RECOMBINANT STRAIN PRODUCING L-LYSINE AND CONSTRUCTION METHODS THEREFOR AND USE THEREOF

Abstract

Provided are a method for introducing point mutations to the coding sequence of NCg12176 gene or improving the expression thereof in Corynebacterium glutamicum, and a method for performing point mutations on the promoter region sequence of dapB gene in Corynebacterium glutamicum. The fermentation yield of L-lysine produced by a strain with the mutations can be increased by means of the methods.

Claims

1-16. (canceled)

17. A L-lysine-producing microorganism that belongs to the genus Corynebacterium, having improved expression of a polynucleotide encoding the amino acid sequence of SEQ ID NO: 3, and/or, the bases at positions -49, -51 and -54 to -58 in the promoter region shown in SEQ ID NO: 29 are mutated; preferably, the improved expression refers to that the expression of the polynucleotide encoding the amino acid sequence of SEQ ID NO: 3 is enhanced, or the polynucleotide encoding the amino acid sequence of SEQ ID NO: 3 has a point mutation, or the polynucleotide encoding the amino acid sequence of SEQ ID NO: 3 has a point mutation and enhanced expression.

18. The microorganism according to claim 17, wherein the point mutation of the polynucleotide encoding the amino acid sequence of SEQ ID NO: 3 results in the substitution of the lysine residue at position 176 of the amino acid sequence of SEQ ID NO: 3 with a different amino acid residue, preferably with an asparagine residue.

19. The microorganism according to claim 17, wherein the polynucleotide encoding the amino acid sequence of SEQ ID NO: 3 comprises the nucleotide sequence of SEQ ID NO: 1.

20. The microorganism according to claim 17, wherein the point-mutated polynucleotide sequence is formed by mutation of the base at position 528 of the polynucleotide sequence shown in SEQ ID NO: 1; preferably, the mutation includes the mutation includes base mutation of adenine (A) to cytosine (C) at position 528 of the polynucleotide sequence shown in SEQ ID NO: 1; preferably, the point-mutated polynucleotide sequence comprises the polynucleotide sequence shown in SEQ ID NO: 2.

21. The microorganism according to claim 17, wherein the nucleotide at position -49 of the promoter region shown in SEQ ID NO: 29 is mutated from cytosine (C) to adenine (A), and the nucleotide at position -51 is mutated from guanine (G) to thymine (T), the nucleotide sequence from positions -54 to -58 is mutated from CTGCA to GGTGT; preferably, the promoter nucleotide sequence is as follows: (a) the nucleotide sequence shown in SEQ ID NO: 30; or (b) a nucleotide sequence having at least 90% identity, preferably at least 95% or at least 98% identity, to the nucleotide sequence shown in SEQ ID NO: 30 and retaining the enhancing activity of the promoter in (a), in which the nucleotide at position -49 is kept as adenine (A), the nucleotide at position -51 is kept as thymine (T), and the nucleotide sequence from positions -54 to -58 is kept as GGTGT.

22. The microorganism according to claim 17, wherein the microorganism is Corynebacterium glutamicum, preferably YP97158.

23. Any of the following products: (1) a polynucleotide sequence; (2) an amino acid sequence; (3) the first recombinant vector; (4) the first recombinant strain; (5) a promoter nucleotide sequence; (6) an expression cassette of promoter; (7) the second recombinant vector; (8) the second recombinant strain.

24. The products according to claim 23, wherein the polynucleotide sequence comprises a polynucleotide encoding the amino acid sequence of SEQ ID NO: 3, wherein the lysine residue at position 176 is substituted with a different amino acid residue, preferably with an asparagine residue; preferably, the polynucleotide sequence comprises a polynucleotide encoding the amino acid sequence of SEQ ID NO: 4. preferably, the polynucleotide sequence is formed by mutation of the base at position 528 of the polynucleotide sequence shown in SEQ ID NO: 1; preferably, the mutation includes base mutation of adenine (A) to cytosine (C) at position 528 of the polynucleotide sequence shown in SEQ ID NO: 1; preferably, the polynucleotide sequence comprises the polynucleotide sequence shown in SEQ ID NO: 2.

25. The products according to claim 23, wherein the amino acid sequence has the sequence shown in SEQ ID NO: 4.

26. The products according to claim 23, wherein the first recombinant vector comprises a polynucleotide encoding the amino acid sequence of SEQ ID NO: 3, wherein the lysine residue at position 176 is substituted with a different amino acid residue, preferably with an asparagine residue; preferably, the polynucleotide sequence comprises a polynucleotide encoding the amino acid sequence of SEQ ID NO: 4. preferably, the polynucleotide sequence is formed by mutation of the base at position 528 of the polynucleotide sequence shown in SEQ ID NO: 1; preferably, the mutation includes base mutation of adenine (A) to cytosine (C) at position 528 of the polynucleotide sequence shown in SEQ ID NO: 1; preferably, the polynucleotide sequence comprises the polynucleotide sequence shown in SEQ ID NO: 2.

