MODIFIED SIRNA WITH REDUCED OFF-TARGET ACTIVITY

20230287418 · 2023-09-14

    Inventors

    Cpc classification

    International classification

    Abstract

    Disclosed is a modified siRNA with a reduced off-target activity. The siRNA comprises a sense strand and an antisense strand, wherein the antisense strand contains a chemical modification as represented by formula (I) or a tautomeric modification thereof in at least one nucleotide position from position 2 to position 8 of 5′ region thereof. A conjugate, a pharmaceutical composition, a cell or a kit containing the siRNA, and the medical use of the siRNA, the conjugate and/or the pharmaceutical composition thereof are also disclosed. Further disclosed are compounds as represented by formula (II) and formula (III) or tautomers thereof, and preparation methods therefor.

    Claims

    1. An siRNA, comprising a sense strand and an antisense strand, wherein each of the strands has 15 to 35 nucleotides; the antisense strand comprises a chemical modification of formula (I) or a tautomer modification thereof in at least one of nucleotide positions 2 to 8 of the 5′ region thereof: ##STR00212## wherein Y is selected from the group consisting of O, NH and S; each X is independently selected from the group consisting of CR.sub.4(R.sub.4′), S, NR.sub.5 and NH—CO, wherein R.sub.4, R.sub.4′ and R.sub.5 are each independently H or C.sub.1-C.sub.6 alkyl; J.sub.2 is H or C.sub.1-C.sub.6 alkyl; n=0, 1 or 2; m=0, 1 or 2; s=0 or 1; R.sub.3 is selected from the group consisting of H, OH, halogen, NH.sub.2, C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkoxy, C.sub.2-C.sub.6 alkenyl, C.sub.2-C.sub.6 alkynyl, S—CH.sub.3, NCH.sub.3(CH.sub.3), OCH.sub.2CH.sub.2OCH.sub.3, —O-alkylamino and (CH.sub.2).sub.pR.sub.6, wherein R.sub.6 is selected from the group consisting of OH, halogen, methoxy, ethoxy, N.sub.3, C.sub.2-C.sub.6 alkenyl and C.sub.2-C.sub.6 alkynyl, and p=1, 2 or 3; Q.sub.1 is ##STR00213##  and Q.sub.2 is R.sub.2; or Q.sub.1 is R.sub.2, and Q.sub.2 is ##STR00214## wherein: R.sub.1 is selected from the group consisting of H, C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkoxy, C.sub.2-C.sub.6 alkenyl, C.sub.2-C.sub.6 alkynyl and (CH.sub.2).sub.qR.sub.7, wherein R.sub.7 is selected from the group consisting of OH, halogen, methoxy, ethoxy, N.sub.3, C.sub.2-C.sub.6 alkenyl and C.sub.2-C.sub.6 alkynyl, and q=1, 2 or 3; J.sub.1 is H or C.sub.1-C.sub.6 alkyl; R.sub.2 is selected from the group consisting of H, OH, halogen, NH.sub.2, C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkoxy, C.sub.2-C.sub.6 alkenyl, C.sub.2-C.sub.6 alkynyl, S—CH.sub.3, NCH.sub.3(CH.sub.3), OCH.sub.2CH.sub.2OCH.sub.3, —O-alkylamino and (CH.sub.2).sub.rR.sub.8, wherein R.sub.8 is selected from the group consisting of OH, halogen, methoxy, ethoxy, N.sub.3, C.sub.2-C.sub.6 alkenyl and C.sub.2-C.sub.6 alkynyl, and r=1, 2 or 3; optionally, R.sub.1 and R.sub.2 are directly linked to form a ring; B is abase; wherein the chemical modification of formula (I) is not ##STR00215## when X is NH—CO, R.sub.1 is not H.

    2.-3. (canceled)

    4. The siRNA according to claim 1, wherein: each X is independently selected from the group consisting of CR4(R4′), S, NR5 and NH—CO, wherein R4, R4′ and R5 are each independently H, methyl, ethyl, n-propyl or isopropyl; each J1 and each J2 is independently H or methyl; R3 is selected from the group consisting of H, OH, F, Cl, NH2, methyl, ethyl, n-propyl, isopropyl, methoxy, ethoxy, n-propoxy, isopropoxy, vinyl, allyl, ethynyl, propargyl, S—CH3, NCH3(CH3), OCH2CH2OCH3, —O-methylamino, —O-ethylamino and (CH2)pR6, wherein R.sub.6 is selected from the group consisting of OH, F, Cl, methoxy, ethoxy, N3, vinyl, allyl, ethynyl and propargyl, and p=1 or 2; R1 is selected from the group consisting of H, methyl, ethyl, n-propyl, isopropyl, methoxy, ethoxy, n-propoxy, isopropoxy, vinyl, allyl, ethynyl, propargyl and (CH2)qR7, wherein R7 is selected from the group consisting of OH, F, Cl, methoxy, ethoxy, N3, vinyl, allyl, ethynyl and propargyl, and q 1 or 2; R2 is selected from the group consisting of H, OH, F, Cl, NH2, methyl, ethyl, n-propyl, isopropyl, methoxy, ethoxy, n-propoxy, isopropoxy, vinyl, allyl, ethynyl, propargyl, S—CH3, NCH3(CH3), OCH2CH2OCH3, —O-methylamino, —O-ethylamino and (CH2)rR8, wherein R8 is selected from the group consisting of OH, F, Cl, methoxy, ethoxy, N3, vinyl, allyl, ethynyl, and propargyl, and r 1 or 2; optionally, R1 and R2 are directly linked to form a ring.

    5. The siRNA according to claim 1, wherein the chemical modification is selected from any one of the following structures: ##STR00216## ##STR00217## ##STR00218##

    6. The siRNA according to claim 1, wherein the antisense strand comprises the chemical modification of formula (I) or the tautomer modification thereof defined in claim 1 at nucleotide position 7 of the 5′ region thereof.

    7. The siRNA according to claim 1, wherein in addition to the nucleotide modified by the chemical modification of formula (I) or the tautomer modification thereof defined in claim 1, the other nucleotides in the sense strand and/or antisense strand are otherwise modified nucleotides.

    8. The siRNA according to claim 7, wherein the otherwise modified nucleotides are each independently selected from the group consisting of a 2′-methoxy-modified nucleotide, a 2′-fluoro-modified nucleotide, and a 2′-deoxy-modified nucleotide.

    9. The siRNA according to claim 1, wherein: in a 5′-end to 3′-end direction, nucleotides in positions 2, 4, 6, 9, 12, 14, 16 and 18 of the antisense strand are each independently a 2′-fluoro-modified nucleotide; or in a 5′-end to 3′-end direction, nucleotides in positions 2, 4, 6, 10, 12, 14, 16 and 18 of the antisense strand are each independently a 2′-fluoro-modified nucleotide.

    10. The siRNA according to claim 1, wherein: the sense strand has a nucleotide sequence of the formula shown below: 5′-N.sub.aN.sub.aN.sub.aN.sub.aXN.sub.aN.sub.bN.sub.bN.sub.bN.sub.aN.sub.aN.sub.aN.sub.aN.sub.aN.sub.aN.sub.aN.sub.aN.sub.aN.sub.a-3; wherein each X is independently N.sub.a or N.sub.b; each N.sub.a and each N.sub.b independently represents a modified nucleotide or an unmodified nucleotide, and modifications on N.sub.a and N.sub.b are different; and/or, the antisense strand has a nucleotide sequence of the formula shown below: 5′-N.sub.a′N.sub.b′N.sub.a′X′N.sub.a′N.sub.b′W′N.sub.a′Y′N.sub.a′X′N.sub.a′N.sub.b′N.sub.a′X′N.sub.a′X′N.sub.a′N.sub.a′N.sub.a′- 3; wherein each X′ is independently N.sub.a or N.sub.b′, and Y′ is N.sub.a′ or N.sub.b′; each N.sub.a and each N.sub.b′ independently represents a modified nucleotide or an unmodified nucleotide, wherein modifications on N.sub.a and N.sub.b′ are different; W′ represents a nucleotide comprising the chemical modification of formula (I) or the tautomer modification thereof defined in claim 1 N.sub.a is a 2′-methoxy-modified nucleotide, and N.sub.b is a 2′-fluoro-modified nucleotide; and/or N.sub.a′ is a 2′-methoxy-modified nucleotide, and N.sub.b′ is a 2′-fluoro-modified nucleotide.

    11. The siRNA according to claim 10, wherein the antisense strand has a nucleotide sequence of the formula shown below: 5′-N.sub.a′N.sub.b′N.sub.a′N.sub.b′N.sub.a′N.sub.b′W′N.sub.a′X′Y′N.sub.a′N.sub.b′N.sub.a′N.sub.b′N.sub.a′N.sub.b′N.sub.a′N.sub.b′N.sub.a′N.sub.a′N.sub.a′-3′; wherein each X′ is independently N.sub.a or N.sub.b′, and Y′ is N.sub.a or N.sub.b′; N.sub.a′ is a 2′-methoxy-modified nucleotide; N.sub.b′ is a 2′-fluoro-modified nucleotide; W′ is as defined in claim 10.

    12. The siRNA according to claim 10, wherein the sense strand has a nucleotide sequence of the formula shown below: 5′-N.sub.aN.sub.aN.sub.aN.sub.aN.sub.aN.sub.aN.sub.bN.sub.bN.sub.bN.sub.aN.sub.aN.sub.aN.sub.aN.sub.aN.sub.aN.sub.aN.sub.aN.sub.aN.sub.a-3′; or, 5′-N.sub.aN.sub.aN.sub.aN.sub.aN.sub.bN.sub.aN.sub.bN.sub.bN.sub.bN.sub.aN.sub.aN.sub.aN.sub.aN.sub.aN.sub.aN.sub.aN.sub.aN.sub.aN.sub.a-3′; wherein N.sub.a is a 2′-methoxy-modified nucleotide, and N.sub.b is a 2′-fluoro-modified nucleotide.

    13. The siRNA according to claim 11, wherein the antisense strand has a nucleotide sequence of the formula shown below: 5′-N.sub.a′N.sub.b′N.sub.a′N.sub.b′N.sub.a′N.sub.b′W′N.sub.a′N.sub.a′N.sub.b′N.sub.a′N.sub.b′N.sub.a′N.sub.b′N.sub.a′N.sub.b′N.sub.a′N.sub.b′N.sub.a′N.sub.a′N.sub.a′-3′; or, 5′-N.sub.a′N.sub.b′N.sub.a′N.sub.b′N.sub.a′N.sub.b′W′N.sub.a′N.sub.b′N.sub.a′N.sub.a′N.sub.b′N.sub.a′N.sub.b′N.sub.a′N.sub.b′N.sub.a′N.sub.b′N.sub.a′N.sub.a′N.sub.a′-3′; wherein, N.sub.a′ is a 2′-methoxy-modified nucleotide, and N.sub.b′ is a 2′-fluoro-modified nucleotide; W′ represents a nucleotide comprising a chemical modification selected from the group consisting of the following structures or a tautomer modification thereof; ##STR00219## wherein B is a base corresponding to position 7 of the 5′ region of the antisense strand.

    14. The siRNA according to claim 1, wherein at least one phosphoester group in the sense strand and/or the antisense strand is a phosphoester group with a phosphorothioate group.

    15. The siRNA according to claim 14, wherein the phosphorothioate group is present in at least one of the positions selected from the group consisting of: a position between the 1st and 2nd nucleotides of the 5′ end of the sense strand; a position between the 2nd and 3rd nucleotides of the 5′ end of the sense strand; an end of the 1st nucleotide of the 3′ end of the sense strand; a position between the 1st and 2nd nucleotides of the 3′ end of the sense strand; a position between the 2nd and 3rd nucleotides of the 3′ end of the sense strand; a position between the 1st and 2nd nucleotides of the 5′ end of the antisense strand; a position between the 2nd and 3rd nucleotides of the 5′ end of the antisense strand; an end of the 1st nucleotide of the 3′ end of the antisense strand; a position between the 1st and 2nd nucleotides of the 3′ end of the antisense strand; and a position between the 2nd and 3rd nucleotides of the 3′ end of the antisense strand.

    16. An siRNA conjugate, comprising: the siRNA according to claim 1; and a conjugated group linked to the siRNA the conjugated group comprises a pharmaceutically acceptable targeting ligand and optionally a linker, the targeting ligand includes a galactose cluster or a galactose derivative cluster, wherein the galactose derivative is selected from the group consisting of N-acetyl-galactosamine, N-trifluoroacetyl-galactosamine, N-propionyl-galactosamine, N-n-butyryl-galactosamine and N-isobutyrylgalactosamine.

    17. A pharmaceutical composition, comprising: the siRNA according to claim 1.

    18. A method for inhibiting expression of a target gene or mRNA thereof in a subject in need thereof, the method comprising: administering to the subject in need thereof an effective amount or effective dose of the siRNA according to claim 1.

    19-33. (canceled)

    34. The siRNA according to claim 1, wherein the chemical modification is selected from any one of the following structures: ##STR00220##

    Description

    BRIEF DESCRIPTION OF THE DRAWINGS

    [0726] FIGS. 1A to 1L show the experimental results of the off-target activity of siRNA comprising different test compounds.

    [0727] FIGS. 2A to 2G show the experimental results of the off-target activity of siRNA2 comprising different test compounds.

    [0728] FIGS. 3A to 3G show the experimental results of the off-target activity of siRNA3 comprising test compounds.

    [0729] FIG. 4 shows the inhibitory activity of galactosamine molecule cluster-conjugated siRNAs against the mTTR gene in murine primary hepatocytes.

    [0730] FIG. 5 shows the in vivo inhibitory activity of galactosamine molecule cluster-conjugated siRNAs against the mouse mTTR gene.

    [0731] FIG. 6 shows the in vivo long-term inhibitory activity of galactosamine molecule cluster-conjugated siRNAs against the mouse mTTR gene.

    [0732] FIG. 7 shows the effect of siRNA agents on the total cholesterol level in Apoc3 transgenic mice.

    [0733] FIG. 8 shows the effect of siRNA agents on the triglyceride level in Apoc3 transgenic mice.

    [0734] FIG. 9 shows the effect of siRNA agents on the Apoc3 protein level in Apoc3 transgenic mice.

    DETAILED DESCRIPTION

    [0735] The present disclosure is further described below with reference to examples, which are not intended to limit the scope of the present disclosure. Experimental procedures without conditions specified in the examples of the present disclosure are generally conducted according to conventional conditions, or according to conditions recommended by the manufacturers of the starting materials or commercial products. If the source of a reagent is not shown, the reagent is obtained from any molecular biology reagent supplier in quality/purity for molecular biology applications.

    I. Preparation of Chemical Modifications and Activity Evaluation

    Example 1. Preparation of Chemical Modifications

    [0736] 1.1. Synthesis of Compound 1-1a and Compound 1-1b

    ##STR00139##

    [0737] Compound 1 (500 mg, 3.42 mmol) and triethylamine (Et.sub.3N, 692 mg, 6.84 mmol, 0.95 mL) were dissolved in dichloromethane (DCM, 10 mL). A solution of 4-toluenesulfonyl chloride (TsCl, 717 mg, 3.76 mmol) in dichloromethane (10 mL) was added dropwise under ice bath conditions. After the dropwise addition was complete, the reaction mixture was stirred at room temperature overnight. After the reaction was complete, the mixture was quenched with water. The aqueous phase was extracted three times with dichloromethane (15 mL). The organic phases were combined, washed first with saturated aqueous sodium bicarbonate solution (10 mL) and then with saturated brine (20 mL), and then concentrated under reduced pressure to evaporate the solvent to give crude 2 (820 mg, 80%), which was directly used in the next step. MS m/z: C.sub.14H.sub.21O.sub.5S, [M+H].sup.+ calculated: 301.10, found: 301.2.

    ##STR00140##

    [0738] Compound 3 (239 mg, 1.22 mmol) was dissolved in dimethylformamide (DMF, 10 mL). A solution of NaH (60% in mineral oil, 93 mg, 2.33 mmol) was added under ice bath conditions. The reaction mixture was stirred for 30 min, and then compound 2 (350 mg, 1.16 mmol) was added dropwise. After the dropwise addition was complete, the reaction mixture was stirred at 60° C. for 5 h. After the reaction was complete, the mixture was quenched with water. The aqueous phase was extracted with ethyl acetate (15 mL) three times. The combined organic phases were washed first with water (10 mL) three times and then with saturated brine (10 mL), then concentrated under reduced pressure to evaporate the solvent, purified by reversed-phase preparative HPLC (C.sup.18, conditions: 5-50% (A: H.sub.2O, B: CH.sub.3CN), flow rate: 70 mL/min), and lyophilized to give compound 4 (220 mg). MS m/z: C.sub.19H.sub.21N.sub.5O.sub.3N.sub.a, M+Na].sup.+ calculated: 390.16, found: 390.3.

    ##STR00141##

    [0739] Compound 4 (1.50 g, 4.08 mmol) was dissolved in 20 mL of a mixed solution of acetic acid and water (4:1) at room temperature. The mixture was stirred at 60° C. for 30 min. After the reaction was complete, the mixture was concentrated under reduced pressure to evaporate the solvent, purified by reversed-phase preparative HPLC (C.sup.18, conditions: 5-25% (A: H.sub.2O, B: CH.sub.3CN), flow rate: 70 mL/min), and lyophilized to give compound 5 (1.10 g). MS m/z: C.sub.16H.sub.18N.sub.5O.sub.3, [M+H].sup.+ calculated: 328.13, found: 328.4.

    ##STR00142##

    [0740] Compound 5 (1.00 g, 3.05 mmol) was dissolved in pyridine (Py, 10 mL). A solution of 4,4′-dimethoxytrityl chloride (DMTrCl, 1.50 g, 4.58 mmol) in pyridine (5 mL) was added dropwise under ice bath conditions. After the dropwise addition was complete, the reaction mixture was stirred at room temperature overnight. After the reaction was complete, the mixture was quenched with water, concentrated under reduced pressure to evaporate the solvent, purified by reversed-phase preparative HPLC (C.sup.18, conditions: 5-80% (A: H.sub.2O, B: CH.sub.3CN), flow rate: 70 mL/min), and lyophilized to give compound 6 (1.00 g). MS m/z: C.sub.37H.sub.36N.sub.5O.sub.5, [M−H].sup.+ calculated: 630.26, found: 630.5. The racemate compound 6 was resolved using a chiral column (Daicel CHIRALPAK® IE 250×4.6 mm, 5 μm, A: n-hexane, B: ethanol) into 6A(−) (410 mg) and 6B(+) (435 mg).

    ##STR00143##

    [0741] Compound 6A(−) (200 mg, 0.32 mmol), tetrazole (11 mg, 0.16 mmol), N-methylimidazole (5 mg, 0.06 mmol) and 3A molecular sieve (500 mg) were dissolved in 10 mL of acetonitrile. Compound 7 (144 mg, 0.48 mmol) was added at room temperature. The mixture was stirred at room temperature overnight. After the reaction was complete, the molecular sieve was filtered out, and dichloromethane (30 mL) was added. The mixture was washed with saturated aqueous sodium bicarbonate solution (10 mL) three times and then with saturated brine (20 mL). The filtrate was concentrated by rotary evaporation, purified by reversed-phase preparative HPLC (C.sup.18, conditions: 5-100% (A: water, B: CH.sub.3CN), flow rate: 70 mL/min), and lyophilized to give compound 1-1a (200 mg). MS m/z: C.sub.40H.sub.39N.sub.6O.sub.7P, [M-diisopropyl+OH].sup.+ calculated: 747.26, found: 747.6. 1H NMR (400 MHz, acetonitrile-d.sub.3) δ 7.56, 7.54 (2s, 1H), 7.36-7.27 (m, 2H), 7.24-7.21 (m, 7H), 6.83-6.80 (m, 4H), 4.12-4.10 (m, 2H), 3.75-3.68 (m, 10H), 3.20-2.80 (m, 2H), 2.68-2.54 (m, 4H), 1.22-1.04 (m, 18H).

    ##STR00144##

    [0742] Compound 6B(+) (200 mg, 0.32 mmol), tetrazole (11 mg, 0.16 mmol), N-methylimidazole (5 mg, 0.06 mmol) and 3A molecular sieve (500 mg) were dissolved in 10 mL of acetonitrile. Compound 7 (144 mg, 0.48 mmol) was added at room temperature. The mixture was stirred at room temperature overnight. After the reaction was complete, the molecular sieve was filtered out, and dichloromethane (30 mL) was added. The mixture was washed with saturated aqueous sodium bicarbonate solution (10 mL) three times and then with saturated brine (20 mL). The filtrate was concentrated by rotary evaporation, purified by reversed-phase preparative HPLC (C.sup.18, conditions: 5-100% (A: water, B: CH.sub.3CN), flow rate: 70 mL/min), and lyophilized to give compound 1-1b (200 mg). MS m/z: C.sub.40H.sub.39N.sub.6O.sub.7P, [M-diisopropyl+OH].sup.+ calculated: 747.26, found: 747.5.

    1.2. Synthesis of Compound 1-2

    [0743] ##STR00145##

    [0744] Compound 1 (2 g, 8.36 mmol) was dissolved in DMF (20 mL). NaH (0.37 g, 9.2 mmol, 60% in mineral oil) was added slowly under argon at room temperature. After 2 h of stirring at room temperature, compound 2 (3.3 g, 16.72 mmol) was added to the reaction mixture. After 12 h of stirring at room temperature, the reaction mixture was concentrated. The residue was recrystallized from ethanol (EtOH, 50 mL) to give the target product 3A (1.3 g, yield: 44.0%) (dichloromethane:ethyl acetate=2:1, Rf=0.2) and the target product 3B (0.6 g, a mixture of compound 1) (dichloromethane:ethyl acetate=2:1, Rf=0.18).

    ##STR00146##

    [0745] Compound 3A (1.3 g, 3.68 mmol) was dissolved in a mixture of trifluoroacetic acid (TFA, 4 mL) and DCM (20 mL), and then the reaction mixture was stirred at room temperature for 12 h and concentrated. The resulting residue was purified using a reversed-phase column (C.sup.18, H.sub.2O+acetonitrile) to give the target product 4 (1 g, yield: 91.44%). MS m/z: C.sub.39H.sub.38N.sub.6O.sub.6, [M+H].sup.+: 687.5.

    ##STR00147##

    [0746] The compound (D-Threonol 5, 1.2 g, 11.4 mmol) was dissolved in pyridine (10 mL), and then a solution of DMTrCl (4.64 g, 13.70 mmol) in pyridine (15 mL) was slowly added. After 16 h of stirring at room temperature, the reaction mixture was quenched with H.sub.2O (10 mL) and concentrated. The reaction mixture was concentrated. The resulting residue was purified using a reversed-phase column (C.sup.18, H.sub.2O+acetonitrile) to give the target product 6 (4.0 g, yield: 86.0%). MS m/z: C.sub.25H.sub.29N.sub.04, [M+Na].sup.+: 430.4.

    ##STR00148##

    [0747] Compound 6 (600 mg, 2.02 mmol), compound 4 (822.5 mg, 2.02 mmol) and dihydroquinoline (EEDQ, 998.2 mg, 4.04 mmol) were dissolved in DCM (10 mL) and methanol (MeOH, 5 mL). After the mixture was stirred at room temperature for 16 h, the solid was filtered out and the filtrate was diluted with DCM (100 mL). The organic phase was washed three times with H.sub.2O (30 mL), dried over anhydrous Na.sub.2SO.sub.4, filtered and concentrated. The resulting residue was purified using a reversed-phase column (C.sup.18, H.sub.2O+acetonitrile) to give the target product 7 (780 mg, yield: 56.3%). MS m/z: C.sub.39H.sub.38N.sub.6O.sub.6, [M+H].sup.+: 687.5.

    ##STR00149##

    [0748] Compound 7 (780 mg, 1.13 mmol), tetrazole (39.8 mg, 0.57 mmol) and N-methylimidazole (18.7 mg, 0.23 mmol) were dissolved in CH.sub.3CN (10 mL). 3A molecular sieve (700 mg) was added. After 5 min of stirring at room temperature under argon, compound 8 (513.5 mg, 1.70 mmol) was added. After 1 h of stirring at room temperature, the molecular sieve was filtered out and the solid was rinsed three times with DCM (30 mL). The filtrate was washed successively with saturated aqueous NaHCO.sub.3 solution (30 mL×4) and H.sub.2O (30 mL×4). The organic phase was concentrated at 30° C. The resulting residue was purified using a reversed-phase column (C.sup.18, H.sub.2O+acetonitrile, acetonitrile 90%) and lyophilized to give the target compound 1-2 (700 mg, yield: 69.5%). MS m/z: C.sub.48H.sub.55N.sub.8O.sub.7P, [M-cyanoethyl-diisopropyl+OH].sup.−: 749.3.

    1.3. Synthesis of Compound 1-3

    [0749] ##STR00150##

    [0750] Compound 1 (2 g, 8.36 mmol) was dissolved in DMF (20 mL). NaH (0.37 g, 9.2 mmol, 60% in mineral oil) was added slowly under argon at room temperature. After 2 h of stirring at room temperature, compound 2 (3.3 g, 16.72 mmol) was added to the reaction mixture. After 12 h of stirring at room temperature, the reaction mixture was concentrated. The residue was recrystallized from EtOH (50 mL) to give the target product 3A (1.3 g, yield: 44.0%) (dichloromethane:ethyl acetate=2:1, Rf=0.2) and the target product 3B (0.6 g, a mixture of compound 1) (dichloromethane:ethyl acetate=2:1, Rf=0.18).

    ##STR00151##

    [0751] Compound 3A (1.3 g, 3.68 mmol) was dissolved in a mixture of TFA (4 mL) and DCM (20 mL), and then the reaction mixture was stirred at room temperature for 12 h and concentrated. The resulting residue was purified using a reversed-phase column (C.sup.18, H.sub.2O+acetonitrile) to give the target product 4 (1 g, yield: 91.44%). MS m/z: C.sub.39H.sub.38N.sub.6O.sub.6, [M+H].sup.+: 687.5.

    ##STR00152##

    [0752] The compound L-Threoninol 5 (1.2 g, 11.4 mmol) was dissolved in pyridine (10 mL), and then a solution of DMTrCl (4.64 g, 13.70 mmol) in pyridine (15 mL) was slowly added. After 16 h of stirring at room temperature, the reaction mixture was quenched with H.sub.2O (10 mL) and concentrated. The reaction mixture was concentrated. The resulting residue was purified using a reversed-phase column (C.sup.18, H.sub.2O+acetonitrile) to give the target product 6 (4.0 g, yield: 86.0%). MS m/z: C.sub.25H.sub.29NO.sub.4, [M+Na].sup.+: 430.4.

    ##STR00153##

    [0753] Compound 6 (600 mg, 2.02 mmol), compound 4 (822.5 mg, 2.02 mmol), tetramethyluronium hexafluorophosphate (HATU, 1.15 g, 3.03 mmol) and diisopropylethylamine (DIEA, 1 mL, 6.05 mmol) were dissolved in DMF (10 mL). After 16 h of stirring at room temperature, the reaction mixture was filtered and the filtrate was diluted with DCM (100 mL). The organic phase was washed three times with H.sub.2O (30 mL), dried over anhydrous Na.sub.2SO.sub.4, filtered and concentrated. The resulting residue was purified using a reversed-phase column (C.sup.18, H.sub.2O+acetonitrile, acetonitrile 60%) and lyophilized to give the target compound 7 (1.0 g, yield: 72.1%). MS m/z: C.sub.39H.sub.38N.sub.6O.sub.6, [M+H].sup.+: 687.5.

    ##STR00154##

    [0754] Compound 7 (1.2 g, 1.75 mmol), tetrazole (61.2 mg, 0.87 mmol) and N-methylimidazole (28.7 mg, 0.35 mmol) were dissolved in CH.sub.3CN (10 mL). 3A molecular sieve (700 mg) was added. After 5 min of stirring at room temperature under argon, compound 8 (0.79 g, 2.62 mmol) was added. After 1 h of stirring at room temperature, the molecular sieve was filtered out and the solid was rinsed three times with DCM (30 mL). The filtrate was washed successively with saturated aqueous NaHCO.sub.3 solution (30 mL×4) and H.sub.2O (30 mL×4). The organic phase was concentrated at 30° C. The resulting residue was purified using a reversed-phase column (C.sup.18, H.sub.2O+acetonitrile, acetonitrile 90%) and lyophilized to give the target compound 1-3 (1.2 g, yield: 77.4%). MS m/z: C.sub.48H.sub.55N.sub.8O.sub.7P, [M-cyanoethyl-diisopropyl+OH].sup.−: 749.3.

    1.4. Synthesis of Compound 1-4a and Compound 1-4b

    [0755] ##STR00155##

    [0756] Compound 1A (6.73 g, 28.14 mmol) was dissolved in dry DMF (80 mL). NaH (60%, 1.24 g, 30.95 mmol) was added slowly under argon. After the mixture was stirred at room temperature for 30 min, the reaction mixture was added to a solution of tetrakis(triphenylphosphine)palladium(0) (Pd(PPh.sub.3).sub.4, 1.95 g, 1.69 mmol), triphenylphosphine (PPh.sub.3, 0.74 g, 2.81 mmol) and compound 1 (4.0 g, 28.14 mmol) in tetrahydrofuran (THF, 60 mL). After the reaction mixture was stirred at 55° C. for 16 h, the solid was filtered out and washed three times with DCM (60 mL). The filtrate was concentrated. The resulting residue was purified using a normal phase column (elution first with ethyl acetate and then with ethyl acetate:methanol (12:1)) to give the target product 2 (7 g, crude).

