Process for the production of a filamentous fungus whole broth enzyme composition with low viscosity

20230287328 · 2023-09-14

    Inventors

    Cpc classification

    International classification

    Abstract

    The present invention relates to a process for the production of a filamentous fungus whole broth enzyme composition with low viscosity, a genetically modified filamentous fungus for production of the whole broth enzyme composition, the use of such a genetically modified filamentous fungus for the production of the filamentous fungus whole broth enzyme composition with low viscosity and a filamentous fungus whole broth enzyme composition produced by such a method.

    Claims

    1. A process for production of a whole broth enzyme composition, comprising the following steps: (a) providing a fermentation medium, originating from hydrolysis of lignocellulosic biomass, with a glucose content of from 5 to 450 g/L, a xylose content of from 2 to 300 g/L, a density of from 1 to 2 kg/L and a dry matter content of from 10 to 75 wt.-%; (b) adding at least one filamentous fungus cell wherein SEQ ID NO:1 has been disrupted; (c) mixing the fermentation medium and the at least one filamentous fungus cell for a time period of from 1 minute to 10 days at a temperature of from 20 to 35° C.; (d) obtaining a whole broth enzyme composition.

    2. The process according to claim 1, wherein the pH of the fermentation medium according to step (a) has been adjusted to a pH selected from pH 2.0 to 6.0.

    3. The process according to claim 1, wherein the ratio of glucose to xylose is from 1.0 to 3.5.

    4. The process according to claim 1, further comprising the step (ai) concentrating the fermentation medium by evaporation, membrane filtration or thin layer evaporation to decrease the weight of the fermentation medium by a factor of 2 to 6.

    5. The process according to ag claim 1, further comprising the step (aii) sterilizing the fermentation medium according to step (a) or the concentrated fermentation medium according to step (ai).

    6. The process according to ag claim 1, wherein the fermentation medium according to step (a) has a furfural content of less than 0.5 g/L.

    7. The process according to ag claim 1, wherein the fermentation medium according to step (a) has a hydroxymethyl furfural (HMF) content of less than 0.5 g/L.

    8. The process according to claim 1, further comprising the step (e) solid-liquid separation of the fermented medium according to step (c) to obtain a solid fraction and a liquid fraction.

    9. The process according to any claim 1, wherein from 0.05 to 5 wt.-% nitrogen is added during step (a) and/or (b) of the process.

    10. The process according to claim 1, wherein from 0.5 to 350-mg/L FeSO.sub.4, MnSO.sub.4, MgSO.sub.4 and/or ZnSO.sub.4 are added during step (a) and/or (b) of the process.

    11. The process according to a claim 1, wherein the filamentous fungus cell is Trichoderma.

    12. The process according to claim 1, wherein the filamentous fungus cell comprises at least one heterologous beta-glucosidase enzyme.

    13. A filamentous fungus cell wherein SEQ ID NO:1 has been disrupted.

    14. The filamentous fungus cell according to claim 13, wherein SEQ ID NO:1 has been disrupted by deletion, mutation, modification of a promotor or any other regulatory sequence, generation of a stop codon or RNA interference.

    15. The filamentous fungus cell according to claim 13, wherein the at least one filamentous fungus cell is a genetically modified filamentous fungus cell with the ability to express at least one heterologous hydrolase enzyme, at least one heterologous pectinase enzyme, at least one heterologous oxidative enzyme and/or at least one heterologous accessory protein.

    16. The Filamentous fungus cell according to claim 13, wherein the at least one filamentous fungus cell is a genetically modified filamentous fungus cell comprising at least one heterologous beta glucosidase enzyme encoding sequence, at least one heterologous beta-xylosidase enzyme encoding sequence, at least one heterologous xylanase enzyme encoding sequence, at least one heterologous pectinase enzyme encoding sequence, at least one heterologous lytic polysaccharide monooxygenase enzyme encoding sequence, at least one heterologous oxidative enzyme encoding sequence and/or at least one heterologous accessory protein encoding sequence.

    17. A whole broth enzyme composition produced according to the process as defined in claim 1.

    18. The process according to claim 1, wherein a whole broth enzyme composition is produced.

    19. A process for the hydrolyzation of lignocellulosic biomass, the process comprising hydrolyzing the lignocellulosic biomass using the whole broth enzyme composition according to claim 18.

    Description

    LIST OF FIGURES

    [0099] FIG. 1: Protein concentrations in the culture supernatants of pSEQ1 D transformants DSEQ1-1 to -3 and reference strain M18.2b. Values are given in relation to the average protein concentration in the supernatants of the host strain M18.2b which is set to 1.

    [0100] FIG. 2: Biomass concentrations in the culture supernatants of pSEQ1 D transformants DSEQ1-1 to -3 and reference strain M18.2b. Values are given in relation to the average biomass concentration in the supernatant of the host strain M18.2b which is set to 1.

    [0101] FIG. 3: Viscosity of culture broths of pSEQ1D transformants DSEQ1-1 to -3 and reference strain M18.2b. Values are given in relation to the viscosity of the culture broth of the host strain M18.2b which is set to 1.

    [0102] FIG. 4: SDS-PAGE gel of culture supernatants of pSEQ1 D transformants DSEQ1-1 to -3 and reference strain M18.2b. Reference bands (“Marker” lane) correspond to 250, 150, 100, 75, 50, 37, 25 and 20 kD

    [0103] FIG. 5: Protein concentrations in the culture supernatants of pSEQ1M1-HygR transformants M1SEQ1-1 to -3 and reference strain M18.2b. Values are given in relation to the average protein concentration in the supernatants of the host strain M18.2b which is set to 1.

    [0104] FIG. 6: Biomass concentrations in the culture supernatants of pSEQ1M1-HygR transformants and M1SEQ1-1 to -3 and reference strain M18.2b. Values are given in relation to the average biomass concentration in the supernatant of the host strain M18.2b which is set to 1.

    [0105] FIG. 7: Viscosity of culture broths of pSEQ1M1-HygR transformants M1SEQ1-1 to -3 and reference strain M18.2b. Values are given in relation to the viscosity of the culture broth of the host strain M18.2b which is set to 1.

    [0106] FIG. 8: SDS-PAGE gel of culture supernatants of pSEQ1M1-HygR transformant M1SEQ1-1 to -3 and reference strain M18.2b. Reference bands (“Marker” lane) correspond to 250, 150, 100, 75, 50, 37, 25 and 20 kD

    [0107] FIG. 9: Protein concentrations in the culture supernatants of pSEQ1 M2-HygR transformant M2SEQ1-1 and reference strain M18.2b. Values are given in relation to the average protein concentration in the supernatants of the host strain M18.2b which is set to 1.

    [0108] FIG. 10: Biomass concentrations in the culture supernatants of pSEQ1 M2-HygR transformant M2SEQ1-1 and reference strain M18.2b. Values are given in relation to the average biomass concentration in the supernatant of the host strain M18.2b which is set to 1.

    [0109] FIG. 11: Viscosity of culture broths of pSEQ1M2-HygR transformant M2SEQ1-1 and reference strain M18.2b. Values are given in relation to the viscosity of the culture broth of the host strain M18.2b which is set to 1.

    [0110] FIG. 12: SDS-PAGE gel of culture supernatants of pSEQ1 M2-HygR transformant M2SEQ1-1 and reference strain M18.2b. Reference bands (“Marker” lane) correspond to 250, 150, 100, 75, 50, 37, 25 and 20 kD

    GENERAL

    [0111] The examples describe three different ways to inactivate the Trichoderma reesei SEQ1 gene—the deletion of a large part of the coding sequence, a mutation that changes an early codon to a stop codon and an insertion resulting in a frame shift—and show the effect of the SEQ1 gene inactivation on the protein production, biomass formation and culture broth viscosity of T. reesei.

    Example 1: Deletion of SEQ1

    [0112] Construction of a SEQ1 Deletion Vector

    [0113] Standard methods known to those skilled in the art and described e.g. by Sambrook and Russel (Molecular Cloning—A laboratory manual; Cold Spring Harbor Laboratory Press, New York) or by Jansohn et al. (Gentechnische Methoden, Elsevier, München) were used for DNA agarose gel electrophorese, purification of DNA, transformation of Escherichia co/i, plasmid propagation and purification, amplification of pieces of DNA by polymerase chain reaction (PCR) and isolation of genomic DNA from Trichoderma reesei. Ligation-independent cloning (LIC) was done essentially as described by Aslanidis and de Jong (1990, Nucleic Acid Res. 18 (20), 6069).

    [0114] The SEQ1 5′ flanking region was amplified by PCR using genomic DNA from Trichoderma reesei M18.2b (DSM 19984) as template, primers SEQ1 D5fw (5′-GACTCTCTATCTGCATCAAC-3′) and SEQ1 D5rv (5′-TGACCTGGAAAGCTTTCAATGTAGAGGTAGACTAGTCAAAGAAGACATCACGAC-3′) and phusion polymerase from Thermo Fisher Scientific according to the manufacturer's instructions (annealing temperature: 64.8° C., elongation time: 1 min 25 sec, 30 cycles). The amplicon (2.7 kb) was purified using the Wizard PCR purification kit from Promega.