27. The product according to claim 23, wherein the first recombinant strain contains a polynucleotide encoding the amino acid sequence of SEQ ID NO: 3, wherein the lysine residue at position 176 is substituted with a different amino acid residue, preferably with an asparagine residue; preferably, the polynucleotide sequence comprises a polynucleotide encoding the amino acid sequence of SEQ ID NO: 4. preferably, the polynucleotide sequence is formed by mutation of the base at position 528 of the polynucleotide sequence shown in SEQ ID NO: 1; preferably, the mutation includes base mutation of adenine (A) to cytosine (C) at position 528 of the polynucleotide sequence shown in SEQ ID NO: 1; preferably, the polynucleotide sequence comprises the polynucleotide sequence shown in SEQ ID NO: 2.

28. The products according to claim 23, wherein the promoter nucleotide sequence comprises the nucleotide sequence obtained by mutating the bases at positions -49, -51 and -54 to -58 in the promoter region shown in SEQ ID NO: 29; preferably, the nucleotide at position -49 of the promoter region shown in SEQ ID NO: 29 is mutated from cytosine (C) to adenine (A), and the nucleotide at position -51 is mutated from guanine (G) to thymine (T), and the nucleotide sequence from positions -54 to -58 is mutated from CTGCA to GGTGT.

29. The products according to claim 28, wherein the promoter nucleotide sequence is as follows: (a) the nucleotide sequence shown in SEQ ID NO: 30; or (b) a nucleotide sequence having at least 90% identity, preferably at least 95% or at least 98% identity, to the nucleotide sequence shown in SEQ ID NO: 30 and retaining the enhancing activity of the promoter in (a), in which the nucleotide at position -49 is kept as adenine (A), the nucleotide at position -51 is kept as thymine (T), and the nucleotide sequence from positions -54 to -58 is kept as GGTGT.

30. The products according to claim 23, wherein the expression cassette comprises the promoter nucleotide sequence comprises the nucleotide sequence obtained by mutating the bases at positions -49, -51 and -54 to -58 in the promoter region shown in SEQ ID NO: 29; preferably, the nucleotide at position -49 of the promoter region shown in SEQ ID NO: 29 is mutated from cytosine (C) to adenine (A), and the nucleotide at position -51 is mutated from guanine (G) to thymine (T), and the nucleotide sequence from positions -54 to -58 is mutated from CTGCA to GGTGT and a coding sequence operably linked to the promoter; preferably, the coding sequence is the coding sequence of dapB gene.

31. The products according to claim 23, wherein the second recombinant vector comprises the promoter nucleotide sequence comprises the nucleotide sequence obtained by mutating the bases at positions -49, -51 and -54 to -58 in the promoter region shown in SEQ ID NO: 29; preferably, the nucleotide at position -49 of the promoter region shown in SEQ ID NO: 29 is mutated from cytosine (C) to adenine (A), and the nucleotide at position -51 is mutated from guanine (G) to thymine (T), and the nucleotide sequence from positions -54 to -58 is mutated from CTGCA to GGTGT; preferably, the recombinant vector is constructed by ligating the promoter nucleotide sequence with pK18mobsacB plasmid.

32. The products according to claim 23, wherein the second recombinant strain contains the promoter nucleotide sequence comprises the nucleotide sequence obtained by mutating the bases at positions -49, -51 and -54 to -58 in the promoter region shown in SEQ ID NO: 29; preferably, the nucleotide at position -49 of the promoter region shown in SEQ ID NO: 29 is mutated from cytosine (C) to adenine (A), and the nucleotide at position -51 is mutated from guanine (G) to thymine (T), and the nucleotide sequence from positions -54 to -58 is mutated from CTGCA to GGTGT; or the expression cassette comprising the promoter nucleotide sequence comprises the nucleotide sequence obtained by mutating the bases at positions -49, -51 and -54 to -58 in the promoter region shown in SEQ ID NO: 29; preferably, the nucleotide at position -49 of the promoter region shown in SEQ ID NO: 29 is mutated from cytosine (C) to adenine (A), and the nucleotide at position -51 is mutated from guanine (G) to thymine (T), and the nucleotide sequence from positions -54 to -58 is mutated from CTGCA to GGTGT and a coding sequence operably linked to the promoter; preferably, the coding sequence is the coding sequence of dapB gene; or the second recombinant vector comprises the promoter nucleotide sequence comprises the nucleotide sequence obtained by mutating the bases at positions -49, -51 and -54 to -58 in the promoter region shown in SEQ ID NO: 29; preferably, the nucleotide at position -49 of the promoter region shown in SEQ ID NO: 29 is mutated from cytosine (C) to adenine (A), and the nucleotide at position -51 is mutated from guanine (G) to thymine (T), and the nucleotide sequence from positions -54 to -58 is mutated from CTGCA to GGTGT; preferably, the recombinant vector is constructed by ligating the promoter nucleotide sequence with pK18mobsacB plasmid; preferably, the host strain of the recombinant strain is YP97158.