    ##STR00156##

    [0757] Compound 2 (8 g, crude) and DMTrCl (12.65 g, 37.34 mmol) were dissolved in pyridine (10 mL). The mixture was stirred at room temperature for 16 h, then quenched with water (80 mL) and concentrated. The resulting residue was purified using a reversed-phase column (C.sup.18, water+acetonitrile) and lyophilized to give the target compound 3 (13 g, yield: 83.7%).

    ##STR00157##

    [0758] Compound 3 (5 g, 8.02 mmol) was dissolved in methanol (MeOH, 20 mL) and ammonia water (6 mL). After the mixture was stirred at room temperature for 16 h, the reaction mixture was concentrated. The resulting residue was purified using a normal phase column (DCM:MeOH=20:1) to give the target compound 4 (4 g, yield: 96.0%).

    ##STR00158##

    [0759] A solution of borane (BH.sub.3) in tetrahydrofuran (1.0 M in THF, 38.54 mL, 38.54 mmol) was added dropwise to a solution of compound 4 (4.00 g, 7.71 mmol) in THF (12 mL) at 0° C. under argon. After the compound was stirred at 0° C. under argon for 6 h, H.sub.2O (27 mL) was added dropwise. Then, after 3 M aqueous NaOH solution (52 mL, 156 mmol) was added dropwise to the reaction mixture at 0° C., 30% aqueous H.sub.2O.sub.2 (106 mL) was added dropwise to the reaction mixture, and EtOH (10 mL) was added. After the reaction mixture was stirred at room temperature for 48 h, saturated Na.sub.2S.sub.2O.sub.3 was added slowly at 0° C. until no bubbles were formed. H.sub.2O (300 mL) was added to the reaction mixture, and the mixture was extracted with DCM (4×200 mL). The organic phase was dried over anhydrous Na.sub.2SO.sub.4, filtered and concentrated. The resulting residue was purified using a reversed-phase column (C.sup.18, acetonitrile+H.sub.2O, 50%) and lyophilized to give the target product 5a (730 mg, yield: 17.6%) and the target product 5b (1.1 g, 26.6%).

    ##STR00159##

    [0760] Compound 5a (730 mg, 1.36 mmol) was dissolved in pyridine (8 mL). TMSCl (0.67 g, 6.14 mmol) was added under argon at room temperature. After 1 h of stirring at room temperature, BzCl (0.29 mL, 2.46 mmol) was added to the reaction mixture. After 16 h of stirring at room temperature, the reaction mixture was quenched with H.sub.2O (10 mL) and concentrated. The resulting residue was dissolved in THF (30 mL). Tetrabutylammonium fluoride (TBAF, 1 mL) was added. After 1 h of stirring at room temperature, ammonia water (0.5 mL) was added. The mixture was stirred at room temperature for 5 h. The reaction mixture was diluted with ethanol (EA, 100 mL) and washed five times with saturated brine (30 mL). The organic phase was concentrated. The resulting residue was purified using a reversed-phase column (C.sup.18, H.sub.2O+acetonitrile, acetonitrile 60%) and lyophilized to give the target product 6a (480 mg, yield: 74.8%). MS m/z: C.sub.38H.sub.35N.sub.5O.sub.5, [M+H].sup.+: 642.6.

    ##STR00160##

    [0761] Compound 5b (1.1 g, 2.05 mmol) was dissolved in pyridine (20 mL). TMSCl (1.34 g, 1.28 mmol) was added under argon at room temperature. After 1 h of stirring at room temperature, benzoyl chloride (BzCl, 0.59 mL, 5.92 mmol) was added to the reaction mixture. After 16 h of stirring at room temperature, the reaction mixture was quenched with H.sub.2O (10 mL) and concentrated. The resulting residue was dissolved in THF (30 mL). TBAF (2 mL) was added. After 1 h of stirring at room temperature, ammonia water (0.5 mL) was added. The mixture was stirred at room temperature for 5 h. The reaction mixture was diluted with EA (100 mL) and washed five times with saturated brine (30 mL). The organic phase was concentrated. The resulting residue was purified using a reversed-phase column (C.sup.18, H.sub.2O+acetonitrile, acetonitrile 60%) and lyophilized to give the target product 6b (1.4 g, yield: 82.1%). MS m/z: C.sub.38H.sub.35N.sub.5O.sub.5, [M+H].sup.+: 642.5.

    ##STR00161##

    [0762] Compound 6a (700 mg, 1.04 mmol), tetrazole (26.2 mg, 0.37 mmol) and N-methylimidazole were dissolved in CH.sub.3CN (10 mL). 3A molecular sieve (500 mg) was added. After 5 min of stirring at room temperature under argon, compound 7 (470.4 mg, 1.56 mmol) was added. After 1 h of stirring at room temperature, the molecular sieve was filtered out and the solid was rinsed three times with DCM (50 mL). The filtrate was washed successively with saturated aqueous NaHCO.sub.3 solution (50 mL×4) and H.sub.2O (50 mL×4). The organic phase was concentrated at 30° C. The resulting residue was purified using a reversed-phase column (C.sup.18, H.sub.2O+acetonitrile, acetonitrile 90%) and lyophilized to give the target compound 1-4A (600 mg, yield: 66.1%). MS m/z: C.sub.47H.sub.52N.sub.7O.sub.6P, [M-cyanoethyl-diisopropyl+OH].sup.−: 704.3.

    ##STR00162##

    [0763] Compound 6b (1.3 g, 2.03 mmol), tetrazole (71.0 mg, 1.01 mmol) and N-methylimidazole (33.3 mg, 0.41 mmol) were dissolved in CH.sub.3CN (20 mL). 3A molecular sieve (700 mg) was added. After 5 min of stirring at room temperature under argon, compound 7 (0.92 g, 3.04 mmol) was added. After 1 h of stirring at room temperature, the molecular sieve was filtered out and the solid was rinsed three times with DCM (50 mL). The filtrate was washed successively with saturated aqueous NaHCO.sub.3 solution (50 mL×4) and H.sub.2O (50 mL×4). The organic phase was concentrated at 30° C. The resulting residue was purified using a reversed-phase column (C.sup.18, H.sub.2O+acetonitrile, acetonitrile 90%) and lyophilized to give the target compound 1-4b (1.4 g, yield: 82.1%). MS m/z: C.sub.47H.sub.52N.sub.7O.sub.6P, [M-cyanoethyl-diisopropyl].sup.−: 704.3.

    1.5. Synthesis of Compound 1-5

    [0764] ##STR00163##

    [0765] Compound 1A (6.73 g, 28.14 mmol) was dissolved in dry DMF (80 mL). NaH (60%, 1.24 g, 30.95 mmol) was added slowly under argon. After the mixture was stirred at room temperature for 30 min, the reaction mixture was added to a solution of Pd(PPh.sub.3).sub.4 (1.95 g, 1.69 mmol), PPh.sub.3 (0.74 g, 2.81 mmol) and compound 1 (4.0 g, 28.14 mmol) in THF (60 mL). After the reaction mixture was stirred at 55° C. for 16 h, the solid was filtered out and washed three times with DCM (60 mL). The filtrate was concentrated. The resulting residue was purified using a normal phase column (elution first with ethyl acetate and then with ethyl acetate:methanol (12:1)) to give the target solid 2 (7 g, crude).

    ##STR00164##

    [0766] Compound 2 (8 g, crude) and DMTrCl (12.65 g, 37.34 mmol) were dissolved in pyridine (10 mL). The mixture was stirred at room temperature for 16 h, then quenched with water (80 mL) and concentrated. The resulting residue was purified using a reversed-phase column (C.sup.18, water+acetonitrile) and lyophilized to give the target compound 3 (13 g, yield: 83.7%).

    ##STR00165##

    [0767] Compound 3 (1 g, 1.60 mmol), KHCO.sub.3 (0.48 g, 4.81 mmol) and ethylene glycol (0.40 g, 6.41 mmol) were dissolved in acetone (50 mL). KMnO.sub.4 (40% in water, 0.67 g, 1.68 mmol) was slowly added at −30° C. After 1 h of stirring at −30° C., the reaction mixture was quenched with saturated aqueous sodium thiosulfate solution (30 mL). The mixture was extracted four times with DCM (30 mL). The organic phase was dried over anhydrous Na.sub.2SO.sub.4, filtered and concentrated. The residue was purified using a reversed-phase column (C.sup.18, H.sub.2O+acetonitrile, acetonitrile 60%) and lyophilized to give the target product 4 (600 mg, yield: 56.9%). MS m/z: C.sub.38H.sub.35N.sub.5O.sub.6, [M+H].sup.+: 658.5.

    ##STR00166##

    [0768] To a 250 mL round-bottom flask were added reactant 4 (5.0 g, 7.601 mmol), NaIO.sub.4 and 1,4-dioxane/water (50 mL/5 mL). The mixture was reacted at room temperature for 2 h and then concentrated under reduced pressure to remove the solvent to give a white solid (6.0 g). Then the solid was dissolved in methanol (50 mL), and sodium borohydride (1.62 g, 38 mmol) was added. After the mixture was stirred at room temperature for 2 h, 10% ammonium chloride solution (10 mL) was added. After removal of the solvent under reduced pressure, the residue was purified by C18 column chromatography (water/acetonitrile: 5%-95%) to give product P1 as a colorless oil 5 (2.0 g, 3.0315 mmol, 39%), LCMS, MS+, [M+H].sup.+: 660.

    ##STR00167##

    [0769] Compound 5 (1.7 g, 2.58 mmol) and DBU (0.77 mL, 5.15 mmol) were dissolved in DCM (20 mL). BzCl (0.5 M in DCM, 0.8 mL) was added dropwise to the reaction at −70° C. under argon. The reaction mixture was let stand at −70° C. for 1 h and quenched with ethanol (5 mL). The quenched reaction mixture was diluted with DCM (100 mL) and washed three times with water (30 mL). The organic phase was dried over anhydrous Na.sub.2SO.sub.4, filtered and concentrated. The resulting residue was purified using a normal phase column (DCM:EA=1:1) to give 6 as a white solid (80 mg, yield: 4.14%). MS m/z: C.sub.45H.sub.41N.sub.5O.sub.7, [M+H].sup.+: 764.5.

    ##STR00168##

    [0770] Compound 4 (380 mg, 0.50 mmol), tetrazole (17.43 mg, 0.25 mmol) and N-methylimidazole (8.17 mg, 0.10 mmol) were dissolved in CH.sub.3CN (10 mL). 3A molecular sieve (500 mg) was added. After 5 min of stirring at room temperature under argon, compound 7 (224.95 mg, 0.75 mmol) was added. After 1 h of stirring at room temperature, the molecular sieve was filtered out and the solid was rinsed three times with DCM (50 mL). The filtrate was washed successively with saturated aqueous NaHCO.sub.3 solution (50 mL×4) and H.sub.2O (50 mL×4). The organic phase was concentrated at 30° C. The resulting residue was purified using a reversed-phase column (C.sup.18, H.sub.2O+acetonitrile, acetonitrile 90%) and lyophilized to give the target product 1-5 (330 mg, yield: 68.8%). MS m/z: C.sub.54H.sub.58N.sub.7O.sub.8P, [M-cyanoethyl-diisopropyl].sup.−: 826.3.

    1.6. Synthesis of Compound 1-6a

    [0771] ##STR00169##

    [0772] Compound 1 (10 g, 68.404 mmol), compound 2 (15 g, 62.186 mmol) and triphenylphosphine (32.62 g, 124.371 mmol) were dissolved in dry THF (30 mL). DIAD (24.656 mL, 124.371 mmol) was slowly added dropwise at 0° C. The reaction mixture was reacted at 25° C. for 12 h, and LCMS showed the reaction had been complete. The reaction mixture was extracted with ethyl acetate (200 mL) and water (200 mL). The organic phase was dried. The filtrate was concentrated. The resulting residue was purified using a normal phase column (DCM/MeOH=10/1) to give the target product 3 (20 g).

    ##STR00170##

    [0773] Compound 3 (20 g, 28.585 mmol) was dissolved in acetic acid (24 mL, 426.016 mmol) and H.sub.2O (12 mL). The mixture was stirred at 60° C. for 1 h. Then the reaction mixture was concentrated to dryness by rotary evaporation. THF (12 mL) and H.sub.2O (12 mL) were added. The mixture was stirred at 80° C. for 7 h. LCMS showed the reaction had been complete. The reaction mixture was extracted with ethyl acetate (200 mL) and water (100 mL). Solid sodium carbonate was added to the aqueous phase until a large amount of solid precipitated out of the aqueous phase. The solid was collected by filtration and washed with water. The filter cake was dried with an oil pump to give the target compound 5 (9 g).

    ##STR00171##

    [0774] Compound 5 (6.8 g, 18.581 mmol) was dissolved in pyridine (80 mL) under nitrogen. TMSCl (14.250 mL, 111.489 mmol) was slowly added at 0° C. The mixture was stirred for 2 h. Isobutyryl chloride (2.044 mL, 19.511 mmol) was then added at 0° C. The mixture was stirred at 25° C. for 1 h, and LCMS showed the reaction had been complete. The mixture was extracted with dichloromethane (200 mL) and water (200 mL). After the organic phase was dried and concentrated to dryness by rotary evaporation, a sample to be purified was prepared. The sample was purified using a normal phase column (elution with DCM:MeOH=10:1, peak at 4.8%) to give compound 6 as a yellow oil (12 g).

    ##STR00172##

    [0775] Compound 6 (5.5 g, 12.392 mmol) was dissolved in pyridine (30 mL) under nitrogen. MOLECULAR SIEVE 4A 1/16 (7 g, 12.392 mmol) was added, and then solid DMTrCl (5.04 g, 14.870 mmol) was added in batches at 0° C. The mixture was reacted at 25° C. for 2 h, and TLC (PE:EtOAc=1:1, Rf=0.69) showed the reaction had been complete. The reaction mixture and TJN200879-040-P1 were combined and treated together. The reaction mixture was extracted with ethyl acetate (200 mL) and water (200 mL). After the organic phase was dried and concentrated to dryness by rotary evaporation, a sample to be purified was prepared. The sample was purified using a normal phase column (elution with PE:EtOAc, peak at 84%) to give compound 7 as a yellow oil (12 g).

    ##STR00173##

    [0776] Compound 7 (12 g, 15.389 mmol) was dissolved in EtOAc (140 mL). Wet palladium on carbon Pd/C (7 g, 15.389 mmol) was added. The reaction mixture was reacted at 25° C. under hydrogen (15 Psi) for 2 h. TLC (PE:EtOAc=0:1, Rf=0.09) showed the reaction had been complete. The reaction mixture was filtered. After the filter cake was rinsed three times with ethyl acetate (30 mL), the filtrate was collected. After the filtrate was concentrated to dryness by rotary evaporation, 50 mL of dichloromethane and 2 mL of triethylamine were added to prepare a sample to be purified. The sample was purified using a normal phase column (elution with DCM:MeOH=10:1, peak at 0.5%) to give 9 g (yellow foamy solid). The resulting racemic compound was resolved by SFC into the target compound 7A(−) (3.9 g) and the target compound 7B(+) (3.8 g).

    ##STR00174##

    [0777] Compound 7A(−) (3.30 g, 5.40 mmol), tetrazole (190 mg, 2.70 mmol), 1-methylimidazole (90 mg, 1.10 mmol) and 3A molecular sieve (500 mg) were dissolved in 30 mL of acetonitrile. Compound 8 (2.50 g, 8.10 mmol) was added at room temperature. The mixture was stirred at room temperature for 2 h. After the reaction was complete, the molecular sieve was filtered out, and DCM (150 mL) was added. The mixture was washed with saturated aqueous sodium bicarbonate solution (30 mL×3) and then with saturated brine (30 mL). The filtrate was concentrated by rotary evaporation, purified by reversed-phase preparative HPLC (C.sup.18, conditions: 5-100% (A: water, B: CH.sub.3CN), flow rate: 70 mL/min), and lyophilized to give compound 1-6a (2.9 g, 66%). MS m/z: C.sub.43H.sub.55N.sub.7O.sub.7P [M+H].sup.+, calculated: 812.38, found: 812.5. 1H NMR (400 MHz, acetonitrile-d.sub.3) δ 7.56, 7.54 (2s, 1H), 7.36-7.27 (m, 2H), 7.24-7.21 (m, 7H), 6.83-6.80 (m, 4H), 4.12-4.10 (m, 2H), 3.75-3.68 (m, 10H), 3.20-2.80 (m, 2H), 2.68-2.54 (m, 4H), 1.22-1.04 (m, 18H).

    1.7. Synthesis of Compound 1-7a

    [0778] ##STR00175##

    [0779] Compound 1 (5 g, 23.1272 mmol), compound 2 (6.76 g, 46.254 mmol) and triphenylphosphine (7.28 g, 27.753 mmol) were dissolved in 30 mL of dioxane under nitrogen. DEAD (5.502 mL, 27.753 mmol) was slowly added dropwise at 0° C. After the dropwise addition was complete, the reaction mixture was slowly warmed to 25° C. and reacted for another hour. The reaction mixture was extracted with 100 mL of H.sub.2O and 100 mL of EtOAc. After the organic phases were combined, dried, filtered and concentrated, a sample to be purified was prepared. The sample was purified using a normal phase column (elution with PE:EtOAc=1:1) to give the target product (4 g).

    ##STR00176##

    [0780] Compound 3 (3.3 g) was dissolved in HOAc (16 mL) and H.sub.2O (4 mL). The reaction mixture was heated in an oil bath at 60° C. for 0.5 h and concentrated to dryness by rotary evaporation. The resulting residue was purified using a normal phase column (elution with PE:EtOAc=0:1) to give the target product 4 (3 g).

    ##STR00177##

    [0781] Compound 4 (3 g, 8.873 mmol) was dissolved in 5 mL of pyridine. A solution of DMTrCl (3.91 g, 11.535 mmol) in 10 mL of pyridine was slowly added dropwise at 0° C. under nitrogen. After the dropwise addition was complete, the reaction mixture was warmed to 25° C. and reacted for another hour. The reaction mixture was extracted with 50 mL of water and 100 mL of ethyl acetate. The aqueous phase was extracted three more times with 100 mL of ethyl acetate. The organic phases were combined, dried, filtered, concentrated, and purified using a normal phase column (with PE:EtOAc=2:1) to give the target product 5 (4 g).

    ##STR00178##

    [0782] Compound 5 (4 g, 5.769 mmol) was dissolved in methanol (10 mL). A saturated solution of NH3 in methanol (40 mL) was added. The mixture was reacted at 0° C. for 6 h. The reaction mixture was concentrated to dryness by rotary evaporation and purified using a normal phase column (PE:EtOAc=0:1) to give a racemic compound (2.4 g). The compound was resolved by SFC into the target product 6A (750 mg, 100% purity) and the target product 6B (400 mg, 99.16% purity).

    ##STR00179##

    [0783] Compound 6A(−) (700 mg, 1.40 mmol), tetrazole (50 mg, 0.70 mmol), 1-methylimidazole (23 mg, 0.28 mmol) and 3A molecular sieve (500 mg) were dissolved in 10 mL of acetonitrile. Compound 7 (630 mg, 2.10 mmol) was added at room temperature. The mixture was stirred at room temperature for 2 h. After the reaction was complete, the molecular sieve was filtered out, and DCM (50 mL) was added. The mixture was washed with saturated aqueous sodium bicarbonate solution (10 mL×3) and then with saturated brine (20 mL). The filtrate was concentrated by rotary evaporation, purified by reversed-phase preparative HPLC (C.sup.18, conditions: 5-100% (A: water, B: CH3CN), flow rate: 70 mL/min), and lyophilized to give compound 1-7a (700 mg, 72%). MS m/z: C38H47N4O7PNa [M+Na]+, calculated: 725.32, found: 725.5.

    1.8. Synthesis of Compound 1-8a

    [0784] ##STR00180##

    [0785] Compound 1 (8.5 g, 76.508 mmol) and compound 2 (30.64 g, 91.809 mmol) were dissolved in DMF (150 mL). CS2CO3 (29.91 g, 91.809 mmol) was added. The reaction mixture was reacted under nitrogen at 90° C. for 12 h. LCMS detection showed the reaction had been complete. The reaction mixture was filtered, concentrated to dryness by rotary evaporation using an oil pump, and separated and purified using a normal phase column (80 g, DCM/MeOH=10/1 to 5/1) to give the target product 3 (13.5 g, 80% purity).

    ##STR00181##

    [0786] Compound 3 (10.5 g, 35.105 mmol) was dissolved in pyridine (65 mL) and CH.sub.3CN (65 mL). BzCl (4.894 mL, 42.126 mmol) was added dropwise to the solution. The mixture was reacted at 25° C. for 2 h. LCMS detection showed starting materials were mostly reacted. The mixture was quenched with H.sub.2O (100 mL) and extracted with EtOAc (100 mL×3). The extract was dried, concentrated to dryness by rotary evaporation, and separated (combined with TJN200872-101) and purified by column chromatography (80 g, PE/EtOAc=10/1 to 0/1, DCM/MeOH=10/1) to give the target product 4 (14 g, 90% purity).

    ##STR00182##

    [0787] Compound 4 (14 g, 36.694 mmol) was dissolved in HOAc (56 mL, 314.796 mmol) and H.sub.2O (14 mL). The mixture was reacted at 60° C. for 2 h, and LCMS showed the reaction had been complete. The mixture was concentrated using an oil pump and separated using a normal phase column (40 g, DCM/MeOH=I/O to 5/1) to give the target product 5 (8.4 g, 90% purity & 2.4 g, 80% purity).

    ##STR00183##

    [0788] Compound 5 (7.4 g, 21.957 mmol), DMAP (0.54 g, 4.391 mmol) and MOLECULAR SIEVE 4A (11.1 g, 2.967 mmol) were dissolved in pyridine (60 mL). The mixture was stirred under ice bath conditions for 10 min, and then DMTrCl (8.93 g, 26.348 mmol) was added. The reaction mixture was stirred for 1.8 h, and LCMS detection showed about 19% of the starting material remained and about 60% was target MS. The mixture was combined with TJN200872-105&106 and purified together. H.sub.2O (50 mL) was added to the reaction mixture. The mixture was extracted with DCM (50 mL×3), dried, concentrated to dryness by rotary evaporation, and separated by column chromatography (120 g, PE/(EA:DCM:TEA=1:1:0.05)=1/0 to 0/1 to DCM/MeOH=10/1) to give compound 6 as a yellow solid (11 g, 89% purity, TJN200872-105&106&107). The starting material was recovered (3.0 g, 70% purity).

    ##STR00184##

    [0789] Compound 6 (15 g, 22.041 mmol) was resolved by SFC (DAICEL CHIRALPAK AD (250 mm×50 mm, 10 μm); 0.1% NH3H.sub.2O EtOH, B: 45% to 45%; 200 mL/min) into the target product 6A (5.33 g, 94.29% purity) and the target product 6B (6.14 g, 97.91% purity). 1.0 g of compound 6 was recovered.

    ##STR00185##

    [0790] Compound 6B(−) (5.4 g, 8.92 mmol), tetrazole (312 mg, 4.46 mmol), 1-methylimidazole (146 mg, 1.78 mmol) and 3A molecular sieve (500 mg) were dissolved in 40 mL of acetonitrile. Compound 7 (4 g, 13.4 mmol) was added at room temperature. The mixture was stirred at room temperature for 2 h. After the reaction was complete, the molecular sieve was filtered out, and DCM (200 mL) was added. The mixture was washed with saturated aqueous sodium bicarbonate solution (30 mL×3) and then with saturated brine (50 mL). The filtrate was concentrated by rotary evaporation, purified by reversed-phase preparative HPLC (C.sup.18, conditions: 5-100% (A: water, B: CH3CN), flow rate: 70 mL/min), and lyophilized to give compound 1-8a (5.8 g, 80%). MS m/z: C45H51N5O7P, [M+H].sup.+, calculated: 804.36, found: 804.4.

    Example 2. Synthesis of siRNA

    [0791] The siRNA synthesis was the same as the conventional phosphoramidite solid-phase synthesis. In synthesizing the modified nucleotide in 5′ position 7 of the AS strand, the original nucleotide of the parent sequence was replaced with the phosphoramidite monomer synthesized above.

    [0792] The synthesis process is briefly described below: Nucleoside phosphoramidite monomers were linked one by one according to the synthesis program on a Dr. Oligo48 synthesizer (Biolytic), starting at a Universal CPG support. Other than the phosphoramidite monomer in 5′ position 7 of the AS strand described above, the other nucleoside monomer materials 2′-F RNA, 2′-O-methyl RNA, and other nucleoside phosphoramidite monomers were purchased from Hongene, Shanghai or Genepharma, Suzhou. 5-Ethylthio-1H-tetrazole (ETT) was used as an activator (a 0.6 M solution in acetonitrile), a 0.22 M solution of PADS in acetonitrile and collidine (1:1 by volume) (Kroma, Suzhou) as a sulfurizing agent, and iodopyridine/water solution (Kroma) as an oxidant.

    [0793] After completion of solid phase synthesis, oligoribonucleotides were cleaved from the solid support and soaked in a solution of 28% ammonia water and ethanol (3:1) at 50° C. for 16 h. The mixture was centrifuged, and the supernatant was transferred to another centrifuge tube. After the supernatant was concentrated to dryness by evaporation, the residue was purified by C.sub.18 reversed-phase chromatography using 0.1 M TEAA and acetonitrile as the mobile phase, and DMTr was removed using 3% trifluoroacetic acid solution. The target oligonucleotides were collected, then lyophilized, identified as the target products by LC-MS, and quantified by UV (260 nm).

    [0794] The resulting single-stranded oligonucleotides were paired in an equimolar ratio in a complementary manner and annealed. The final double-stranded siRNA was dissolved in 1×PBS, and the solution was adjusted to the concentration required for the experiment so it was ready to be used.

    Example 3. psiCHECK Activity Screening

    [0795] 3.1. Experimental Materials and Instruments

    [0796] The synthesis of siRNA samples is as described before. The plasmids were obtained from Sangon Biotech (Shanghai) Co., Ltd. The consumables, reagents and instruments for the psiCHECK assay are shown in Table 1 and Table 2.

    TABLE-US-00001 TABLE 1 Consumables and reagents for the psiCHECK assay Reagent consumables Catalog Name Company number/model Batch No. Shelf life Huh 7 cells Cobioer, ATCC- / / Nanjing Cobioer/CBP60202 Dual-Glo ® Luciferase Promega E2940 0000363099 2020/5/13 Assay System Lipofectamine ® 2000 Invitrogen 11668-019 / 2021/6/14

    TABLE-US-00002 TABLE 2 Instruments for the psiCHECK assay Instruments Name Company Catalog number/model Nanodrop Thermo Nanodrop One Microplate reader PerkinElmer En Vision2105 Graphing software / Graph Prism 5

    [0797] 3.2. Procedure of psiCHECK Activity Screening

    [0798] Cell plating and cell transfection were carried out. The specific amounts for preparing the transfection complex are shown in Table 3.

    TABLE-US-00003 TABLE 3 Amounts required for transfection complex in each well of a 96-well plate Amount/well Opti-MEM Plasmid Mix 0.05 μL 10 μL Lipofectamine 2000  0.2 μL 10 μL

    [0799] Note: Lipo: 0.2 μL/well; Plasmid: 0.05 μL/well; Opti-MEM: 10 μL/well.

    [0800] Dilutions with different concentrations were prepared as working solutions for later use to meet different experimental requirements according to Table 4.

    TABLE-US-00004 TABLE 4 Multi-concentration-point dilution protocol for siRNAs Final concentration (nM) Added water and siRNA / / 40 4 μL siRNA (20 μM) + 96 μL H2O 13.33333333 30 μL siRNA + 60 μL H2O 4.444444444 30 μL siRNA + 60 μL H2O 1.481481481 30 μL siRNA + 60 μL H2O 0.49382716 30 μL siRNA + 60 μL H2O 0.164609053 30 μL siRNA + 60 μL H2O 0.054869684 30 μL siRNA + 60 μL H2O 0.018289895 30 μL siRNA + 60 μL H2O 0.006096632 30 μL siRNA + 60 μL H2O 0.002032211 30 μL siRNA + 60 μL H2O 0.000677404 30 μL siRNA + 60 μL H2O

    [0801] 24 h after transfection, assays were carried out according to the instructions of the Dual-Glo® Luciferase Assay System kit. The Dual-Glo® Luciferase Assay System assays were carried out using the dual luciferase reporter gene assay kit (Promega, cat.E2940), and the Firefly chemiluminescence values and Renilla chemiluminescence values were read. The relative values were calculated as Ren/Fir, and the inhibition (%) was calculated as 1−(Ratio+siRNA/Ratioreporter only)×100%.

    [0802] In the present disclosure, the proportion of remaining expression of mRNA=100%−inhibition (%).

    Example 4. On-Target and Off-Target Activity Experiments of siRNAs Comprising Different Chemical Modifications

    [0803] The following siRNAs were synthesized using the compounds of Example 1 and the method of Example 2, and the on-target activity and off-target activity of each siRNA were verified using the method of Example 3. The siRNAs had identical sense strands and comprised the following modified nucleotides/chemical modifications, respectively, in position 7 of the 5′ end of the antisense strand:

    ##STR00186## ##STR00187## ##STR00188##

    [0804] wherein the nucleotide synthesized using 2-hydroxymethyl-1,3-propanediol as the starting material was defined as hmpNA; [0805] TJ-NA019(A) was obtained by solid-phase synthesis using the nucleoside phosphoramidite monomer 1-2 of example section 1.1; [0806] TJ-NA020(A) was obtained by solid-phase synthesis using the nucleoside phosphoramidite monomer 1-3 of example section 1.1; [0807] TJ-NA026(A) was obtained by solid-phase synthesis using the nucleoside phosphoramidite monomer 1-4a of example section 1.1; [0808] TJ-NA027(A) was obtained by solid-phase synthesis using the nucleoside phosphoramidite monomer 1-4b of example section 1.1; [0809] TJ-NA038(A) was obtained by solid-phase synthesis using the nucleoside phosphoramidite monomer 1-5 of example section 1.1; [0810] (+)hmpNA(A) was obtained by solid-phase synthesis using the nucleoside phosphoramidite monomer 1-1b of example section 1.1, and its absolute configuration was (S)-hmpNA(A); [0811] (−)hmpNA(A) was obtained by solid-phase synthesis using the nucleoside phosphoramidite monomer 1-1a of example section 1.1, and its absolute configuration was (R)-hmpNA(A).