    [0115] The SEQ1 3′ flanking region was amplified by PCR using genomic DNA from Trichoderma reesei M18.2b (DSM 19984) as template, primers SEQ1 D3fw (5′-CGCATGGTGGGCGTCGTGATGTCTTCTTTGACTAGTCTACCTCTACATTGAAAG C-3′) and SEQ1 D3rv (5′-GATTACCTGTCAAGTCTATG-3′) and phusion polymerase from Thermo Fisher Scientific according to the manufacturer's instructions (annealing temperature: 62.4° C., elongation time: 1 min 25 sec, 30 cycles). The amplicon (2.7 kb) was purified using the Wizard PCR purification kit from Promega.

    [0116] The SEQ1 5′ and 3′ flanking regions were fused by PCR using Phusion polymerase (Thermo Fisher Scientific) and the buffer and dNTP solution provided with the polymerase. 100 ng purified SEQ1 5′ PCR amplicon, 100 ng purified SEQ1 3′ amplicon, 10 μl 5× Phusion HF buffer, 1 μl 10 mM dNTP solution, 1 U Phusion polymerase and PCR grade water up to a final volume of 48 μl were mixed. The mixture was first incubated at 98° C. for 30° C. and then subjected to 10 cycles of 10 sec at 98° C., 30 sec at 65° C. and 2 min 40 sec at 72° C. and then cooled to 10° C. Then 1 μl of a 20 μM solution of primer SEQ1 Dnestfw (5′-GACAGTCCTGCAGGAGTCACTGCCTTTGAAAG-3′) and 1 μl of a 20 μM solution of primer SEQ1 Dnestrv (5′-GACAGTCCTGCAGGTGTAAGGATAAAGGACGAC-3′) were added and the mixture was incubated at 98° C. for 30 sec and then subjected to 30 cycles of 10 sec at 98° C., 30 sec at 66.2° C. and 1 min 20 sec at 72° C. The incubation time at 72° C. was increased by 5 sec per cycle. Finally, the mixture was incubated at 72° C. for 10 min and then cooled to 10° C. The amplicon (5.2 kb) was purified using the Wizard PCR purification kit from Promega.

    [0117] The purified SEQ1 5′-3′ flank fusion product was digested with SbfI (New England Biolabs) according to the manufacturer's instructions and purified using the Wizard PCR purification kit from Promega.

    [0118] Plasmid pUC19 (New England Biolabs) was digested with SbfI (New England Biolabs) according to the manufacturer's instructions and purified using the Wizard PCR purification kit from Promega.

    [0119] The SbfI-digested SEQ1 5′-3′ flank fusion product and pUC19 were ligated using the “Mighty Mix” DNA ligation kit (Takara) according to the manufacturer's instructions using a molar insert/vector ratio of 5 to 1. The ligation mixture was transformed into Escherichia coli Mach 1 (Thermo Fisher Scientific) and plated on LB agar plates containing 100 mg.Math.l.sup.−1 ampicillin. After 20 h of incubation at 37° C. colonies were picked from the plate and used to inoculate 3 ml of LB liquid medium with 100 mg.Math.l.sup.−1 ampicillin. After 20 h of incubation at 37° C. plasmid DNA was isolated and digested with SbfI to identify clones containing the insert. A plasmid containing the insert was designated pSEQ1-5′-3′.

    [0120] Plasmid pSEQ1-5′-3′ was digested with SpeI (New England Biolabs) according to the manufacturer's instructions and purified using the Wizard PCR purification kit from Promega. 1 μl each of 10 μM solutions of oligonucleotides LIC1fw (5′-CTAGGAGTTCTGCCTTGGGTTTAAACGAGAGAAAGACTC-3′) and LIC1 rv (5′-CTAGGAGTCTTTCTCTCGTTTAAACCCAAGGCAGAACTC-3′) were mixed, put in a PCR cycler and cooled from 70 to 20° C. over the course of 2 h. Then the oligonucleotide mixture was mixed with 750 ng of purified, SpeI-digested pSEQ1-5′-3′, 1 μl 10×T4 Ligase buffer (Promega), 1 μl 500 g/I PEG3350, 1 μl T4 DNA Ligase (5 U/μl; Thermo Fisher Scientific) and 2 μl of PCR-grade water. The mixture was incubated for 1 h at 20° C., purified using the Wizard PCR purification kit from Promega and the DNA eluted in 50 μl of PCR-grade water. This solution was supplemented with 6 μl of Taq Polymerase buffer (Promega) and PCR-grade water was added to a final volume of 60 μl. The mixture was then transformed into Escherichia coli Mach 1 (Thermo Fisher Scientific) and plated on LB agar plates containing 100 mg.Math.l.sup.−1 ampicillin. After 20 h of incubation at 37° C. colonies were picked from the plate and used to inoculate 3 ml of LB liquid medium with 100 mg.Math.l.sup.−1 ampicillin. After 20 h of incubation at 37° C. plasmid DNA was isolated and digested with PmeI and SspI (New England Biolabs) according to the manufacturer's instructions to identify clones containing the insert. A plasmid containing the insert was designated pSEQ1-5′-3′-LIC.

    [0121] Plasmid pSEQ1-5′-3′-LIC was digested with PmeI (New England Biolabs) according to the manufacturer's instructions and purified using the Wizard PCR purification kit from Promega.

    [0122] The hygromycin B resistance cassette (HygR) (SEQ ID NO: 4) was synthesized by Thermo Scientific. HygR was amplified by PCR using the DNA from Thermo Scientific as template, primers SEQ1 MHygRfw (5′-GTTCTGCCTTGGGTTTAACAAGACACAGCCCTATAAC-3′) and SEQ1MHygRrv (5′-GTCTTTCTCTCGTTTAACAGACAAGAGCCCTATAAC-3′) and phusion polymerase from Thermo Fisher Scientific according to the manufacturer's instructions (annealing temperature: 68.5° C., elongation time: 40 sec, 30 cycles). The amplicon (2.4 kb) was purified using the Wizard PCR purification kit from Promega.

    [0123] The PCR-amplified HygR was fused with PmeI-digested pSEQ1-5′-3′-LIC using ligation independent cloning (LIC). The linearized vector was treated with T4 DNA polymerase in the presence of dATP. PCR-amplified HygR was treated with T4 DNA polymerase in the presence of dTTP. T4 DNA polymerase treated vector and HygR were mixed and annealed as described by Aslanidis and de Jong (1990, Nucleic Acid Res. 18 (20), 6069). The assays were then transformed in chemically competent Escherichia coli Mach 1 (Thermo Fisher Scientific), plated on LB-Agar plates containing 100 mg.Math.l.sup.−1 ampicillin and incubated at 37° C. for 24 h. Colonies were picked from the agar plates using toothpicks, transferred into liquid LB medium containing 100 mg.Math.l.sup.−1 ampicillin and incubated at 37° C. for 24 h with shaking (250 RPM). Plasmid DNA was isolated and integration of the insert was verified by digestion with SbfI. Plasmid clones were verified by Sanger sequencing and one plasmid with correct sequence was designated pSEQ1 D.

    [0124] Transformation of the SEQ1 Deletion Vector into Trichoderma reesei

    [0125] Vector pSEQ1 D was digested with SbfI (New England Biolabs) according to the manufacturer's instructions and the deletion cassette (7.8 kb) was purified by agarose gel electrophoresis and with the Wizard PCR purification kit from Promega. Trichoderma reesei M18.2b (DSM 19984) was transformed with the digested vector essentially as described in Penttilä et al (1987) Gene 61: 155-164 or Gruber et al (1990) Curr Genet 18: 71-76. The transformants were selected on potato dextrose agar plates containing 100 mg.Math.l.sup.−1 of hygromycin and 1 M sorbitol and purified by singularisation. Conidia stocks of the purified strains were prepared by growing them on potato dextrose agar plates at 30° C. until the plates were covered with spores. The conidia were harvested with sterile sodium chloride (0.9 g.Math.l.sup.−1)-Triton X-100 (0.01 g.Math.l.sup.−1) solution, adjusted to OD.sub.600=10, supplemented with 50 g.Math.l.sup.−1 of glycerol and stored at −80° C.

    [0126] Genomic DNA was isolated from the mycelium of the transformants and the host strain. The integration of the SEQ1 deletion cassette at the intended locus was verified by PCR using phusion polymerase from Thermo Fisher Scientific according to the manufacturer's instructions, genomic DNA from the transformants as template and primers SEQ1 DKO1fw (5′-ACTCTCTATCTGCATCAAC-3′) and SEQ1 DKO1 rv (5′-GTAGTGTATTGACCGATTC-3′) (annealing temperature: 62.6° C., elongation time: 1 min 20 sec, 30 cycles) and primers SEQ1 DKO2fw (5′-TGATGTGCTTGATATTGGGC-3′) and SEQ1 DKO2rv (5′-CTCCATCGCTCAACTATGTG-3′) (annealing temperature: 57.5° C., elongation time: 1 min 15 sec, 30 cycles). A 3.9 kb band with primers SEQ1 DKO1fw and SEQ1 DKO1 rv indicates the integration of the deletion cassette at the SEQ1 locus, while SEQ1 DKO2fw and SEQ1 DKO2rv (1.2 kb amplicon) amplify a part of the SEQ1 gene replaced by pSEQ1 D and therefore only give a band when the SEQ1 gene is still present. Genomic DNA from strain M18.2b was also tested as a control.