33. A method for producing L-lysine, comprising culturing the microorganism according to claim 17 or the first recombinant strain contains a polynucleotide encoding the amino acid sequence of SEQ ID NO: 3, wherein the lysine residue at position 176 is substituted with a different amino acid residue, preferably with an asparagine residue; preferably, the polynucleotide sequence comprises a polynucleotide encoding the amino acid sequence of SEQ ID NO: 4. preferably, the polynucleotide sequence is formed by mutation of the base at position 528 of the polynucleotide sequence shown in SEQ ID NO: 1; preferably, the mutation includes base mutation of adenine (A) to cytosine (C) at position 528 of the polynucleotide sequence shown in SEQ ID NO: 1; preferably, the polynucleotide sequence comprises the polynucleotide sequence shown in SEQ ID NO: 2; or the second recombinant strain contains the promoter nucleotide sequence comprises the nucleotide sequence obtained by mutating the bases at positions -49, -51 and -54 to -58 in the promoter region shown in SEQ ID NO: 29; preferably, the nucleotide at position -49 of the promoter region shown in SEQ ID NO: 29 is mutated from cytosine (C) to adenine (A), and the nucleotide at position -51 is mutated from guanine (G) to thymine (T), and the nucleotide sequence from positions -54 to -58 is mutated from CTGCA to GGTGT; or the expression cassette comprising the promoter nucleotide sequence comprises the nucleotide sequence obtained by mutating the bases at positions -49, -51 and -54 to -58 in the promoter region shown in SEQ ID NO: 29; preferably, the nucleotide at position -49 of the promoter region shown in SEQ ID NO: 29 is mutated from cytosine (C) to adenine (A), and the nucleotide at position -51 is mutated from guanine (G) to thymine (T), and the nucleotide sequence from positions -54 to -58 is mutated from CTGCA to GGTGT and a coding sequence operably linked to the promoter; preferably, the coding sequence is the coding sequence of dapB gene; or the second recombinant vector comprises the promoter nucleotide sequence comprises the nucleotide sequence obtained by mutating the bases at positions -49, -51 and -54 to -58 in the promoter region shown in SEQ ID NO: 29; preferably, the nucleotide at position -49 of the promoter region shown in SEQ ID NO: 29 is mutated from cytosine (C) to adenine (A), and the nucleotide at position -51 is mutated from guanine (G) to thymine (T), and the nucleotide sequence from positions -54 to -58 is mutated from CTGCA to GGTGT; preferably, the recombinant vector is constructed by ligating the promoter nucleotide sequence with pK18mobsacB plasmid; preferably, the host strain of the recombinant strain is YP97158, and recovering L-lysine from the culture.

Description

DETAILED DESCRIPTION OF THE INVENTION

[0128] The technical solutions of the invention will be described in further detail below with reference to specific examples. It should be understood that the following examples are only for illustrating and explaining the invention, and should not be construed as limiting the protection scope of the invention. The technologies implemented based on the above content of the invention are all encompassed by the intended protection scope of the invention. Unless otherwise stated, the raw materials and reagents used in the following examples are all commercially available, or can be prepared by known methods; the operations performed are all known in the art, or are carried out according to the user manuals of commercially available products.

[0129] In the following examples, the compositions of the basic media used for culturing the strains are identical, and to this basic medium, correspondingly required sucrose, kanamycin or chloramphenicol, etc., can be added. The composition of the basic medium is as follows:

TABLE-US-00023 Component Formula Sucrose 10 g/L Polypeptone 10 g/L Beef extract 10 g/L Yeast extract powder 5 g/L Urea 2 g/L NaCl 2.5 g/L Agar powder 20 g/L pH 7.0 Culture temperature 32° C.

[0130] The preparation and conditions of SSCP-PAGE in the following examples are as follows:

TABLE-US-00024 Component Amount (final concentration of acrylamide: 8%) 40% Acrylamide 8 ml ddH.sub.2O 26 ml Glycerin 4 ml 10*TBE 2 ml TEMED 40 .Math.l 10% AP 600 .Math.l Electrophoresis conditions The electrophoresis tank is placed in ice and 1×TBE buffer is used; voltage: 120 V; electrophoresis time: 10 h

[0131] The fermentation medium formula and fermentation control process of L-Lysine in the following examples are as follows:

TABLE-US-00025 Fermentation medium formula Component Formula hydrolyzed sugar from starch 30 g/L (NH.sub.4).sub.2SO.sub.4 12 g/L MgSO.sub.4 0.87 g/L Sirup 20 g/L Acidified corn pulp 3 mL/L H.sub.3PO.sub.4 0.4 mL/L KCl 0.53 g/L FeSO.sub.4 120 mg/L MnSO.sub.4 120 mg/L Nicotinamide 42 mg/L Calcium pantothenate 6.3 mg/L Vitamin B1 6.3 mg/L Copper and zinc salt solution 0.6 g/L Biotin 0.88 mg/L

TABLE-US-00026 Fermentation control process Calibration Temperature: 37° C., air volume: 4 L/min, speed: 1000 rpm, tank pressure: 0 mpa, calibrate after 5 min Inoculum amount 10% Culture temperature (°C) 37° C. pH pH6.9±0.05 Dissolved oxygen (DO) 10-30% Initial conditions Temperature: 37° C., pH6.9, tank pressure: 0 Mpa, air volume: 3 L/min, speed: 550 rpm Whole process control Whole process control: 1. when DO is less than 30%, increase the speed by 750 rpm.fwdarw.800 rpm.fwdarw.air volume: 4 L/min.fwdarw.850 rpm.fwdarw.950 rpm; 2. at 6 hours of fermentation, increase tank pressure to 0.01 Mpa; at 12 h hours of fermentation, increase tank pressure by 0.02 Mpa .fwdarw. 0.03 Mpa.fwdarw.0.04 Mpa.fwdarw.0.05 Mpa Residual sugar control 0.1-0.2% before F12 h; after F12 h, combined with DO requirement, residual sugar is controlled to be 0.1-0.05% Ammonia-nitrogen control 0.1-0.15 before F12 h; 0.15-0.25 for F12-F32 h; 0.1-0.15 after F32 h Fed-batch 25% Ammonia water, 70% concentrated sugar, 50% materials ammonium sulfate, 10% bubble enemy Fermentation cycle About 48 h