    [0812] Similarly, the following structures were obtained by solid-phase synthesis and by changing the base species of hmpNA, and their absolute configurations were determined: [0813] (+)hmpNA(G), with the absolute configuration (S)-hmpNA(G); [0814] (−)hmpNA(G), with the absolute configuration (R)-hmpNA(G), obtained by solid-phase synthesis using the nucleoside phosphoramidite monomer 1-6a of example section 1.6; [0815] (+)hmpNA(C), with the absolute configuration (S)-hmpNA(C); [0816] (−)hmpNA(C), with the absolute configuration (R)-hmpNA(C), obtained by solid-phase synthesis using the nucleoside phosphoramidite monomer 1-8a of example section 1.8; [0817] (+)hmpNA(U), with the absolute configuration (R)-hmpNA(U); and [0818] (−)hmpNA(U), with the absolute configuration (S)-hmpNA(U), obtained by solid-phase synthesis using the nucleoside phosphoramidite monomer 1-7a of example section 1.7.

    [0819] The absolute configurations (S)-hmpNA(G), (R)-hmpNA(G), (S)-hmpNA(C), (R)-hmpNA(C), (S)-hmpNA(U) and (R)-hmpNA(U) are determined from their intermediate or derivative by X-Ray diffraction.

    [0820] The structure of the intermediate or derivative is:

    ##STR00189##

    [0821] TJ-NA067: determined as a colorless massive crystal (0.30×0.10×0.04 mm3), belonging to the monoclinic crystal system with a P21 space group. Lattice parameter a=16.0496(5) Å, b=4.86260(10) Å, c=16.4686(5) Å, α=90°, β=118.015(4°), γ=90°, V=1134.65(7) A3, Z=4. Calculated density Dc=1.389 g/cm3; the number of electrons in a unit cell F(000)=504.0; linear absorption coefficient of a unit cell μ (Cu Kα)=0.840 mm-1; diffraction experiment temperature T=150.00(11) K.

    ##STR00190##

    [0822] 6A(+): determined as a colorless massive crystal (0.30×0.20×0.10 mm3), belonging to the monoclinic crystal system with a P21 space group. Lattice parameter a=22.6688(7) A, b=8.5595(2) A, c=23.3578(5) Å, α=90°, β=113.876(3)°, γ=90°, V=4144.3(2) A3, Z=2. Calculated density Dc=0.999 g/cm3; the number of electrons in a unit cell F(000)=1318.0; linear absorption coefficient of a unit cell μ (Cu Kα)=0.570 mm-1; diffraction experiment temperature T=100.01(18) K.

    ##STR00191##

    [0823] TJ-NA048: determined as a colorless acicular crystal (0.30×0.04×0.04 mm3), belonging to the monoclinic crystal system with a P1 space group. Lattice parameter a=7.6165(4) Å, b=11.3423(5) Å, c=17.3991(8) Å, α=85.007(4°), β=88.052(4°), γ=70.532(4°), V=1411.75(12) A3, Z=2. Calculated density Dc=1.366 g/cm3; the number of electrons in a unit cell F(000)=620.0; linear absorption coefficient of a unit cell μ (Cu Kα)=0.856 mm-1; diffraction experiment temperature T=150.00(13) K.

    ##STR00192##

    [0824] TJ-NA092: determined as a colorless prismatic crystal (0.30×0.10×0.10 mm3), belonging to the triclinic crystal system with a P1 space group. Lattice parameter a=5.17960(10) Å, b=8.0667(2) Å, c=12.4077(2) Å, α=93.146(2°), β=101.266(2°), γ=96.134(2°), V=503.993(18) Å3, Z=2. Calculated density Dc=1.412 g/cm3; the number of electrons in a unit cell F(000)=228.0; linear absorption coefficient of a unit cell μ (Cu Kα)=0.945 mm-1; diffraction experiment temperature T=100.00(10) K.

    TABLE-US-00005 TABLE 5 HBV-S-targeting siRNA sequences and modifications SEQ ID NO SS strand 5′-3′ SEQ ID NO: 1 UmsGmsAmCmAfAmGfAfAfUmCmCmUmCmAmCmAmAmUm Double AS strand 5′-3′ strand code TRD4389 SEQ ID NO: 2 AmsUfsUmGmUmGfAmGmGmAmUmUmCmUfUmGfUmCmAmsA parent msCm sequence TRD5252 SEQ ID NO: 3 AmsUfsUmGmUmGfGNA(A)GmGmAmUmUmCmUfUmGfUmCmA msAmsCm TRD5812 SEQ ID NO: 4 AmsUfsUmGmUmGfAbasicGmGmAmUmUmCmUfUmGfUmCmAm sAmsCm TRD5813 SEQ ID NO: 5 AmsUfsUmGmUmGfIdGmGmAmUmUmCmUfUmGfUmCmAmsAm sCm TRD5816 SEQ ID NO: 6 AmsUfsUmGmUmGfTJ- NA009(A)GmGmAmUmUmCmUfUmGfUmCmAmsAmsCm TRD5817 SEQ ID NO: 7 AmsUfsUmGmUmGfTJ- NA019(A)GmGmAmUmUmCmUfUmGfUmCmAmsAmsCm TRD5818 SEQ ID NO: 8 AmsUfsUmGmUmGfTJ- NA020(A)GmGmAmUmUmCmUfUmGfUmCmAmsAmsCm TRD5821 SEQ ID NO: 9 AmsUfsUmGmUmGfTJ- NA027(A)GmGmAmUmUmCmUfUmGfUmCmAmsAmsCm TRD5822 SEQ ID AmsUfsUmGmUmGf(+)hmpNA(A)GmGmAmUmUmCmUfUmGfU NO: 10 mCmAmsAmsCm TRD5823 SEQ ID AmsUfsUmGmUmGf(−)hmpNA(A)GmGmAmUmUmCmUfUmGfUm NO: 11 CmAmsAmsCm TRD5825 SEQ ID AmsUfsUmGmUmGfTJ- NO: 12 NA038(A)GmGmAmUmUmCmUfUmGfUmCmAmsAmsCm

    [0825] The experimental results of on-target activity are shown in Table 6, and the experimental results of off-target activity are shown in Table 7 and FIGS. 1A-1L. The test sequences with the compounds of the current experiment all showed activity similar to or slightly better than that of the parent sequence, which indicates that the modifications did not affect on-target activity. The siRNAs comprising GNA/Abasic/Id, TJ-NA019(A). TJ-NA020(A), TJ-NA0262(A), (+)hmpNA(A) and (−)hmpNA(A) had the best activity. In addition, the parent sequence had significant off-target activity, and all the modifications showed significant inhibitory effects against off-target activity. Particularly, in the siRNAs comprising TJ-NA027(A), (+)hmpNA(A) and (−)hmpNA(A), no off-target activity was observed.

    TABLE-US-00006 TABLE 6 On-target activity results of HBV-S-targeting siRNAs Remaining percentage of target gene's mRNA (on-target activity) expression (mean) Double strand 40 13.3 4.44 1.48 0.493 0.164 0.054 0.0182 0.00609 0.00203 0.00067 IC.sub.50 value code nM nM nM nM nM nM nM nM nM nM nM (nM) TRD4389 5.4% 4.1% 4.8% 4.8% 8.4% 21.7% 53.0% 82.5% 104.9% 99.4% 95.2% 0.0589 TRD5252 3.4% 3.1% 3.1% 3.6% 5.7% 11.1% 22.1% 44.7% 72.8% 92.2% 86.6% 0.0162 TRD5812 3.8% 3.0% 3.4% 3.6% 7.3% 9.8% 23.5% 44.8% 63.9% 90.4% 81.4% 0.0158 TRD5813 5.1% 3.8% 4.4% 4.3% 6.1% 13.2% 33.5% 53.8% 74.5% 80.8% 96.4% 0.0214 TRD5816 3.9% 3.8% 3.4% 4.9% 6.9% 16.1% 39.8% 71.8% 96.3% 92.9% 108.1% 0.0389 TRD5817 4.8% 4.2% 4.5% 3.7% 6.6% 13.7% 31.0% 61.0% 81.8% 92.9% 103.7% 0.0251 TRD5818 3.7% 3.3% 3.1% 3.7% 6.1% 10.9% 26.3% 55.8% 69.1% 87.4% 88.8% 0.0195 TRD5820 4.4% 3.8% 3.5% 3.7% 4.2% 9.5% 22.8% 49.2% 79.4% 93.2% 91.7% 0.0191 TRD5821 6.8% 5.2% 5.7% 6.1% 8.7% 19.7% 39.3% 69.9% 102.8% 92.9% 97.9% 0.0398 TRD5822 4.4% 4.5% 4.1% 3.7% 5.3% 13.2% 24.6% 51.2% 82.3% 84.9% 101.9% 0.0200 TRD5823 3.6% 3.8% 3.4% 3.4% 5.2% 11.0% 29.7% 58.3% 71.4% 84.7% 100.7% 0.0200 TRD5825 4.3% 3.6% 3.4% 4.2% 17.1% 18.0% 32.7% 66.0% 88.7% 93.8% 103.2% 0.0302

    TABLE-US-00007 TABLE 7 Off-target activity results of HBV-S-targeting siRNAs Remaining percentage of target gene's mRNA (off-target activity) expression (mean) Double strand 40 13.3 4.44 1.48 0.493 0.164 0.054 0.0182 0.00609 0.00203 0.00067 code nM nM nM nM nM nM nM nM nM nM nM TRD4389 57.4% 55.9% 65.5% 73.3% 89.2% 92.8% 105.3% 102.4% 107.6% 96.0% 101.2% TRD5252 97.3% 100.4% 104.0% 108.1% 107.3% 102.9% 108.7% 94.9% 101.2% 101.8% 97.7% TRD5812 98.2% 107.0% 99.1% 100.7% 110.1% 125.2% 113.7% 105.3% 105.5% 99.5% 93.8% TRD5813 100.5% 105.2% 95.9% 112.1% 102.3% 104.3% 101.5% 97.2% 110.7% 100.6% 93.6% TRD5816 108.3% 101.5% 97.2% 109.5% 116.7% 122.8% 108.5% 113.2% 121.6% 112.9% 106.8% TRD5817 104.5% 106.7% 110.0% 109.3% 119.4% 120.9% 127.3% 113.6% 117.7% 112.2% 105.0% TRD5818 83.7% 89.7% 83.0% 91.0% 117.5% 79.4% 99.1% 103.4% 89.2% 92.9% 98.7% TRD5820 92.1% 100.3% 104.3% 98.9% 103.6% 103.8% 106.2% 108.3% 105.8% 100.3% 97.7% TRD5821 102.9% 99.3% 98.3% 99.6% 106.8% 106.4% 108.7% 108.1% 104.5% 95.4% 107.8% TRD5822 106.1% 93.8% 81.6% 100.4% 100.4% 96.9% 105.3% 101.9% 94.6% 101.4% 94.0% TRD5823 91.8% 89.1% 92.9% 99.8% 97.8% 101.1% 90.7% 92.6% 97.9% 95.9% 87.1% TRD5825 84.9% 89.7% 97.7% 106.7% 103.9% 104.7% 100.0% 100.9% 90.2% 112.7% 98.3%

    Example 5. Sequence-Dependence Experiment of siRNAs Comprising Different Chemical Modifications

    [0826] The Abasic modification is known to be siRNA sequence-dependent, so the inventors tested the test compounds of the present disclosure on multiple different sequences. siRNAs targeting the mRNAs of four different genes (ANGPTL3, HBV-S, HBV-X and TTR) (their sequences are shown in Table 8) were used and modified in position 7 of the 5′ end of the AS strand with the compounds of Example 1: TJ-NA020(A), TJ-NA0272(A), (+)hmpNA(A), (−)hmpNA(A), GNAW (as a control), and Id compound (the sequences are shown in Table 9), and were compared to the parent sequences with respect of on-target activity and off-target activity.

    TABLE-US-00008 TABLE 8 Sequences of siRNAs targeting different genes SIRNA SEQ ID SEQ ID target gene NO SS strand 5′-3′ NO AS strand 5′-3′ ANGPTL3 SEQ ID GmsAmsAmCmUfAmCfU SEQ ID UmsGfsAmAfGmAfAmAmGf (siRNA1) NO: 13 fCfCmCmUmUmUmCmU NO: 14 GmGmAfGmUfAmGfUmUfC mUmCmAm msUmsUm HBV-S SEQ ID CmsCmsAmUmUfUmGfU SEQ ID UmsGfsAmAmCmCfAmCmU (siRNA2) NO: 15 fUfCmAmGmUmGmGmU NO: 16 mGmAmAmCmAfAmAfUmG mUmCmsGm mGmsCmsAm HBV-X SEQ ID CmsAmsCmCmUfCmUfG SEQ ID UmsAfsUmGfCmGfAmCmGf (siRNA3) NO: 17 fCfAmCmGmUmCmGmC NO: 18 UmGmCfAmGfAmGfGmUfG mAmUmsGm msAmsAm TTR SEQ ID CmsAmsGmUmGfUmUfC SEQ ID UmsUfsAmUfAmGfAmGmCf (siRNA4) NO: 19 fUfUmGmCmUmCmUmA NO: 20 AmAmGfAmAfCmAfCmUfG mUmAmAm msUmsUm

    TABLE-US-00009 TABLE 9 Sequences of siRNAs targeting different genes and comprising chemical modifications Target mRNA siRNA SEQ ID NO AS strand modification ANGPT TRD5840 SEQ ID NO: 21 UmsGfsAmAfGmAfAmAmGfGmGmAfGmUfAmGfUm L3 UfCmsUmsUm TRD5841 SEQ ID NO: 22 UmsGfsAmAfGmAfGNA(A)AmGfGmGmAfGmUfAmG fUmUfCmsUmsUm TRD5842 SEQ ID NO: 23 UmsGfsAmAfGmAfIdAmGfGmGmAfGmUfAmGfUmUf CmsUmsUm TRD5843 SEQ ID NO: 24 UmsGfsAmAfGmAfTJ- 020(A)AmGfGmGmAfGmUfAmGfUmUfCmsUmsUm TRD5844 SEQ ID NO: 25 UmsGfsAmAfGmAfTJ- 027(A)AmGfGmGmAfGmUfAmGfUmUfCmsUmsUm TRD5845 SEQ ID NO: 26 UmsGfsAmAfGmAf(+)hmpNA(A)AmGfGmGmAfGmUf AmGfUmUfCmsUmsUm TRD5846 SEQ ID NO: 27 UmsGfsAmAfGmAf(−)hmpNA(A)AmGfGmGmAfGmUf AmGfUmUfCmsUmsUm HBV-S TRD5847 SEQ ID NO: 28 UmsGfsAmAmCmCfAmCmUmGmAmAmCmAfAmAfU mGmGmsCmsAm TRD5848 SEQ ID NO: 29 UmsGfsAmAmCmCfGNA(A)CmUmGmAmAmCmAfA mAfUmGmGmsCmsAm TRD5849 SEQ ID NO: 30 UmsGfsAmAmCmCfIdCmUmGmAmAmCmAfAmAfUm GmGmsCmsAm TRD5850 SEQ ID NO: 31 UmsGfsAmAmCmCfTJ- 020(A)CmUmGmAmAmCmAfAmAfUmGmGmsCmsAm TRD5851 SEQ ID NO: 32 UmsGfsAmAmCmCfTJ- 027(A)CmUmGmAmAmCmAfAmAfUmGmGmsCmsAm TRD5852 SEQ ID NO: 33 UmsGfsAmAmCmCf(+)hmpNA(A)CmUmGmAmAmCm AfAmAfUmGmGmsCmsAm TRD5853 SEQ ID NO: 34 UmsGfsAmAmCmCf(−)hmpNA(A)CmUmGmAmAmCm AfAmAfUmGmGmsCmsAm HBV-X TRD5854 SEQ ID NO: 35 UmsAfsUmGfCmGfAmCmGfUmGmCfAmGfAmGfGm UfGmsAmsAm TRD5855 SEQ ID NO: 36 UmsAfsUmGfCmGfGNA(A)CmGfUmGmCfAmGfAmGf GmUfGmsAmsAm TRD5856 SEQ ID NO: 37 UmsAfsUmGfCmGfIdCmGfUmGmCfAmGfAmGfGmUf GmsAmsAm TRD5857 SEQ ID NO: 38 UmsAfsUmGfCmGfTJ- 020(A)CmGfUmGmCfAmGfAmGfGmUfGmsAmsAm TRD5858 SEQ ID NO: 39 UmsAfsUmGfCmGfTJ- 027(A)CmGfUmGmCfAmGfAmGfGmUfGmsAmsAm TRD5859 SEQ ID NO: 40 UmsAfsUmGfCmGf(+)hmpNA(A)CmGfUmGmCfAmGf AmGfGmUfGmsAmsAm TRD5860 SEQ ID NO: 41 UmsAfsUmGfCmGf(−)hmpNA(A)CmGfUmGmCfAmGf AmGfGmUfGmsAmsAm TTR TRD5861 SEQ ID NO: 42 UmsUfsAmUfAmGfAmGmCfAmAmGfAmAfCmAfCm UfGmsUmsUm TRD5862 SEQ ID NO: 43 UmsUfsAmUfAmGfGNA(A)GmCfAmAmGfAmAfCmAf CmUfGmsUmsUm TRD5863 SEQ ID NO: 44 UmsUfsAmUfAmGfIdGmCfAmAmGfAmAfCmAfCmUf GmsUmsUm TRD5864 SEQ ID NO: 45 UmsUfsAmUfAmGfTJ- 020(A)GmCfAmAmGfAmAfCmAfCmUfGmsUmsUm TRD5865 SEQ ID NO: 46 UmsUfsAmUfAmGfTJ- 027(A)GmCfAmAmGfAmAfCmAfCmUfGmsUmsUm TRD5866 SEQ ID NO: 47 UmsUfsAmUfAmGf(+)hmpNA(A)GmCfAmAmGfAmAf CmAfCmUfGmsUmsUm( TRD5867 SEQ ID NO: 48 UmsUfsAmUfAmGf(−)hmpNA(A)GmCfAmAmGfAmAf CmAfCmUfGmsUmsUm

    [0827] The results of the on-target activity experiment are shown in Table 10. GNA(A) showed significant sequence dependence, and different sequences had significantly different on-target activity. The test compounds of the present disclosure did not show significant sequence dependence, which indicates that they are more universally applicable. Moreover, making only a 2′-F modification in position 9 of the 5′ end of the AS strand and only a 2′-OMe modification in position 10 resulted in similar activity—that is, the test compounds of the present disclosure did not show significant sequence dependence.

    TABLE-US-00010 TABLE 10 On-target activity results of siRNAs for different target sequences Remaining percentage of target gene's mRNA (on-target activity) expression (mean) Double strand 40 13.3 4.44 1.48 0.493 0.164 0.054 0.0182 0.00609 0.00203 0.00067 IC50 value code nM nM nM nM nM nM nM nM nM nM nM (nM) TRD5840 28.0% 24.2% 30.9% 52.8% 48.9% 86.7% 92.7% 89.8% 92.4% 95.8% 102.4% 0.8710 TRD5841 57.5% 51.1% 55.5% 68.3% 76.5% 85.9% 82.9% 87.8% 81.5% 64.0% 97.8% >40 TRD5842 39.4% 43.7% 41.7% 70.8% 82.5% 99.1% 99.1% 92.1% 98.8% 95.6% 92.7% 3.1623 TRD5843 28.7% 30.0% 33.3% 50.4% 78.8% 75.0% 76.0% 107.4% 95.7% 92.0% 94.0% 1.6218 TRD5844 38.6% 36.3% 44.9% 59.8% 76.2% 104.5% 111.5% 105.4% 110.6% 103.6% 114.3% 2.3442 TRD5845 28.2% 30.5% 41.7% 55.0% 63.9% 78.0% 77.1% 84.1% 95.8% 83.2% 91.9% 1.9953 TRD5846 31.6% 26.8% 34.1% 59.1% 84.8% 102.1% 97.2% 108.9% 95.6% 107.2% 102.1% 1.9055 TRD5847 9.3% 7.2% 6.3% 8.5% 17.9% 47.2% 80.6% 94.7% 100.5% 106.1% 110.6% 0.1380 TRD5848 46.5% 35.1% 26.6% 36.0% 67.3% 76.3% 88.4% 104.1% 91.6% 95.1% 98.1% 0.7943 TRD5849 24.8% 16.7% 13.7% 20.9% 41.0% 71.6% 95.5% 98.2% 93.1% 104.3% 113.3% 0.3311 TRD5850 19.7% 14.2% 12.8% 15.5% 29.3% 54.3% 84.2% 87.6% 86.6% 90.0% 95.2% 0.2042 TRD5851 22.9% 15.5% 12.6% 20.2% 38.6% 70.0% 88.4% 102.3% 106.6% 101.0% 101.9% 0.3020 TRD5852 24.7% 17.5% 13.1% 21.1% 40.5% 64.1% 84.3% 94.5% 88.4% 100.2% 95.1% 0.2951 TRD5853 17.5% 11.5% 9.9% 13.5% 30.3% 54.5% 74.6% 86.3% 90.3% 91.0% 84.1% 0.1905 TRD5854 37.9% 32.4% 35.3% 50.3% 70.6% 89.7% 98.8% 101.1% 106.1% 99.6% 114.7% 1.3804 TRD5855 41.3% 40.7% 36.9% 73.6% 71.7% 87.0% 89.0% 85.8% 94.9% 104.4% 101.6% 4.2658 TRD5856 38.6% 37.8% 35.8% 59.5% 72.7% 92.3% 92.5% 85.2% 102.1% 93.1% 102.1% 2.0417 TRD5857 38.5% 34.4% 35.6% 45.6% 66.8% 81.4% 82.7% 84.7% 85.6% 95.0% 103.3% 1.1749 TRD5858 25.0% 24.3% 26.0% 38.1% 59.3% 75.4% 86.5% 104.8% 93.8% 92.4% 94.7% 0.7244 TRD5860 43.5% 37.1% 34.1% 50.8% 77.6% 88.5% 86.6% 100.0% 95.1% 97.8% 110.8% 1.5488 TRD5861 3.8% 2.5% 1.7% 2.2% 5.5% 20.6% 43.0% 64.4% 96.7% 105.0% 92.9% 0.0407 TRD5862 1.2% 1.3% 1.1% 1.3% 3.8% 12.7% 36.6% 85.4% 101.8% 97.8% 117.2% 0.0417 TRD5863 1.7% 1.4% 1.2% 1.7% 5.1% 18.9% 45.7% 75.5% 92.5% 106.3% 106.7% 0.0447 TRD5864 1.1% 1.2% 0.9% 1.4% 2.3% 7.2% 27.9% 52.4% 84.7% 90.8% 100.0% 0.0219 TRD5865 3.2% 2.3% 1.7% 1.9% 3.1% 11.9% 36.3% 64.4% 96.0% 97.2% 93.2% 0.0331 TRD5866 1.2% 1.2% 1.3% 1.4% 3.4% 12.7% 32.2% 67.7% 87.7% 97.4% 103.4% 0.0309 TRD5867 1.8% 1.5% 1.3% 1.3% 2.2% 8.8% 27.3% 56.0% 85.3% 86.9% 108.5% 0.0224

    [0828] The experimental results of the off-target activity of siRNA2 and siRNA3 are shown in Table 11, FIGS. 2A-2G (targeting HBV-S) and FIGS. 3A-3G (targeting HBV-X). It can be seen that the test compounds of the present disclosure significantly reduced the off-target activity of siRNA relative to the parent sequences. Moreover, making only a 2′-F modification in position 9 of the 5′ end of the AS strand and only a 2′-OMe modification in position 10 resulted in similar off-target activity—that is, the modifications can similarly reduce the off-target activity of siRNA significantly.

    TABLE-US-00011 TABLE 11 Off-target activity results of siRNAs for different target sequences Remaining percentage of target gene's mRNA (off-target activity) expression (mean) Double strand 40 13.3 4.44 1.48 0.493 0.164 0.054 0.0182 0.00609 0.00203 0.00067 code nM nM nM nM nM nM nM nM nM nM nM TRD5847 51.2% 47.6% 47.5% 66.7% 77.8% 81.8% 93.2% 93.3% 93.1% 96.5% 85.7% TRD5848 99.9% 96.7% 101.6% 100.6% 91.6% 107.0% 96.7% 100.7% 95.4% 101.9% 113.0% TRD5849 77.3% 77.6% 69.3% 87.2% 90.7% 83.1% 85.4% 95.2% 94.1% 94.0% 108.0% TRD5850 86.3% 90.2% 92.1% 92.9% 89.8% 99.3% 98.6% 96.0% 95.8% 98.0% 103.5% TRD5851 84.9% 85.0% 87.7% 84.8% 86.8% 88.7% 92.1% 83.2% 91.5% 84.8% 104.1% TRD5852 81.8% 83.1% 79.0% 89.9% 91.3% 98.2% 99.3% 96.7% 109.6% 94.0% 99.8% TRD5853 86.4% 87.2% 91.4% 92.9% 91.9% 99.7% 87.0% 81.0% 89.0% 86.8% 91.3% TRD5854 36.9% 32.7% 36.1% 39.8% 62.9% 81.3% 87.6% 87.0% 95.8% 93.6% 99.8% TRD5855 71.1% 78.2% 81.6% 92.0% 91.0% 94.1% 87.3% 93.6% 99.4% 119.9% 96.6% TRD5856 89.7% 100.1% 96.5% 106.1% 112.7% 124.4% 117.5% 122.3% 117.5% 120.1% 112.6% TRD5857 84.9% 69.5% 86.0% 79.6% 87.1% 91.1% 96.1% 87.8% 104.8% 95.1% 95.2% TRD5858 73.9% 82.8% 92.5% 95.4% 107.5% 97.5% 99.1% 96.1% 94.1% 101.8% 99.8% TRD5859 79.8% 81.0% 86.0% 96.4% 101.9% 98.8% 99.8% 118.4% 101.3% 93.3% 103.2% TRD5860 78.4% 75.6% 80.6% 86.1% 83.2% 95.9% 91.6% 91.5% 95.6% 97.3% 98.6%

    II. Preparation and Activity Evaluation of Targeting Ligands

    [0829]

    TABLE-US-00012 TABLE 12 Main instrument models and sources of starting materials for preparing targeting ligands Main instrument models and sources of starting materials Name Company Catalog number/model Solid-phase Dr. Oligo 48 Biolytic synthesizer HPLC Agilent 1260 Infinity II Agilent Mass spectrometer Waters Acquity UPLC Waters Nucleoside Hongene Biotech phosphoramidite monomer starting material

    Example 6. Galactosamine Compound 1-t Linked to Solid-Phase Support

    [0830] ##STR00193##

    [0831] The synthesis schemes are as follows:

    1) Scheme of Synthesis of Compound 1-g

    [0832] ##STR00194##

    2) Scheme of Synthesis of Compound 1-h

    [0833] ##STR00195##

    3) Scheme of Synthesis of Compound 1-1

    [0834] ##STR00196##

    4) Synthesis of Compound 1-q

    [0835] ##STR00197##

    5) Synthesis of Galactosamine Compound 1-t Linked to Solid-Phase Support

    [0836] ##STR00198##

    Step 1

    [0837] The starting material 1-a (297 g, 763 mmol) and the starting material 1-b (160 g, 636 mmol) were dissolved in 960 mL of DCE. Sc(OTf).sub.3 (15.6 g, 31.8 mmol) was added at 15° C. Then the reaction mixture was heated to 85° C. and stirred for 2 h. After the reaction was complete, 1.5 L of saturated NaHCO.sub.3 was added to terminate the reaction. The organic phase was separated, washed with 1.5 L of saturated brine, dried over anhydrous Na.sub.2SO.sub.4 and filtered. The filtrate was distilled under reduced pressure and purified by silica gel column chromatography (petroleum ether:ethyl acetate=5:1 to 0:1) to give product 1-c as a light yellow oil (328 g, 544 mmol, yield: 85.5%, purity: 96.4%).

    [0838] .sup.1HNMR:(400 MHz, CDCl.sub.3) δ 7.44-7.29 (m, 5H), 5.83 (d, J=8.8 Hz, 1H), 5.40-5.23 (m, 2H), 5.18-5.06 (m, 2H), 4.86 (s, 1H), 4.66 (d, J=8.4 Hz, 1H), 4.21-4.07 (m, 2H), 4.04-3.77 (m, 3H), 3.51-3.45 (m, 1H), 3.31-3.11 (m, 2H), 2.18 (d, J=2.0 Hz, 1H), 2.14 (s, 3H), 2.06 (s, 3H), 2.03-1.99 (m, 3H), 1.95 (s, 3H), 1.64-1.46 (m, 4H), 1.43-1.29 (m, 4H). MS, C.sub.28H.sub.40N.sub.2O.sup.11, found: M+581.3.

