RAA PRIMERS AND KITS FOR DETECTION OF HEPATITIS C VIRUS

Abstract

The present disclosure disclosed recombinase aided amplification (RAA) primers and kits for the detection of hepatitis c virus. Nucleotide sequences of the RAA primers include: an upstream primer: 5′-FITC-CTTGGGATATGATGATGAACTGGTCACCTAC-3′ (SEQ ID NO. 1); and a downstream primer: 5′-Biotin-AAGAGTAGCATCACAATCAGAACCTTAGCC-3′ (SEQ ID NO. 2). The HCV detection by using the RAA primers screened by the present disclosure has good specificity and high sensitivity (at least 10 copies/μL can be detected). The RAA primers can be used to prepare an HCV detection kit and construct an RAA amplification system. And combined with a lateral flow chromatography technology, the present disclosure can achieve rapid and low-cost detection of HCV and visual result judgment, no complex professional background is required, the use process is convenient and fast, and the detection results are safe and reliable.

Claims

1. Recombinase aided amplification (RAA) primers for detecting hepatitis C virus, wherein nucleotide sequences of the RAA primers comprise: TABLE-US-00005 an upstream primer: (SEQ ID NO. 1) 5′-FITC-CTTGGGATATGATGATGAACTGGTCACCTAC-3′; and a downstream primer: (SEQ ID NO. 2) 5′-Biotin-AAGAGTAGCATCACAATCAGAACCTTAGCC-3′.

2. The RAA primers according to claim 1, wherein nucleotide sequences of the RAA primers further comprise: TABLE-US-00006 an upstream primer: (SEQ ID NO. 3) 5′-FITC-AGTACAGGACTGCAATTGCTCAATATATCC-3′; and a downstream primer: (SEQ ID NO. 4) 5′-Biotin-GCAAAGATAGCATCACAATCAGAACCTTAG-3′.

3. A hepatitis C virus detection kit, wherein the hepatitis C virus detection kit comprises the recombinase aided amplification (RAA) primers of claim 1.

4. The hepatitis C virus detection kit according to claim 3, further comprising an RNA extraction reagent, an RAA amplification reaction reagent, a lateral flow chromatography test strip, reaction dry powder, and a positive control sample.

5. The hepatitis C virus detection kit according to claim 4, wherein the RAA amplification reaction reagent is a reagent including a buffer and a magnesium acetate solution, the buffer including 200 mmol/L of HEPES at pH 6.8, 600 mmol/L of NaCl solution, and 60 mmol/L of MgCl.sub.2 solution.

6. The hepatitis C virus detection kit according to claim 4, wherein the positive control sample is a plasmid including C/E1 gene of the hepatitis C virus.

7. A recombinase aided amplification (RAA) amplification system for detecting hepatitis C virus, wherein the RAA amplification system comprises: 41.5 μL of a buffer, 10 μL of deionized water, 2.5 μL of each of the upstream primer and downstream primer according to claim 1, 2 μL of an RNA extract of a sample to be tested, reaction dry powder, and 2.5 μL of a magnesium acetate solution in 280 mmol/L, wherein the buffer includes 200 mmol/L of HEPES at pH 6.8, 600 mmol/L of NaCl solution, and 60 mmol/L of MgCl.sub.2 solution, the reaction dry powder is a cre recombinase at 50 μg/ml.

8. A method of using the hepatitis C virus detection kit of claim 4, wherein the method comprises the following steps: using the RNA extraction reagent to extract RNA from a sample to be tested, and obtaining an RAA amplification product by performing an isothermal amplification reaction on the RNA extract.

9. The method according to claim 8, wherein the isothermal amplification reaction includes: adding 41.5 μL of a buffer, 10 μL of deionized water, 2.5 μL of each of the upstream primer and downstream primer, 2 μL of each of the RNA extract or the positive control sample to a 0.2 mL detection tube containing reaction dry powder, wherein the buffer includes 200 mmol/L of HEPES at pH 6.8, 600 mmol/L of NaCl solution, and 60 mmol/L of MgCl.sub.2 solution, the reaction dry powder is a cre recombinase at 50 μg/ml, and finally adding 2.5 μL of 280 mmol/L magnesium acetate solution for thoroughly mixing to obtain a mixed RAA amplification system, placing the mixed RAA amplification system on a water bath, and reacting at 30-42° C. for 5-30 min to obtain the RAA amplification product.

10. The method according to claim 9, wherein the method further comprises the following steps: dripping the obtained RAA amplification product to a sample well of a colloidal gold-labeled lateral flow chromatography test strip, and after reaction for 3-10 min, determining a detection result by observing the appearance of a detection line and/or a control line on the colloidal gold-labeled lateral flow chromatography test strip.