Example 1: Construction of Transformation Vector pK18-NCg12176.SUP.A528C Comprising Point-Mutated NCg12176 Gene Coding Region

[0132] According to the genomic sequence of wild-type Corynebacterium glutamicum ATCC13032 published by NCBI, two primer pairs for amplifying NCg12176 gene coding region sequence were designed and synthesized, and a point mutation was introduced into the NCg12176 gene coding region (SEQ ID NO: 1) (the protein encoded by which has the amino acid sequence shown in SEQ ID NO: 3) of strain YP97158, which was deposited on Aug. 16, 2016 at China General Microbiological Culture Collection Center (Address: No.1 West Beichen Road, Chaoyang District, Beijing, Telephone: 010-64807355) with a deposition number of CGMCC No. 12865 and has been recorded in Chinese Patent Application CN106367432A (Filing date: Sep. 1, 2016; Publication date: Feb. 1, 2017), by allelic substitution, such that the base at position 528 of the nucleotide sequence of the NCg12176 gene was changed from adenine (A) to cytosine (C) (SEQ ID NO: 2: NCg12176.sup.A528C ) and the amino acid residue at position 176 of the amino acid sequence of the corresponding encoded protein was changed from a lysine residue to an asparagine residue (SEQ ID NO: 4 : NCg12176 .sup.K176N).

[0133] The primers designed were as follows (synthesized by Invitrogen, Shanghai):

TABLE-US-00027 P1: 5′ CAGTGCCAAGCTTGCATGCCTGCAGGTCGACTCTAGCGGCGAC CGCATGGACACCG 3′ (SEQ ID NO:5)

TABLE-US-00028 P2: 5′ CCGGGGACTGGTTTTCGGGTGTTGGTGTGC 3′ (SEQ ID N O:6)

TABLE-US-00029 P3: 5′ GCACACCAACACCCGAAAACCAGTCCCCGG 3′ (SEQ ID N O:7)

TABLE-US-00030 P4: 5′ CAGTATGACCATGATTACGAATTCGAGCTCGGTACCCCGAGGT CTCTCAGAATCGGT 3′ (SEQ ID NO:8)

[0134] Construction method: using the genomic DNA of Corynebacterium glutamicum ATCC13032 as template, PCR amplifications were performed with primers P1 and P2, and primers P3 and P4, respectively.

[0135] PCR system: 10 × Ex Taq Buffer 5 .Math.L, dNTP Mixture (2.5 mM each) 4 .Math.L, Mg.sup.2+ (25 mM) 4 .Math.L, primers (10 pM) 2 .Math.L each, Ex Taq (5U/.Math.L) 0.25 .Math.L, total volume 50 .Math.L.

[0136] PCR amplification procedure: initial denaturation at 94° C. for 5 min; 30 cycles of denaturation at 94° C. for 30 s, annealing at 52° C. for 30 s, and extension at 72° C. for 40 s; and a final extension at 72° C. for 10 min. Two DNA fragments containing the NCg12176 gene coding region, NCg12176 Up and NCg12176 Down, with sizes of respectively 796 bp and 786 bp, were obtained.

[0137] The above two DNA fragments were isolated and purified by agarose gel electrophoresis and then using the two purified DNA fragments as template, overlap PCR amplification was performed with primers P1 and P4 to obtain a fragment of about 1552 bp.

[0138] PCR system: 10 × Ex Taq Buffer 5 .Math.L, dNTP Mixture (2.5 mM each) 4 .Math.L, Mg.sup.2+ (25 mM) 4 .Math.L, primers (10 pM) 2 .Math.L each, Ex Taq (5U/.Math.L) 0.25 .Math.L, total volume 50 .Math.L.

[0139] PCR amplification procedure: initial denaturation at 94° C. for 5 min; 30 cycles of denaturation at 94° C. for 30 s, annealing at 52° C. for 30 s, and extension at 72° C. for 90 s; and a final extension at 72° C. for 10 min.

[0140] This DNA fragment (NCg12176.sup.A528C) caused the change of the base at position 528 of the NCg12176 gene coding region of YP97158 from adenine (A) to cytosine (C) and then the change of the amino acid residue at position 176 of the encoded protein from a lysine (K) residue to an asparagine (N) residue.

[0141] The pK18mobsacB plasmid (Addgene) was digested with Xba I. The NCg12176.sup.A528C and the linearized pK18mobsacB plasmid were isolated and purified by agarose gel electrophoresis, and then assembled by the NEBuider recombination system to obtain a vector pK18-NCg12176.sup.A528C containing a kanamycin resistance marker. The vector pK18-NCg12176.sup.A528C was sent for sequencing, and the correct vector pK18-NCg12176.sup.A528C containing point mutation (A-C) was stored for later use.