    [0127] Three strains that had integrated the deletion cassette from pSEQ1 D at the SEQ1 locus were named DSEQ1-1 to -3.

    [0128] Growth of the SEQ1 Deletion Strains in Shake Flasks

    [0129] The strains DSEQ1-1 to -3 and M18.2b were grown in shake flasks in Hydrolysate Medium 1. Hydrolysate Medium 1 contains (g.Math.l.sup.−1):

    TABLE-US-00001 Concentration Name [g/L] Acetic acid 0.34 Calcium 0.12 Chloride, water soluble 0.15 Copper 0.0001 Fat (HCl soluble) 0.001 Furfural 0.003 Glucose 6.5 Glycerol 0.009 HMF 0.006 Iron 0.004 Magnesium 0.048 Manganese 0.002 Na-D/L-Lactat 0.097 Nitrogen, soluble 0.85 Phosphorus 0.48 Phthalate 8.2 Potassium 3.2 Sodium 0.015 Sulfur 0.86 Xylose 3.6 Zinc 0.001

    [0130] The medium was adjusted to pH 5.5 with HCl or NaOH and sterilized by autoclaving (20 min at 121° C.).

    [0131] 15 ml of the medium were distributed into 50 ml Erlenmeyer shake flasks under a sterile hood. Conidia stocks of strains DSEQ1-1 to -3 and M18.2b were thawed, 75 μl of the conidia suspensions were pipetted into the Erlenmeyer flasks with the medium under a sterile hood and the flasks were closed with rubber foam caps. Three flasks were inoculated per strain. The flasks were incubated at 30° C. with shaking (250 RPM) for 6 days. After 6 days, the cultures were poured into 15 ml tubes. Aliquots were removed, centrifuged (3220×g, 4° C., 15 min) and the supernatants stored at 4° C., while the remaining culture broth was used for determination of the biomass and viscosity (see below).

    [0132] Characterization of the Culture Supernatants and Broths: Protein Concentration, SDS-PAGE, Biomass, Viscosity

    [0133] Protein concentrations in the centrifuged culture supernatants of strains DSEQ1-1 to -3 and M18.2b were measured using the Quick Start™ Bradford reagent (BioRad) and BSA standard solutions (BioRad) according to the supplier's instructions. The results of the measurements are shown in FIG. 1. It is obvious from these data that strains DSEQ1-1 to -3 produce significantly more protein than the host strain M18.2b.

    [0134] For biomass determination, Whatman™ filter discs (P1) were dried at 60° C. until their weight remained constant for 24 h. Culture broths of strains DSEQ1-1 to -3 and M18.2b were filtered using those dried filter discs and the mycelia were washed with at least ten times the broth's volume of deionized water. Then the filter discs with the mycelium were dried at 60° C. until their weight remained constant for 24 h. The filter discs with the dried mycelia were weighed. The biomass concentration in the culture broth was then calculated by subtracting the mass of the dried filter disc from the mass of the dried filter disc with the mycelia and then dividing that value by the volume of the culture broth that had been filtered. The results of the measurements are shown in FIG. 2. It is obvious from these data that strains DSEQ1-1 to -3 produce significantly less biomass than the host strain M18.2b.

    [0135] The viscosity of the culture broths of strains DSEQ1-1 to -3 and M18.2b was measured using a Malvern Kinexus Lab+ KNX2110 rotational rheometer with the Vane tool (4Vnn:CUPnn) according to the manufacturer's instructions. The measurements were taken at a temperature of 20° C. and at a rotation velocity of 18.11 RPM (“rotations per minute”). The viscosity is depicted in FIG. 3 and is presented in relation to the viscosity of the culture broth of strain M18.2b, which is set to 1. It is obvious from these data that the viscosity of the culture broths produced with DSEQ1-1 to -3 is significantly lower than that of the host strain M18.2b.

    [0136] SDS-PAGE analysis of the centrifuged culture supernatants of strains DSEQ1-1 to -3 and M18.2b was done using methods known to those skilled in the art (e.g. described by Jansohn et al. (Gentechnische Methoden, Elsevier, München)) and the Criterion XT system (BioRad). Equal volumes of culture supernatants were loaded in each lane. Precision Plus Protein™ All Blue Standards (BioRad) was used as protein size reference. The gel image is shown in FIG. 4. A person skilled in the art will recognize that the protein pattern of the SEQ1 deletion strains DSEQ1-1 to -3 is indistinguishable from that of the host strain M18.2b.

    [0137] Summary

    [0138] Taken together these data demonstrate that the deletion of the SEQ1 gene results in a significantly more efficient protein production, with more protein and less biomass being formed. The analysis of the secreted proteins by SDS-PAGE shows that their composition doesn't change significantly, indicating a general increase in protein production. In addition, the viscosity of the culture broth is significantly reduced as well.

    Example 2: Mutation of the SEQ1 Gene (Early Stop Codon)

    [0139] Construction of a SEQ1 Mutation Vector

    [0140] SEQ ID NO: 2, containing the flanking regions that introduce the mutation G174T (position according to SEQ ID NO: 1) into the SEQ1 gene, and a LIC site for insertion of the marker gene was synthesized by Thermo Fisher Scientific and cloned into a pUC19-derived plasmid. The resulting plasmid was named pSEQ1M1

    [0141] Plasmid pSEQ1 M1 was digested with SrfI (New England Biolabs) according to the manufacturer's instructions and purified using the Wizard PCR purification kit from Promega.

    [0142] The hygromycin B resistance cassette (HygR) (SEQ ID NO: 4) was synthesized by Thermo Scientific. HygR was amplified by PCR using the DNA from Thermo Scientific as template, primers SEQ1 MHygRfw (5′-AACAAGACACAGCCCTATAAC-3′) and SEQ1 MHygRrv (5′-AACAGACAAGAGCCCTATAAC-3′) and phusion polymerase from Thermo Fisher Scientific according to the manufacturer's instructions (annealing temperature: 68.5° C., elongation time: 40 sec, 30 cycles). The amplicon (2.4 kb) was purified using the Wizard PCR purification kit from Promega.

    [0143] The PCR-amplified HygR marker was fused with linearized pSEQ1 M1 using ligation independent cloning (LIC). The linearized vector was treated with T4 DNA polymerase in the presence of dTTP. The amplified promotors were treated with T4 DNA polymerase in the presence of dATP. T4 DNA polymerase treated vector and promotors were mixed and annealed as described in Ref. The assays were then transformed in chemically competent Escherichia coli XL1-Blue cells (Agilent), plated on LB-Agar plates containing 100 mg.Math.l.sup.−1 ampicillin (LB-Amp) and incubated at 37° C. for 24 h. Colonies were picked from the agar plates using toothpicks, transferred into liquid LB-Amp medium and incubated at 37° C. for 24 h with shaking (250 RPM). Plasmid DNA was isolated and integration of the insert was verified by digestion with XmnI. Plasmid clones were verified by Sanger sequencing and one plasmid with correct sequence was designated pSEQ1M1-HygR.

    [0144] Transformation of the SEQ1 Mutation Vector into Trichoderma reesei

    [0145] Vector pSEQ1 M1-HygR was digested with XmnI (New England Biolabs) according to the manufacturer's instructions and the mutation cassette (6.0 kb) was purified by agarose gel electrophoresis and with the Wizard PCR purification kit from Promega. Trichoderma reesei M18.2b (DSM 19984) was transformed with the digested vector essentially as described in Penttilä et al. (1987) Gene 61: 155-164 or Gruber et al (1990) Curr Genet 18: 71-76. The transformants were selected on potato dextrose agar plates containing 100 mg.Math.l.sup.−1 of hygromycin and 1 M sorbitol and purified by singularisation. Conidia stocks of the purified strains were prepared by growing them on potato dextrose agar plates at 30° C. until the plates were covered with spores. The conidia were harvested with sterile sodium chloride (0.9 g.Math.l.sup.−1)-Triton X-100 (0.01 g.Math.l.sup.−1) solution, adjusted to OD.sub.600=10, supplemented with 50 g.Math.l.sup.−1 of glycerol and stored at −80° C.

    [0146] Genomic DNA was isolated from the mycelium of the transformants and the host strain. The integration of the SEQ1 mutation cassette at the intended locus was verified by PCR using phusion polymerase from Thermo Fisher Scientific according to the manufacturer's instructions, genomic DNA from the transformants as template and primers SEQ1 M1 KOfw (5′-GATGGCTGTGTAGAAGTAC-3′) and SEQ1M1KOrv (5′-ATGAATAGGAGTGTGTGTG-3′) (annealing temperature: 62.0° C., elongation time: 1 min 25 sec, 30 cycles). A 2.5 kb band with primers SEQ1M1 KOfw and SEQ1M1 KOrv indicates the integration of the mutation cassette at the SEQ1 locus. Genomic DNA from strain M18.2b was also tested as a control. In order to verify that the intended mutation had been inserted into the SEQ1 ORF, the respective region was amplified by PCR using phusion polymerase from Thermo Fisher Scientific according to the manufacturer's instructions, genomic DNA from the transformants as template and primers SEQ1 M1 Seqfw (5′-ATACTCGTCAACTCCATC-3′) and SEQ1 M1 Seqrv (5′-ATCGCTCAACTATGTGAC-3′) (annealing temperature: 56.3° C., elongation time: 50 sec, 30 cycles). The 1.5 kb amplicon was purified using the Wizard PCR purification kit from Promega and sequenced using Primer M1 Seq-01 (5′-AGCAAGTCAAAGTCATGAGG-3′).