    Step 2

    [0839] The compound obtained in step 1 was divided into two parts for parallel reactions, each of which was carried out as follows: Compound 1-c (72.0 g, 124 mmol) was added to 432 mL of THF. Pd/C (20.0 g, 10% purity) was added under argon, and then TFA (14.1 g, 124 mmol, 9.18 mL) was added. Hydrogen gas was introduced into the reaction solution, and the gas pressure was maintained at 30 Psi. The reaction solution was heated to 30° C. and stirred for 16 h. After the reaction was complete, the two reactions carried out in parallel were combined. The reaction mixture was filtered, and the filtrate was concentrated under reduced pressure. The residue was diluted with dichloromethane and concentrated under reduced pressure; the process was repeated three times. The residue was dried under reduced pressure to give the target compound 1-d (139 g).

    [0840] .sup.1HNMR (400 MHz, DMSO-d.sub.6) δ 7.85 (d, J=9.2 Hz, 1H), 7.74 (s, 3H), 5.21 (d, J=3.6 Hz, 1H), 4.97 (dd, J=2.8, 10.8 Hz, 1H), 4.48 (d, J=8.8 Hz, 1H), 4.06-3.98 (m, 3H), 3.93-3.82 (m, 1H), 3.73-3.68 (m, 1H), 3.63-3.56 (m, 1H), 3.43-3.38 (m, 1H), 2.82-2.71 (m, 2H), 2.13-2.09 (m, 3H), 2.01-1.97 (m, 3H), 1.91-1.87 (m, 3H), 1.77 (s, 3H), 1.76-1.73 (m, 1H), 1.52-1.44 (m, 4H), 1.28 (s, 4H).

    Step 3

    [0841] Compound 1-d (139 g, 247 mmol) and compound 1-e (75.3 g, 223 mmol) were added to DMF solution (834 mL), and then DIPEA (41.6 g, 322 mmol, 56.1 mL), HOBt (36.8 g, 272 mmol) and EDCI (52.2 g, 272 mmol) were added at 0° C. The reaction mixture was stirred at 15° C. for 16 h. After the reaction was complete, the reaction mixture was diluted with dichloromethane (400 mL) and then washed successively with saturated ammonium chloride solution (1 L), saturated NaHCO.sub.3 (1.00 L) and saturated brine. The organic phase was separated, dried over anhydrous sodium sulfate, filtered and distilled under reduced pressure to remove the solvent. The residue was purified by silica gel column chromatography (petroleum ether:ethyl acetate=5:1 to 0:1) to give the target compound 1-f (108 g, yield: 56.8%).

    [0842] .sup.1HNMR (40 (400 MHz, DMSO-d.sub.6) δ 7.89-7.78 (m, 2H), 7.41-7.27 (m, 6H), 5.21 (d, J=3.2 Hz, 1H), 5.08-4.92 (m, 3H), 4.48 (d, J=8.4 Hz, 1H), 4.07-3.99 (m, 3H), 3.97-3.81 (m, 2H), 3.75-3.64 (m, 1H), 3.42-3.37 (m, 1H), 3.13-2.93 (m, 2H), 2.20 (t, J=8.0 Hz, 2H), 2.10 (s, 3H), 1.99 (s, 3H), 1.89 (s, 3H), 1.87-1.79 (m, 1H), 1.76 (s, 3H), 1.74-1.64 (m, 1H), 1.48-1.41 (m, 2H), 1.38 (s, 12H), 1.29-1.20 (m, 4H), 1.19-1.14 (m, 1H). MS, C.sub.37H.sub.55N.sub.3O.sub.14, found: M.sup.+766.4.

    Step 4

    [0843] The compound 1-f obtained above was divided into two parts for parallel reactions, each of which was carried out as follows: Compound 6 (47.0 g, 61.3 mmol) was added to 280 mL of THF. Pd/C (15.0 g, 10% purity) was added under argon, and then TFA (7.00 g, 61.3 mmol, 4.54 mL) was added. Hydrogen gas was introduced into the reaction solution, and the gas pressure was maintained at 30 Psi. The reaction solution was heated to 30° C. and stirred for 16 h. After the reaction was complete, the two reactions carried out in parallel were combined. The reaction mixture was filtered, and the filtrate was concentrated under reduced pressure. The residue was diluted with dichloromethane and concentrated under reduced pressure; the process was repeated three times. The residue was dried under reduced pressure to give the target compound 1-g (94.0 g, crude).

    [0844] .sup.1HNMR (400 MHz, DMSO-d6) δ 8.38 (s, 1H), 8.10 (s, 3H), 7.83 (d, J=9.2 Hz, 1H), 5.21 (d, J=3.2 Hz, 1H), 4.96 (dd, J=3.6, 11.2 Hz, 1H), 4.47 (d, J=8.4 Hz, 1H), 4.06-3.98 (m, 3H), 3.92-3.82 (m, 1H), 3.75-3.67 (m, 2H), 3.60 (s, 1H), 3.43-3.37 (m, 1H), 3.18-3.04 (m, 2H), 2.30-2.24 (m, 2H), 2.10 (s, 3H), 2.00 (s, 3H), 1.95-1.90 (m, 2H), 1.89 (s, 3H), 1.78-1.75 (m, 3H), 1.49-1.41 (m, 3H), 1.40 (s, 9H), 1.26 (s, 4H).

    Step 5

    [0845] The compound 1-f obtained above was divided into two parts for parallel reactions, each of which was carried out as follows: Compound 1-f (46.0 g, 60 mmol) was added to HCl-EtOAc (2.00 M, 276 mL), and the reaction mixture was stirred at 15° C. for 16 h. After the reaction was complete, the two reaction solutions were combined and concentrated by distillation under reduced pressure. The residue was diluted with dichloromethane and concentrated under reduced pressure; the process was repeated three times. The residue was dried under reduced pressure to give a light red compound 1-h (91.0 g, crude).

    [0846] .sup.1HNMR (400 MHz, DMSO-d.sub.6) δ 7.91-7.80 (m, 2H), 7.42-7.26 (m, 6H), 5.21 (d, J=3.2 Hz, 1H), 5.07-4.92 (m, 4H), 4.48 (d, J=8.4 Hz, 1H), 4.06-3.98 (m, 3H), 3.98-3.82 (m, 3H), 3.73-3.65 (m, 1H), 3.44-3.35 (m, 1H), 3.12-2.94 (m, 2H), 2.22 (t, J=8.0 Hz, 2H), 2.10 (s, 3H), 2.01-1.97 (m, 4H), 1.94-1.90 (m, 1H), 1.89 (s, 3H), 1.87-1.79 (m, 2H), 1.76 (s, 3H), 1.74-1.67 (m, 1H), 1.49-1.40 (m, 2H), 1.40-1.32 (m, 2H), 1.24 (d, J=4.0 Hz, 4H), 1.19-1.13 (m, 1H).

    [0847] MS, C.sub.33H.sub.47N.sub.3O.sub.14, found: M.sup.+710.3.

    Step 6

    [0848] Two reactions were carried in parallel as follows: Compound 1-g (45.0 g, 60.3 mmol) and compound 1-h (38.5 g, 54.3 mmol) were added to 270 mL of DMF, then DIPEA (10.1 g, 78.4 mmol, 13.6 mL) was added at 0° C., and then HOBt (8.97 g, 66.3 mmol) and EDCI (12.7 g, 66.3 mmol) were added. The reaction mixture was stirred at 15° C. for 16 h. After the reaction was complete, the two reaction solutions were combined, diluted with 300 mL of DCM, and washed successively with saturated ammonium chloride (800 mL), saturated NaHCO.sub.3(800 mL) and saturated brine (800 mL). The organic phase was dried over anhydrous Na.sub.2SO.sub.4. After filtration, the filtrate was concentrated by evaporation under increased pressure. The residue was purified by silica gel column chromatography (petroleum ether:ethyl acetate=5:1 to 0:1) to give a white compound 1-i (66.0 g, 47.4 mmol, yield: 39.3%, purity 95.1%).

    [0849] .sup.1HNMR (400 MHz, DMSO-d.sub.6) δ 7.96-7.78 (m, 5H), 7.41-7.25 (m, 6H), 5.21 (d, J=3.6 Hz, 2H), 5.05-4.92 (m, 4H), 4.48 (d, J=8.8 Hz, 2H), 4.22-4.12 (m, 1H), 4.02 (s, 6H), 3.94-3.80 (m, 3H), 3.74-3.64 (m, 2H), 3.45-3.35 (m, 2H), 3.11-2.92 (m, 4H), 2.20-2.12 (m, 4H), 2.10 (s, 6H), 1.99 (s, 6H), 1.89 (s, 6H), 1.82-1.79 (m, 2H), 1.76 (s, 6H), 1.74-1.63 (m, 2H), 1.44 (d, J=6.0 Hz, 4H), 1.37 (s, 12H), 1.24 (s, 9H).

    [0850] MS: C.sub.62H.sub.94N.sub.6O.sub.25, found: m/z 1323.8.

    Step 7

    [0851] This step was performed in 11 reactions, each of which was carried out as follows: Compound 1-i (5.00 g, 3.78 mmol) and toluene (300 mL) were added, and silica gel (45.0 g) was added. The reaction mixture was stirred at 100° C. for 40 h. After the 11 reactions were complete, the reaction mixtures were combined. After the solvent was distilled off under reduced pressure, isopropanol and dichloromethane were added to the residue, and the mixture was stirred for 20 min. Insoluble matter was removed by filtration, and the filter cake was washed with isopropanol until no product was dissolved in isopropanol. The resulting solution was concentrated to remove the solvent and dried under reduced pressure to give a light yellow compound 1-j (43.2 g, 34.0 mmol, yield: 82.0%).

    [0852] .sup.1HNMR: (400 MHz, DMSO-d.sub.6) δ 8.01 (d, J=7.6 Hz, 1H), 7.93-7.79 (m, 2H), 7.39-7.27 (m, 3H), 5.21 (d, J=3.2 Hz, 1H), 5.06-4.91 (m, 2H), 4.48 (d, J=8.0 Hz, 1H), 4.07-3.97 (m, 3H), 3.94-3.82 (m, 2H), 3.73-3.65 (m, 1H), 3.45-3.36 (m, 2H), 3.10-2.94 (m, 2H), 2.15 (d, J=7.6 Hz, 2H), 2.10 (s, 3H), 1.99 (s, 3H), 1.89 (s, 3H), 1.86-1.79 (m, 1H), 1.77 (s, 3H), 1.74-1.65 (m, 1H), 1.44 (s, 2H), 1.37 (d, J=5.2 Hz, 2H), 1.24 (s, 4H).

    [0853] MS: C.sub.58H.sub.86N.sub.6O.sub.25, found: m/z=1267.8.

    Step 8

    [0854] This step was performed in two parallel reactions, each of which was carried out as follows: Compound 1-d (11.8 g, 21.0 mmol) and compound 1-j (21.3 g, 16.8 mmol) were added to 70 mL of DMF, then DIPEA (3.54 g, 27.3 mmol, 4.77 mL) was added at 0° C., and then HOBt (3.13 g, 23.1 mmol) and EDCI (4.44 g, 23.1 mmol) were added. The reaction mixture was stirred at 15° C. for 16 h. After the reaction was complete, the two reaction solutions were combined, diluted with 500 mL of DCM, and washed successively with saturated ammonium chloride (1.5 L), saturated NaHCO.sub.3 (1.5 mL) and saturated brine (1.5 mL). The organic phase was dried over anhydrous Na.sub.2SO.sub.4. After filtration, the filtrate was concentrated by evaporation under increased pressure. The residue was purified by silica gel column chromatography (dichloromethane:methanol=50:1 to 10:1) to give a light yellow compound 1-k (54.0 g, 31.8 mmol, yield: 75.6%).

    [0855] .sup.1HNMR (400 MHz, DMSO-d.sub.6) δ 7.91 (d, J=7.6 Hz, 1H), 7.87-7.78 (m, 5H), 7.73 (t, J=5.2 Hz, 1H), 7.42-7.24 (m, 6H), 5.21 (d, J=3.6 Hz, 3H), 5.06-4.92 (m, 5H), 4.48 (d, J=8.4 Hz, 3H), 4.19-4.09 (m, 2H), 4.07-3.97 (m, 10H), 3.94-3.80 (m, 4H), 3.76-3.64 (m, 3H), 3.42-3.37 (m, 4H), 3.08-2.94 (m, 6H), 2.20-2.12 (m, 2H), 2.10 (s, 9H), 2.08-2.01 (m, 2H), 1.99 (s, 9H), 1.89 (s, 9H), 1.87-1.79 (m, 2H), 1.77 (s, 9H), 1.74-1.63 (m, 2H), 1.44 (d, J=5.6 Hz, 6H), 1.40-1.31 (m, 6H), 1.24 (s, 13H).

    [0856] MS: C.sub.78H.sub.118N.sub.8O.sub.33, found: m/z=1696.1.

    Step 9

    [0857] This step was performed in 3 parallel reactions, each of which was carried out as follows: Compound 1-k (17.0 g, 10.0 mmol) and THF (100 mL) were added. Pd/C (5.0 g, 10% purity) was added under argon, and then TFA (1.14 g, 10.0 mmol, 742 μL) was added. Hydrogen gas was introduced into the reaction solution, and the gas pressure was maintained at 15 Psi. The reaction solution was heated to 30° C. and stirred for 4 h. After the reaction was complete, the 3 reactions carried out in parallel were combined. The reaction mixture was filtered, and the filtrate was concentrated under reduced pressure. The residue was diluted with dichloromethane and concentrated under reduced pressure; the process was repeated three times. The residue was purified by preparative liquid chromatography (C.sup.18, mobile phase A 0.1% TFA-water, mobile phase B: 10-40% CAN, 20 min) to give a white compound 1-1 (17.3 g, 10.2 mmol, yield: 34.0%).

    [0858] .sup.1HNMR: (400 MHz, DMSO-d.sub.6) δ 8.45 (t, J=5.2 Hz, 1H), 8.14 (d, J=5.2 Hz, 3H), 7.97 (t, J=5.2 Hz, 1H), 7.90-7.77 (m, 4H), 5.21 (d, J=2.8 Hz, 3H), 4.96 (dd, J=3.2, 11.6 Hz, 3H), 4.47 (d, J=8.4 Hz, 3H), 4.20-4.10 (m, 1H), 4.02 (s, 8H), 3.87 (q, J=9.6 Hz, 3H), 3.75-3.61 (m, 4H), 3.46-3.34 (m, 3H), 3.21-2.93 (m, 6H), 2.21 (s, 2H), 2.14-2.02 (m, 11H), 1.99 (s, 9H), 1.96-1.82 (m, 12H), 1.80-1.65 (m, 10H), 1.44 (d, J=5.6 Hz, 8H), 1.36 (d, J=6.4 Hz, 4H), 1.30-1.17 (m, 12H)

    [0859] MS: C.sub.70H.sub.112N.sub.8O.sub.31, found: m/2z=781.8.

    Step 10

    [0860] Compound 1-m (2 g, 12.64 mmol) was dissolved in pyridine (10 mL). A solution of DMTrCl (4.71 g, 13.90 mmol) in pyridine (10 mL) was added dropwise at room temperature. The reaction mixture was stirred at room temperature for 5 h. After the reaction was complete, the reaction mixture was quenched with methanol and concentrated under reduced pressure to give a crude product. The crude product was purified using silica gel (elution with petroleum ether:ethyl acetate=10:1). The product eluate was collected and concentrated under reduced pressure to evaporate the solvent to give compound 1-n (4 g).

    [0861] MS m/z: C.sub.29H.sub.32O.sub.5, [M+H].sup.+ found: 461.3.

    Step 11

    [0862] Compound 1-n (2 g, 4.34 mmol), N,N-diisopropylethylamine (DIEA, 1.43 mL, 8.68 mmol) and HATU (2.47 g, 6.51 mmol) were dissolved in DMF (10 mL). A solution of compound 1-o in DMF (5 mL) was added at room temperature. The reaction mixture was stirred at room temperature for 8 h. After the reaction was complete, water was added to quench the reaction. The aqueous phase was extracted with ethyl acetate. The combined organic phases were washed first with water and then with saturated brine (20 mL), then concentrated under reduced pressure to evaporate the solvent, purified by reversed-phase preparative HPLC (column: Boston Green ODS 150×30 mm×5 μm, conditions: 25-80% (A: water 0.075% NH.sub.3.Math.H.sub.2O, B: CH.sub.3CN), flow rate: 55 mL/min), and lyophilized to give compound 1-p (2.4 g). MS m/z: C.sub.33H.sub.39NO.sub.7, [M+H].sup.+ found: 562.4.

    Step 12

    [0863] Compound 1-p (2.4 g, 4.27 mmol) was dissolved in 15 mL of a mixed solution of methanol and water (2:1). LiOH (0.36 g, 8.54 mmol) was added at room temperature. The mixture was stirred overnight. After the reaction was complete, the mixture was concentrated under reduced pressure to evaporate the solvent, purified by reversed-phase preparative HPLC (column: Boston Green ODS 150×30 mm×5 μm, conditions: 25-75% (A: water 0.075% NH.sub.3.Math.H.sub.2O, B: CH.sub.3CN), flow rate: 55 mL/min), and lyophilized to give compound 1-p (2 g).

    [0864] MS m/z: C.sub.32H.sub.37NO.sub.7, [M+H].sup.+ found: 548.6.

    Step 13

    [0865] Compound 1-q (0.37 g, 0.69 mmol), DIEA (0.19 mL, 1.15 mmol) and HATU (0.32 g, 0.86 mmol) were dissolved in 2 mL of DMF. A solution of compound 1-1 (0.9 g, 0.69 mmol) in DMF (2 mL) was added at room temperature. The mixture was stirred at room temperature overnight. After the reaction was complete, the reaction mixture was diluted with dichloromethane (10 mL) and washed successively with saturated NaHCO.sub.3 (20 mL) and saturated brine (20 mL). The organic phase was dried over anhydrous Na.sub.2SO.sub.4, filtered and then concentrated under reduced pressure. The residue was purified by reversed-phase preparative HPLC (column: Boston Green ODS 150×30 mm×5 μm, conditions: 25-65% (A: water 0.075% NH.sub.31120, B: CH.sub.3CN), flow rate: 45 mL/min) and lyophilized to give compound 1-r (0.5 g).

    [0866] MS m/z: C.sub.102H.sub.147N.sub.9O.sub.37, [M−H].sup.+ found: 2088.5.

    Step 14

    [0867] Compound 1-r (300 mg, 0.14 mmol) and succinic anhydride (28.70 mg, 0.28 mmol) were dissolved in tetrahydrofuran. DMAP (3.50 mg, 0.028 mmol) was added to the reaction mixture, and the mixture was stirred at 40° C. overnight. After the reaction was complete, methanol (18.8 mg) was added. The reaction mixture was stirred for 10 min, then diluted with dichloromethane (3 mL) and washed twice with saturated NaHCO3 (5 mL). The organic phase was concentrated to dryness under reduced pressure and purified by reversed-phase preparative HPLC (column: Boston Green ODS 150×30 mm×5 μm, conditions: 25-65% (A: water 0.075% NH.sub.3.Math.H.sub.2O, B: CH.sub.3CN), flow rate: 35 mL/min) and lyophilized to give compound 1-s (140 mg).

    [0868] MS m/z: C.sub.106H.sub.151N.sub.9O.sub.40, [M−H].sup.+ found: 2189.4.

    Step 15

    [0869] The compound 1-r (140 mg, 64 μmmol) obtained in the previous step was added to acetonitrile (5 mL). Then HBTU (48.7 mg, 128 μmol) was added, a surface amino-modified solid-phase support (CPG-NH2, 2.3 g) was added, and DIEA (41.5 mg, 320 μmol, 55 μL) was added. The mixture was reacted with shaking at 30° C. for 16 h. After the reaction was complete, the mixture was filtered and washed successively with methanol (8 mL×4) and dichloromethane (8 mL×4). The solid was added to pyridine:acetic anhydride (v:v=4:1, 10.0 mL), and the mixture was reacted with shaking at 30° C. for another 16 h. After the reaction was complete, the mixture was filtered and washed successively with methanol (8 mL×4) and dichloromethane (8 mL×4) to give compound 1-t linked to the solid-phase support (2.1 g).

    Example 7. Galactosamine Compound 2-e Linked to Solid-Phase Support

    [0870] ##STR00199##

    [0871] The synthesis schemes are as follows:

    1) Synthesis of Compound 2-b

    [0872] ##STR00200##

    2) Synthesis of Compound 2-e

    [0873] ##STR00201##

    Step 1

    [0874] Compound 2-a (1.00 g, 2.37 mmol) was added to THF (7.5 mL) and H.sub.2O (7.5 mL), and then LiOH.Math.H.sub.2O (109 mg, 2.60 mmol) was added. The reaction mixture was stirred at 16° C. for 16 h. After the reaction was complete, the solvent was removed by evaporation under reduced pressure. The residue was further lyophilized to give a white compound 2-b (960 mg, 2.32 mmol, yield: 97.8%).

    [0875] .sup.1HNMR: (400 MHz, DMSO-d.sub.6) δ 7.44 (d, J=8.4 Hz, 2H), 7.34-7.23 (m, 6H), 7.22-7.15 (m, 1H), 6.86 (d, J=8.0 Hz, 4H), 3.73 (s, 6H), 3.66 (d, J=6.4 Hz, 1H), 3.32 (d, J=12.0 Hz, 1H), 3.11 (dd, J=2.0, 9.2 Hz, 1H), 2.85 (t, J=8.8 Hz, 1H).

    [0876] MS m/z: C.sub.24H.sub.24O.sub.6, found: m/z: 407.2.

    Step 2

    [0877] Compound 1-1 (500 mg, 0.30 mmol) was added to dichloromethane (3 mL), then compound 2-b (0.14 g, 0.34 mmol) was added at 15° C. to the reaction, and HBTU (142 mg, 375 μmol) and DIEA (115 mg, 895 μmol) were added at 0° C. The mixture was reacted at 15° C. for 16 h. After the reaction was complete, the reaction mixture was diluted with dichloromethane (10 mL) and washed successively with saturated NaHCO.sub.3 (20 mL) and saturated brine (20 mL). The organic phase was dried over anhydrous Na2SO4, filtered and then concentrated under reduced pressure. The residue was purified by preparative liquid chromatography (column: Welch Xtimate C18 250×70 mm #10 μm; mobile phase: [water-ACN]; B %: 40% to 66%, 18 min) to give compound 2-c.

    [0878] MS m/z: C.sub.94H.sub.134N.sub.8O.sub.36, [M−H].sup.+ found: 1952.1.

    Step 3

    [0879] Compound 2-c (230 mg, 0.12 mmol) and succinic anhydride (23.5 mg, 0.26 mmol) were dissolved in a dichloromethane solution (2 mL). DMAP (43.1 mg, 0.35 mmol) was added to the reaction mixture. The mixture was stirred at 15° C. for 16 h. After the reaction was complete, methanol (18.8 mg) was added. The reaction mixture was stirred for 10 min, then diluted with dichloromethane (3 mL) and washed twice with saturated NaHCO.sub.3. The reaction mixture was concentrated to dryness under reduced pressure to give compound 2-d (240 mg, crude).

    [0880] MS m/z: C106H151N9O40, [M−H].sup.+ found: m/2z: 2070.2

    Step 4

    [0881] The compound 2-d (240 mg, 116 μmmol) obtained in the previous step was added to acetonitrile (8 mL). Then HBTU (88.7 mg, 233 μmol) was added, a surface amino-modified solid-phase support (CPG-NH2, 4 g) was added, and DIEA (75.5 mg, 584 μmol, 101 μL) was added. The mixture was reacted with shaking at 30° C. for 16 h. After the reaction was complete, the mixture was filtered and washed successively with methanol (8 mL×4) and dichloromethane (8 mL×4). The solid was added to pyridine:acetic anhydride (v:v=4:1, 10.0 mL), and the mixture was reacted with shaking at 30° C. for another 16 h. After the reaction was complete, the mixture was filtered and washed successively with methanol (8 mL×4) and dichloromethane (8 mL×4) to give the target product compound 2-e linked to the solid-phase support (3.7 g).

    Example 8. Galactosamine Compound 3-n Linked to Solid-Phase Support

    [0882] ##STR00202##

    [0883] The synthesis schemes are as follows:

    1) Synthesis of Compound 3-d

    [0884] ##STR00203##

    2) Synthesis of Compound 3-g

    [0885] ##STR00204##

    3) Synthesis of Compound 3-n

    [0886] ##STR00205##

    ##STR00206##

    Step 1

    [0887] The starting material 3-a (78.8 g, 202 mmol) and the starting material 3-b (40 g, 168 mmol) were dissolved in DCE (250 mL). CF.sub.3SO.sub.3H (4.15 g, 8.43 mmol) was added at 15° C. Then the reaction mixture was heated to 75° C. and stirred for 2 h. After the reaction was complete, 1 L of saturated NaHCO.sub.3 was added to terminate the reaction. The organic phase was separated, washed with 1 L of saturated brine, dried over anhydrous Na.sub.2SO.sub.4 and filtered. The filtrate was distilled under reduced pressure and purified by silica gel column chromatography (petroleum ether:ethyl acetate=5:1 to 0:1) to give the target product 3-c (63.2 g, 107 mmol, yield: 63.5%).

    [0888] .sup.1HNMR:(400 MHz, CDCl.sub.3) δ 7.35-7.26 (m, 5H), 5.88 (s, 1H), 5.34-5.25 (m, 2H), 4.65 (d, J=8.4 Hz, 1H), 4.16-4.13 (m, 2H), 3.92-3.87 (m, 3H), 3.18-3.17 (m, 1H), 3.15-3.14 (m, 2H), 2.16-1.91 (m, 15H), 1.58-1.50 (m, 5H), 1.49-1.36 (m, 2H).

    [0889] MS m/z: C.sub.24H.sub.40N.sub.2O.sub.11, found: m/z: 567.4.

    Step 2

    [0890] The compound 3-c (60.0 g, 106 mmol) obtained above was added to 360 mL of THF. Pd/C (15.0 g, 10% purity) was added under argon, and then TFA (12.1 g, 106 mmol, 7.84 mL) was added. Hydrogen gas was introduced into the reaction solution, and the gas pressure was maintained at 30 Psi. The reaction solution was heated to 30° C. and stirred for 16 h. After the reaction was complete, the reaction mixture was filtered, and the filtrate was concentrated under reduced pressure. The residue was diluted with dichloromethane and concentrated under reduced pressure; the process was repeated three times (500 mL×3). The residue was dried under reduced pressure to give a light yellow compound 3-d (44 g, 102 mmol, yield: 96.1%).

    Step 3

    [0891] Compound 3-e (60.0 g, 447 mmol) was dissolved in DMF (300 mL). K.sup.2CO.sub.3 (92.7 g, 671 mmol) was added, and BnBr (115 g, 671 mmol, 79.7 mL) was added dropwise at 0° C. The reaction mixture was stirred at 25° C. for 6 h. The reaction mixture was poured into crushed ice and then extracted with ethyl acetate (100 mL×6). The organic phase was washed successively with water (100 mL×2) and saturated brine (100 mL×3). The organic phase was dried over anhydrous sodium sulfate and distilled under reduced pressure to remove the solvent. The residue was purified by silica gel column chromatography (petroleum ether:ethyl acetate=2:1 to 0:1) to give compound 3-f as a white solid (60.3 g, 269 mmol, yield: 60.1%).

    [0892] .sup.1HNMR: (400 MHz, CDCl.sub.3) δ 7.37-7.26 (m, 5H), 5.18 (d, J=4.4 Hz, 2H), 3.95-3.90 (m, 2H), 3.75-3.71 (m, 2H), 1.08 (s, 1H).

    [0893] MS m/z: C.sub.12H.sub.16O.sub.4, found: m/z: 223.5.

    Step 4

    [0894] Compound 3-f (50.0 g, 223 mmol) was dissolved in dichloromethane (300 mL). Pyridine (73.5 g, 929 mmol, 75 mL) and a solution of p-nitrophenyl chloroformate (180 g, 892 mmol) in dichloromethane (50 mL) were added. The reaction mixture was stirred at 25° C. under nitrogen for 24 h. After the reaction was complete, the mixture was diluted with dichloromethane (250 mL) and washed successively with a NaHSO.sub.4 solution (30 mL×3) and saturated brine (30 mL×2). The organic phase was dried over MgSO.sub.4, filtered and concentrated under reduced pressure to evaporate the solvent. The resulting crude product was purified by silica gel column chromatography (petroleum ether:ethyl acetate=3:1) to give the target compound 3-g (37.0 g, 66.7 mmol, yield: 29.9%).

    [0895] MS m/z: C.sub.26H.sub.22N.sub.2O.sub.12, found: m/z: 553.4.

    Step 5

    [0896] Compound 3-g (22.0 g, 39.7 mmol) was added to acetonitrile (120 mL), and triethylamine (24.1 g, 238 mmol, 33.1 mL) was added under nitrogen. The reaction mixture was cooled to 0° C., and a solution of compound 3-d (42.1 g, 40 mmol) in acetonitrile (120 mL) was added dropwise. The reaction mixture was warmed to 25° C. and stirred for 1 h. After the reaction was complete, the mixture was concentrated under reduced pressure to remove the solvent and then purified by silica gel column chromatography (petroleum ether:ethyl acetate=2:1) to give the target compound 3-h (37.0 g, 12.0 mmol, yield: 30.2%).

    [0897] MS m/z: C.sub.52H.sub.76N.sub.4O.sub.24, found: m/z: 1141.8.