Example 2: Construction of Engineered Strain Containing Point-Mutated Gene NCg12176.SUP.A528C

[0142] Construction method: the plasmid pK18-NCg12176.sup.A528C for allelic substitution was transformed into L-lysine-producing strain YP97158 (see WO2014121669A1 for its construction method; it was confirmed by sequencing that wild-type NCg12176 gene coding region was retained on the chromosome of this strain) through electroporation; single colonies obtained after culture were identified by primer P1 and universal primer M13R respectively, and the strain from which a band of about 1559 bp could be amplified was a positive strain. The positive strain was cultured on the medium containing 15% sucrose, and single colonies obtained after culture were cultured on the medium containing kanamycin and without kanamycin at the same time; the strain that grew on the medium without kanamycin and did not grow on the medium containing kanamycin was further identified by PCR using the following primers (synthesized by Invitrogen, Shanghai):

TABLE-US-00031 P5: 5′ GAAAACACCGCCCGAATC 3′ (SEQ ID NO:9)

TABLE-US-00032 P6: 5′ GGAGTGCGTGTTTGTTGATG 3′ (SEQ ID NO: 10)

[0143] The above PCR amplification product was subjected to sscp electrophoresis after high temperature denaturation and ice bath (the amplified fragment of plasmid pK18-NCg12176.sup.A528C was used as a positive control, the amplified fragment of YP97158 was used as a negative control, and water was used as a blank control). Because of the different fragment structures, the fragments had different electrophoretic positions. The strain whose fragment had an electrophoretic position inconsistent with the negative control fragment, but the same as the positive control fragment had successful allelic substitution. PCR amplification was performed again with primers P5 and P6 to amplify the target fragment of the strain with successful allelic substitution, and the amplified fragment was ligated with the PMD19-T vector for sequencing. The strain with successful allelic substitution was verified by examining the mutated base sequence, and named as YPL-4-011.

Example 3: Construction of Engineered Strain Overexpressing NCg12176 or NCg12176 .SUP.A528C Gene on Genome

[0144] According to the genomic sequence of wild-type Corynebacterium glutamicum ATCC13032 published by NCBI, three primer pairs for amplifying upstream and downstream homologous arm fragments and NCg12176 or NCg12176.sup.A528C gene coding region and promoter region sequence were designed and synthesized. The NCg12176 or NCg12176.sup.A528C gene was introduced into strain YP97158 by homologous recombination.

[0145] The primers designed were as follows (synthesized by Invitrogen, Shanghai):

TABLE-US-00033 P7: 5’CAGTGCCAAGCTTGCATGCCTGCAGGTCGACTCTAGAATGCGTT  CTGGACTGAGG3′ (SEQ ID NO:11)

TABLE-US-00034 P8:5’AACACCATTGTCCCTGTTTTGGGCGAAATTTTCCCGGTGCACCGA G AACAGATG3′ (SEQ ID NO: 12)

TABLE-US-00035 P9:5′CGGGAAAATTTCGCCCAAAACAGGGACAATGGTGTTATGGCATTT GCAGACA TTGTGCGC3′ (SEQ ID NO: 13)

TABLE-US-00036 P10:5′CTTGATTIAATTGCGCCATCICAGGCGAACGGCTTCGTCTCGTA G3’ (SEQ ID NO: 14)

TABLE-US-00037 P1 1:5’CTACGAGACGAAGCCGTTCGCCTGAGATGGCGCAATTAAATCA AG 3′ (SEQ ID NO: 15)

TABLE-US-00038 P12:5′CAGCTATGACCATGATTACGAATTCGAGCTCGGTACCCGCTATG ACACCTTCAACGGATC 3′ (SEQ ID NO: 16)

[0146] Construction method: using the genomic DNA of Corynebacterium glutamicum ATCC13032 or YPL-4-011 as template, PCR amplifications were respectively carried out with primers P7 and P8, P9 and P10 and P11 and P12 to obtain the upstream homologous arm fragment of about 720 bp, NCg12176 gene and its promoter fragment of about 1092 bp, NCg12176.sup.A528C gene and its promoter fragment of about 1092 bp, and the downstream homologous arm fragment of about 653 bp. Using the mixture of above three fragments amplified (i.e., upstream homologous arm fragment, NCg12176 gene and its promoter fragment, downstream homologous arm fragment; or upstream homologous arm fragment, NCg12176.sup.A528C gene and its promoter fragment, downstream homologous arm fragment) as template, amplification was performed with primers P7 and P12 to obtain an integrating homologous arm fragment.

[0147] After the PCR reaction, the amplified products were recovered by electrophoresis, and the desired DNA fragments of about 2504 bp were recovered using a column gel DNA recovery kit (TIANGEN). The fragments were respectively ligated with Xba I-digested plasmid PK18mobsacB by NEBuider recombination system to obtain integrating plasmids PK18mobsacB-NCg12176 and PK18mobsacB-NCg12176.sup.A528C. These two plasmids contained kanamycin resistance markers, and recombinants with the plasmids integrated into the genomes could be obtained by kanamycin resistance screening.

[0148] PCR system: 10 × Ex Taq Buffer 5 .Math.L, dNTP Mixture (2.5 mM each) 4 .Math.L, Mg.sup.2+ (25 mM) 4 .Math.L, primers (10 pM) 2 .Math.L each, Ex Taq (5U/.Math.L) 0.25 .Math.L, total volume 50 .Math.L.

[0149] PCR amplification procedure: initial denaturation at 94° C. for 5 min; 30 cycles of denaturation at 94° C. for 30 s, annealing at 52° C. for 30 s, and extension at 72° C. for 120 s; and a final extension at 72° C. for 10 min.