11. The method according to claim 10, wherein the method further comprises: first incubating the RAA amplification product at 37° C. for 5 min, diluting the RAA amplification product with 200 μL of a PBST buffer, dripping the diluted RAA amplification product to the sample well of the colloidal gold-labeled lateral flow chromatography test strip, and after reaction at room temperature for 5-10 min, determining the detection result by observing the appearance of the detection line and/or the control line on the colloidal gold-labeled lateral flow chromatography test strip.

Description

BRIEF DESCRIPTION OF THE DRAWINGS

[0030] FIG. 1 is an exemplary graph showing the results of a sensitivity experiment based on the RAA-LFA detection method according to some embodiments of the present disclosure.

[0031] FIG. 2 is an exemplary graph showing the results of a specificity experiment based on the RAA-LFA detection method according to some embodiments of the present disclosure.

DETAILED DESCRIPTION

[0032] The specific embodiments of the present disclosure will be described below in conjunction with the accompanying drawings and embodiments, but the following embodiments are only used to describe the present disclosure in detail and do not limit the scope of the present disclosure in any way.

[0033] Additionally, for numerical ranges in the present disclosure, it should be understood that each intervening value between the upper and lower limits of the range is also specifically disclosed. Every smaller range between any stated value or intervening value in a stated range and any other stated value or intervening value in that stated range is also encompassed within the present disclosure. The upper and lower limits of these smaller ranges may independently be included or excluded in the range.

[0034] Unless otherwise defined, all technical and scientific terms used in the present disclosure have the same meaning as commonly understood by one of ordinary skill in the art to which the present disclosure relates. Although only the preferred methods and materials are described herein, any methods and materials similar or equivalent to those described in the present disclosure can also be used in the practice or testing of the present disclosure. All documents mentioned in the present disclosure are incorporated by reference for the purpose of disclosing and describing the methods and/or materials in connection with which the documents are referred. In the event of a conflict with any incorporated document, the content of the present disclosure controls.

Embodiment 1: Primer Design and Condition Optimization

[0035] The key to RAA amplification lies in the design of primers, but RAA is different from conventional PCR reactions. At present, there is no software or mature design principles for RAA primer design, and there is no large amount of data to provide a basis for its primer design. There is no mature experience to follow. Based on long-term practical research, the present disclosure selects the C/E1 genes of the HCV 1b genotype strain and other 6 genotype strains included in the NCBI for sequence comparison, and prudently selects the conserved region as the target of RAA amplification. The nucleotide sequence of the conserved region of C/E1 gene is shown in SEQ ID NO. 5 (AGTACAGGACTGCAATTGCTCAATATATCCCGGCCACGTGACAGGTCACCGTATG GCTTGGGATATGATGATGAACTGGTCACCTACAGCAGCCCTAGTGGTATCGCAGTT ACTCCGGATCCCACAAGCTGTCGTGGATATGGTGGCGGGGGCCCATTGGGGAGT CCTAGCGGGCCTTGCCTACTATTCCATGGTGGGGAACTGGGCTAAGGTTCTGATT GTGATGCTACTCTT). A plurality of factors has been comprehensively considered, such as 1. GC content (40-60%); 2. length (30-35nt); 3. the size of the amplification product (100-300 bp) and so on. Primer design includes upstream primer design and downstream primer design. According to the designed upstream RAA primers and downstream RAA primers, cross-pairing was carried out, and paired primers were screened to obtain the optimal primers. See Table 1 for details.

TABLE-US-00004 TABLE 1 designed RAA primers for the conserved region of the C/E1 gene of hepatitis C virus SEQ Primer ID Location name NO Sequence (5′-3′) (nt) RAA-F1 3 AGTACAGGACTGCAA 1241-1270 TTGCTCAATATATCC RAA-R1 4 GCAAAGATAGCATCA 1477-1447 CAATCAGAACCTTAG RAA-F2 1 CTTGGGATATGATGA 1297-1327 TGAACTGGTCACCTA C RAA-R2 2 AAGAGTAGCATCACA 1474-1445 ATCAGAACCTTAGCC

[0036] The specificity and amplification efficiency were further evaluated, and a more preferred primer pair was screened, specifically: after RAA amplification was performed with the RAA primer pairs designed in Table 1, agarose gel electrophoresis and lateral chromatography technology were performed. The F2/R2 primer pair after being screened has best amplification effect, good specificity and no non-specific amplification. However, other primer pairs have problems such as non-specific amplification and low amplification efficiency. Therefore, the F2/R2 primer pair was selected for the subsequent optimization of RAA reaction conditions, as well as the specificity and sensitivity test. The specific nucleotide sequence of the primer pair F2/R2 is: an upstream primer: 5′-FITC-CTTGGGATATGATGATGAACTGGTCACCTAC-3′ (SEQ ID NO.1); a downstream primer: 5′-Biotin-AAGAGTAGCATCACAATCAGAACCTTAGCC-3′ (SEQ ID NO. 2).