    Step 6

    [0898] Compound 3-h (11.0 g, 9.64 mmol) was dissolved in ethyl acetate (60 mL). Pd/C (2.00 g, 10% purity) was added. Hydrogen gas was introduced into the reaction solution, and the gas pressure was maintained at 40 Psi. The reaction solution was stirred at 25° C. for 8 h. After the reaction was complete, the mixture was filtered and concentrated to dryness by evaporation under reduced pressure to give the target compound 3-i (10.0 g, 9.42 mmol, yield: 97.7%).

    [0899] .sup.1HNMR: (400 MHz, DMSO-d.sub.6) δ 7.79 (d, J=9.2 Hz, 2H), 7.10 (s, 2H), 5.74 (t, J=1.6 Hz, 2H), 5.21 (d, J=3.6 Hz, 2H), 4.98-4.95 (m, 2H), 4.48 (d, J=8.4 Hz, 2H), 4.02 (d, J=4.8 Hz, 11H), 3.87-3.84 (m, 2H), 3.69-3.67 (m, 2H), 3.41-3.39 (m, 2H), 2.94-2.90 (m, 4H), 2.10 (s, 5H), 1.99 (s, 7H), 1.89 (s, 6H), 1.77 (s, 6H), 1.47-1.35 (m, 8H), 1.26-1.24 (m, 4H), 1.23-1.08 (m, 3H).

    [0900] MS m/z: C.sub.45H.sub.70N.sub.4O.sub.24, found: m/z: 1051.4.

    Step 7

    [0901] Compound 3-i (5.00 g, 4.76 mmol) was added to a mixed solvent of dichloromethane (30 mL) and DMF (30 mL), then compound 33 (312 mg, 2.38 mmol) was added, and HBTU (1.80 g, 4.76 mmol) and DIEA (615 mg, 4.76 mmol) were added. The reaction mixture was stirred at 25° C. for 12 h. After the reaction was complete, the reaction mixture was poured into ethyl acetate (100 mL), then washed with saturated brine, dried over anhydrous Na.sub.2SO.sub.4, filtered and concentrated under reduced pressure to evaporate the solvent. The residue was purified by preparative HPLC to give the target compound 3-k (2.1 g, 956 μmol, yield: 20.1%).

    [0902] .sup.1HNMR: (400 MHz, DMSO-d.sub.6) δ 7.84-7.81 (m, 5H), 7.12-7.07 (m, 3H), 5.21 (d, J=3.6 Hz, 4H), 4.99-4.96 (m, 4H), 4.49 (d, J=8.4 Hz, 4H), 4.06-4.00 (m, 24H), 3.88-3.86 (m, 4H), 3.55-3.52 (m, 4H), 3.49-3.43 (m, 4H), 3.25-3.05 (m, 4H), 2.94-2.93 (m, 8H), 2.11 (s, 12H), 2.00 (s, 16H), 1.90 (s, 12H), 1.78 (s, 12H), 1.46-1.44 (m, 8H), 1.38-1.35 (m, 8H), 1.26-1.24 (m, 8H), 1.18-1.16 (m, 6H), 1.09-0.99 (m, 2H).

    [0903] MS m/z: C.sub.96H.sub.153N.sub.11O.sub.46, found: m/z: 2197.5.

    Step 8

    [0904] Compound 3-k (100 mg, 45.5 μmol) was added to DMF (1 mL), then compound 2-b (21.1 mg, 54 μmol) was added to the reaction, and HBTU (21.8 mg, 57.3 μmol) and DIEA (17.7 mg, 136 μmol) were added. The mixture was reacted at 15° C. for 16 h. After the reaction was complete, the reaction mixture was diluted with dichloromethane (10 mL) and washed successively with saturated NaHCO.sub.3 and saturated brine. The organic phase was dried over anhydrous Na.sub.2SO.sub.4, filtered and then concentrated under reduced pressure. The residue was purified by preparative liquid chromatography (column: Phenomenex Gemini-NX 150×30 mm×5 μm; mobile phase: [water-ACN]; B %: 35% to 75%, 12 min) to give compound 3-1. MS m/z: C.sub.120H.sub.175N.sub.11O51, found: 2586.9.

    Step 9

    [0905] Compound 3-1 (14 mg, 5.4 μmol) and succinic anhydride (1.08 mg, 10.8 μmol) were dissolved in a dichloromethane solution (1 mL). DMAP (2.0 mg, 16 μmol) and TEA (1.1 mg, 10.8 μmol, 1.5 μL) were added to the reaction mixture. The mixture was stirred at 15° C. for 16 h. After the reaction was complete, methanol (0.9 mg) was added. The reaction mixture was stirred for 10 min, then diluted with dichloromethane and washed twice with saturated NaHCO.sub.3. The reaction mixture was concentrated to dryness under reduced pressure to give compound 3-m (18 mg).

    [0906] MS m/z: C.sub.124H.sub.179N.sub.11O.sub.54, found: 2687.2.

    Step 10

    [0907] The compound 3-m (18 mg, 6.7 μmmol) obtained in the previous step was added to acetonitrile (3 mL). Then HBTU (5.1 mg, 13.4 μmol) was added, a surface amino-modified solid-phase support (CPG-NH2, 200 mg) was added, and DIEA (4.3 mg, 33.5 μmol, 5.8 μL) was added. The mixture was reacted with shaking at 30° C. for 16 h. After the reaction was complete, the mixture was filtered and washed successively with methanol (2 mL×4) and dichloromethane (2 mL×4). The solid was added to pyridine:acetic anhydride (v:v=4:1, 2 mL), and the mixture was reacted with shaking at 30° C. for another 16 h. After the reaction was complete, the mixture was filtered and washed successively with methanol and dichloromethane to give the target product compound 3-n linked to the solid-phase support (200 mg).

    Example 9. Galactosamine Compound 4-c Linked to Solid-Phase Support

    [0908] ##STR00207##

    [0909] The synthesis schemes are as follows:

    1) Synthesis of Compound 4-c

    [0910] ##STR00208##

    Step 1

    [0911] Compound 3-k (149.5 mg, 68 μmmol), DIEA (141.0 mg, 1.09 mmol), 3A molecular sieve (500 mg) and DEPBT (163.4 mg, 0.55 mmol) were dissolved in 5 mL of DCM. Compound 1-q (400 mg, 0.18 mmol) was added at room temperature. The mixture was stirred at room temperature overnight. After the reaction was complete, the molecular sieve was filtered out. The filtrate was concentrated to dryness by rotary evaporation, purified by reversed-phase preparative HPLC (column: Boston Green ODS 150×30 mm×5 μm, conditions: 5-50% (A: water, B: CH.sub.3CN), flow rate: 45 mL/min), and lyophilized to give compound 4-a (118 mg, 32 μmmol, yield: 62.6%).

    [0912] MS m/z: C.sub.128H.sub.188N.sub.12O.sub.52, found: [M+HCOO.sup.−]=2770.6.

    Step 2

    [0913] Compound 4-a (110 mg, 4.0 μmol), DMAP (7.4 mg, 40 μmol), 3A molecular sieve (100 mg) and succinic anhydride (11.9 mg, 120 μmol) were dissolved in 5 mL THF. The mixture was stirred at 40° C. under argon for 4 h. After the reaction was complete, the molecular sieve was filtered out. The filtrate was concentrated to dryness by rotary evaporation, purified by reversed-phase preparative HPLC (column: Boston Green ODS 150×30 mm×5 μm, conditions: 5-50% (A: water, B: CH.sub.3CN), flow rate: 45 mL/min), and lyophilized to give compound 4-b (80 mg, 28.3 μmmol, yield: 70.8%).

    [0914] MS m/z: C.sub.132H.sub.192N.sub.12O.sub.55, [M−H].sup.+ found: 2824.6.

    Step 3

    [0915] The compound 38 (71 mg, 25 μmmol) obtained in the previous step was added to acetonitrile (5 mL). Then HBTU (19.0 mg, 50 μmol) was added, a surface amino-modified solid-phase support (CPG-NH2, 0.86 g) was added, and DIEA (16.2 mg, 125 μmol, 21.6 μL) was added. The mixture was reacted with shaking at 30° C. for 16 h. After the reaction was complete, the mixture was filtered and washed successively with methanol (5 mL×4) and dichloromethane (5 mL×4). The solid was added to pyridine:acetic anhydride (v:v=4:1, 6.0 mL), and the mixture was reacted with shaking at 30° C. for another 16 h. After the reaction was complete, the mixture was filtered and washed successively with methanol and dichloromethane to give compound 4-c linked to the solid-phase support (0.74 g).

    Example 10. Preparation of Control Compound L96

    [0916] ##STR00209##

    [0917] The control compound L96 was prepared using the method described in the patent WO2014025805A1.

    Example 11. Synthesis of Galactosamine Molecule Cluster-Conjugated siRNAs

    [0918] An siRNA used for testing, the siRNA targeting the mRNA of the mouse TTR gene (Molecular Therapy Vol. 26 No 3 Mar. 2018), is shown below. A galactosamine molecule cluster M was linked to the 3′ end of the SS strand by a covalent bond.

    [0919] SS strand (5′-3′): CmsAmsGmUmGfUmUfCfUfUmGmCmUmCmUmAmUmAm Am-M

    [0920] AS strand (5′-3′): UmsUfsAmUmAmGfAmGmCmAmAmGmAmAfCm AfCmUmGmsUmsUm

    [0921] Reference was made to the aforementioned phosphoramidite solid-phase synthesis method, and the difference was that in synthesizing the SS strand, a CPG support to which a galactosamine cluster was linked was used in place of the Universal-CPG support.

    [0922] The synthesis is briefly described below: Nucleoside phosphoramidite monomers were linked one by one according to the synthesis program on a Dr. Oligo48 synthesizer (Biolytic), starting at the synthesized CPG support to which a galactosamine cluster was linked described above. The nucleoside monomer materials 2′-F RNA, 2′-O-methyl RNA, and other nucleoside phosphoramidite monomers were purchased from Hongene, Shanghai or Genepharma, Suzhou. 5-Ethylthio-1H-tetrazole (ETT) was used as an activator (a 0.6 M solution in acetonitrile), a 0.22 M solution of PADS in acetonitrile and collidine (1:1 by volume) (Kroma, Suzhou) as a sulfurizing agent, and iodopyridine/water solution (Kroma) as an oxidant.

    [0923] After completion of solid phase synthesis, oligoribonucleotides were cleaved from the solid support and soaked in a solution of 28% ammonia water and ethanol (3:1) at 50° C. for 16 h. The mixture was centrifuged, and the supernatant was transferred to another centrifuge tube. After the supernatant was concentrated to dryness by evaporation, the residue was purified by C18 reversed-phase chromatography using 0.1 M TEAA and acetonitrile as the mobile phase, and DMTr was removed using 3% trifluoroacetic acid solution. The target oligonucleotides were collected, then lyophilized, identified as the target products by LC-MS, and quantified by UV (260 nm).

    [0924] The resulting single-stranded oligonucleotides were paired in an equimolar ratio in a complementary manner and annealed with the AS strand. The final double-stranded siRNA was dissolved in 1×PBS, and the solution was adjusted to the concentration required for the experiment.

    [0925] The galactosamine cluster-conjugated siRNAs were synthesized. The siRNAs used in the experiment target the mouse TTR mRNA. M=

    ##STR00210##

    TABLE-US-00013 TABLE 13 Targeting ligand activity evaluation siRNA numbering and sequences SIRNA compound SEQ ID SEQ ID No. NO SS strand (5′-3′) NO AS strand (5′-3′) S-1 SEQ ID CmsAmsGmUmGfUmUfCfU SEQ ID UmsUfsAmUmAmGfAmGmC NO: 49 fUmGmCmUmCmUmAmUm NO: 50 mAmAmGmAmAfCmAfCmU AmAm-NAG1 mGmsUmsUm S-2 SEQ ID CmsAmsGmUmGfUmUfCfU SEQ ID UmsUfsAmUmAmGfAmGmC NO: 51 fUmGmCmUmCmUmAmUm NO: 52 mAmAmGmAmAfCmAfCmU AmAm-NAG2 mGmsUmsUm S-3 SEQ ID CmsAmsGmUmGfUmUfCfU SEQ ID UmsUfsAmUmAmGfAmGmC NO: 53 fUmGmCmUmCmUmAmUm NO: 54 mAmAmGmAmAfCmAfCmU AmAm-NAG3 mGmsUmsUm S-4 SEQ ID CmsAmsGmUmGfUmUfCfU SEQ ID UmsUfsAmUmAmGfAmGmC NO: 55 fUmGmCmUmCmUmAmUm NO: 56 mAmAmGmAmAfCmAfCmU AmAm-NAG4 mGmsUmsUm S-L96 SEQ ID CmsAmsGmUmGfUmUfCfU SEQ ID UmsUfsAmUmAmGfAmGmC NO: 57 fUmGmCmUmCmUmAmUm NO: 58 mAmAmGmAmAfCmAfCmU AmAm-L96 mGmsUmsUm S-1-2 SEQ ID CmsAmsGmUmGfUmUfCfU SEQ ID UmsUfsAmUmAmGfAmGmC NO: 59 fUmGmCmUmCmUmAmUm NO: 60 mAmAmGmAmAfCmAfCmU AmsAms-NAG1 mGmsUmsUm S-L96-2 SEQ ID CmsAmsGmUmGfUmUfCfU SEQ ID UmsUfsAmUmAmGfAmGmC NO: 61 fUmGmCmUmCmUmAmUm NO: 62 mAmAmGmAmAfCmAfCmU AmAm-L96 mGmsUmsUm

    Example 12. Inhibition of mRNA Expression in Primary Hepatocytes by Galactosamine Molecule Cluster-Conjugated siRNAs

    [0926] Fresh primary hepatocytes were isolated from mice using the method reported by Severgini et al. (Cytotechnology. 2012; 64(2):187-195).

    [0927] After being isolated, the primary hepatocytes were inoculated into a 24-well plate at 100 thousand cells per well. The test siRNAs were added at final concentrations of 50 nM, 10 nM, 2 nM, 0.4 nM, 0.08 nM, 0.016 nM, 0.0032 nM and 0.00064 nM. Subsequently, the primary hepatocytes were cultured at 37° C. with 5% CO.sub.2 for 24 h. After 24 h, the mTTR's mRNA expression level was determined using the qPCR method.

    [0928] As shown in FIGS. 4, S-1, S-2, S-3 and S-4 all exhibited excellent inhibition efficiency against mTTR gene expression. The IC50 values of S-1 and S-4 are lower than those of the other two groups. The IC50 value of the control group S-L96 is 0.280 nM, while the IC50 value of S-1 is 0.131 nM and that of S-4 is 0.135 nM, which indicates that siRNAs conjugated with the S-1 and S-4 compounds have better efficiency of being taken by primary hepatocytes in vitro than the control group, and that the S-1 and S-4 compounds can more efficiently mediate the entry of siRNA into primary hepatocytes.

    Example 13. In Vivo Inhibition of mRNA Expression by Galactosamine Molecule Cluster-Conjugated siRNAs

    [0929] 8-week-old C57BL/6 mice (Joinnbio, SPF, female) were injected subcutaneously with the siRNAs described above. On day 1, 100 μL of solution containing PBS or a dose (1 mg/kg (mpk) or 0.2 mpk) of a corresponding siRNA (S-L96, S-3, S-2, S-4 or S-1) formulated in PBS was injected subcutaneously into the loose skin on the neck and shoulder of the mice. In each group, 6 mice were given injections.

    [0930] Three days after administration, the mice were sacrificed by cervical dislocation, and the mTTR's mRNA expression levels in the liver tissues of the mice were determined by qPCR.

    [0931] As shown in FIGS. 5, S-1, S-2, S-3 and S-4 all exhibited excellent inhibition efficiency against mTTR gene expression. When administered at 1 mpk and 0.2 mpk, S-2, S-3, S-4 and the control group S-L96 showed similar activity. S-1 showed better activity than the control group S-L96 when administered at 1 mpk and 0.2 mpk.

    Example 14. Long-Term Effectiveness Experiment for In Vivo Inhibition of mRNA Expression by Galactosamine Molecule Cluster-Conjugated siRNAs

    [0932] Two siRNA compounds S-1-2 and S-L96-2 (see Table 13 for their SS and AS strands) were synthesized using the synthesis method in Example 11 and used for in vivo administration to mice. 8-week-old C57BL/6 mice (Joinnbio, SPF, female) were injected subcutaneously with the galactosamine molecule cluster-conjugated siRNAs described above. On day 0, 100 μL of solution containing PBS (referred to as the Mock group, i.e., the blank control group) or a dose (1 mg/kg (mpk)) of a corresponding galactosamine molecule cluster-conjugated siRNA (S-1 or S-L96) formulated in PBS was injected subcutaneously into the loose skin on the neck and shoulder of the mice. In each group, 9 mice were given injections.

    [0933] Three mice were sacrificed by cervical dislocation 7 days, 14 days, and 28 days after administration. Two samples of liver tissue were collected from each mouse, and the mTTR's mRNA expression levels in the liver tissues of the mice were determined by qPCR.

    [0934] 7 days, 14 days and 28 days after administration, the mRNA ratios of S-1-2 relative to the PBS group were 0.13, 0.12 and 0.21, respectively, and the mRNA ratios of S-L96-2 relative to the PBS group were 0.17, 0.13 and 0.29, respectively.

    [0935] FIG. 6 also shows the mRNA expression levels in mouse liver tissue 7 days, 14 days and 28 days after administration of compounds S-1-2 and S-L96-2.

    [0936] The results show that the siRNA administered still showed efficient mRNA inhibition on day 28, and that S-1-2 had higher inhibition than the control group S-L96-2.

    III. Activity Verification

    Example 15. Synthesis of siRNA Conjugates

    [0937] Nucleoside monomers were linked one by one in the 3′-5′ direction in the order in which the nucleotides were arranged using the solid-phase phosphoramidite method. Each time a nucleoside monomer was linked, four reactions—deprotection, coupling, capping, oxidation and sulfurization—were involved. The sense strand and the antisense strand were synthesized under identical conditions.

    [0938] Oligonucleotide synthesis instrument models: a Biolytic Dr. Oligo 48 oligonucleotide solid-phase synthesizer and a GE oligo pilot100 oligonucleotide solid-phase synthesizer.

    TABLE-US-00014 TABLE 14 Reagents used in the synthesis of siRNA conjugates Reagent Reagent name composition Specification Use Manufacturer ACT 0.6 M ETT in ACN 4L Catalyst Kroma Cap A N-methylimidazole: 4L Capping Kroma acetonitrile 2:8 Cap B1 Acetic anhydride: 4L reagent Kroma acetonitrile 40:60 Cap B2 Pyridine: 4L Kroma acetonitrile 60:40

    [0939] Detection method: The purity of the sense and antisense strands described above was determined and the molecular weights were analyzed using Waters Acquity UPLC-SQD2 LCMS (column: ACQUITY UPLC BEH C18). The found values agreed with the calculated values, which indicates that what had been synthesized were sense strands conjugated by molecules at the 3′ end and antisense strands. The siRNAs had the sense and antisense strands shown in Table 15.

    TABLE-US-00015 TABLE 15 Synthesis of siRNA and siRNA conjugate sequences Double SEQ ID SEQ ID strand No. NO Sense strand 5′-3′ NO Antisense strand 5′-3 Naked SEQ ID GUG UGC ACU UCG CUU SEQ ID AGU GAA GCG AAG UGC sequence 1 NO: 63 CACC NO: 64 ACA CGG TRD006890 SEQ ID GmsUmsGm UmGfCm SEQ ID AmsGfsUm GfAmAf NO: 65 AfCfUf UmCmGm NO: 66 (−)hmpNA(G)CmGm CmUmUm CmAmCms Cms- AfAmGf UmGfCm AfCmAf NAG1 CmsGmsGm TRD006924 SEQ ID GmsUmsGm UmGmCm SEQ ID AmsGfsUm GfAmAf NO: 67 AfCfUf UmCmGm NO: 68 (−)hmpNA(G)CmGm CmUmUm CmAmCms Cms- AfAmGf UmGfCm AfCmAf NAG1 CmsGmsGm Naked SEQ ID CUU UUG UCU UUG GGU SEQ ID AUA UAC CCA AAG ACA sequence 2 NO: 69 AUAU NO: 70 AAA GAA TRD006896 SEQ ID CmsUmsUm UmUfGm SEQ ID AmsUfsAm UfAmCf NO: 71 UfCfUf UmUmGm NO: 72 (−)hmpNA(C)CmAm GmGmUm AmUmAms Ums- AfAmGf AmCfAm AfAmAf NAG1 GmsAmsAm Naked SEQ ID UUA CCA AUU UUC UUU SEQ ID AAC AAA AGA AAA UUG sequence 3 NO: 73 UGU U NO: 74 GUA ACA TRD006897 SEQ ID UmsUmsAm CmCfAm SEQ ID AmsAfsCm AfAmAf NO: 75 AfUfUf UmUmCm NO: 76 (−)hmpNA(A)GmAm UmUmUm UmGmUms Ums- AfAmAf UmUfGm GfUmAf NAG1 AmsCmsAm Naked SEQ ID CGU GUG CAC UUC GCU SEQ ID AUG AAG CGA AGU GCA sequence 4 NO: 77 UCA C NO: 78 CAC GGU TRD006905 SEQ ID CmsGmsUm GmUfGm SEQ ID AmsUfsGm AfAmGf NO: 79 CfAfCf UmUmCm NO: 80 (−)hmpNA(C)GmAm GmCmUm UmCmAms Cms- AfGmUf GmCfAm CfAmCf NAG1 GmsGmsUm Naked SEQ ID UGU CUU UGG GUA UAC SEQ ID AAA UGU AUA CCC AAA sequence 5 NO: 81 AUUU NO: 82 GAC AAA TRD006894 SEQ ID UmsGmsUm CmUfUm SEQ ID AmsAfsAm UfGmUf NO: 83 UfGfGf GmUmAm NO: 84 (−)hmpNA(A)UmAm UmAmCm AmUmUms Ums- CfCmCf AmAfAm GfAmCf NAG1 AmsAmsAm Naked SEQ ID CUU UUG UCU UUG GGU SEQ ID sequence 6 NO: 85 AUAC NO: 86 AAA GAA TRD006895 SEQ ID CmsUmsUm UmUfGm SEQ ID AmsUfsAm UfAmCf NO: 87 UfCfUf UmUmGm NO: 88 (−)hmpNA(C)CmAm GmGmUm AmUmAms Cms- AfAmGf AmCfAm AfAmAf NAG1 GmsAmsAm Naked SEQ ID CAU CUU CUU GUU GGU SEQ ID AAG AAC CAA CAA GAA sequence 7 NO: 89 UCU U NO: 90 GAU GAG TRD006899 SEQ ID CmsAmsUm CmUfUm SEQ ID AmsAfsGm AfAmCf NO: 91 CfUfUf GmUmUm NO: 92 (−)hmpNA(C)AmAm GmGmUm UmCmUms Ums- CfAmAf GmAfAm GfAmUf NAG1 GmsAmsGm Naked SEQ ID UGU CUG CGG CGU UUU SEQ ID UGA UAA AAC GCC GCA sequence 8 NO: 93 AUCA NO: 94 GAC ACA TRD006900 SEQ ID UmsGmsUm CmUfGm SEQ ID UmsGfsAm UfAmAf NO: 95 CfGfGf CmGmUm NO: 96 (−)hmpNA(A)AmCm UmUmUm AmUmCms Ams- GfCmCf GmCfAm GfAmCf NAG1 AmsCmsAm Naked SEQ ID UGC ACU UCG CUU CAC SEQ ID AGA GGU GAA GCG AAG sequence 9 NO: 97 CUCU NO: 98 UGC ACA TRD006906 SEQ ID UmsGmsCm AmCfUm SEQ ID AmsGfsAm GfGmUf NO: 99 UfCfGf CmUmUm NO: 100 (−)hmpNA(G)AmAm CmAmCm CmUmCms Ums- GfCmGf AmAfGm UfGmCf NAG1 AmsCmsAm Naked SEQ ID GCA CUU CGC UUC ACC SEQ ID UAG AGG UGA AGC GAA sequence 10 NO: 101 UCU G NO: 102 GUG CAC TRD006907 SEQ ID GmsCmsAm CmUfUm SEQ ID UmsAfsGm AfGmGf NO: 103 CfGfCf UmUmCm NO: 104 (−)hmpNA(U)GmAm AmCmCm UmCmUms Gms- AfGmCf GmAfAm GfUmGf NAG1 CmsAmsCm Naked SEQ ID GGC GCU GAA UCC UGC SEQ ID AUC CGC AGG AUU CAG sequence 11 NO: 105 GGA C NO: 106 CGC CGA TRD006908 SEQ ID GmsGmsCm GmCfUm SEQ ID AmsUfsCm CfGmCf NO: 107 GfAfAf UmCmCm NO: 108 (−)hmpNA(A)GmGm UmGmCm GmGmAms Cms- AfUmUf CmAfGm CfGmCf NAG1 CmsGmsAm AD66810 SEQ ID GmsUmsGm UmGfCm SEQ ID UmsGfsUm GmAmAf NO: 109 AfCfUf UmCmGm NO: 110 GmCfGf AmAmGm CmUmUm CmAmCm Am- UmGfCm AfCmAm L96 CmsUmsUm AD81890 SEQ ID GmsUmsGm UmGfCm SEQ ID UmsGfsUm NO: 111 AfCfUf UmCmGm NO: 112 GmAmAGNA(A) GmCfGf CmUmUm CmAmCm Am- AmAmGm UmGfCm L96 AfCmAm CmsUmsUm TRD006912 SEQ ID GmsUmsGm UmGfCm SEQ ID UmsGfsUm GmAmAf NO: 113 AfCfUf UmCmGm NO: 114 G(GNA)CfGf AmAmGm CmUmUm CmAmCm Am- UmGfCm AfCmAm L96 CmsUmsUm [0940] wherein the nucleotide synthesized using 2-hydroxymethyl-1,3-propanediol as the starting material was defined as hmpNA; [0941] (−)hmpNA(A) was obtained by solid-phase synthesis using the nucleoside phosphoramidite monomer 1-1a of example section 1.1; [0942] (−)hmpNA(G) was obtained by solid-phase synthesis using the nucleoside phosphoramidite monomer 1-6a of example section 1.6; [0943] (−)hmpNA(C) was obtained by solid-phase synthesis using the nucleoside phosphoramidite monomer 1-8a of example section 1.8; [0944] (−)hmpNA(U) was obtained by solid-phase synthesis using the nucleoside phosphoramidite monomer 1-7a of example section 1.7.

    [0945] In Table 15, the structure of NAG1 is as shown in Example 11.

    Example 16. siRNA Activity and Off-Target Level Validation

    [0946] In vitro molecular level simulation on-target and off-target level screening was performed on the compounds of the present disclosure in HEK293A cells.

    [0947] On-target sequences and off-target sequences corresponding to the siRNA sequences were constructed and inserted into psiCHECK-2 plasmids. The plasmids contained the renilla luciferase gene and the firefly luciferase gene. The plasmids were dual reporter gene systems. The target sequence of siRNA was inserted into the 3′ UTR region of the renilla luciferase gene. The activity of siRNA for the target sequence was reflected by measuring the renilla luciferase expression after calibration with firefly luciferase. The measurement used Dual-Luciferase Reporter Assay System (Promega, E2940).

    [0948] HEK293A cells were cultured at 37° C. with 5% CO.sub.2 in a DMEM high glucose medium containing 10% fetal bovine serum. 24 h prior to transfection, the HEK293A cells were inoculated into a 96-well plate at a density of 10 thousand cells per well. Each well contained 100 μL of medium.

    [0949] The cells were co-transfected with siRNA and the corresponding plasmid using Lipofectamine2000 (ThermoFisher, 11668019) according to the instructions. 0.2 μL of Lipofectamine2000 was used for each well. The transfection amount of plasmid was 10 ng per well. For the on-target sequence plasmids and the off-target sequence plasmids, a total of 5 concentration points or 11 concentration points of siRNA were set up. In cases where 5 concentration points were set up, the highest concentration point in transfection was 10 nM, and 10-fold serial dilution was carried out. In cases where 11 concentration points were set up, the highest concentration point final concentration in transfection was 20 nM, and 3-fold serial dilution was carried out. 24 h after transfection, the off-target levels were determined using Dual-Luciferase Reporter Assay System (Promega, E2940).

    [0950] The results in Table 16 to Table 19 show that the compounds TRD006890 and TRD006924 of the present disclosure have low off-target activity while having high on-target activity, and are both significantly better than the positive control AD81890.

    [0951] The results in Table 20 show that the GNA modification was significantly sequence site-dependent. When the GNA modification site was in 5′ position 7 (TRD006912) or position 6 (AD81890) of the AS strand, off-target activity was higher, which indicates greater toxicity. Further, TRD006912 saw a further decrease in on-target activity (from 0.68 to 0.96) compared to AD81890.