[0150] The two integrating plasmids were respectively electro-transformed into the L-lysine-producing strain YP97158, and single colonies obtained after culture were identified by PCR with primers P13 and P14. A fragment of about 1609 bp could be amplified from positive strains, and no fragment could be amplified from original strains. The positive strains were screened with 15% sucrose and cultured on media containing kanamycin and without kanamycin at the same time. The strain that grew in the medium without kanamycin and did not grow on the medium containing kanamycin was further identified by PCR using primers P15 and P16, and the strain from which a fragment of about 1123 bp could be amplified was a strain with YP97158 genome integrated with NCg12176 or NCg12176.sup.A528C gene, which were named as YPL-4-012 (without point mutation) and YPL-4-013 (with point mutation), respectively.

TABLE-US-00039 P13: 5′ TCCAAGGAAGATACACGCC 3′(SEQ ID NO: 17)

TABLE-US-00040 P14: 5′ CCTGAGCGGAATAGTCCTGTG3’(SEQ ID NO:18)

TABLE-US-00041 P15: 5′ ACGCACCCGTGTTCTACCT3′(SEQ ID NO: 19)

TABLE-US-00042 P16: 5′ CGTTGGAATCTTGCGTTG 3′(SEQ ID NO:20)

Example 4: Construction of Engineered Strain Overexpressing NCg12176 or NCg12176 .SUP.A528C Gene on Plasmid

[0151] According to the genomic sequence of wild-type Corynebacterium glutamicum ATCC13032 published by NCBI, three primer pairs for amplifying NCg12176 or NCg12176 .sup.A528C gene coding region and promoter region sequence were designed and synthesized. The primers designed were as follows (synthesized by Invitrogen, Shanghai):

TABLE-US-00043 P17:5′GCTTGCATGCCTGCAGGTCGACTCTAGAGGATCCCCCGGGAAAA TTTCGCCCAAAACAG3’(SEQ ID NO:21)

TABLE-US-00044 P18:5′ATCAGGCTGAAAATCTTCTCTCATCCGCCAAAACTCAGGCGAAC GGCTTCGTCTCGTAG 3′(SEQ ID NO:22)

[0152] Construction method: using the genomic DNA of wild-type Corynebacterium glutamicum ATCC13032 or YPL-4-011 as template, PCR amplifications were respectively carried out with primers P17 and P18 to obtain the NCg12176 or NCg12176.sup.A528C gene and its promoter fragment of about 1140 bp. The amplified products were recovered by electrophoresis, and the desired DNA fragments of about 1140 bp were recovered using a column gel DNA recovery kit (TIANGEN). The fragments were ligated with EcoR I-digested shuttle plasmid pXMJ19 by NEBuider recombination system to obtain overexpression plasmids pXMJ19-NCg12176 and pXMJ19-NCg12176.sup.A528C, respectively. These two plasmids contained chloramphenicol resistance markers, and the strains transformed with the plasmids could be obtained by chloramphenicol resistance screening.

[0153] PCR system: 10×Ex Taq Buffer 5 .Math.L, dNTP Mixture (2.5 mM each) 4 .Math.L, Mg.sup.2+ (25 mM) 4 .Math.L, primers (10 pM) 2 .Math.L each, Ex Taq (5U/.Math.L) 0.25 .Math.L, total volume 50 .Math.L.

[0154] PCR amplification procedure: initial denaturation at 94° C. for 5 min; 30 cycles of denaturation at 94° C. for 30 s, annealing at 52° C. for 30 s, and extension at 72° C. for 90 s; and a final extension at 72° C. for 10 min.

[0155] The plasmids were respectively electro-transformed into L-lysine-producing strain YP97158, and the single colonies obtained after culture were identified by PCR with primers M13R(-48) and P18. The strains from which a fragment of about 1147 bp could be amplified by PCR were the strains transformed with plasmids, which were named as YPL-4-014 (without point mutation) and YPL-4-015 (with point mutation), respectively.

Example 5: Construction of Engineered Strain Lacking NCg12176 Gene on Genome

[0156] According to the genomic sequence of Corynebacterium glutamicum ATCC13032 published by NCBI, two primer pairs for amplifying the fragments at the two ends of NCg12176 gene coding region were synthesized and the PCR-amplified fragments were used as upstream and downstream homologous arm fragments. The primers designed were as follows (synthesized by Invitrogen, Shanghai):

TABLE-US-00045 P19:5′CAGTGCCAAGCTTGCATGCCTGCAGGTCGACTCTAGTCAAAGAG GGCGAGATAAT3′(SEQ ID NO:23)

TABLE-US-00046 P20:5′GTTCATGAGACACCCAGTAGGACGACCTACAGAATACTAGTCAG TG 3′(SEQ ID NO:24)

TABLE-US-00047 P21:5′CACTGACTAGTATTCTGTAGGTCGTCCTACTGGGTGTCTCATGA AC 3′(SEQ ID NO:25)

TABLE-US-00048 P22:5′CAGCTATGACCATGATTACGAATTCGACTTCGGTACCCACCGCA CGATGGTTCACT3′(SEQ ID NO:26)

[0157] Using the genomic DNA of Corynebacterium glutamicum ATCC13032 as template, PCR amplification was carried out with primers P19 and P20, and P21 and P22 respectively to obtain an upstream homologous arm fragment of 852 bp and a downstream homologous arm fragment of 787 bp; and then overlap PCR was carried out with primers P19 and P22 to obtain an entire homologous arm fragment of 1639 bp. After the PCR reaction, the amplified product was recovered by electrophoresis, and the desired 1639 bp DNA fragment was recovered using a column gel DNA recovery kit (TIANGEN). The fragment was ligated with Xba I-digested shuttle plasmid pXMJ19 by NEBuider recombination system to obtain a knock-out plasmid. The plasmid contained a kanamycin resistance marker.