[0037] The RAA reaction time and reaction temperature were optimized, and it was found that the RAA amplification efficiency was the highest when the reaction temperature was 37° C. and the reaction was performed for 5 min. The optimized RAA reaction conditions of the present disclosure require only one temperature for the entire gene amplification process, do not require special instruments, are simpler to operate, and are suitable for on-site rapid detection of the hepatitis C virus.

Embodiment 2: Sensitivity and Specificity Test

[0038] A standard hepatitis C virus plasmid sample was selected as a template, and the template was diluted 10-fold gradient with double distilled water to a standard plasm id template with a concentration of 108 copies/μL-1copy/μL. Double distilled water was used as a blank control (CK). The optimized reaction conditions and the primer pair F2/R2 described in embodiment 1 were used for the RAA detection. The result is that the minimum detected template amount is 10 copies/μL (see FIG. 1). The sensitivity is higher than that of the conventional PCR method. The detection method of the present disclosure is simpler and faster, especially suitable for on-site detection, and has looser requirements on experimental conditions (e.g., small concentration of samples can be detected).

[0039] The nucleic acid samples were extracted from the positive samples of hepatitis A virus (HAV), hepatitis B virus (HBV), human immunodeficiency virus (HIV), Syphilis, and Human Papillomavirus (HPV) among the six infectious diseases as templates, and RAA was carried out according to the optimized reaction conditions and primer pair F2/R2 in Embodiment 1, and detection was performed by gel electrophoresis and lateral chromatography technology.

[0040] The experimental results of the lateral chromatography technology are shown in FIG. 2, only the hepatitis C virus (HCV) is positive, and the others are all negative, indicating that the RAA detection system of the present disclosure has good specificity.

Embodiment 3: Validation Test Applied to Individual Patient Screening

[0041] 2 mL of peripheral blood in vitro of a patient were taken and centrifuged at 3000 rpm for 5 min, and 200 μL of supernatant were taken to add into 560 μL of AVL lysate containing 5.6 μg of Carrier RNA. Viral RNA was extracted according to the instruction of QIAamp Viral RNA Mini Handbook (Qiagen, catalog #52904/52906), elution volume is 50 μL. According to the instruction of the RAA kit, 41.5 μL of buffer (which includes 200 mmol/L of HEPES at pH 6.8, 600 mmol/L of NaCl solution, and 60 mmol/L of MgCl.sub.2 solution), 10 μL of deionized water, 2.5 μL of each upstream primer and downstream primer of the primer pair F2/R2, 2 μL of RNA extract from the patient (2 μL of a positive template plasmid is added to another detection tube, the other condition is the same as the RNA extract), and finally 2.5 μL of 280 mmol/L magnesium acetate solution were added to a 0.2 mL detection tube containing reaction dry powder (The reaction dry powder cre recombinase at 50 μg/ml. The cre recombinase is used to promote RAA amplification, for example, for RNA extract, the cre recombinase may convert RNA to DNA for amplification; for DNA extract, the cre recombinase may promote DNA amplification directly) to obtain a RAA amplification system, the RAA amplification system was thoroughly mixed, the mixed RAA amplification system was placed on a water bath for reaction at 30-42° C. for 5-30 min to obtain the RAA amplification product. The amplification product was directly added dropwise to the colloidal gold-labeled lateral flow chromatography test strip, and the resulting bands were clear. For a positive sample, the detection line (T line) was red which could be distinguished by the naked eye, and for a negative sample, the detection line (T line) was not colored. The control line (line C) indicates that the test result is valid.

Embodiment 4: Validation Test Applied to Multiple Patients

[0042] 2 mL of peripheral blood from each patient was taken and centrifuged at 3000 rpm for 5 min, and 200 μL of supernatant were taken. The viral RNA of each serum was extracted by using an automatic nucleic acid extractor, with an elution volume of 50 μL. According to the instruction of RAA kit, 41.5 μL of buffer, 10 μL of deionized water, 2.5 μL of each upstream primer and downstream primer, 2 μL of RNA extract from each patient (2 μL of a positive template plasmid is added to another detection tube, the other condition is the same as the RNA extract), and finally 2.5 μL of 280 mmol/L magnesium acetate solution were added to a 0.2 mL detection tube containing reaction dry powder to obtain a RAA amplification system, the RAA amplification system was thoroughly mixed, the mixed RAA amplification system was placed on a water bath for reaction at 30-42° C. for 5-30 min to obtain the RAA amplification product. The amplification product was directly added dropwise to the colloidal gold-labeled lateral flow chromatography test strip, and the resulting band was clear. For a positive sample, the detection line (T line) was red which could be distinguished by the naked eye, and for a negative sample, the detection line (T line) was not colored. The control line (line C) indicates that the test result is valid.

[0043] The present disclosure has been described in detail above in conjunction with the accompanying drawings and embodiments. However, those skilled in the art can understand that changes, modifications, substitutions, combinations, and simplifications made without departing from the concept of the present disclosure should be equivalent alternatives, thereby forming multiple specific embodiments, that are within the scope of common variations of the present disclosure.