    TABLE-US-00016 TABLE 16 TRD006890 activity and off-target IC50 value TRD006890 Transfection Remaining percentage of target gene's mRNA expression (mean) IC50 value concentration nM 20.000 6.67 2.22 0.74 0.25 0.082 0.027 0.0091 0.0030 0.0010 0.0003 (nM) On-target activity 0.28 0.21 0.14 0.16 0.24 0.44 0.73 0.95 0.99 1.02 1.00 0.08 Off-target activity 1.05 0.92 0.97 1.07 1.11 1.06 1.07 1.10 1.05 1.13 1.05 >3000

    TABLE-US-00017 TABLE 17 TRD006924 activity IC50 values TRD006924 Transfection Remaining percentage of target gene's mRNA expression (mean) IC50 value concentration nM 20.000 6.67 2.22 0.74 0.25 0.082 0.027 0.0091 0.0030 0.0010 0.0003 (nM) On-target activity 0.40 0.25 0.18 0.17 0.21 0.40 0.66 0.83 0.92 0.99 1.00 0.060 Off-target activity 0.88 0.83 0.92 1.06 1.04 1.04 1.01 1.02 1.04 0.98 1.00 133.4

    TABLE-US-00018 TABLE 18 AD81890 activity and off-target IC50 value AD81890 Transfection Remaining percentage of target gene's mRNA expression (mean) IC50 value concentration nM 20.0 6.67 2.22 0.74 0.25 0.082 0.027 0.0091 0.0030 0.0010 0.0003 (nM) On-target activity 0.12 0.11 0.23 0.41 0.75 0.93 1.00 1.05 1.02 1.04 1.03 0.68 Off-target activity 0.23 0.36 0.60 0.87 0.95 0.95 0.89 0.92 0.95 0.95 0.98 3.93

    TABLE-US-00019 TABLE 19 AD66810 activity and off-target IC50 value AD66810 Transfection Remaining percentage of target gene's mRNA expression (mean) IC50 value concentration nM 20.000 6.67 2.22 0.74 0.25 0.082 0.027 0.0091 0.0030 0.0010 0.0003 (nM) On-target activity 0.07 0.05 0.09 0.17 0.46 0.73 0.92 0.91 1.01 1.02 1.02 0.2 Off-target activity 0.05 0.06 0.14 0.30 0.63 0.88 0.96 0.96 1.03 1.07 1.12 0.4

    TABLE-US-00020 TABLE 20 TRD006912 activity and off-target IC50 value TRD006912 Transfection Remaining percentage of target gene's mRNA expression (mean) IC50 value concentration nM 20.000 6.67 2.22 0.74 0.25 0.082 0.027 0.0091 0.0030 0.0010 0.0003 (nM) On-target activity 0.26 0.22 0.31 0.51 0.75 0.91 0.95 0.99 1.05 1.02 0.98 0.96 Off-target activity 0.82 0.82 0.93 0.91 0.90 0.94 0.86 0.93 0.94 1.01 1.04 64.46

    Example 17. Evaluation of siRNA Compounds' In Vitro Anti-HBV Activity Using HepG2.2.15 Cells

    [0952] On day 1, HepG2.2.15 cells were inoculated into a 96-well plate at 20 thousand cells per well. While the cells were inoculated, the HepG2.2.15 cells were transfected with different concentrations of siRNA using RNAiMax. On day 4, the cell culture supernatant was collected and tested for HBsAg by ELISA (the remaining supernatant was frozen for later use). Finally, the cells were collected, and the RNA was extracted from the cells. The total HBV RNA (including 3.5 kb+2.4 kb+2.1kb+0.7 kb RNA) and 3.5 kb HBV RNA (including pgRNA+preCore RNA) were measured by RT-PCR, and meanwhile the GAPDH gene's RNA was measured as an internal reference. Five concentration points were set for the test compounds, and 2 replicate wells were assayed in parallel. The final concentration of DMSO in the culture was 0.5%.

    [0953] Percent inhibition was calculated using the formulas below:


    % HBsAg inhibition=(1−HBsAg content of sample/HBsAg content of DMSO control group)×100%


    HBV RNA inhibition=(1−HBV's RNA content of sample/HBV's RNA content of DMSO control group)×100%


    cell viability=(absorbance of sample−absorbance of culture control)/(absorbance of DMSO control−absorbance of culture control)×100.

    [0954] EC.sub.50 values were calculated by analysis using Graphpad Prism software (four parameter logistic equations).

    TABLE-US-00021 TABLE 21 Antiviral activity of compounds in HepG2.2.15 Compound HBsAg pgRNA Total RNA No. EC.sub.50 (nM) IC50 (nM) IC50 (nM) TRD006890 0.003 0.575 0.612 TRD006924 0.008 0.010 0.068 AD81890 0.053 0.620 0.207 AD66810 0.092 0.163 1.639 TRD006894 0.027 0.409 0.752 TRD006895 0.1693 0.707 0.790 TRD006896 0.002 0.373 0.584 TRD006897 0.008 0.122 0.211 TRD006899 NA 2.805 NA TRD006900 0.142 NA 1.640 TRD006905 NA 0.228 0.845 TRD006906 0.034 0.576 0.521 TRD006907 0.020 0.836 0.847 TRD006908 0.022 0.331 0.311 NA: undetectable.

    [0955] As shown in Table 21, referring to the control compounds AD66810 and AD81890 and the test indicators for antiviral activity, the test compounds TRD006890, TRD006894, TRD006895, TRD006896, TRD006897, TRD006899, TRD006900, TRD006905, TRD006906, TRD006907 and TRD006908 exhibited excellent antiviral activity on HepG2.2.15 cells.

    Example 18. Evaluation of siRNA Compounds' In Vitro Anti-HBV Infection Activity Using Primary Human Hepatocytes

    [0956] On day 0, primary human hepatocytes were inoculated into a 48-well plate at 120 thousand cells per well. While the cells were inoculated, test compounds were added. siRNA was transferred into primary human hepatocytes in a free uptake manner. siRNA was 5-fold diluted from a starting concentration of 200 nM to 7 concentrations. On day 1, the type D HBV was added to infect the primary human hepatocytes. On day 2, day 4 and day 6, the media were replaced with fresh media. The final concentration of DMSO in the cultures was 2%. On day 8, the cell culture supernatant was collected and tested for HBV DNA by qPCR, and for HBeAg and HBsAg by ELISA. Seven concentration points were set for the test compounds and the control compound, and 2 replicate wells were assayed in parallel.

    TABLE-US-00022 TABLE 22 Antiviral activity of compounds in primary human hepatocytes Concentration HBsAg HBeAg HBV DNA Compound (nM) inhibition (%) inhibition (%) inhibition (%) AD81890 200    87.60 ± 0.00  81.95 ± 0.92  88.48 ± 2.13  TRD006924 97.55 ± 0.07* 96.05 ± 0.21* 96.98 ± 0.08* AD81890 40   87.55 ± 1.48  80.95 ± 1.20  88.78 ± 2.21  TRD006924 95.80 ± 0.42* 92.55 ± 0.64* 95.51 ± 0.76  AD81890 8   77.10 ± 2.12  68.90 ± 2.26  75.47 ± 2.49  TRD006924 89.35 ± 0.78* 82.80 ± 0.28* 90.34 ± 1.27* AD81890 1.6 56.70 ± 0.57  43.55 ± 3.32  56.74 ± 4.33  TRD006924 66.30 ± 2.26* 59.20 ± 0.71* 74.37 ± 3.09* *indicates that there was a significant difference (p < 0.05) in the results of the same test indicator between TRD006924 and AD81890 when they were at the same concentration.

    [0957] As shown in table 22, referring to the control compound AD81890 and the test indicators for antiviral activity, the test compound TRD006894 exhibited significantly better antiviral activity on primary human hepatocytes.

    Example 19. In Vivo Anti-HBV Activity of siRNA Compounds

    [0958] On day 28, mice (C57BL/6, male) were injected with rAAV8-1.3HBV via tail vein. On day 14 and day 21 after virus injection, blood was collected from the submandibular veins of all the experimental mice so as to collect plasma. The HBV DNA content, the HBeAg content and the HBsAg content of the plasma were measured.

    [0959] On day 28 after virus injection, the mice were randomized into groups based on the test results of the plasma samples on day 14 and day 21 after virus injection.

    [0960] All the mice were dosed subcutaneously once at 3 mg/kg on day 28 after virus injection. Before administration, submandibular blood was collected from all the mice so as to collect plasma, which was then tested for HBV DNA, HBeAg, HBsAg and ALT. The day of administration was day 0. On day 7, day 14 and day 21 after administration, submandibular blood was collected from all the mice so as to collect plasma for tests. HBV DNA in the plasma was quantified by qPCR. HBeAg and HBsAg in the plasma were quantified by ELISA.

    [0961] On day 7, compared to the control compound AD81890, the test compound TRD006894 exhibited excellent antiviral activity in mice. The test compound TRD006894 can maintain the activity in vivo for a long time: it can effectively inhibit the virus activity on both day 14 and day 21.

    TABLE-US-00023 TABLE 23 In vivo anti-HBV activity of compounds Time HBsAg HBeAg HBV DNA Compound (days) inhibition (%) inhibition (%) inhibition (%) PBS  7 62.2 ± 16.3 92.1 ± 9.3  66.0 ± 22.0 AD81890 20.8 ± 8.5  TRD006924  7.3 ± 4.6 #  33.4 ± 5.7 #    7.8 ± 6.2 *# PBS 14 157.8 ± 73.2   199.7 ± 88.4  94.8 ± 38.0 TRD006924 11.3 ± 6.3 #   58.8 ± 12.1 #  24.5 ± 16.9 # PBS 21  93.8 ± 47.4  93.2 ± 9.8  143.2 ± 57.9  TRD006924   15.9 ± 12.0 #   58.3 ± 13.2 #   39.2 ± 33.6 # * indicates that there was a significant difference (p < 0.05) in the results of the same test indicator on the same day of testing between TRD006924 and AD81890 when they were at the same concentration. # indicates that there was a significant difference (p < 0.05) in the results of the same test indicator on the same day of testing between TRD006924 and PBS.

    Example 20. Design and Synthesis of Human ApoC3 siRNAs

    [0962] 1) siRNA design: the human ApoC3 gene (NM_000040.3) was used as the target gene to meet the general rules for active siRNA to design 19/21nt siRNAs. The sequences of the unmodified sense strand and antisense strand are detailed in Table 14, wherein the SS strand and the AS strand of the unmodified siRNA are both unmodified.

    [0963] 2) siRNA synthesis: siRNAs were synthesized on a Dr.Oligo48 synthesizer (Biolytic) in a specification of 200 nmol using universal solid support (Biocomma, Shenzhen)-mediated phosphoramidite chemistry. The target oligonucleotides were collected, then lyophilized, identified as the target products by LC-MS, and quantified by UV (260 nm).

    [0964] In synthesizing the modified nucleotide in 5′ position 7 of the AS strand, the original nucleotide of the parent sequence was replaced with the phosphoramidite monomers synthesized in Example 1. The sequences of the antisense strands modified in 5′ position 7 are detailed in Table 14, wherein W′ is selected from the group consisting of

    ##STR00211##

    [0965] wherein M is O or S; wherein B is selected from a natural base in the corresponding position in Table 24.

    [0966] The sequences of the sense strands and the antisense strands of ApoC3 siRNAs modified by 2′-fluoro, 2′-methoxy, etc. are detailed in Table 25, and the sequences of the sense strands and the antisense strands of ApoC3 siRNA conjugates are detailed in Table 26.

    [0967] The sense strands and the antisense strands were synthesized by following the steps described above and were annealed in an equimolar ratio to form double-stranded structures by hydrogen bonding. Finally, the resulting double-stranded siRNAs were dissolved in 1×PBS, and the solutions were adjusted to the concentrations required for the experiment.

    TABLE-US-00024 TABLE 24 Sense strans and antisense strands of human ApoC3 siRNAs AS strand with chemical SEQ ID SS strand SEQ ID Unmodified AS SEQ ID modification in NO (5′-3′) NO strand (5′-3′) NO position 7 (5′-3′) SEQ ID GCCUCUGCCCG SEQ ID UUGAAGCUCGG SEQ ID UUGAAGW′UCGG NO: 115 AGCUUCAA NO: 116 GCAGAGGCCA NO: 117 GCAGAGGCCA SEQ ID GCUUCAUGCAG SEQ ID AUGUAACCCUGC SEQ ID AUGUAAW′CCUG NO: 118 GGUUACAU NO: 119 AUGAAGCUG NO: 120 CAUGAAGCUG SEQ ID UGAGCAGCGUG SEQ ID AACUCCUGCACG SEQ ID AACUCCW′GCAC NO: 121 CAGGAGUU NO: 122 CUGCUCAGU NO: 123 GCUGCUCAGU SEQ ID CAGUUCCCUGA SEQ ID AUAGUCUUUCA SEQ ID AUAGUCW′UUCA NO: 124 AAGACUAU NO: 125 GGGAACUGAA NO: 126 GGGAACUGAA SEQ ID AAGUCCACCUG SEQ ID UGGAUAGGCAG SEQ ID UGGAUAW′GCAG NO: 127 CCUAUCCA NO: 128 GUGGACUUGG NO: 129 GUGGACUUGG SEQ ID UCUCAGUGCUC SEQ ID AGGUAGGAGAG SEQ ID AGGUAGW′AGAG NO: 130 UCCUACCU NO: 131 CACUGAGAAU NO: 132 CACUGAGAAU SEQ ID GGCAUGCUGGC SEQ ID AUUGGGAGGCC SEQ ID AUUGGGW′GGCC NO: 133 CUCCCAAU NO: 134 AGCAUGCCUG NO: 135 AGCAUGCCUG SEQ ID GCAUGCUGGCC SEQ ID UAUUGGGAGGC SEQ ID UAUUGGW′AGGC NO: 136 UCCCAAUA NO: 137 CAGCAUGCCU NO: 138 CAGCAUGCCU SEQ ID CUGGCCUCCCA SEQ ID AGCUUUAUUGG SEQ ID AGCUUUW′UUGG NO: 139 AUAAAGCU NO: 140 GAGGCCAGCA NO: 141 GAGGCCAGCA SEQ ID GGCCUCCCAAU SEQ ID UCAGCUUUAUU SEQ ID UCAGCUW′UAUU NO: 142 AAAGCUGA NO: 143 GGGAGGCCAG NO: 144 GGGAGGCCAG SEQ ID UAAAGCUGGAC SEQ ID AGCUUCUUGUCC SEQ ID AGCUUCW′UGUC NO: 145 AAGAAGCU NO: 146 AGCUUUAUU NO: 147 CAGCUUUAUU SEQ ID UAUUCUCAGUG SEQ ID UAGGAGAGCAC SEQ ID UAGGAGW′GCAC NO: 148 CUCUCCUA NO: 149 UGAGAAUACU NO: 150 UGAGAAUACU SEQ ID CCGUUAAGGAC SEQ ID AAGAACUUGUCC SEQ ID AAGAACW′UGUC NO: 151 AAGUUCUU NO: 152 UUAACGGUG NO: 153 CUUAACGGUG SEQ ID CUGCGAGCUCC SEQ ID AGACCCAAGGAG SEQ ID AGACCCW′AGGA NO: 154 UUGGGUCU NO: 155 CUCGCAGGA NO: 156 GCUCGCAGGA SEQ ID ACAGUAUUCUC SEQ ID AGAGCACUGAG SEQ ID AGAGCAW′UGAG NO: 157 AGUGCUCU NO: 158 AAUACUGUCC NO: 159 AAUACUGUCC SEQ ID UUCUCAGUGCU SEQ ID AGUAGGAGAGC SEQ ID AGUAGGW′GAGC NO: 160 CUCCUACU NO: 161 ACUGAGAAUA NO: 162 ACUGAGAAUA SEQ ID AAGGGACAGUA SEQ ID ACUGAGAAUAC SEQ ID ACUGAGW′AUAC NO: 163 UUCUCAGU NO: 164 UGUCCCUUUU NO: 165 UGUCCCUUUU SEQ ID AAUAAAGCUGG SEQ ID UUUCUUGUCCAG SEQ ID UUUCUUW′UCCA NO: 166 ACAAGAAA NO: 167 CUUUAUUGG NO: 168 GCUUUAUUGG SEQ ID GACAAGUUCUC SEQ ID AGAACUCAGAG SEQ ID AGAACUW′AGAG NO: 169 UGAGUUCU NO: 170 AACUUGUCCU NO: 171 AACUUGUCCU SEQ ID CGAGGAUGCCU SEQ ID AAGAAGGGAGG SEQ ID AAGAAGW′GAGG NO: 172 CCCUUCUU NO: 173 CAUCCUCGGC NO: 174 CAUCCUCGGC SEQ ID ACUACUGGAGC SEQ ID UUAACGGUGCUC SEQ ID UUAACGW′UGCU NO: 175 ACCGUUAA NO: 176 CAGUAGUCU NO: 177 CCAGUAGUCU SEQ ID AUAAAGCUGGA SEQ ID ACUUCUUGUCCA SEQ ID ACUUCUW′GUCC NO: 178 CAAGAAGU NO: 179 GCUUUAUUG NO: 180 AGCUUUAUUG SEQ ID AGGGACAGUAU SEQ ID UACUGAGAAUA SEQ ID UACUGAW′AAUA NO: 181 UCUCAGUA NO: 182 CUGUCCCUUU NO: 183 CUGUCCCUUU SEQ ID GCCUCCCAAUA SEQ ID UCCAGCUUUAUU SEQ ID UCCAGCW′UUAU NO: 184 AAGCUGGA NO: 185 GGGAGGCCA NO: 186 UGGGAGGCCA SEQ ID UGCUGGCCUCC SEQ ID UUUUAUUGGGA SEQ ID UUUUAUW′GGGA NO: 187 CAAUAAAA NO: 188 GGCCAGCAUG NO: 189 GGCCAGCAUG SEQ ID AUUCUCAGUGC SEQ ID AUAGGAGAGCA SEQ ID AUAGGAW′AGCA NO: 190 UCUCCUAU NO: 191 CUGAGAAUAC NO: 192 CUGAGAAUAC SEQ ID UUCAGUUCCCU SEQ ID AGUCUUUCAGG SEQ ID AGUCUUW′CAGG NO: 193 GAAAGACU NO: 194 GAACUGAAGC NO: 195 GAACUGAAGC SEQ ID CAUGCUGGCCU SEQ ID UUAUUGGGAGG SEQ ID UUAUUGW′GAGG NO: 196 CCCAAUAA NO: 197 CCAGCAUGCC NO: 198 CCAGCAUGCC SEQ ID UAUUCUCAGUG SEQ ID UAGGAGAGCAC SEQ ID UAGGAGW′GCAC NO: 199 CUCUCCUU NO: 200 UGAGAAUACU NO: 201 UGAGAAUACU SEQ ID UAUUCUCAGUG SEQ ID UAGGAGAGCAC SEQ ID UAGGAGW′GCAC NO: 202 CUCUCCUC NO: 203 UGAGAAUACU NO: 204 UGAGAAUACU SEQ ID UAUUCUCAGUG SEQ ID UAGGAGAGCAC SEQ ID UAGGAGW′GCAC NO: 205 CUCUCCUG NO: 206 UGAGAAUACU NO: 207 UGAGAAUACU SEQ ID CCGUUAAGGAC SEQ ID AAGAACUUGUCC SEQ ID AAGAACW′UGUC NO: 208 AAGUUCUA NO: 209 UUAACGGUG NO: 210 CUUAACGGUG SEQ ID CCGUUAAGGAC SEQ ID AAGAACUUGUCC SEQ ID AAGAACW′UGUC NO: 211 AAGUUCUC NO: 212 UUAACGGUG NO: 213 CUUAACGGUG SEQ ID CCGUUAAGGAC SEQ ID AAGAACUUGUCC SEQ ID AAGAACW′UGUC NO: 214 AAGUUCUG NO: 215 UUAACGGUG NO: 216 CUUAACGGUG SEQ ID AAUAAAGCUGG SEQ ID UUUCUUGUCCAG SEQ ID UUUCUUW′UCCA NO: 217 ACAAGAAU NO: 218 CUUUAUUGG NO: 219 GCUUUAUUGG SEQ ID AAUAAAGCUGG SEQ ID UUUCUUGUCCAG SEQ ID UUUCUUW′UCCA NO: 220 ACAAGAAC NO: 221 CUUUAUUGG NO: 222 GCUUUAUUGG SEQ ID AAUAAAGCUGG SEQ ID UUUCUUGUCCAG SEQ ID UUUCUUW′UCCA NO: 223 ACAAGAAG NO: 224 CUUUAUUGG NO: 225 GCUUUAUUGG SEQ ID GCACCGUUAAG SEQ ID AACUUGUCCUUA SEQ ID AACUUGW′CCUU NO: 226 GACAAGUA NO: 227 ACGGUGCUC NO: 228 AACGGUGCUC SEQ ID GCACCGUUAAG SEQ ID AACUUGUCCUUA SEQ ID AACUUGW′CCUU NO: 229 GACAAGUC NO: 230 ACGGUGCUC NO: 231 AACGGUGCUC SEQ ID GCACCGUUAAG SEQ ID AACUUGUCCUUA SEQ ID AACUUGW′CCUU NO: 232 GACAAGUG NO: 233 ACGGUGCUC NO: 234 AACGGUGCUC SEQ ID GACAAGUUCUC SEQ ID AGAACUCAGAG SEQ ID AGAACUW′AGAG NO: 235 UGAGUUCA NO: 236 AACUUGUCCU NO: 237 AACUUGUCCU SEQ ID GACAAGUUCUC SEQ ID AGAACUCAGAG SEQ ID AGAACUW′AGAG NO: 238 UGAGUUCC NO: 239 AACUUGUCCU NO: 240 AACUUGUCCU SEQ ID GACAAGUUCUC SEQ ID AGAACUCAGAG SEQ ID AGAACUW′AGAG NO: 241 UGAGUUCG NO: 242 AACUUGUCCU NO: 243 AACUUGUCCU SEQ ID AUUCUCAGUGC SEQ ID AUAGGAGAGCA SEQ ID AUAGGAW′AGCA NO: 244 UCUCCUAA NO: 245 CUGAGAAUAC NO: 246 CUGAGAAUAC SEQ ID AUUCUCAGUGC SEQ ID AUAGGAGAGCA SEQ ID AUAGGAW′AGCA NO: 247 UCUCCUAC NO: 248 CUGAGAAUAC NO: 249 CUGAGAAUAC SEQ ID AUUCUCAGUGC SEQ ID AUAGGAGAGCA SEQ ID AUAGGAW′AGCA NO: 250 UCUCCUAG NO: 251 CUGAGAAUAC NO: 252 CUGAGAAUAC SEQ ID GCACCGUUAAG SEQ ID AACUUGUCCUUA SEQ ID AACUUGW′CCUU NO: 253 GACAAGUU NO: 254 ACGGUGCUC NO: 255 AACGGUGCUC SEQ ID CCGUUAAGGAC SEQ ID AAGAACUUGUCC SEQ ID AAGAACW′UGUC NO: 256 AAGUUCUU NO: 257 UUAACGGUG NO: 258 CUUAACGGUG SEQ ID AUUCUCAGUGC SEQ ID AUAGGAGAGCA SEQ ID AUAGGAW′AGCA NO: 259 UCUCCUAU NO: 260 CUGAGAAUAC NO: 261 CUGAGAAUAC SEQ ID AAUAAAGCUGG SEQ ID UUUCUUGUCCAG SEQ ID UUUCUUW′UCCA NO: 262 ACAAGAAA NO: 263 CUUUAUUGG NO: 264 GCUUUAUUGG SEQ ID GACAAGUUCUC SEQ ID AGAACUCAGAG SEQ ID AGAACUW′AGAG NO: 265 UGAGUUCU NO: 266 AACUUGUCCU NO: 267 AACUUGUCCU SEQ ID UAUUCUCAGUG SEQ ID UAGGAGAGCAC SEQ ID UAGGAGW′GCAC NO: 268 CUCUCCUA NO: 269 UGAGAAUACU NO: 270 UGAGAAUACU SEQ ID AUUCUCAGUGC SEQ ID AUAGGAGAGCA SEQ ID AUAGGAW′AGCA NO: 271 UCUCCUAU NO: 272 CUGAGAAUAC NO: 273 CUGAGAAUAC SEQ ID UAUUCUCAGUG SEQ ID UAGGAGAGCAC SEQ ID UAGGAGW′GCAC NO: 274 CUCUCCUG NO: 275 UGAGAAUACU NO: 276 UGAGAAUACU SEQ ID GACAAGUUCUC SEQ ID AGAACUCAGAG SEQ ID AGAACUW′AGAG NO: 277 UGAGUUCC NO: 278 AACUUGUCCU NO: 279 AACUUGUCCU SEQ ID GCACCGUUAAG SEQ ID AACUUGUCCUUA SEQ ID AACUUGW′CCUU NO: 280 GACAAGUC NO: 281 ACGGUGCUC NO: 282 AACGGUGCUC

    TABLE-US-00025 TABLE 25 Modified sense strands and antisense strands of human ApoC3 siRNAs Double SEQ ID SEQ ID strand No. NO SS strand (5′-3′) NO AS strand (5′-3′) TRD005077 SEQ ID GmsCmsCmUmCfUmGfC SEQ ID UmsUfsGmAmAmGfCmUmC NO: 283 fCfCmGmAmGmCmUmU NO: 284 mGmGmGmCmAfGmAfGmG mCmAmAm mCmsCmsAm TRD005088 SEQ ID CmsGmsAmGmGfAmUfG SEQ ID AmsAfsGmAmAmGfGmGmA NO: 285 fCfCmUmCmCmCmUmU NO: 286 mGmGmCmAmUfCmCfUmCm mCmUmUm GmsGmsCm TRD005092 SEQ ID GmsCmsUmUmCfAmUfG SEQ ID AmsUfsGmUmAmAfCmCmC NO: 287 fCfAmGmGmGmUmUmA NO: 288 mUmGmCmAmUfGmAfAmG mCmAmUm mCmsUmsGm TRD005112 SEQ ID UmsGmsAmGmCfAmGfC SEQ ID AmsAfsCmUmCmCfUmGmCm NO: 289 fGfUmGmCmAmGmGmA NO: 290 AmCmGmCmUfGmCfUmCmA mGmUmUm msGmsUm TRD005124 SEQ ID UmsUmsCmAmGfUmUfC SEQ ID AmsGfsUmCmUmUfUmCmA NO: 291 fCfCmUmGmAmAmAmG NO: 292 mGmGmGmAmAfCmUfGmA mAmCmUm mAmsGmsCm TRD005126 SEQ ID CmsAmsGmUmUfCmCfC SEQ ID AmsUfsAmGmUmCfUmUmU NO: 293 fUfGmAmAmAmGmAmC NO: 294 mCmAmGmGmGfAmAfCmU mUmAmUm mGmsAmsAm TRD005131 SEQ ID AmsCmsUmAmCfUmGfG SEQ ID UmsUfsAmAmCmGfGmUmG NO: 295 fAfGmCmAmCmCmGmU NO: 296 mCmUmCmCmAfGmUfAmG mUmAmAm mUmsCmsUm TRD005140 SEQ ID GmsCmsAmCmCfGmUfU SEQ ID AmsAfsCmUmUmGfUmCmC NO: 297 fAfAmGmGmAmCmAmA NO: 298 mUmUmAmAmCfGmGfUmG mGmUmUm mCmsUmsCm TRD005143 SEQ ID CmsCmsGmUmUfAmAfG SEQ ID AmsAfsGmAmAmCfUmUmG NO: 299 fGfAmCmAmAmGmUmU NO: 300 mUmCmCmUmUfAmAfCmG mCmUmUm mGmsUmsGm TRD005151 SEQ ID GmsAmsCmAmAfGmUfU SEQ ID AmsGfsAmAmCmUfCmAmG NO: 301 fCfUmCmUmGmAmGmU NO: 302 mAmGmAmAmCfUmUfGmU mUmCmUm mCmsCmsUm TRD005171 SEQ ID AmsAmsGmUmCfCmAfC SEQ ID UmsGfsGmAmUmAfGmGmC NO: 303 fCfUmGmCmCmUmAmU NO: 304 mAmGmGmUmGfGmAfCmU mCmCmAm mUmsGmsGm TRD005181 SEQ ID CmsUmsGmCmGfAmGfC SEQ ID AmsGfsAmCmCmCfAmAmG NO: 305 fUfCmCmUmUmGmGmG NO: 306 mGmAmGmCmUfCmGfCmA mUmCmUm mGmsGmsAm TRD005197 SEQ ID AmsAmsGmGmGfAmCfA SEQ ID AmsCfsUmGmAmGfAmAmU NO: 307 fGfUmAmUmUmCmUmC NO: 308 mAmCmUmGmUfCmCfCmUm mAmGmUm UmsUmsUm TRD005198 SEQ ID AmsGmsGmGmAfCmAfG SEQ ID UmsAfsCmUmGmAfGmAmA NO: 309 fUfAmUmUmCmUmCmA NO: 310 mUmAmCmUmGfUmCfCmCm mGmUmAm UmsUmsUm TRD005202 SEQ ID AmsCmsAmGmUfAmUfU SEQ ID AmsGfsAmGmCmAfCmUmG NO: 311 fCfUmCmAmGmUmGmC NO: 312 mAmGmAmAmUfAmCfUmG mUmCmUm mUmsCmsCm TRD005204 SEQ ID UmsAmsUmUmCfUmCfA SEQ ID UmsAfsGmGmAmGfAmGmC NO: 313 fGfUmGmCmUmCmUmC NO: 314 mAmCmUmGmAfGmAfAmU mCmUmAm mAmsCmsUm TRD005205 SEQ ID AmsUmsUmCmUfCmAfG SEQ ID AmsUfsAmGmGmAfGmAmG NO: 315 fUfGmCmUmCmUmCmC NO: 316 mCmAmCmUmGfAmGfAmA mUmAmUm mUmsAmsCm TRD005206 SEQ ID UmsUmsCmUmCfAmGfU SEQ ID AmsGfsUmAmGmGfAmGmA NO: 317 fGfCmUmCmUmCmCmU NO: 318 mGmCmAmCmUfGmAfGmA mAmCmUm mAmsUmsAm TRD005207 SEQ ID UmsCmsUmCmAfGmUfG SEQ ID AmsGfsGmUmAmGfGmAmG NO: 319 fCfUmCmUmCmCmUmA NO: 320 mAmGmCmAmCfUmGfAmG mCmCmUm mAmsAmsUm TRD005208 SEQ ID GmsGmsCmAmUfGmCfU SEQ ID AmsUfsUmGmGmGfAmGmG NO: 321 fGfGmCmCmUmCmCmC NO: 322 mCmCmAmGmCfAmUfGmCm mAmAmUm CmsUmsGm TRD005209 SEQ ID GmsCmsAmUmGfCmUfG SEQ ID UmsAfsUmUmGmGfGmAmG NO: 323 fGfCmCmUmCmCmCmA NO: 324 mGmCmCmAmGfCmAfUmG mAmUmAm mCmsCmsUm TRD005210 SEQ ID CmsAmsUmGmCfUmGfG SEQ ID UmsUfsAmUmUmGfGmGmA NO: 325 fCfCmUmCmCmCmAmA NO: 326 mGmGmCmCmAfGmCfAmU mUmAmAm mGmsCmsCm TRD005212 SEQ ID UmsGmsCmUmGfGmCfC SEQ ID UmsUfsUmUmAmUfUmGmG NO: 327 fUfCmCmCmAmAmUmA NO: 328 mGmAmGmGmCfCmAfGmC mAmAmAm mAmsUmsGm TRD005214 SEQ ID CmsUmsGmGmCfCmUfC SEQ ID AmsGfsCmUmUmUfAmUmU NO: 329 fCfCmAmAmUmAmAmA NO: 330 mGmGmGmAmGfGmCfCmA mGmCmUm mGmsCmsAm TRD005216 SEQ ID GmsGmsCmCmUfCmCfC SEQ ID UmsCfsAmGmCmUfUmUmA NO: 331 fAfAmUmAmAmAmGmC NO: 332 mUmUmGmGmGfAmGfGmC mUmGmAm mCmsAmsGm TRD005217 SEQ ID GmsCmsCmUmCfCmCfA SEQ ID UmsCfsCmAmGmCfUmUmU NO: 333 fAfUmAmAmAmGmCmU NO: 334 mAmUmUmGmGfGmAfGmG mGmGmAm mCmsCmsAm TRD005219 SEQ ID AmsAmsUmAmAfAmGfC SEQ ID UmsUfsUmCmUmUfGmUmC NO: 335 fUfGmGmAmCmAmAmG NO: 336 mCmAmGmCmUfUmUfAmU mAmAmAm mUmsGmsGm TRD005220 SEQ ID AmsUmsAmAmAfGmCfU SEQ ID AmsCfsUmUmCmUfUmGmU NO: 337 fGfGmAmCmAmAmGmA NO: 338 mCmCmAmGmCfUmUfUmA mAmGmUm mUmsUmsGm TRD005221 SEQ ID UmsAmsAmAmGfCmUfG SEQ ID AmsGfsCmUmUmCfUmUmG NO: 339 fGfAmCmAmAmGmAmA NO: 340 mUmCmCmAmGfCmUfUmU mGmCmUm mAmsUmsUm