    [0147] Three strains containing the mutation from pSEQ1M1-HygR in the SEQ1 ORF were named M1SEQ1-1 to -3.

    [0148] Growth of the SEQ1 Mutation Strains in Shake Flasks

    [0149] The strains M1SEQ1-1 to -3 and M18.2b were grown in shake flasks in Hydrolysate Medium 1 as defined before for example 1. The medium was adjusted to pH 5.5 with HCl or NaOH and sterilized by autoclaving (20 min at 121° C.).

    [0150] 15 ml of the medium were distributed into 50 ml Erlenmeyer shake flasks under a sterile hood. Conidia stocks of strains M1SEQ1-1 to -3 and M18.2b were thawed, 75 μl of the conidia suspensions were pipetted into the Erlenmeyer flasks with the medium under a sterile hood and the flasks were closed with rubber foam caps.

    [0151] Three flasks were inoculated per strain. The flasks were incubated at 30° C. with shaking (250 RPM) for 6 days. After 6 days, the cultures were poured into 15 ml tubes. Aliquots were removed, centrifuged (3220×g, 4° C., 15 min) and the supernatants stored at 4° C., while the remaining culture broth was used for determination of the biomass and viscosity (see below).

    [0152] Characterization of the Culture Supernatants and Broths: Protein Concentration, SDS-PAGE, Biomass, Viscosity

    [0153] Protein concentrations in the centrifuged culture supernatants of strains M1SEQ1-1 to -3 and M18.2b were measured using the Quick Start™ Bradford reagent (BioRad) and BSA standard solutions (BioRad) according to the supplier's instructions. The results of the measurements are shown in FIG. 5. It is obvious from these data that strains M1SEQ1-1 to -3 produce significantly more protein than the host strain M18.2b.

    [0154] For biomass determination, Whatman™ filter discs (P1) were dried at 60° C. until their weight remained constant for 24 h. Culture broths of strains M1 SEQ1-1 to -3 and M18.2b were filtered using those dried filter discs and the mycelia were washed with at least ten times the broth's volume of deionized water. Then the filter discs with the mycelium were dried at 60° C. until their weight remained constant for 24 h. The filter discs with the dried mycelia were weighted. The biomass concentration in the culture broth was then calculated by subtracting the mass of the dried filter disc from the mass of the dried filter disc with the mycelia and then dividing that value by the volume of the culture broth that had been filtered. The results of the measurements are shown in FIG. 6. It is obvious from these data that strains M1 SEQ1-1 to -3 produce significantly less biomass than the host strain M18.2b.

    [0155] The viscosity of the culture broths of strains M1 SEQ1-1 to -3 and M18.2b was measured using a Malvern Kinexus Lab+ KNX2110 rotational rheometer with the Vane tool (4Vnn:CUPnn) according to the manufacturer's instructions. The measurements were taken at a temperature of 20° C. and at a rotation velocity of 18.11 RPM (“rotations per minute”). The viscosity is depicted in FIG. 7 and is presented in relation to the viscosity of the culture broth of strain M18.2b, which is set to 1. It is obvious from these data that the viscosity of the culture broths produced with M1SEQ1-1 to -3 is significantly lower than that of the host strain M18.2b.

    [0156] SDS-PAGE analysis of the centrifuged culture supernatants of strains M1SEQ1-1 to -3 and M18.2b was done using methods known to those skilled in the art (e.g. described by Jansohn et al. (Gentechnische Methoden, Elsevier, München)) and the Criterion XT system (BioRad). Equal volumes of culture supernatants were loaded in each lane. Precision Plus Protein™ All Blue Standards (BioRad) was used as protein size reference. The gel image is shown in FIG. 8. A person skilled in the art will recognize that the protein pattern of the SEQ1 mutation strains M1SEQ1-1 to -3 is indistinguishable from that of the host strain M18.2b.

    [0157] Summary

    [0158] Taken together these data demonstrate that the mutation of the SEQ1 gene by creation of an early stop codon results in a significantly more efficient protein production, with more protein and less biomass being formed. The analysis of the secreted proteins by SDS-PAGE shows that their composition doesn't change significantly, indicating a general increase in protein production. In addition, the viscosity of the culture broth is significantly reduced as well.

    Example 3: Mutation of the SEQ1 Gene (Frame Shift)

    [0159] Construction of a SEQ1 Mutation Vector

    [0160] SEQ ID NO: 3, containing the flanking regions that introduce a G after T874 (position according to SEQ ID NO: 1) into the SEQ1 gene, and a LIC site for insertion of the marker gene was synthesized by Thermo Fisher Scientific and cloned into a pUC19-derived plasmid. The resulting plasmid was named pSEQ1M2

    [0161] Plasmid pSEQ1 M2 was digested with SrfI (New England Biolabs) according to the manufacturer's instructions and purified using the Wizard PCR purification kit from Promega.

    [0162] The hygromycin B resistance cassette (HygR) (SEQ ID NO: 4) was synthesized by Thermo Scientific. HygR was amplified by PCR using the DNA from Thermo Scientific as template, primers SEQ1 MHygRfw (5′-AACAAGACACAGCCCTATAAC-3′) and SEQ1 MHygRrv (5′-AACAGACAAGAGCCCTATAAC-3′) and phusion polymerase from Thermo Fisher Scientific according to the manufacturer's instructions (annealing temperature: 68.5° C., elongation time: 40 sec, 30 cycles). The amplicon (2.4 kb) was purified using the Wizard PCR purification kit from Promega.

    [0163] The PCR-amplified HygR marker was fused with linearized pSEQ1 M1 using ligation independent cloning (LIC). The linearized vector was treated with T4 DNA polymerase in the presence of dTTP. The amplified promotors were treated with T4 DNA polymerase in the presence of dATP. T4 DNA polymerase treated vector and promotors were mixed and annealed as described in Ref. The assays were then transformed in chemically competent Escherichia coli XL1-Blue cells (Agilent), plated on LB-Agar plates containing 100 mg.Math.l.sup.−1 ampicillin (LB-Amp) and incubated at 37° C. for 24 h. Colonies were picked from the agar plates using toothpicks, transferred into liquid LB-Amp medium and incubated at 37° C. for 24 h with shaking (250 RPM). Plasmid DNA was isolated and integration of the insert was verified by digestion with XmnI. Plasmid clones were verified by Sanger sequencing and one plasmid with correct sequence was designated pSEQ1 M2-HygR.

    [0164] Transformation of the SEQ1 Mutation Vector into Trichoderma reesei

    [0165] Vector pSEQ1 M2-HygR was digested with XmnI (New England Biolabs) according to the manufacturer's instructions and the mutation cassette (6.4 kb) was purified by agarose gel electrophoresis and with the Wizard PCR purification kit from Promega. Trichoderma reesei M18.2b (DSM 19984) was transformed with the digested vector essentially as described in Penttilä et al (1987) Gene 61: 155-164 or Gruber et al (1990) Curr Genet 18: 71-76. The transformants were selected on potato dextrose agar plates containing 100 mg.Math.l.sup.−1 of hygromycin and 1 M sorbitol and purified by singularisation. Conidia stocks of the purified strains were prepared by growing them on potato dextrose agar plates at 30° C. until the plates were covered with spores. The conidia were harvested with sterile sodium chloride (0.9 g.Math.l.sup.−1)-Triton X-100 (0.01 g.Math.l.sup.−1) solution, adjusted to OD.sub.600=10, supplemented with 50 g.Math.l.sup.−1 of glycerol and stored at −80° C.

    [0166] Genomic DNA was isolated from the mycelium of the transformants and the host strain. The integration of the SEQ1 mutation cassette at the intended locus was verified by PCR using phusion polymerase from Thermo Fisher Scientific according to the manufacturer's instructions, genomic DNA from the transformants as template and primers SEQ1 M2KOfw (5′-GATGGCTGTGTAGAAGTAC-3′) and SEQ1M2KOrv (5′-ATGAATAGGAGTGTGTGTG-3′) (annealing temperature: 62.2° C., elongation time: 1 min 25 sec, 30 cycles). A 2.5 kb band with primers SEQ1 M2KOfw and SEQ1M2KOrv indicates the integration of the mutation cassette at the SEQ1 locus.

    [0167] Genomic DNA from strain M18.2b was also tested as a control. In order to verify that the intended mutation had been inserted into the SEQ1 ORF, the respective region was amplified by PCR using phusion polymerase from Thermo Fisher Scientific according to the manufacturer's instructions, genomic DNA from the transformants as template and primers SEQ1 M2Seqfw (5′-GACAGAAGCTCAAAGATTAG-3′) and SEQ1 M2Seqrv (5′-CAAGTCAAAGTCATGAGG-3′) (annealing temperature: 63.6° C., elongation time: 50 sec, 30 cycles). The 1.5 kb amplicon was purified using the Wizard PCR purification kit from Promega and sequenced using Primer M2Seq-01 (5′-CACTCTGTAAAGGCAAAGGG-3′).