[0158] The knock-out plasmid was electro-transformed into lysine-producing strain YP97158, and single colonies obtained after culture were identified by PCR with the following primers (synthesized by Invitrogen, Shanghai):

TABLE-US-00049 P23: 5′ TCAAAGAGGGCGAGATAAT 3′(SEQ ID NO:27)

TABLE-US-00050 P24; 5′ ACCGCACGATGGTTCACT 3′(SEQ ID NO:28)

[0159] The strains from which 1521 bp and 2556 bp fragments could be amplified by the above PCR were positive strains, and the strains from which only a 2556 bp fragment could be amplified were the original strains. The positive strains were screened on 15% sucrose medium and cultured on the medium containing kanamycin and without kanamycin, respectively. The strain that grew in the medium without kanamycin and did not grow on the medium containing kanamycin was further identified by PCR with primers P23 and P24, and the strain from which a fragment of 1521 bp could be amplified was a genetically engineered strain with the NCg12176 gene coding region knocked out, which was named as YPL-4-016.

Example 6: L-Lysine Fermentation Experiment

[0160] The strains constructed in Examples 2 to 5 and original strain YP97158 were fermented in the culture medium shown in Table 1 in the BLBIO-5GC-4-H model fermenter (purchased from Shanghai Bailun Biotechnology Co., Ltd.) according to the control process shown in Table 2 for fermentation experiments. The experiment for each strain was conducted in triplicate. The results are shown in Table 3.

TABLE-US-00051 L-Lysine fermentation experiment results Strain L-Lysine production (g/100 ml) OD (660 nm) YP97158 18.8 37.3 YPL-4-011 19.0 37.2. YPL-4-012 19.3 36.5 YPL-4-013 19.8 37.0 YPL-4-014 20.1 36.8 YPL-4-015 20.3 35.9 YPL-4-016 18.2 36.7

[0161] The results are shown in Table 3. Overexpression of the NCg-12176 gene, or point mutation in the NCg12176 gene coding region, i.e., NCg12176.sup.A528C and overexpression in Corynebacterium glutamicum contribute to the improvement of L-lysine production, while the gene down-regulation or knock-out is not conducive to the accumulation of lysine.

Example 7: Construction of Transformation Vector pK18-PdapB (C(-49)A G(-51)T.SUB., CTGCA(-54-58)GGTGT) Comprising Point-Mutated Dapb Gene Promoter Region

[0162] According to the genomic sequence of wild-type Corynebacterium glutamicum ATCC13032 published by NCBI, two primer pairs for amplifying dapB gene promoter region sequence were designed and synthesized, and point mutations were introduced into the dapB gene promoter region (SEQ ID NO: 29) in strain YP97158 by allelic substitution, such that the nucleotide at position -49 of the nucleotide sequence of the dapB gene promoter region was mutated from cytosine (C) to adenine (A), the nucleotide at position -51 was mutated from guanine (G) to thymine (T), and the nucleotide sequence from positions -54 to -58 was mutated from CTGCA to GGTGT.

[0163] The primers designed were as follows (synthesized by Invitrogen, Shanghai):

TABLE-US-00052 P1′: 5′CCGGAATTCAGCATGCCGGACATGCGGAC3′(EcoR 1) (SE Q ID NO:31)

TABLE-US-00053 P2’: 5′ CCTTCTGAACGGGTTGTGGTATAATGGTGG 3′ (SEQ ID  NO:32)

TABLE-US-00054 P3’; 5′ CCACCATTATACCACAACCCGTTCAGAAGG 3’ (SEQ ID  NO:33)

TABLE-US-00055 P4’: 5′ ACATGCATGCGAATATTGACGTTGAGGAAG 3′(Sph I) ( SEQ ID NO:34).

[0164] Construction method: using the genomic DNA of Corynebacterium glutamicum ATCC13032 as template, PCR amplifications were performed with primers P1′ and P2′, and primers P3′ and P4′, respectively.

[0165] PCR system: 10×Ex Taq Buffer 5 .Math.L, dNTP Mixture (2.5 mM each) 4 .Math.L, Mg.sup.2+ (25 mM) 4 .Math.L, primers (10 pM) 2 .Math.L each, Ex Taq (5U/.Math.L) 0.25 .Math.L, total volume 50 .Math.L.

[0166] PCR amplification procedure: initial denaturation at 94° C. for 5 min; 30 cycles of denaturation at 94° C. for 30 s, annealing at 52° C. for 30 s, and extension at 72° C. for 60 s; and a final extension at 72° C. for 10 min.

[0167] Two DNA fragments containing a point mutation, dapB Up and dapB Down, with sizes of respectively 665 bp and 664 bp were obtained. The above two DNA fragments were isolated and purified by agarose gel electrophoresis and then using the two purified DNA fragments as template, overlap PCR amplification was performed with primers P1′ and P4′ to obtain an Up-Down fragment of about 1279 bp.