    TABLE-US-00026 TABLE 26 Modified sense strands and antisense strands of human ApoC3 siRNA conjugates Double SEQ ID SEQ ID strand No. NO SS strand (5′-3′) NO AS strand (5′-3′) TRD005874 SEQ ID UmsAmsUmUmCfUmCfA SEQ ID UmsAfsGmGfAmGf(−)hmpNA NO: 341 fGfUmGmCmUmCmUmC NO: 342 (A)GmCfAmCmUfGmAfGmAf mCmUmAm-NAG1 AmUfAmsCmsUm TRD005875 SEQ ID CmsCmsGmUmUfAmAfG SEQ ID AmsAfsGmAfAmCf(−)hmpNA NO: 343 fGfAmCmAmAmGmUmU NO: 344 (U)UmGfUmCmCfUmUfAmAf mCmUmUm-NAG1 CmGfGmsUmsGm TRD005876 SEQ ID CmsUmsGmCmGfAmGfCf SEQ ID AmsGfsAmCfCmCf(−)hmpNA NO: 345 UfCmCmUmUmGmGmG NO: 346 (A)AmGfGmAmGfCmUfCmGf mUmCmUm-NAG1 CmAfGmsGmsAm TRD005877 SEQ ID AmsCmsAmGmUfAmUfU SEQ ID AmsGfsAmGfCmAf(−)hmpNA NO: 347 fCfUmCmAmGmUmGmC NO: 348 (C)UmGfAmGmAfAmUfAmCf mUmCmUm-NAG1 UmGfUmsCmsCm TRD005878 SEQ ID UmsUmsCmUmCfAmGfU SEQ ID AmsGfsUmAfGmGf(−)hmpNA NO: 349 fGfCmUmCmUmCmCmU NO: 350 (A)GmAfGmCmAfCmUfGmAf mAmCmUm-NAG1 GmAfAmsUmsAm TRD005879 SEQ ID AmsAmsGmGmGfAmCfA SEQ ID AmsCfsUmGfAmGf(−)hmpNA NO: 351 fGfUmAmUmUmCmUmC NO: 352 (A)AmUfAmCmUfGmUfCmCf mAmGmUm-NAG1 CmUfUmsUmsUm TRD005882 SEQ ID AmsAmsUmAmAfAmGfC SEQ ID UmsUfsUmCfUmUf(−)hmpNA NO: 353 fUfGmGmAmCmAmAmG NO: 354 (G)UmCfCmAmGfCmUfUmUf mAmAmAm-NAG1 AmUfUmsGmsGm TRD005884 SEQ ID GmsAmsCmAmAfGmUfU SEQ ID AmsGfsAmAfCmUf(−)hmpNA NO: 355 fCfUmCmUmGmAmGmU NO: 356 (C)AmGfAmGmAfAmCfUmUf mUmCmUm-NAG1 GmUfCmsCmsUm TRD005885 SEQ ID CmsGmsAmGmGfAmUfG SEQ ID AmsAfsGmAfAmGf(−)hmpNA NO: 357 fCfCmUmCmCmCmUmU NO: 358 (G)GmAfGmGmCfAmUfCmCf mCmUmUm-NAG1 UmCfGmsGmsCm TRD005886 SEQ ID AmsCmsUmAmCfUmGfG SEQ ID UmsUfsAmAfCmGf(−)hmpNA NO: 359 fAfGmCmAmCmCmGmU NO: 360 (G)UmGfCmUmCfCmAfGmUf mUmAmAm-NAG1 AmGfUmsCmsUm TRD005887 SEQ ID AmsUmsAmAmAfGmCfU SEQ ID AmsCfsUmUfCmUf(−)hmpNA NO: 361 fGfGmAmCmAmAmGmA NO: 362 (U)GmUfCmCmAfGmCfUmUf mAmGmUm-NAG1 UmAfUmsUmsGm TRD005888 SEQ ID AmsGmsGmGmAfCmAfG SEQ ID UmsAfsCmUfGmAf(−)hmpNA NO: 363 fUfAmUmUmCmUmCmA NO: 364 (G)AmAfUmAmCfUmGfUmCf mGmUmAm-NAG1 CmCfUmsUmsUm TRD005889 SEQ ID GmsCmsCmUmCfCmCfAf SEQ ID UmsCfsCmAfGmCf(−)hmpNA NO: 365 AfUmAmAmAmGmCmU NO: 366 (U)UmUfAmUmUfGmGfGmAf mGmGmAm-NAG1 GmGfCmsCmsAm TRD005890 SEQ ID UmsGmsCmUmGfGmCfCf SEQ ID UmsUfsUmUfAmUf(−)hmpNA NO: 367 UfCmCmCmAmAmUmA NO: 368 (U)GmGfGmAmGfGmCfCmAf mAmAmAm-NAG1 GmCfAmsUmsGm TRD005891 SEQ ID AmsUmsUmCmUfCmAfG SEQ ID AmsUfsAmGfGmAf(−)hmpNA NO: 369 fUfGmCmUmCmUmCmC NO: 370 (G)AmGfCmAmCfUmGfAmGf mUmAmUm-NAG1 AmAfUmsAmsCm TRD005892 SEQ ID UmsUmsCmAmGfUmUfC SEQ ID AmsGfsUmCfUmUf(−)hmpNA NO: 371 fCfCmUmGmAmAmAmG NO: 372 (U)CmAfGmGmGfAmAfCmUf mAmCmUm-NAG1 GmAfAmsGmsCm TRD005893 SEQ ID CmsAmsUmGmCfUmGfG SEQ ID UmsUfsAmUfUmGf(−)hmpNA NO: 373 fCfCmUmCmCmCmAmA NO: 374 (G)GmAfGmGmCfCmAfGmCf mUmAmAm-NAG1 AmUfGmsCmsCm TRD006925 SEQ ID AmsUmsUmCmUfCmAfG SEQ ID AmsUfsAmGfGmAfGmAmGm NO: 375 fUfGmCmUmCmUmCmC NO: 376 CfAmCfUmGfAmGfAmAfUms mUmAmsUms-NAG1 AmsCm TRD006926 SEQ ID UmsAmsUmUmCfUmCfA SEQ ID UmsAfsGmGfAmGf(−)hmpNA NO: 377 fGfUmGmCmUmCmUmC NO: 378 (A)GmCmAfCmUfGmAfGmAf mCmUmUm-NAG1 AmUfAmsCmsUm TRD006927 SEQ ID UmsAmsUmUmCfUmCfA SEQ ID UmsAfsGmGfAmGf(−)hmpNA NO: 379 fGfUmGmCmUmCmUmC NO: 380 (A)GmCmAfCmUfGmAfGmAf mCmUmCm-NAG1 AmUfAmsCmsUm TRD006928 SEQ ID UmsAmsUmUmCfUmCfA SEQ ID UmsAfsGmGfAmGf(−)hmpNA NO: 381 fGfUmGmCmUmCmUmC NO: 382 (A)GmCmAfCmUfGmAfGmAf mCmUmGm-NAG1 AmUfAmsCmsUm TRD006929 SEQ ID CmsCmsGmUmUfAmAfG SEQ ID AmsAfsGmAfAmCf(−)hmpNA NO: 383 fGfAmCmAmAmGmUmU NO: 384 (U)UmGmUfCmCfUmUfAmAf mCmUmAm-NAG1 CmGfGmsUmsGm TRD006930 SEQ ID CmsCmsGmUmUfAmAfG SEQ ID AmsAfsGmAfAmCf(−)hmpNA NO: 385 fGfAmCmAmAmGmUmU NO: 386 (U)UmGmUfCmCfUmUfAmAf mCmUmCm-NAG1 CmGfGmsUmsGm TRD006931 SEQ ID CmsCmsGmUmUfAmAfG SEQ ID AmsAfsGmAfAmCf(−)hmpNA NO: 387 fGfAmCmAmAmGmUmU NO: 388 (U)UmGmUfCmCfUmUfAmAf mCmUmGm-NAG1 CmGfGmsUmsGm TRD006932 SEQ ID AmsAmsUmAmAfAmGfC SEQ ID UmsUfsUmCfUmUf(−)hmpNA NO: 389 fUfGmGmAmCmAmAmG NO: 390 (G)UmCmCfAmGfCmUfUmUf mAmAmUm-NAG1 AmUfUmsGmsGm TRD006933 SEQ ID AmsAmsUmAmAfAmGfC SEQ ID UmsUfsUmCfUmUf(−)hmpNA NO: 391 fUfGmGmAmCmAmAmG NO: 392 (G)UmCmCfAmGfCmUfUmUf mAmAmCm-NAG1 AmUfUmsGmsGm TRD006934 SEQ ID AmsAmsUmAmAfAmGfC SEQ ID UmsUfsUmCfUmUf(−)hmpNA NO: 393 fUfGmGmAmCmAmAmG NO: 394 (G)UmCmCfAmGfCmUfUmUf mAmAmGm-NAG1 AmUfUmsGmsGm TRD006935 SEQ ID GmsAmsCmAmAfGmUfU SEQ ID AmsGfsAmAfCmUf(−)hmpNA NO: 395 fCfUmCmUmGmAmGmU NO: 396 (C)AmGmAfGmAfAmCfUmUf mUmCmAm-NAG1 GmUfCmsCmsUm TRD006936 SEQ ID GmsAmsCmAmAfGmUfU SEQ ID AmsGfsAmAfCmUf(−)hmpNA NO: 397 fCfUmCmUmGmAmGmU NO: 398 (C)AmGmAfGmAfAmCfUmUf mUmCmCm-NAG1 GmUfCmsCmsUm TRD006937 SEQ ID GmsAmsCmAmAfGmUfU SEQ ID AmsGfsAmAfCmUf(−)hmpNA NO: 399 fCfUmCmUmGmAmGmU NO: 400 (C)AmGmAfGmAfAmCfUmUf mUmCmGm-NAG1 GmUfCmsCmsUm TRD006938 SEQ ID AmsUmsUmCmUfCmAfG SEQ ID AmsUfsAmGfGmAf(−)hmpNA NO: 401 fUfGmCmUmCmUmCmC NO: 402 (G)AmGmCfAmCfUmGfAmGf mUmAmAm-NAG1 AmAfUmsAmsCm TRD006939 SEQ ID AmsUmsUmCmUfCmAfG SEQ ID AmsUfsAmGfGmAf(−)hmpNA NO: 403 fUfGmCmUmCmUmCmC NO: 404 (G)AmGmCfAmCfUmGfAmGf mUmAmCm-NAG1 AmAfUmsAmsCm TRD006940 SEQ ID AmsUmsUmCmUfCmAfG SEQ ID AmsUfsAmGfGmAf(−)hmpNA NO: 405 fUfGmCmUmCmUmCmC NO: 406 (G)AmGmCfAmCfUmGfAmGf mUmAmGm-NAG1 AmAfUmsAmsCm TRD006963 SEQ ID GmsCmsAmCmCfGmUfUf SEQ ID AmsAfsCmUfUmGf(−)hmpNA NO: 407 AfAmGmGmAmCmAmA NO: 408 (U)CmCmUfUmAfAmCfGmGf mGmUmAm-NAG1 UmGfCmsUmsCm TRD006964 SEQ ID GmsCmsAmCmCfGmUfUf SEQ ID AmsAfsCmUfUmGf(−)hmpNA NO: 409 AfAmGmGmAmCmAmA NO: 410 (U)CmCmUfUmAfAmCfGmGf mGmUmCm-NAG1 UmGfCmsUmsCm TRD006965 SEQ ID GmsCmsAmCmCfGmUfUf SEQ ID AmsAfsCmUfUmGf(−)hmpNA NO: 411 AfAmGmGmAmCmAmA NO: 412 (U)CmCmUfUmAfAmCfGmGf mGmUmGm-NAG1 UmGfCmsUmsCm TRD006966 SEQ ID GmsCmsAmCmCfGmUfUf SEQ ID AmsAfsCmUfUmGf(−)hmpNA NO: 413 AfAmGmGmAmCmAmA NO: 414 (U)CmCmUfUmAfAmCfGmGf mGmUmUm-NAG1 UmGfCmsUmsCm TRD006884 SEQ ID CmsCmsGmUmUfAmAfG SEQ ID AmsAfsGmAfAmCf(−)hmpNA NO: 415 fGfAmCmAmAmGmUmU NO: 416 (U)UmGmUfCmCfUmUfAmAf mCmUmsUms-NAG1 CmGfGmsUmsGm TRD006885 SEQ ID AmsUmsUmCmUfCmAfG SEQ ID AmsUfsAmGfGmAf(−)hmpNA NO: 417 fUfGmCmUmCmUmCmC NO: 418 (G)AmGmCfAmCfUmGfAmGf mUmAmsUms-NAG1 AmAfUmsAmsCm TRD006886 SEQ ID AmsAmsUmAmAfAmGfC SEQ ID UmsUfsUmCfUmUf(−)hmpNA NO: 419 fUfGmGmAmCmAmAmG NO: 420 (G)UmCmCfAmGfCmUfUmUf mAmAmsAms-NAG1 AmUfUmsGmsGm TRD006887 SEQ ID GmsAmsCmAmAfGmUfU SEQ ID AmsGfsAmAfCmUf(−)hmpNA NO: 421 fCfUmCmUmGmAmGmU NO: 422 (C)AmGmAfGmAfAmCfUmUf mUmCmsUms-NAG1 GmUfCmsCmsUm TRD006888 SEQ ID UmsAmsUmUmCfUmCfA SEQ ID UmsAfsGmGfAmGf(−)hmpNA NO: 423 fGfUmGmCmUmCmUmC NO: 424 (A)GmCmAfCmUfGmAfGmAf mCmUmsAms-NAG1 AmUfAmsCmsUm TRD006971 SEQ ID UmsAmsUmUmCfUmCfA SEQ ID UmsAfsGmGfAmGf(−)hmpNA NO: 425 fGfUmGmCmUmCmUmC NO: 426 (A)GmCmAfCmUfGmAfGmAf mCmUmsGms-NAG1 AmUfAmsCmsUm TRD006972 SEQ ID GmsAmsCmAmAfGmUfU SEQ ID AmsGfsAmAfCmUf(−)hmpNA NO: 427 fCfUmCmUmGmAmGmU NO: 428 (C)AmGmAfGmAfAmCfUmUf mUmCmsCms-NAG1 GmUfCmsCmsUm TRD006975 SEQ ID GmsCmsAmCmCfGmUfUf SEQ ID AmsAfsCmUfUmGf(−)hmpNA NO: 429 AfAmGmGmAmCmAmA NO: 430 (U)CmCmUfUmAfAmCfGmGf mGmUmsCms-NAG1 UmGfCmsUmsCm TRD006976 SEQ ID GmsCmsAmCmCfGmUfUf SEQ ID AmsAfsCmUfUmGf(−)hmpNA NO: 431 AfAmGmGmAmCmAmA NO: 432 (U)CmCmUfUmAfAmCfGmGf mGmUmsGms-NAG1 UmGfCmsUmsCm

    [0968] In Table 25 to Table 26, the nucleotide synthesized using 2-hydroxymethyl-1,3-propanediol as the starting material is defined as hmpNA; hmpNA is a racemic structure; [0969] (−)hmpNA(A) was obtained by solid-phase synthesis using the nucleoside phosphoramidite monomer 1-1a of example section 1.1; (+)hmpNA(A) is an optical isomer; [0970] (−)hmpNA(G) was obtained by solid-phase synthesis using the nucleoside phosphoramidite monomer 1-3a of example section 1.6; (+)hmpNA(G) is an optical isomer; [0971] (−)hmpNA(C) was obtained by solid-phase synthesis using the nucleoside phosphoramidite monomer 1-8a of example section 1.8; (+)hmpNA(C) is an optical isomer; [0972] (−)hmpNA(U) was obtained by solid-phase synthesis using the nucleoside phosphoramidite monomer 1-7a of example section 1.7; (+)hmpNA(U) is an optical isomer.

    [0973] The lowercase letter m indicates that the left nucleotide adjacent to the letter m is a 2′-methoxy-modified nucleotide; the lowercase letter f indicates that the left nucleotide adjacent to the letter f is a 2′-fluoro-modified nucleotide;

    the lowercase letter s, when present between uppercase letters, indicates that the two nucleotides adjacent to the letter s are linked by a phosphorothioate group;
    the lowercase letter s, when being the first at the 3′ end, indicates that the left nucleotide adjacent to the letter s ends in a phosphorothioate group.

    [0974] In Table 26, the structure of NAG1 is as shown in Example 11.

    Example 21. Inhibition of Human ApoC3 in Huh7 Cells by siRNAs—Single Concentration Point Inhibitory Activity Screening

    [0975] The effects of siRNAs targeting human ApoC3 on the human ApoC3 mRNA expression level were tested in vitro. Huh7 cells were cultured at 37° C. with 5% CO.sub.2 in a DMEM high glucose medium containing 10% fetal bovine serum. 24 h prior to transfection, the Huh7 cells were inoculated into a 96-well plate at a density of 10 thousand cells per well. Each well contained 100 μL of medium.

    [0976] The cells were transfected with siRNAs at a final concentration of 10 nM using Lipofectamine RNAiMAX (ThermoFisher, 13778150) according to the instructions of the product. 24 h after treatment, the cells were lysed using TaqMan™ Fast Advanced Cells-to-CT™ Kit (ThermoFisher, A35378), and one-step reverse transcription and quantitative real-time PCR detection were carried out. The human ApoC3 mRNA level was measured and corrected based on the ACTIN internal reference gene level.

    [0977] Experimental materials and instruments for cell viability screening (Cells-to-CT) in a 96-well plate are shown in Table 1 and Table 2 in example section 3.1.

    Experimental procedure of cell viability screening (Cells-to-CT) in a 96-well plate: [0978] (I) Cell transfection. The amounts of the components of the transfection complex are shown in Table 27:

    TABLE-US-00027 TABLE 27 Amounts required for transfection complex in each well of a 96-well plate Amount Opti-MEM SIRNA 10 nM (final 15 μL concentration in 96-well plate) RNAiMAX 0.9 μL 15 μL [0979] (II) Extraction of cellular RNA using Cell-to-CT method and cell RNA reverse transcription. The reverse transcription reaction system is shown in Table 29, and the reaction conditions are shown in Table 30.

    TABLE-US-00028 TABLE 28 Cells-to-CT kit components and storage conditions Reagent name Brand Cat. No. Components Storage conditions TaqManTM Fast Thermo 4444964 TaqMan ™M Fast  4° C. Advanced Master Mix Advanced Master Mix Cells-to-CT Bulk Lysis Thermo 4391851C Lysis Solution  4° C. Reagents Stop Solution −20° C. Dnase I −20° C. Cells-to-CT Bulk Fast Thermo A39110 20 × RT Fast Advanced −20° C. Enzyme Mix Advanced RT Reagents 2 × Fast Advanced RT  4° C. Buffer

    TABLE-US-00029 TABLE 29 Cellular RNA reverse transcription reaction system Reagent Amount (μL) 20 × RT Fast Advanced Enzyme Mix 25   2 × Fast Advanced RT Buffer 2.5 RNA (Lysis Mix) 22.5  Total amount 50  

    TABLE-US-00030 TABLE 30 Reverse transcription reaction conditions Reverse transcription reaction program Step Phase Cycle Temperature Time Reverse transcription 1 1 37° C. 30 min Reverse transcriptase 2 1 95° C.  5 min inactivation Holding 3 1  4° C. Long-term

    [0980] After the reverse transcription was complete, the samples could be stored in a refrigerator at 4° C. before use in Taqman Q-PCR or stored in a freezer at −40° C. (6 months).

    (III) Taqman Probe Q-PCR Detection

    [0981] 1. Reaction kit (ThermoFisher TaqMan Fast Advanced Master Mix (4444964); the shelf life of the kit was checked; the kit components were stored in a freezer at −40° C., and stored in a refrigerator at 4° C. after dissolution and use); [0982] 2. The following reaction mixtures (Table 32) were prepared in Microtubes. The working concentration of the primers was 10 μM.

    TABLE-US-00031 TABLE 31 Taqman probe primers Primer name SEQ ID NO Primer sequence hApoc3-PF SEQ ID NO: 433 TGCCTCCCTTCTCAGCTTCA hApoc3-PR SEQ ID NO: 434 GGGAACTGAAGCCATCGGTC hApoc3-P SEQ ID NO: 435 5′6-FAM-ATGAAGCACGCC ACCAAGACCGCCA-3′BHQ1 hACTB-PF SEQ ID NO: 436 ACGTGGACATCCGCAAAGAC hACTB-PR SEQ ID NO: 437 TCTTCATTGTGCTGGGTGCC hACTB-P SEQ ID NO: 438 5′TET-AACACAGTGCTGTC TGGCGGCACCA-3′BHQ2

    TABLE-US-00032 TABLE 32 Detection solutions for Taqman probe Q-PCR detection reaction Reagent Amount (μL) TaqMan ™ Fast Advanced Master Mix 10 Target gene-probe-F 0.4 Target gene-probe-R 0.4 Target gene-probe 0.2 Internal reference gene-probe-F 0.4 Internal reference gene-probe-R 0.4 Internal reference gene-probe 0.2 cDNA (RT Mix) 8 Total amount 20

    [0983] The samples were placed in an RT-PCR instrument and reacted according to the reaction program in Table 33 (40 cycles of reaction).

    TABLE-US-00033 TABLE 33 RT-PCR reaction program RT-PCR instrument reaction program Step Phase Cycle Temperature Time UDG activation 1 1 50° C. 2 min Enzyme activation 2 1 95° C. 20 s PCR 3 40 95° C. 1 s 60° C. 24 s Note: TaqMan ® Fast Advanced Master Mix includes ROX ™ reference dye.
    3. Result analysis method

    [0984] After the Taqman probe Q-PCR detection was complete, corresponding Ct values were acquired according to a threshold value automatically set by the system, and the expression of a certain gene was relatively quantified by comparing the Ct values: comparing Ct refers to calculating differences in gene expression according to the differences from the Ct value of the internal reference gene, and is also referred to as 2.sup.−ΔΔCt, ΔΔCt=[(target gene of Ct experimental group−internal reference of Ct experimental group)−(target gene of Ct control group−internal reference of Ct control group)]. Inhibition (%)=(1−remaining amount of target gene expression)×100%.

    [0985] The experimental results are expressed relative to the remaining percentage of human ApoC3 mRNA expression in cells treated with the control siRNA. The results are shown in Table 34.

    TABLE-US-00034 TABLE 34 Single concentration point screening results of inhibition of human ApoC3 in Huh7 cells by siRNAs Remaining Remaining mRNA mRNA Compound No. expression level SD Compound No. expression level SD TRD005077 19.1% 6.8% TRD005151  5.4% 3.1% TRD005088  7.2% 4.9% TRD005157  7.6% 0.5% TRD005089  6.4% 4.5% TRD005163 18.9% 2.6% TRD005092  6.7% 3.4% TRD005171  4.3% 0.5% TRD005110 19.0% 12.3%  TRD005173 10.8% 2.7% TRD005112 10.2% 3.4% TRD005181 16.5% 3.2% TRD005115 19.2% 5.9% TRD005197  5.3% 0.9% TRD005117 19.6% 2.5% TRD005198 10.8% 2.2% TRD005118 16.3% 0.8% TRD005202  5.1% 1.6% TRD005119 10.1% 2.6% TRD005203 19.6% 2.0% TRD005124  9.0% 1.7% TRD005204  2.9% 0.6% TRD005125 16.8% 2.9% TRD005205 12.6% 2.1% TRD005126 15.9% 3.6% TRD005206  8.1% 1.5% TRD005131  7.4% 1.5% TRD005207  7.7% 2.6% TRD005135 10.0% 0.7% TRD005208 19.5% 9.4% TRD005140  4.7% 0.6% TRD005209 10.9% 4.3% TRD005141 16.7% 2.2% TRD005210 10.8% 3.0% TRD005142 17.4% 2.3% TRD005211 14.4% 2.6% TRD005143  3.5% 0.2% TRD005212 10.8% 3.8% TRD005144 15.3% 4.6% TRD005214 15.0% 3.5% TRD005146 11.5% 3.7% TRD005216  9.1% 2.2% TRD005220 17.8% 2.1% TRD005217 19.1% 7.0% TRD005221 19.7% 3.6% TRD005219 16.4% 1.7%

    Example 22. Inhibition of Human ApoC3 in Huh7 Cells by siRNAs—Five Concentration Point Inhibitory Activity

    [0986] Screening was performed in Huh7 cells using siRNAs in 5 concentration gradients. Each siRNA sample for transfection was serially diluted 10-fold from the starting final concentration 10 nM to five concentration points.

    [0987] Huh7 cells were cultured at 37° C. with 5% CO.sub.2 in a DMEM high glucose medium containing 10% fetal bovine serum. 24 h prior to transfection, the Huh7 cells were inoculated into a 96-well plate at a density of 10 thousand cells per well. Each well contained 100 μL of medium.

    [0988] The cells were transfected with siRNAs at final concentrations of 10 nM, 1 nM, 0.1 nM, 0.01 nM and 0.001 nM using Lipofectamine RNAiMAX (ThermoFisher, 13778150) according to the instructions of the product. 24 h after treatment, the cells were lysed using TaqMan™ Fast Advanced Cells-to-CT™ Kit (ThermoFisher, A35378), and one-step reverse transcription and quantitative real-time PCR detection were carried out. The human ApoC3 mRNA level was measured and corrected based on the ACTIN internal reference gene level.

    [0989] The results are expressed relative to the remaining percentage of human ApoC3 mRNA expression in cells treated with the control siRNA. The IC50 results of inhibition are shown in Table 35.

    [0990] The experiment was carried out with reference to the cell viability screening (Cells-to-CT) in a 96-well plate in Example 21.