    [0168] A strain containing the mutation from pSEQ1M2-HygR in the SEQ1 ORF was named M2SEQ1-1.

    [0169] Growth of the SEQ1 Mutation Strain in Shake Flasks

    [0170] The strains M2SEQ1-1 and M18.2b were grown in shake flasks in Hydrolysate Medium 1 as defined before for example 1. The medium was adjusted to pH 5.5 with HCl or NaOH and sterilized by autoclaving (20 min at 121° C.).

    [0171] 15 ml of the medium were distributed into 50 ml Erlenmeyer shake flasks under a sterile hood. Conidia stocks of strains M2SEQ1-1 and M18.2b were thawed, 75 μl of the conidia suspensions were pipetted into the Erlenmeyer flasks with the medium under a sterile hood and the flasks were closed with rubber foam caps. Three flasks were inoculated per strain. The flasks were incubated at 30° C. with shaking (250 RPM) for 6 days. After 6 days, the cultures were poured into 15 ml tubes. Aliquots were removed, centrifuged (3220×g, 4° C., 15 min) and the supernatants stored at 4° C., while the remaining culture broth was used for determination of the biomass and viscosity (see below).

    [0172] Characterization of the Culture Supernatants and Broths: Protein Concentration, SDS-PAGE, Biomass, Viscosity

    [0173] Protein concentrations in the centrifuged culture supernatants of strains M2SEQ1-1 and M18.2b were measured using the Quick Start™ Bradford reagent (BioRad) and BSA standard solutions (BioRad) according to the supplier's instructions. The results of the measurements are shown in FIG. 9. It is obvious from these data that strain M2SEQ1-1 produce significantly more protein than the host strain M18.2b.

    [0174] For biomass determination, Whatman™ filter discs (P1) were dried at 60° C. until their weight remained constant for 24 h. Culture broths of strains M2SEQ1-1 and M18.2b were filtered using those dried filter discs and the mycelia were washed with at least ten times the broth's volume of deionized water. Then the filter discs with the mycelium were dried at 60° C. until their weight remained constant for 24 h. The filter discs with the dried mycelia were weighed. The biomass concentration in the culture broth was then calculated by subtracting the mass of the dried filter disc from the mass of the dried filter disc with the mycelia and then dividing that value by the volume of the culture broth that had been filtered. The results of the measurements are shown in FIG. 10. It is obvious from these data that strain M2SEQ1-1 produce significantly less biomass than the host strain M18.2b.

    [0175] The viscosity of the culture broths of strains M2SEQ1-1 and M18.2b was measured using a Malvern Kinexus Lab+ KNX2110 rotational rheometer with the Vane tool (4Vnn:CUPnn) according to the manufacturer's instructions. The measurements were taken at a temperature of 20° C. and at a rotation velocity of 18.11 RPM (“rotations per minute”). The viscosity is depicted in FIG. 11 and is presented in relation to the viscosity of the culture broth of strain M18.2b, which is set to 1. It is obvious from these data that the viscosity of the culture broths produced with M2SEQ1-1 is significantly lower than that of the host strain M18.2b.

    [0176] SDS-PAGE analysis of the centrifuged culture supernatants of strains M2SEQ1-1 and M18.2b was done using methods known to those skilled in the art (e.g. described by Jansohn et al. (Gentechnische Methoden, Elsevier, München)) and the Criterion XT system (BioRad). Equal volumes of culture supernatants were loaded in each lane. Precision Plus Protein™ All Blue Standards (BioRad) was used as protein size reference. The gel image is shown in FIG. 12. A person skilled in the art will recognize that the protein pattern of the SEQ1 mutation strain M2SEQ1-1 is indistinguishable from that of the host strain M18.2b.

    [0177] Summary

    [0178] Taken together these data demonstrate that the mutation of the SEQ1 gene by creation of a frame shift results in a significantly more efficient protein production, with more protein and less biomass being formed. The analysis of the secreted proteins by SDS-PAGE shows that their composition doesn't change significantly, indicating a general increase in protein production. In addition, the viscosity of the culture broth is significantly reduced as well.