[0168] Overlap PCR system: 10×Ex Taq Buffer 5 .Math.L, dNTP Mixture (2.5 mM each) 4 .Math.L, Mg.sup.2+ (25 mM) 4 .Math.L, primers (10 pM) 2 .Math.L each, Ex Taq (5U/.Math.L) 0.25 .Math.L, total volume 50 .Math.L.

[0169] Overlap PCR amplification procedure: initial denaturation at 94° C. for 5 min; 30 cycles of denaturation at 94° C. for 30 s, annealing at 52° C. for 30 s, and extension at 72° C. for 90 s; and a final extension at 72° C. for 10 min.

[0170] This Up-Down fragment was isolated and purified by agarose gel electrophoresis. The fragment contained the dapB gene promoter region and its upstream and downstream sequences, and the two ends of the fragment contained EcoR I and Sph I restriction sites respectively. This DNA fragment resulted in the change of the nucleotide from C to A at position -49 of the YP97158 dapB gene promoter region, and the nucleotide from G to T at position -51, and the nucleotide sequence from CTGCA to GGTGT from positions -54 to -58.

[0171] The fragment was double-digested with restriction enzymes EcoR I and Sph I and then ligated with shuttle plasmid pK18mobsacB (Addgene) which was double-digested with the same restriction enzymes EcoR I and Sph I, to obtain allelic substitution plasmid pK18-PdapB (C(-49)A,G(-51)T> CTGCA(—54—-58)GGTFGTF) containing a kanamycin resistance marker. The vector pK18-PdapB (C(-49)A,G(-51)T,CTFGCA(-54—-58)GGTFGT) was sent for sequencing, and the correct vector pK18-PdapB (C(-49)A,G(-51)T,CTGCA(-54—-58)GGTGT) containing point mutations was stored for later use.

Example 8: Construction of Engineered Strain Containing Point Mutated Vector pK18-PdapB (C(-49)A,G(-51)T,CTGCA(-54—-58)GGTGT)

[0172] Allelic substitution plasmid pK18-PdapB (C(-49)A,G(-51)T,CTGCA(-54—-58)GGTGT) was electro-transformed into L-lysine-producing strain YP97158 (it was confirmed by sequencing that wild-type dapB gene promoter was retained on the chromosome of this strain), and single colonies obtained after culture were identified by primer P1′ and universal primer M13R, respectively. A fragment of about 1350 bp could be amplified from positive strains. The positive strains were cultured on the medium containing 15% sucrose, and single colonies obtained after culture were cultured on the medium containing kanamycin and without kanamycin, respectively.

[0173] The strain that grew in the medium without kanamycin and did not grow on the medium containing kanamycin was further identified by PCR using the following primers (synthesized by Invitrogen, Shanghai):

TABLE-US-00056 P5’: 5′ AGATCGTCGGACTCATTGAC3’ (SEQ ID NO:35)

TABLE-US-00057 P6’: 5′ CAAACATAGTTCCACCTGTG 3′ (SEQ ID NO:36)

[0174] The above PCR amplification product was subjected to sscp electrophoresis after high temperature denaturation and ice bath (the amplified fragment of plasmid pK18-PdapB (C(-49)A-G(-51)T′CTGCA(-54--58)GGTGT) was used as a positive control, the amplified fragment of YP97158 was used as a negative control, and water was used as a blank control). Because of the different fragment structures, the fragments had different electrophoretic positions. The strain whose fragment had an electrophoretic position inconsistent with the negative control fragment, but the same as the positive control fragment had successful allelic substitution. PCR amplification was performed again to amplify the target fragment of the positive strain, and the amplified fragment was ligated with PMD19-T vector for sequencing. The strain with successful allelic substitution was verified by examining the mutated base sequence, and named as YPL-4-010.

Example 9: L-Lysine Fermentation Experiment

[0175] The strain YPL-4-010 constructed in Example 8 and original strain YP97158 were fermented in the culture medium shown in Table 1 in the BLBIO-5GC-4-H model fermenter (purchased from Shanghai Bailun Biotechnology Co., Ltd.) according to the control process shown in Table 2 for fermentation experiments. The experiment for each strain was conducted in triplicate. The results are shown in Table 4.

TABLE-US-00058 L-Lysine fermentation experiment results Strain L-Lysine production (g/100 ml) Conversion rate ( % ) YP97158 Batch 1 18.8 64.0 Batch 2 19.0 64.1 Batch 3 18.9 63.9 Mean 18.9 64.0 YPL-4-010 Batch 1 20.8 64.6 Batch 2 20.6 64.6 Batch 3 20.9 64.5 Mean 20.8 64.6 Fold increase 10.05% 0.94% Note: Conversion rate = (total mass of lysine/total consumption of glucose) x100%

[0176] The results are shown in Table 4, point mutation of the dapB gene promoter in C. glutamicum, PdapB.sup.(C(-49)A, G(-51)T, CTGCA(-54—-58)GGTGT), contributed to the improvement of L-lysine production.

[0177] The embodiments of the invention have been described above. However, the invention is not limited to the above-described embodiments. Any modification, equivalent replacement, improvement, etc. made within the spirit and principle of the invention shall be included within the protection scope of the invention.