identical oligonucleotides at identical antibody concentration were aggregated and their mean fluorescent signal was fit to the following equation:


    F.sup.pep.sub.mean([T])=F.sub.bg+F.sup.pep.sub.max*([T]/([T]+K.sub.d.sup.pep))

    where F.sup.pep.sub.mean([T]) is the mean fluorescent signal for the peptide at a given target concentration, [T], F.sub.bg is the background fluorescent signal when [T]=0, F.sup.pep.sub.max is the maximum fluorescent signal observed for the peptide at full binding saturation, and K.sub.d.sup.pep is the equilibrium dissociation constant for the peptide. A single mixture of beads displaying one of three possible peptide epitopes was split and incubated at different concentrations of fluorescent anti-FLAG M2 antibody and analyzed using flow cytometry. The fluorescent signals obtained from each bead at each concentration was sufficient to determine the identity of the oligonucleotide displayed on the bead and an accurate equilibrium binding measurement (dissociation constant) was obtained for the peptides displayed on the beads. The accuracy of the biophysical assay is evidenced by its correlation with previously measured affinities for these three peptides.

    [0167] Methods for generating beads that covalently display a homogenous population of polypeptides, together with a homogenous population of their encoding DNA by a process of two compartmentalized steps: PCR amplification and polypeptide expression and conjugation have been shown. Furthermore, it is demonstrated that, by sequencing the DNA and assaying polypeptide binding of each bead on a single instrument, the binding properties of each polypeptide are linked to the sequence of the nucleic acid molecule encoding the polypeptide, thereby determining both the identity and the binding function of each individual polypeptide on a per-bead basis.

    OTHER EMBODIMENTS

    [0168] All publications, patents, and patent applications mentioned in this specification are incorporated herein by reference to the same extent as if each independent publication or patent application was specifically and individually indicated to be incorporated by reference.

    [0169] While the invention has been described in connection with specific embodiments thereof, it will be understood that it is capable of further modifications and this application is intended to cover any variations, uses, or adaptations of the invention following, in general, the principles of the invention and including such departures from the invention that come within known or customary practice within the art to which the invention pertains and may be applied to the essential features hereinbefore set forth, and follows in the scope of the claims. Other embodiments are within the claims.