    TABLE-US-00002 Sequence listing SEQ1 native gene SEQ ID NO: 1 ATGAGGGCCTATCAGATCGAGATGCTCGACAAGAGCCTCAAGCAAAATGTCATT GTTGCTGTATGTTGAAGTTTCTCTCCAATCCCCCGTCTCCCCCTTTGCTGTCGTT GTCTTCGACGTTGAAAGACATGTCCATTGACCAAGGGGCGTTGTTATAAATCTA GATGGACACGGGAAGTGGCAAGACTCAAGTGTAAGTTGTGCATCTTCATCATCG GCAGCCCACGTAACCTGTGCCAGCCCTTAGCACCCTTCTTCGCAAAAGACTGAC TTGGCGCTTGCATCAGAGCTGTGCTTCGTATCAAGAAGGAGCTGGAAATCTGCG ATGCATCAAAGGTGAGTCTGCCGTCTGGATACAGTTGCACAACGACCTGGACAG CTGCACTGACGCAGCACGCATCAGATCATCTGGTTCATCGCGCCAACAGTTTCG CTGTGTCATCAGCAACACGATGTGCTCAAGTTGCAGATACCTGCCGTGCCCATG ATGACACTGGCCGGGAACTCCAATATCGATGCTTGGGGGCCGGATATCTGGGC CATTCTTCTCGACACGGTTCGAATTGTCATATCCACACCCCAGGTTCTGCTCGAT GCCCTTGACCATGCTTACCTGAACTTGGGTCTTCTGGCGCTGCTTGTATTTGAT GAAGGTATGGGACGACCTGCCTTCACTCTGTAAAGGCAAAGGGGCCGCCAGAA GTTGCAAATCGCTGACGTGTCTTGTGCAAAAGTCCACAACTGCATTGGCAGAAG TCCAGGCGGCAAAATCATGCTCCACCACTACCATCCGCGCAAGCTGGCTGGTG AAAGCGTGCCTGCTGTTCTGGGTCTGACGGCAACTCCGAGCATTCAGTCTGAG CTTGCCGATATTGATGCCTTGGAATGGCTGATGGATGCAAGATGCGTCTCGCCC ACTCTCCATCGCGACGAACTGCTCAAATGCGTCAAGAGGCCCAATATCAAGCAC ATCATCTATAAAGCCGGCAAAGAAGACATCACGACGCCCACCATGCGCGACTTG GATCGGGTCTACCGGGCGCTGGACATTCTCGAAGACCCCTACATACTCATGCT GCGCAACAACCCTACGGACCGAAACAACCGCCTGCTGCTAACAGCCATTGAAA AGTACGATACCTACACACAGAACCAGATGAAGTCGTTCTGCGCCCGATCAAGAG AGATATGCAAGCAACTCGGTCCCTGGGCTGCTGACCTCTTCATCTGGAAGGCCA TCTCAGCTCACTTGGACAAGGTGGACAGGCAGACGGATGGAGTTGACGAGTAT GGCAACAAGTGGTCGTCGGGGTCGACAAGCTTCCTGGAAAAGAAGCACCTGGC CGACATCTATCGTCGAGTCAAGGTCCAACGTCCTTCCGATGTGCCACAGGTCTT TGAAGACATTTCCGACAAGGTCGGTAAGCTAATCTTTGAGCTTCTGTCGGTAGA GGAGCCCACGGTGGGCATCATCTTCGTCGAGGAACGAGTCATGGTTGCTATGC TGGCCGAGGTTCTCTCTGTCAACCACACAATCACGTCCCGGTACCGGATCGGG ACCATGGTTGGCACCTCAAATTACGCTGGGCGGCGGAAGGCCGTTTATGACTT CGACCAGAAAACGGACTACAAGGACCTGCAGAGCTTCCGCTCCGGCAAGATTA ACCTGCTGATTGCGACGTCAGTGCTGGAGGAGGGCATCGACGTGCCTGCCTGC AACCTAGTCATATGCTTTGACACTCCGACGACCCCAAAGTCCTTTATCCAGCGG CGCGGACGGGCTCGCTCCAAGGACTCGAATCTCCTTCTTTTCTTTGACGATGCC AACCCTGCGATCTTGAAGTGGCAGGCGAAAGAGGAGGAGATGAACAGGATCTT CGAAGACGAAGAGAGGGCGATTCGCGAACTCGGCAAACTGGAAGATTCGGAGA GTCCGAGCACCATCTCCTTCACCGTCCCGTCTACCGGCGCAAGGCTAGATTTTG ACAATGCGAAGCAGCACCTCGAGCACTTCTGCAGAGTCTTGTGCCCGTCGGAC TTTGTGGACAGCCGCCCGGACTACATCATCCGCAGGGAGCAGGACTCTCCTTT GTTGACTGCCATTGTACTGCTCCCTCCGTTTCTGCCGGTGAATCTGAGGCAGCA CACCAGTGCTTCTCCTTGGCGCTCCGAGAAGAACGCCACCAAGGATGCTGCGT ATCAGGCGTATATAGCCCTGTATGACGCGAAGCTCGTCAACGAGAACCTGCTGC CCTTCAAGTCCAGCGACATGCTCGGAATCGATAAGCGAGTATCCGAGGTGCCG GTCGAGCCGTTGATGAAGCCATGGCATCGTGTCGCTCCTGCGTGGCGGGAAGC TGGCGACAAGTGGCTTTACTCCTTGAGCTGCGTGGAGGAGGACGGCCGAGTAA GTGCAGAGTACGAGGTTCTGCTGCCAGTCTGGCTGAACCAGCCTCAGCCCCTG AAAATGTTCCTCGACCGCAATCACCAGGTGGAGTTGCAGCTGAAGGCCGGGAT ACCCGTGCCGCACGAGCAAGTTGCGTCCCTGCCAGATCATACATCGACTTTGCT GGCGCTGCATTTCGGTCATCGATGGCCTCTCGAGCAGAAAGAGCACGTCATTC GGGTCTGGGCCAAGGATCAACCCCTATCGCTGAACCAAATTGGCGAGCTCACA TACGATCCACAGAATGAGAGCGTCAGCCGGGGAGAGTTTCTCATCCGGGACAA CACCAGAGCCCCCTACCTGTACAAGGATACCATTGCGTTCAAGCCCGAACCGA GCCAGGTCCAGAATACCTTTTACGAGTACGACAAGGCGCCCGAAGACGTGCCG TATCTCGTGCTCACCAAATGGACGCGGCGGACCGACTTTCTGCATCGCCTCCAA GGGAATCCCGCCAAGAATGAGGTTAGTAGCAAGCCATACGCACGCGTATATCC GCTGTCGTGGGCGACAGTCGATACCATCCCCGCCAGGCACGCCCAGTTTGGCA TGCTGATCCCGACCATGATCCACGAGCTCGGCGTCATGCTCATGGCCAAGGAG CTGGCCTACTCCGTTCTCGACGAGGTTGGCATTTCGGATCTGCAGCTGGTCAAG GAGGCCATCAGCGCGCGGAGTGCCTCGGAGCCGGTGAATTACGAGAGGCTGG AGTTTTTGGGCGACTCGATTCTCAAGTTTTGTGCCTGTATGCGCGCCGCTGCTG AAAGTAAGTTGCTCAAGCGTTTTACTCATATATGACTCCTGTGTGCACCTGTCCT CTGACATGGAACTGTTTTGCTGACCACATTTGATACTGCCTAGAACCCGACTATC CCGAGGGCTATCTCTCGTATTGGAGAGACCGACTCGTCTCCAACTCGAGGCTG TACAAAGCCGCTCTCGAGTTTGGGCTGCCGAGGTTCATCTTGACGAAACCTTTT ACCGGTCAAAAGTGGCGCCCACTCTACCTGGACGAGGTCCTCCAGCAAGGGGA CGTCGCTACGCCGGAGAAGAGAAAATTATCGACCAAGACGCTCGCAGACGTGG TCGAGGCGCTGATCGGGGCCTCATACGTCGATGGAGGCCTTTCAAAGGCAGTG ACTTGCATCTCAAAATTCGTCCCCGAAGGCTCGTGGACCAGTGTTGATGCAGAT AGAGAGTCTCTCTTTGCGAGAGTGCCAGACGGCGAGCCTCTCCCGCCGCCATT GGAGCCGCTGGAGAAGTTGATCGGCTACACGTTCCAGAAAAAGGCGCTCTTGA TGGAGGCTCTGACGCATGCCTCGTATGCTGCAGACTTCGGAACGCGATCTCTC GAGAGGCTCGAATTCATAGGAGACGCTGTCCTGGACAACATTATCGTTACGAAG CTCTTTAGGCTGAAGCCAGCGCTGCCCCATTTCAGGATGCATACGCTGAAGACG GGCCTGGTGAATGGGGACTTTCTTGCTTTCATGACAATGGAGCACGGAGTGCAA CTGGCGGCGGACCCTGTGGTGACAGAAGAAGCTACGGTGGAGGTCCCGGAAA CGATTTCCTACCTGTGGTCGTTTTTGAGGCAGGCCTCTTTTCCCATTGCCATCGA GCTGAAGGAGACGAACAAGCGGCACGCTGCCCTGAGAGAGCAGATTCACGAAG CAATGGACAATGACGATCATTACCCCTGGGCGCTGCTGGCCGCCCTGAGCCCG AAGAAGTTCTACTCTGACCTCTTCGAGGCGGTTCTCGGCGCTGTGTGGATCGAC TCCGGGTCGCTGGCGGCGTGCGAGGGCATGGTTGCGCAGTTTGGGATCTTAAA GTACATGGATCGGCTGCTGCGTGACGAAGTCCACGTGCAGCATCCTAAGGAGG AGCTGGGCATGTGGGCAAACACAGAGACTGTGACGTACGAGCTCGAGATGAAG GGGAGCGAGGAGAGCGCGGGGGAGAGGGAGTATTTCTGCAAGGTGTTTGTTG GAAAGAGGGAGGTTGTGGAGGTTCGTGGGGGGGTCAATAAGGAGGAGGTGAA GACGAAGGGTGCGACGGAGGCGTTGCGGATTTTGAGGGAGGAGAAAAGGCGC GGTGCTGAGGATGTGGTGATGGTGGGATAA SEQ1 mutation flanks 1 SEQ ID NO: 2 GACTGAAGGCCTTCATCAAATACAAGCAGCGCCAGAAGACCCAAGTTCAGGTAA GCATGGTCAAGGGCATCGAGCAGAACCTGGGGTGTGGATATGACAATTCGAAC CGTGTCGAGAAGAATGGCCCAGATATCCGGCCCCCAAGCATCGATATTGGAGT TCCCGGCCAGTGTCATCATGGGCACGGCAGGTATCTGCAACTTGAGCACATCG TGTTGCTGATGACACAGCGAAACTGTTGGCGCGATGAACCAGATGATCTGATGC GTGCTGCGTCAGTGCAGCTGTCCAGGTCGTTGTGCAACTGTATCCAGACGGCA GACTCACCTTTGATGCATCGCAGATTTCCAGCTCCTTCTTGATACGAAGCACAG CTCTGATGCAAGCGCCAAGTCAGTCTTTTGCGAAGAAGGGTGCTAAGGGCTGG CACAGGTTACGTGGGCTGCCGATGATGAAGATGCACAACTTACACTTGAGTCTT GCCACTTCACGTGTCCATCTAGATTTATAACAACGCCCCTTGGTCAATGGACAT GTCTTTCAACGTCGAAGACAACGACAGCAAAGGGGGAGACGGGGGATTGGAGA GAAACTTCAACATACAGCAACAATGACATTTTGCTTGAGGCTCTTGTCGAGCATC TCGATCTGATAGGCCCTCATGACTTTGACTTGCTCTCCCTCCTCGCCCAGCAGT GCTGCCTGGGAGCCTGAGGTTGTTGTCGGGATGGCTCCATCTTGACCGGGCGT AGGCTGCTTGATATCAGCTCCAGGCACGGCAGCCTCGTCGGCGACATGGCCAT CGGGAGCACCATCCGACCCCGTGGCCGCGCCCGCCCCTTTCTCGACGGCGTG GCCAGTCACATAGTTGAGCGATGGAGCCACGTCTCCAGAGGAGCAAGACGACC ATGAATCCGCGTCCGACGACGACGACGAGCGTGGGCGCACCCGCGGCACGTC ATCCCCAGCGCTCGCCAGGCCCGGAGCAGCAGCCGAAGCAGCGCGGACAGGA CCAGGACCAGACCCAGGCCCTGACCCTGACCCTGATGGCAGCCCAGGGCCAG CCGCCGCTACTAGCTGCAACATGGAAAGGCGACGGCGGCAGTTTGGCGCTCCC GCGGCGGCGGATCCCGGGGTGTGACTCAGGCAGCGGCCCCTGCGAAGCACCC GCAGCCTCAGGGAGCGTATTCTGACGTGTCGGGCAGACGCAACGAGTGCGTAT CGAGCGACTAGCTGCGCGTGAATCCCGGCTCGCGATGCCTCACGGCGACGGC GGCGGAGTTGGTTGCGGGGTTGGCGACTCGACGCTGGCGGGCTGGGACGCG GATTTGCACCTGGATCACCTGGATCTGGAGCTGGAGCTGCTGGATTCATGCCC CTGCTCGGCGGGAAGCCGGTGATTTGCGTGGCTGCCACTGGGGAGCTAAGAG AGAGGCAAGCCGTAGTCTTAGTCGTAGTTATATGTAGTTGTAAGGTAAGGCAAG GTACATGTAGTCGTCTGTAGGGCCTGTCTAGCGAACCTTGAGGTTTCCTGGATC CACGGCGAGCTTGGCCAGCATCAGAGAGAGGAGGAGGAGGCAGAGAGGCGTC AACAGCTGAGGCGTCACGGCTCGAGTGTCACAGGCATCGCTTCCCCGCAGGTG GAACAAGGCGTGTGTCCTTTCGTTGGGCTGCTGAGATGCCAATTGCTTGCTTGC TGGGGGTGAGAGAGAGGCCGCAGAGGTGTAGGAGGAGGAGACGCAATTGGGT GACGTGGGGGGAGTGAATGAATACAACGTCAAAGCAGGACTGCGAATTCAATC TATGGCAGGCAAGGACACTCGTGCACGACAGGCTACATAGCTACTATTAGCAAA CGGAGGATGTTGTTTTTGTGTTGGTTCATGCAGCCACTCATGCAGAGCCCCGGC CTCTTCTCACCTTGTTTGGGTTGTTGAAGCTTGTTTCGTGGCTTGATAGTGAGCC GCTGCGTTAAGATTCAAACTGTCACCGTTAGCGTCGGCAGCCTCGTTCACGGCC TCTCCTTGGTTTCTGGAACTCTCACAGGTATGTCAAGCAAGAATGTAACAAGACA CAGCCCGGGCTCTTGTCTGTTACCAGGTCATATGAGCCAGGGATCAAGAAATCC GCGGAAAGGTCAATAAAATGGGAGTTACTGAGTATATTCCGTCCCGTGCCTTTT CTTCATGCTGGTCTCTGGAGGAAATCTCACGGCTATCGTCACGAATGGCCGAAT AAGTGCGACCATCTTCAGAGCTTCGTGTGACTGGCGACCATCTTTACCCGAAGT CAGATAGACAGGAATCACCATTGGTAGCAGTGACTAATTAATGCACTGTTACAAC ACATGACTGACAAGTTTCGAAAACCAAGAATAAGGTACTATCAATATCATAAGTA CCTAGGATCTAAGGTATGTAGGCAGACCGTCATCATCACCTTCAAACCCCCGAC AGGACAGGCCTCAATCCCCGGCAGTAGGTACATACTCTATCTCCGGGACTTGAC GACCCACCATTGCGATTGCCGCCTCAATGCCAGAAGGAACTTTTGTCCTCCCAG TGCTTTGTCCTGCTACTGTCATTACCAAGCAAGCCTTAGGAGTCATAAGAGTCAT ACTGAACCTTAGGTACTTGTTGGGCAGAGCCATGTGGCCTACACTCCCAAACTC AAAATTACTGGTCCGTTCATGCCTTGGATCATGTATCTTTCCATTTGCCAATCATA GGCCTCCCGGAACTTTCAAGCAATAGAGAGGTCAGCTCGATGCTGGACAGGGC AGACCGTACTTACACGTACCTAGGTAGCCTCTCTGTAGAACCTTTGACCCTCAA AAGGTTCATCACCAAGTTATTGCGTAGCATGACCTAGAATACTGAAATTAGATCG CGCAAGTAGCAATAATTCGCTATACTATGTATGCGGCAAGTCGCATTTCAGAAG CCGGTTCTGTTCAACCACAGTCCAACCGTCGTCAATCTGGAGATGCGTCACAGG AGCCGCAGGTGACTGCACAGCGATGCACCGTGGTGATGACATTGAATCTGCCT AGGTATAATTACCTACATTTTCAATGTCTGTCTTCAAAAATAGAATAAAGTGCCAC TTGGCATTCGACAATTGTTGTGTTGAACAATTGGGAGTATCTACGTCGTGAATCA TGTTGCAAGCAAGAGGTATAGGTAGGTACCTTACCTGTTGAAGCAGCTAGCGCC CTAGAGGCAGCCTCTGATGTCGTCTTGTCATTTTTTGATCCATCTCAAACAAGTC TCAACAACGCATCCCATGCACCATGGAGCTTTTCGCAACAGGCTTCAACGCCTG GAACCAGCTCACTTTCACCAAAGGCAGCCCCCAAGAGGCCATCCCAGAGGAAC CAGATGACCTCTTCGGCTTTACAAAAGTTCTCTCCGCCACATCCATTGAACGGC CAGTATCGCGCCTCACTTACACCATCGGTACCTTATATCAAATCACAACCTATCT CATACCCCATCACACCTCCCTTTTACGCCCTATAAAAGACCATTACCGCCTAAAC CTCAACAATCAAACCACAAACTGACAAAAGATTTCCCCCCCCTCCAGTCCGAAA AGACGACCACCTCATCCTCGCCGGCCATGGCCCCTCGCAGCACAACCTCGAGC ACCTCTACGCGTCCGCCGAAACGTTTCGACT SEQ1 mutation flanks 2 SEQ ID NO: 3 GACTGAAGTACTTCATCTGGTTCTGTGTGTAGGTATCGTACTTTTCAATGGCTGT TAGCAGCAGGCGGTTGTTTCGGTCCGTAGGGTTGTTGCGCAGCATGAGTATGT AGGGGTCTTCGAGAATGTCCAGCGCCCGGTAGACCCGATCCAAGTCGCGCATG GTGGGCGTCGTGATGTCTTCTTTGCCGGCTTTATAGATGATGTGCTTGATATTG GGCCTCTTGACGCATTTGAGCAGTTCGTCGCGATGGAGAGTGGGCGAGACGCA TCTTGCATCCATCAGCCATTCCAAGGCATCCAATATCGGCAAGCTCAGACTGAA TGCTCGGAGTTGCCGTCAGACCCAGAACAGCAGGCACGCTTTCACCAGCCAGC TTGCGCGGATGGTAGTGGTGGAGCATGATTTTGCCGCCTGGACTTCTGCCAAT GCAGTTGTGGACTTTTGCACAAGACACGTCAGCGATTTGCAACTTCTGGCGGCC CCTTTGCCTTTACAGAGTGAAGGCAGGTCGTCCCATACCTTCATCAAATACAAG CAGCGCCAGAAGACCCAAGTTCAGGTAAGCATGGTCAAGGGCATCGAGCAGAA CCTGGGGTGTGGATATGACAATTCGAACCGTGTCGAGAAGAATGGCCCAGATAT CCGGCCCCCAAGCATCGATATTGGAGTTCCCGGCCAGTGTCATCATGGGCACG GCAGGTATCTGCAACTTGAGCACATCGTGTTGCTGATGACACAGCGAAACTGTT GGCGCGATGAACCAGATGATCTGATGCGTGCTGCGTCAGTGCAGCTGTCCAGG TCGTTGTGCAACTGTATCCAGACGGCAGACTCACCTTTGATGCATCGCAGATTT CCAGCTCCTTCTTGATACGAAGCACAGCTCTGATGCAAGCGCCAAGTCAGTCTT TTGCGAAGAAGGGTGCTAAGGGCTGGCACAGGTTACGTGGGCTGCCGATGATG AAGATGCACAACTTACACTTGAGTCTTGCCACTTCCCGTGTCCATCTAGATTTAT AACAACGCCCCTTGGTCAATGGACATGTCTTTCAACGTCGAAGACAACGACAGC AAAGGGGGAGACGGGGGATTGGAGAGAAACTTCAACATACAGCAACAATGACA TTTTGCTTGAGGCTCTTGTCGAGCATCTCGATCTGATAGGCCCTCATGACTTTGA CTTGCTCTCCCTCCTCGCCCAGCAGTGCTGCCTGGGAGCCTGAGGTTGTTGTC GGGATGGCTCCATCTTGACCGGGCGTAGGCTGCTTGATATCAGCTCCAGGCAC GGCAGCCTCGTCGGCGACATGGCCATCGGGAGCACCATCCGACCCCGTGGCC GCGCCCGCCCCTTTCTCGACGGCGTGGCCAGTCACATAGTTGAGCGATGGAGC CACGTCTCCAGAGGAGCAAGACGACCATGAATCCGCGTCCGACGACGACGACG AGCGTGGGCGCACCCGCGGCACGTCATCCCCAGCGCTCGCCAGGCCCGGAGC AGCAGCCGAAGCAGCGCGGACAGGACCAGGACCAGACCCAGGCCCTGACCCT GACCCTGATGGCAGCCCAGGGCCAGCCGCCGCTACTAGCTGCAACATGGAAAG GCGACGGCGGCAGTTTGGCGCTCCCGCGGCGGCGGATCCCGGGGTGTGACTC AGGCAGCGGCCCCTGCGAAGCACCCGCAGCCTCAGGGAGCGTATTCTGACGT GTCGGGCAGACGCAACGAGTGCGTATCGAGCGACTAGCTGCGCGTGAATCCC GGCTCGCGATGCCTCACGGCGACGGCGGCGGAGTTGGTTGCGGGGTTGGCGA CTCGACGCTGGCGGGCTGGGACGCGGATTTGCACCTGGATCACCTGGATCTGG AGCTGGAGCTGCTGGATTCATGCCCCTGCTCGGCGGGAAGCCGGTGATTTGCG TGGCTGCCACTGGGGAGCTAAGAGAGAGGCAAGCCGTAGTCTTAGTCGTAGTT ATATGTAGTTGTAAGGTAAGGCAAGGTACATGTAGTCGTCTGTAGGGCCTGTCT AGCGAACCTTGAGGTTTCCTGGATCCACGGCGAGCTTGGCCAGCATCAGAGAG AGGAGGAGGAGGCAGAGAGGCGTCAACAGCTGAGGCGTCACGGCTCGAGTGT CACAGGCATCGCTTCCCCGCAGGTGGAACAAGGCGTGTGTCCTTTCGTTGGGC TGCTGAGATGCCAATTGCTTGCTTGCTGGGGGTGAGAGAGAGGCCGCAGAGGT GTAGGAGGAGGAGACGCAATTGGGTGACGTGGGGGGAGTGAATGAATACAAC GTCAAAGCAGGACTGCGAATTCAATCTATGGCAGGCAAGGACACTCGTGCACG ACAGGCTACATAGCTACTATTAGCAAACGGAGGATGTTGTTTTTGTGTTGGTTCA TGCAGCCACTCATGCAGAGCCCCGGCCTCTTCTCACCTTGTTTGGGTTGTTGAA GCTTGTTTCGTGGCTTGATAGTGAGCCGCTGCGTTAAGATTCAAACTGTCACCG TTAGCGTCGGCAGCCTCGTTCACGGCCTCTCCTTGGTTTCTGGAACTCTCACAG GTATGTCAAGCAAGATAACAAGACACAGCCCGGGCTCTTGTCTGTTACCAGGTC ATATGAGCCAGGGATCAAGAAATCCGCGGAAAGGTCAATAAAATGGGAGTTACT GAGTATATTCCGTCCCGTGCCTTTTCTTCATGCTGGTCTCTGGAGGAAATCTCAC GGCTATCGTCACGAATGGCCGAATAAGTGCGACCATCTTCAGAGCTTCGTGTGA CTGGCGACCATCTTTACCCGAAGTCAGATAGACAGGAATCACCATTGGTAGCAG TGACTAATTAATGCACTGTTACAACACATGACTGACAAGTTTCGAAAACCAAGAA TAAGGTACTATCAATATCATAAGTACCTAGGATCTAAGGTATGTAGGCAGACCGT CATCATCACCTTCAAACCCCCGACAGGACAGGCCTCAATCCCCGGCAGTAGGT ACATACTCTATCTCCGGGACTTGACGACCCACCATTGCGATTGCCGCCTCAATG CCAGAAGGAACTTTTGTCCTCCCAGTGCTTTGTCCTGCTACTGTCATTACCAAGC AAGCCTTAGGAGTCATAAGAGTCATACTGAACCTTAGGTACTTGTTGGGCAGAG CCATGTGGCCTACACTCCCAAACTCAAAATTACTGGTCCGTTCATGCCTTGGAT CATGTATCTTTCCATTTGCCAATCATAGGCCTCCCGGAACTTTCAAGCAATAGAG AGGTCAGCTCGATGCTGGACAGGGCAGACCGTACTTACACGTACCTAGGTAGC CTCTCTGTAGAACCTTTGACCCTCAAAAGGTTCATCACCAAGTTATTGCGTAGCA TGACCTAGAATACTGAAATTAGATCGCGCAAGTAGCAATAATTCGCTATACTATG TATGCGGCAAGTCGCATTTCAGAAGCCGGTTCTGTTCAACCACAGTCCAACCGT CGTCAATCTGGAGATGCGTCACAGGAGCCGCAGGTGACTGCACAGCGATGCAC CGTGGTGATGACATTGAATCTGCCTAGGTATAATTACCTACATTTTCAATGTCTG TCTTCAAAAATAGAATAAAGTGCCACTTGGCATTCGACAATTGTTGTGTTGAACA ATTGGGAGTATCTACGTCGTGAATCATGTTGCAAGCAAGAGGTATAGGTAGGTA CCTTACCTGTTGAAGCAGCTAGCGCCCTAGAGGCAGCCTCTGATGTCGTCTTGT CATTTTTTGATCCATCTCAAACAAGTCTCAACAACGCATCCCATGCACCATGGAG CTTTTCGCAACAGGCTTCAACGCCTGGAACCAGCTCACTTTCACCAAAGGCAGC CCCCAAGAGGCCATCCCAGAGGAACCAGATGACCTCTTCGGCTTTACAAAAGTT CTCTCCGCCACATCCATTGAACGGCCAGTATCGCGCCTCACTTACACCATCGGT ACCTTATATCAAATCACAACCTATCTCATACCCCATCACACCTCCCTTTTACGCC CTATAAAAGACCATTACCGCCTAAACCTCAACAATCAAACCACAAACTGACAAAA GATTTCCCCCCCCTCCAGTCCGAAAATTTTCGACT Hygromycin B resistance marker SEQ ID NO: 4 GTTAACAAGACACAGCCCTATAACTTCGTATAATGTATGCTATACGAAGTTATAT AACGGTGAGACTAGCGGCCGGTCCCCTTATCCCAGCTGTTCCACGTTGGCCTG CCCCTCAGTTAGCGCTCAACTCAATGCCCCTCACTGGCGAGGCGAGGGCAAGG ATGGAGGGGCAGCATCGCCTGAGTTGGAGCAAAGCGGCCCGGCCGCCATGGG AGCAGCGAACCAACGGAGGGATGCCGTGCTTTGTCGTGGCTGCTGTGGCCAAT CCGGGCCCTTGGTTGGCTCACAGAGCGTTGCTGTGAGACCATGAGCTATTATTG CTAGGTACAGTATAGAGAGAGGAGAGAGAGAGAGAGAGAGAGAGAGGGGAAAA AAGGTGAGGTTGAAGTGAGAAAAAAAAAAAAAAAAAAAAATCCAACCACTGACG GCTGCCGGCTCTGCCACCCCCCTCCCTCCACCCCAGACCACCTGCACACTCAG CGCGCAGCATCACCTAATCTTGGCTCGCCTTCCCGCAGCTCAGGTTGTTTTTTT TTTCTCTCTCCCTCGTCGAAGCCGCCCTTGTTCCCTTATTTATTTCCCTCTCCAT CCTTGTCTGCCTTTGGTCCATCTGCCCCTTTGTCTGCATCTCTTTTGCACGCATC GCCTTATCGTCGTCTCTTTTTTCACTCACGGGAGCTTGACGAAGACCTGACTCG TGAGCCTCACCTGCTGATTTCTCTCCCCCCCTCCCGACCGGCTTGACTTTTGTT TCTCCTCCAGTACCTTATCGCGAAGCCGGAAGAACCTCTTAACCTCTAGATGAA AAAGCCTGAACTCACCGCCACGTCTGTCGAGAAGTTCCTGATCGAAAAGTTCGA CAGCGTCTCCGACCTGATGCAGCTCTCGGAGGGCGAAGAATCTCGTGCTTTCA GCTTCGATGTAGGAGGGCGTGGATATGTCCTGCGGGTAAATAGCTGCGCCGAT GGTTTCTACAAAGATCGTTATGTTTATCGGCACTTTGCATCGGCCGCGCTCCCG ATTCCGGAAGTGCTTGACATTGGGGAATTCAGCGAGAGCCTGACCTATTGCATC TCCCGCCGTGCACAGGGTGTCACGTTGCAAGACCTGCCTGAAACCGAACTGCC CGCTGTTCTGCAGCCGGTCGCGGAGGCCATGGATGCGATCGCTGCGGCCGAT CTCAGCCAGACGAGCGGGTTCGGCCCATTCGGACCGCAAGGAATCGGTCAATA CACTACATGGCGTGATTTCATATGCGCGATTGCTGATCCCCATGTGTATCACTG GCAAACTGTGATGGACGACACCGTCAGTGCGTCCGTCGCGCAGGCTCTCGATG AGCTGATGCTTTGGGCCGAGGACTGCCCCGAAGTCCGGCACCTCGTGCACGC GGATTTCGGCTCCAACAATGTCCTGACGGACAATGGCCGCATAACAGCGGTCAT TGACTGGAGCGAGGCGATGTTCGGGGATTCCCAATACGAGGTCGCCAACATCT TCTTCTGGAGGCCGTGGTTGGCTTGTATGGAGCAGCAGACGCGCTACTTCGAG CGGAGGCACCCGGAGCTTGCAGGATCGCCGCGGCTCCGGGCGTATATGCTCC GCATTGGTCTTGACCAACTCTATCAGAGCTTGGTTGACGGCAATTTCGATGATG CAGCTTGGGCGCAGGGTCGATGCGACGCAATCGTCCGATCCGGAGCCGGGAC TGTCGGGCGTACACAAATCGCCCGCAGAAGCGCGGCCGTCTGGACCGATGGC TGTGTAGAAGTACTCGCCGATAGTGGAAACCGACGCCCCAGCACTCGTCCGAG GGCAAAGGAATAGATGCATGGCTTTCGTGACCGGGCTTCAAACAATGATGTGCG ATGGTGTGGTTCCCGGTTGGCGGAGTCTTTGTCTACTTTGGTTGTCTGTCGCAG GTCGGTAGACCGCAAATGAGCAACTGATGGATTGTTGCCAGCGATACTATAATT CACATGGATGGTCTTTGTCGATCAGTAGCTAGTGAGAGAGAGAGAACATCTATC CACAATGTCGAGTGTCTATTAGACATACTCCGAGAATAAAGTCAACTGTGTCTGT GATCTAAAGATCGATTCGGCAGTCGAGTAGCGTATAACAACTCCGAGTACCAGC GAAAGCACGTCGTGACAGGAGCAGGGCTTTGCCAACTGCGCAACCTTGCTTGA ATGAGGATACACGGGGTGCAACATGGCTGTACTGATCCATCGCAACCAAAATTT CTGTTTATAGATCAAGCTGGTAGATTCCAATTACTCCACCTCTTGCGCTTCTCCA TGACATGTAAGTGCACGTGGAAACCATACCCAATATAACTTCGTATAATGTATGC TATACGAAGTTATAGGGCTCTTGTCTGTTAAC