    TABLE-US-00035 TABLE 35 Multi-dose inhibitory activity of siRNAs against human ApoC3 in Huh7 cells Remaining percentage of target gene's mRNA expression (mean) IC50 value siRNA sample 10 nM 1 nM 0.1 nM 0.01 nM 0.001 nM (nM) TRD005077 18.9% 29.4% 73.5% 85.0% 104.8% 0.2951 TRD005088 7.4% 8.1% 21.6% 57.6% 101.4% 0.0148 TRD005092 17.1% 19.0% 62.1% 71.3% 79.4% 0.1660 TRD005112 14.3% 19.6% 88.6% 105.5% 98.1% 0.3020 TRD005124 59.5% 105.6% 125.1% 144.7% 136.9% 0.1023 TRD005126 17.0% 22.8% 64.5% 98.4% 104.8% 0.1738 TRD005131 12.9% 25.5% 68.6% 90.3% 105.2% 0.2399 TRD005140 9.0% 23.5% 70.2% 107.4% 101.7% 0.2344 TRD005143 6.2% 10.1% 38.3% 92.9% 112.1% 0.0631 TRD005151 5.7% 11.2% 53.4% 87.5% 122.0% 0.0891 TRD005171 12.7% 65.1% 101.7% 114.1% 147.4% 0.3090 TRD005181 9.0% 17.8% 55.7% 74.6% 83.3% 0.1288 TRD005197 4.8% 11.8% 58.9% 72.5% 98.4% 0.1047 TRD005198 6.3% 21.1% 67.8% 103.6% 110.0% 0.2042 TRD005202 4.3% 6.8% 15.4% 56.7% 102.1% 0.0135 TRD005204 5.9% 7.7% 11.8% 45.4% 87.3% 0.0083 TRD005205 11.9% 18.3% 45.3% 110.3% 114.3% 0.0871 TRD005206 7.3% 7.8% 16.3% 52.2% 106.0% 0.0112 TRD005207 11.6% 22.0% 72.6% 88.3% 108.8% 0.2399 TRD005208 20.7% 25.3% 64.2% 96.0% 107.3% 0.1862 TRD005209 13.2% 16.1% 32.8% 76.8% 105.2% 0.0363 TRD005210 25.4% 31.6% 58.3% 95.0% 122.3% 0.1738 TRD005212 21.0% 30.2% 62.3% 85.5% 111.2% 0.1862 TRD005214 16.9% 38.0% 61.7% 106.0% 99.3% 0.2630 TRD005216 14.5% 30.7% 74.7% 105.0% 93.5% 0.3311 TRD005217 8.1% 18.4% 54.7% 89.0% 108.7% 0.1175 TRD005219 7.1% 11.6% 32.8% 69.3% 107.8% 0.0295 TRD005220 9.7% 12.7% 34.9% 63.9% 94.2% 0.0269 TRD005221 12.2% 19.7% 45.2% 75.6% 104.8% 0.0631

    Example 23. siRNAs' On-Target Activity and Off-Target Level Validation by psiCHECK

    [0991] In vitro molecular level simulation on-target and off-target level screening was performed on siRNAs in Huh 7 cells using 11 concentration gradients. The results show that the siRNAs of the present disclosure have low off-target activity while having high activity.

    [0992] Huh 7 cells were cultured at 37° C. with 5% CO.sub.2 in a DMEM high glucose medium containing 10% fetal bovine serum. 24 h prior to transfection, the Huh7 cells were inoculated into a 96-well plate at a density of 10 thousand cells per well. Each well contained 100 μL of medium.

    [0993] The cells were co-transfected with siRNA and the corresponding plasmid using Lipofectamine2000 (ThermoFisher, 11668019) according to the instructions. 0.2 μL of Lipofectamine2000 was used for each well. The transfection amount of plasmid was 10 ng per well. For the on-target and off-target plasmids, a total of 11 concentration points of siRNA were set up. The highest concentration point final concentration was 40 nM, and 3-fold serial dilution was carried out (40 nM, 13.3 nM, 4.44 nM, 1.48 nM, 0.494 nM, 0.165 nM, 0.0549 nM, 0.0183 nM, 0.00609 nM, 0.00203 nM and 0.000677 nM). 24 h after transfection, the off-target levels were determined using Dual-Luciferase Reporter Assay System (Promega, E2940). The results are shown in Table 37 to Table 40.

    [0994] In the Huh7 cell line, the on-target/off-target activity of siRNAs in Table 35 with good activity was determined by performing psi-CHECK screening.

    [0995] The Psi-CHECK plasmids were purchased from Synbio Technologies (Suzhou) Co., Ltd. and Sangon Biotech (Shanghai) Co., Ltd.

    [0996] The experimental materials and instruments are detailed in Table 1 and Table 2 in Example 3.1, and the experimental results are detailed in Table 37 to Table 40. See Example 3.2 for the experimental procedure of psiCHECK activity screening, wherein the multi-concentration dilution protocol for siRNA samples is shown in Table 36. The results are shown in Table 37 to Table 40.

    TABLE-US-00036 TABLE 36 Multi-concentration dilution protocol for siRNA samples SiRNA Final concentration (μM) concentration (nM) Added water and siRNA 20 / / 4 40  4 μL siRNA + 16 μL H.sub.2O 1.333333 13.33333 20 μL siRNA + 40 μL H.sub.2O 0.444444 4.444444 20 μL siRNA + 40 μL H.sub.2O 0.148148 1.481481 20 μL siRNA + 40 μL H.sub.2O 0.049383 0.493827 20 μL siRNA + 40 μL H.sub.2O 0.016461 0.164609 20 μL siRNA + 40 μL H.sub.2O 0.005487 0.05487 20 μL siRNA + 40 μL H.sub.2O 0.001829 0.01829 20 μL siRNA + 40 μL H.sub.2O 0.00061 0.006097 20 μL siRNA + 40 μL H.sub.2O 0.000203 0.002032 20 μL siRNA + 40 μL H.sub.2O 6.77E−05 0.000677 20 μL siRNA + 40 μL H.sub.2O

    TABLE-US-00037 TABLE 37 Results of psiCHECK on-target activity screening of siRNAs (GSCM) Double strand 40 13.3 4.44 1.48 0.494 0.165 0.0549 0.0183 0.00609 0.00203 0.000677 IC50 value No. nM nM nM nM nM nM nM nM nM nM nM (nM) TRD005088 0.21 0.19 0.20 0.25 0.38 0.53 0.76 0.84 0.85 0.93 1.04 0.1950 TRD005092 0.28 0.25 0.24 0.28 0.34 0.44 0.73 0.84 0.96 1.07 1.09 0.1349 TRD005126 0.36 0.29 0.24 0.28 0.34 0.48 0.68 0.79 0.83 0.96 0.95 0.1349 TRD005131 0.25 0.25 0.28 0.29 0.38 0.55 0.72 0.83 0.98 0.96 0.94 0.1995 TRD005140 0.19 0.16 0.16 0.24 0.32 0.52 0.69 0.84 0.98 0.95 1.00 0.1660 TRD005143 0.13 0.13 0.13 0.13 0.18 0.26 0.38 0.56 0.75 0.88 0.94 0.0263 TRD005151 0.11 0.11 0.11 0.20 0.33 0.52 0.69 0.75 0.85 0.94 0.90 0.1738 TRD005181 0.23 0.25 0.23 0.23 0.22 0.32 0.49 0.66 0.85 0.91 0.92 0.0447 TRD005197 0.06 0.07 0.08 0.12 0.20 0.34 0.60 0.68 0.85 0.94 1.00 0.0692 TRD005198 0.31 0.33 0.27 0.33 0.42 0.61 0.67 0.79 0.90 0.85 0.91 0.2630 TRD005202 0.11 0.10 0.12 0.13 0.21 0.35 0.49 0.73 0.95 0.97 0.98 0.0603 TRD005204 0.06 0.05 0.05 0.06 0.09 0.14 0.18 0.31 0.55 0.77 0.93 0.0074 TRD005206 0.06 0.05 0.05 0.08 0.13 0.28 0.54 0.78 0.90 0.88 0.94 0.0676 TRD005219 0.13 0.12 0.12 0.15 0.27 0.45 0.73 0.85 0.90 0.97 0.92 0.1413 TRD005220 0.16 0.15 0.15 0.23 0.39 0.61 0.72 0.88 0.92 0.88 0.92 0.2570

    TABLE-US-00038 TABLE 38 Results of psiCHECK off-target activity screening of the seed regions of the AS strands of siRNAs (GSSM) Double strand 40 13.3 4.44 1.48 0.494 0.165 0.0549 0.0183 0.00609 0.00203 0.000677 IC50 value No. nM nM nM nM nM nM nM nM nM nM nM (nM) TRD005077 0.98 0.94 0.94 0.99 0.95 1.03 1.01 0.93 1.08 1.04 0.96 >40 nM TRD005088 1.17 1.14 1.13 1.12 1.19 1.15 1.20 1.08 1.25 1.00 1.15 >40 nM TRD005092 0.89 0.96 0.94 1.05 1.04 1.03 0.94 1.10 1.05 1.10 1.21 >40 nM TRD005112 0.72 0.69 0.77 0.85 0.92 0.89 1.06 0.96 1.12 1.02 0.98 >40 nM TRD005124 0.99 0.95 0.96 1.02 1.08 0.97 0.99 1.04 1.03 0.95 1.12 >40 nM TRD005126 0.88 1.01 1.03 0.96 0.90 0.96 1.05 0.98 0.98 1.03 1.04 >40 nM TRD005140 0.95 0.99 0.92 0.93 0.94 0.92 0.99 1.01 1.01 1.01 0.95 >40 nM TRD005143 1.08 1.21 1.00 1.11 1.00 0.89 1.06 1.00 0.90 1.08 1.13 >40 nM TRD005151 0.94 0.95 0.96 0.89 0.93 0.92 0.86 0.89 0.89 0.90 0.77 >40 nM TRD005171 0.94 1.16 1.01 1.00 1.18 0.94 1.10 1.17 1.07 1.03 1.03 >40 nM TRD005181 1.01 0.99 0.98 1.04 1.09 1.07 1.25 1.02 1.07 0.98 1.09 >40 nM TRD005197 0.70 0.87 0.89 1.05 0.93 0.94 0.98 0.89 0.90 0.88 0.85 >40 nM TRD005198 0.94 0.91 0.92 0.99 1.04 1.01 1.21 0.86 0.97 1.02 1.01 >40 nM TRD005202 0.53 0.44 0.50 0.67 0.75 0.81 0.85 0.83 0.87 0.93 0.99 39.81 TRD005204 0.75 0.73 0.83 0.89 0.85 1.03 0.95 0.85 0.78 1.01 0.99 >40 nM TRD005205 0.89 0.88 0.75 0.98 0.83 0.91 0.88 0.94 0.83 0.82 0.83 >40 nM TRD005206 0.64 0.64 0.64 0.92 0.86 0.98 0.86 1.06 1.12 0.97 1.02 >40 nM TRD005207 0.67 0.89 0.84 0.97 1.01 1.04 0.99 0.99 1.01 0.97 1.09 >40 nM TRD005208 0.72 0.71 0.69 0.83 0.95 0.84 0.97 1.01 1.04 0.94 1.04 >40 nM TRD005209 0.73 0.72 0.79 0.96 1.02 1.01 0.99 1.11 1.06 1.05 1.23 >40 nM TRD005210 0.76 0.85 0.77 0.86 1.04 0.99 0.99 1.07 1.04 1.01 1.09 >40 nM TRD005212 0.79 0.89 0.91 0.96 0.93 0.96 0.95 1.04 0.98 0.88 1.01 >40 nM TRD005214 0.92 0.89 0.99 1.00 0.92 1.06 1.02 0.98 1.11 0.99 1.04 >40 nM TRD005216 0.88 0.87 0.83 0.92 0.91 0.83 0.86 0.81 0.84 0.92 0.98 >40 nM TRD005217 0.91 0.93 0.96 0.85 0.92 0.85 0.82 0.84 0.90 0.80 0.83 >40 nM TRD005219 0.70 0.68 0.80 0.84 0.76 0.93 0.88 0.81 0.87 0.89 0.90 >40 nM TRD005220 0.98 1.03 0.93 1.08 1.02 1.05 0.98 1.15 1.13 1.04 1.01 >40 nM TRD005221 0.74 0.74 0.87 0.99 1.02 0.90 0.99 0.97 1.01 0.88 1.09 >40 nM

    TABLE-US-00039 TABLE 39 Results of off-target activity screening (PSSM) Double strand 40 13.3 4.44 1.48 0.494 0.165 0.0549 0.0183 0.00609 0.00203 0.000677 IC50 value No. nM nM nM nM nM nM nM nM nM nM nM (nM) TRD005088 0.98 1.00 1.00 0.93 0.95 0.97 0.98 0.94 1.01 1.00 0.97 >40 nM TRD005092 1.01 1.03 0.98 1.05 1.03 1.08 1.08 0.96 1.09 1.02 0.92 >40 nM TRD005126 0.99 0.93 1.03 0.98 1.00 1.01 0.95 0.99 0.97 1.04 1.03 >40 nM TRD005140 1.02 0.97 1.03 1.12 1.07 1.07 1.05 1.08 1.16 0.98 0.98 >40 nM TRD005143 1.01 0.90 0.97 0.96 1.04 0.98 1.01 0.95 :0.91 1.03 0.95 >40 nM TRD005151 0.96 0.94 0.90 0.92 0.90 0.99 0.95 0.97 0.93 0.88 0.96 >40 nM TRD005181 0.96 0.99 0.84 0.91 0.84 0.86 0.84 0.86 0.89 0.93 0.95 >40 nM TRD005197 0.84 0.78 0.83 0.91 0.92 0.87 0.83 0.88 0.84 0.88 1.01 >40 nM TRD005198 0.84 0.89 0.99 0.90 0.99 .098 1.02 1.02 1.01 0.91 0.92 >40 nM TRD005202 0.95 0.83 0.85 0.94 0.99 0.93 0.91 0.95 0.98 0.74 0.84 >40 nM TRD005204 0.92 0.85 0.86 0.99 1.01 1.00 1.02 1.03 0.92 1.13 0.95 >40 nM TRD005206 1.03 1.02 1.03 1.07 1.17 1.14 1.19 1.14 0.98 1.17 1.07 >40 nM TRD005219 1.15 1.09 0.99 0.97 0.96 1.05 1.00 1.06 1.02 0.89 1.12 >40 nM TRD005220 0.90 1.04 0.94 0.93 1.09 0.94 0.90 0.95 1.04 0.86 1.02 >40 nM

    Example 24. Inhibition of Human ApoC3 in Huh7 Cells by siRNAs—11 Concentration Point Inhibitory Activity

    [0997] siRNAs that showed 80% or higher in vitro inhibition (20% or lower mRNA remaining expression level) in Table 17 were subjected to off-target modification (modification in position 7 of the AS strand) in Huh7 cells using 11 concentration gradients and then Huh7 cell viability screening was carried out. Each siRNA sample for transfection was serially diluted 3-fold from the starting final concentration 40 nM to 11 concentration points.

    [0998] Huh7 cells were cultured at 37° C. with 5% CO.sub.2 in a DMEM high glucose medium containing 10% fetal bovine serum. 24 h prior to transfection, the Huh7 cells were inoculated into a 96-well plate at a density of 10 thousand cells per well. Each well contained 100 μL of medium.

    [0999] The cells were transfected with siRNAs at final concentrations of 40 nM, 13.3 nM, 4.44 nM, 1.48 nM, 0.494 nM, 0.165 nM, 0.0549 nM, 0.0183 nM, 0.00609 nM, 0.00203 nM and 0.000677 nM using Lipofectamine RNAiMAX (ThermoFisher, 13778150) according to the instructions of the product. 24 h after treatment, the cells were lysed using TaqMan™ Fast Advanced Cells-to-CT™ Kit (ThermoFisher, A35378), and one-step reverse transcription and quantitative real-time PCR detection were carried out. The human ApoC3 mRNA level was measured and corrected based on the ACTIN internal reference gene level.

    [1000] The results are expressed relative to the remaining percentage of human ApoC3 mRNA expression in cells treated with the control siRNA. The IC50 results of inhibition are shown in Table 41.

    [1001] The experiment was carried out with reference to the cell viability screening (Cells-to-CT) in a 96-well plate in Example 21.

    TABLE-US-00040 TABLE 41 Multi-dose inhibitory activity of siRNAs against human ApoC3 in Huh7 cells Double strand 40 13.3 4.44 1.48 0.494 0.165 No. nM nM nM nM nM nM TRD005874 3.5% 3.8% 6.2% 9.1% 12.8% 22.8% TRD005875 4.7% 6.2% 11.4% 13.6% 26.0% 47.2% TRD005878 5.8% 12.3% 10.1% 11.8% 23.4% 38.1% TRD005879 4.2% 7.8% 12.5% 17.0% 35.0% 39.7% TRD005882 7.7% 8.6% 12.8% 14.6% 22.2% 37.8% TRD005885 12.9% 22.1% 35.5% 28.6% 30.0% 63.6% TRD005891 6.7% 10.5% 15.3% 21.6% 28.9% 49.3% Huh7 cell Double strand 0.0549 0.0183 0.00609 0.00203 0.000677 IC50 value No. nM nM nM nM nM (nM) TRD005874 45.4% 76.1% 116.3% 122.8% 118.9% 0.0457 TRD005875 86.1% 122.0% 135.6% 106.8% 106.2% 0.1585 TRD005878 106.6% 131.2% 148.7% 149.6% 119.6% 0.1349 TRD005879 78.5% 132.2% 140.2% 142.9% 140.5% 0.1318 TRD005882 78.5% 114.3% 165.6% 145.6% 109.9% 0.1072 TRD005885 100.7% 130.5% 155.8% 117.4% 105.0% 0.2239 TRD005891 95.8% 109.4% 122.0% 128.9% 105.3% 0.1862

    Example 25. siRNAs' On-Target Activity and Off-Target Level Validation by psiCHECK

    [1002] After siRNAs were modified (in position 7 of the AS strand) in HEK293A cells using 11 concentration gradients, in vitro molecular level simulation on-target and off-target activity screening was performed. The results show that the siRNAs of the present disclosure have low off-target activity while having high activity. See Example 16 for the experimental procedure. To improve detection sensitivity, a GSSM-5 hits off-target plasmid, i.e. 5 identical GSSM sequences linked by TTCC, was constructed for the antisense strands of siRNAs.

    [1003] The results are shown in Table 43 to Table 46. The results show that all the siRNAs had high-level in vitro on-target inhibitory activity (GSCM IC50 value less than 0.3 nM) and no significant off-target effect. Procedure of psiCHECK activity screening

    [1004] In the HEK293A cell line, the activity of siRNAs was determined by performing psi-CHECK activity assays. The experimental materials and instruments are detailed in Table 1 and Table 2 in Example 3.1, and the experimental results are detailed in Table 43 to Table 46.

    [1005] See Example 3.2 for the experimental procedure of psiCHECK activity screening, wherein the multi-concentration dilution protocol for siRNA samples is shown in Table 42.

    TABLE-US-00041 TABLE 42 Multi-concentration dilution protocol for siRNAs siRNA Final concentration (μM) concentration (nM) Added water and siRNA 20 / / 4 40   4 μL siRNA + 16 μL H2O 1.333333 13.33333  20 μL siRNA + 40 μL H2O 0.444444 4.444444  20 μL siRNA + 40 μL H2O 0.148148 1.481481 20 μL siRNA + 40 μL H.sub.2O 0.049383 0.493827 20 μL siRNA + 40 μL H.sub.2O 0.016461 0.164609 20 μL siRNA + 40 μL H.sub.2O 0.005487 0.05487 20 μL siRNA + 40 μL H.sub.2O 0.001829 0.01829 20 μL siRNA + 40 μL H.sub.2O 0.00061 0.006097 20 μL siRNA + 40 μL H.sub.2O 0.000203 0.002032 20 μL siRNA + 40 μL H.sub.2O 6.77E−05 0.000677 20 μL siRNA + 40 μL H.sub.2O

    TABLE-US-00042 TABLE 43 Results of psiCHECK on-target activity screening of siRNAs (GSCM) Double strand 40 13.3 4.44 1.48 0.494 0.165 No. nM nM nM nM nM nM TRD005874 7.0% 4.9% 4.7% 4.6% 5.3% 8.5% TRD005875 27.1% 19.8% 14.0% 12.4% 12.6% 18.7% TRD005876 49.9% 24.8% 16.9% 14.5% 15.2% 18.6% TRD005877 16.6% 8.2% 6.0% 6.5% 9.5% 19.8% TRD005878 21.9% 12.9% 9.2% 7.1% 7.8% 10.9% TRD005879 15.1% 8.0% 4.6% 4.8% 4.7% 6.5% TRD005882 18.4% 9.7% 9.3% 9.0% 8.8% 10.4% TRD005883 38.3% 22.4% 13.0% 13.4% 19.3% 38.6% TRD005884 27.1% 18.0% 13.6% 14.2% 18.7% 33.9% TRD005886 49.5% 30.0% 19.5% 17.0% 18.0% 30.6% TRD005887 21.0% 12.0% 10.3% 9.6% 11.3% 19.4% TRD005889 50.7% 32.9% 25.8% 28.5% 39.2% 58.7% TRD005890 77.9% 48.0% 33.0% 27.7% 27.6% 37.9% TRD005891 27.0% 16.6% 12.2% 10.1% 8.9% 12.0% TRD005893 84.6% 58.2% 40.8% 30.6% 29.5% 42.6% Double strand 0.0549 0.0183 0.00609 0.00203 0.000677 GSCM IC50 No. nM nM nM nM nM value (nM) TRD005874 16.6% 35.4% 70.5% 85.8% 97.8% 0.0115 TRD005875 34.0% 55.5% 80.1% 95.7% 99.9% 0.0229 TRD005876 31.2% 53.9% 82.8% 91.6% 99.5% 0.0214 TRD005877 43.7% 72.5% 90.6% 97.6% 98.1% 0.041 TRD005878 21.5% 51.9% 74.9% 86.5% 98.0% 0.017 TRD005879 12.6% 30.3% 55.7% 79.3% 91.8% 0.0076 TRD005882 20.3% 45.7% 75.5% 92.6% 99.6% 0.0148 TRD005883 69.4% 85.9% 95.3% 96.6% 101.4% 0.1023 TRD005884 59.3% 81.4% 93.2% 97.4% 101.3% 0.0759 TRD005886 57.8% 81.1% 89.5% 101.8% 99.0% 0.0646 TRD005887 45.5% 71.4% 85.4% 95.2% 94.3% 0.0417 TRD005889 75.6% 85.2% 91.0% 96.2% 95.6% 0.2399 TRD005890 60.9% 86.1% 94.5% 102.2% 104.4% 0.0813 TRD005891 25.9% 52.6% 75.5% 90.3% 98.8% 0.0186 TRD005893 61.0% 75.5% 89.2% 92.1% 96.8% 0.0851

    [1006] Note: since the transfection efficiency was low at the highest concentration (40 nM) due to the internal synthesis process, the experimental data corresponding to the highest concentration (40 nM) were discarded at the time of data processing.

    TABLE-US-00043 TABLE 44 Results of psiCHECK off-target activity screening of the seed regions of the AS strands of siRNAs (GSSM-5hits) IC50 Double strand 40 13.3 4.44 1.48 0.494 0.165 0.0549 0.0183 0.00609 0.00203 0.000677 value No. nM nM nM nM nM nM nM nM nM nM nM (nM) TRD005875 1.00 0.97 0.98 1.00 1.04 1.06 1.00 1.07 1.01 1.16 1.03 ND TRD005882 0.72 0.75 0.89 0.92 1.01 0.96 0.92 1.01 0.90 1.00 0.91 80.4 TRD005891 0.78 0.76 0.84 0.90 0.98 0.98 1.00 0.98 1.01 0.97 0.95 84.4 TRD005874 0.72 0.69 0.74 0.93 0.98 1.00 0.99 0.98 0.95 1.12 0.93 59.0 TRD005887 0.75 0.74 0.82 0.85 0.91 0.92 0.94 1.02 1.03 0.98 1.08 101.0 Note: ND = undetectable.

    TABLE-US-00044 TABLE 45 Results of psiCHECK off-target activity screening of the SS strands of siRNAs (PSCM) IC50 Double strand 40 13.3 4.44 1.48 0.494 0.165 0.0549 0.0183 0.00609 0.00203 0.000677 value No. nM nM nM nM nM nM nM nM nM nM nM (nM) TRD005874 0.57 0.60 0.69 0.79 0.87 0.99 0.97 1.02 1.01 1.00 0.97 26.2 TRD005875 0.82 0.78 0.81 0.87 0.94 0.98 1.02 0.95 0.98 0.99 0.82 123.9 TRD005877 0.95 0.78 0.76 0.73 0.80 0.85 0.99 0.95 1.03 1.08 0.93 291.2 TRD005878 0.57 0.60 0.69 0.78 0.89 0.92 0.98 1.04 1.03 0.96 0.90 29.5 TRD005879 0.65 0.64 0.72 0.80 0.89 0.95 1.02 1.06 1.03 1.06 0.98 48.4 TRD005882 1.36 1.04 1.07 1.04 1.04 1.06 1.08 1.03 1.07 1.03 0.96 ND TRD005883 0.88 0.90 0.90 0.91 0.86 0.94 0.91 0.97 1.01 0.98 0.97 353.6 TRD005884 0.92 0.86 0.94 0.97 1.01 1.00 0.98 1.00 0.98 0.95 0.97 244.5 TRD005885 0.42 0.47 0.68 0.81 0.92 0.97 0.92 1.02 1.00 0.99 0.98 16.6 TRD005887 0.72 0.70 0.78 0.85 0.95 0.98 1.04 1.02 1.06 0.93 0.89 61.8 TRD005891 0.70 0.87 0.93 0.95 0.98 0.95 0.97 0.96 0.96 1.03 0.95 95.6 TRD005892 0.73 0.61 0.78 0.91 0.98 0.99 0.97 0.97 1.00 1.03 0.97 19.8 Note: ND = undetectable.

    TABLE-US-00045 TABLE 46 Results of psiCHECK off-target activity screening of the seed regions of the SS strands of siRNAs (PSSM) IC50 Double strand 40 13.3 4.44 1.48 0.494 0.165 0.0549 0.0183 0.00609 0.00203 0.000677 value No. nM nM nM nM nM nM nM nM nM nM nM (nM) TRD005874 0.78 0.85 0.96 1.07 0.83 1.01 0.89 0.87 0.89 0.95 0.88 140.1 TRD005875 1.19 1.00 0.87 0.89 0.91 0.94 0.99 0.99 0.96 0.98 0.90 ND TRD005877 1.05 0.85 0.72 0.82 0.86 0.87 0.92 0.96 1.07 0.99 0.88 ND TRD005878 0.70 0.64 0.69 0.81 0.81 0.81 0.97 1.01 0.96 0.90 0.91 46.5 TRD005879 0.72 0.64 0.71 0.86 0.91 1.01 1.01 1.05 1.07 1.00 0.92 18.3 TRD005882 1.37 1.10 1.06 1.06 1.06 1.05 1.04 1.02 1.02 0.98 0.94 ND TRD005883 1.21 1.09 1.00 0.91 0.91 0.95 0.97 1.04 1.05 1.04 1.02 ND TRD005884 0.98 0.95 0.95 1.06 1.07 1.04 1.09 1.08 1.03 1.05 0.99 699.4 TRD005885 0.81 0.78 0.97 0.90 0.99 0.94 1.01 1.05 1.01 0.94 0.94 116.6 TRD005887 0.95 0.88 0.88 0.99 1.03 1.03 1.04 1.08 1.03 1.00 1.01 334.6 TRD005891 0.74 0.81 0.92 0.99 0.97 1.07 1.05 1.01 1.03 1.05 1.07 93.6 TRD005892 0.77 0.70 0.83 0.95 0.96 1.00 1.06 1.05 1.08 1.05 1.09 26.4 Note: ND = undetectable.

    Example 26. Inhibition of Human ApoC3 in Huh7 Cells by siRNAs—11 Concentration Point Inhibitory Activity

    [1007] After siRNAs were modified (in position 7 of the AS strand) in Huh7 cells using 11 concentration gradients, Huh7 cell viability screening was performed. Each siRNA sample for transfection was serially diluted 3-fold from the starting final concentration 20 nM to 11 concentration points.

    [1008] Huh7 cells were cultured at 37° C. with 5% CO.sub.2 in a DMEM high glucose medium containing 10% fetal bovine serum. 24 h prior to transfection, the Huh7 cells were inoculated into a 96-well plate at a density of 10 thousand cells per well. Each well contained 100 μL of medium.

    [1009] The cells were transfected with siRNAs at final concentrations of 20 nM, 6.67 nM, 2.22 nM, 0.741 nM, 0.247 nM, 0.0823 nM, 0.0274 nM, 0.00914 nM, 0.00305 nM, 0.00102 nM and 0.000339 nM using Lipofectamine RNAi MAX (ThermoFisher, 13778150) according to the instructions of the product. 24 h after treatment, the total cellular RNA was extracted from the cells using a high-throughput cellular RNA extraction kit, and RNA reverse transcription and quantitative real-time PCR detection were carried out. The human ApoC3 mRNA level was measured and corrected based on the ACTIN internal reference gene level. The results are expressed relative to the remaining percentage of human ApoC3 mRNA expression in cells treated with the control siRNA. The IC50 results of inhibition are shown in Table 53.

    [1010] Experimental materials for cell viability screening (nucleic acid extractor) in a 96-well plate are shown in Table 1 and Table 2.

    Experimental procedure of cell viability screening (nucleic acid extractor) in a 96-well plate:

    I. Cell Transfection

    [1011] Reference was made to the procedure of cell transfection in Example 21.

    [1012] The amounts of the components of the transfection complex are shown in Table 47:

    TABLE-US-00046 TABLE 47 Amounts required for transfection complex in each well of a 96-well plate Amount Opti-MEM siRNA According to actual needs 15 μL RNAiMAX 0.9 μL 15 μL

    II. Extraction of Cellular RNA Using Nucleic Acid Extractor (Magnetic Bead Method)

    [1013] 1. Preparation: high-throughput cellular RNA extraction kit (FG0417-L/FG0418-XL, magnetic bead method).

    TABLE-US-00047 TABLE 48 Cellular RNA extraction kit components and storage conditions Cellular RNA extraction kit (FG0410-L, magnetic bead method) Kit component Volume (mL) Storage conditions Suspension of magnetic beads 2.2   4° C. Lysis solution LB 22 Room temperature Buffer WB1 22 Room temperature Buffer WB2 5.5 Room temperature Eluent RFW 5.5 Room temperature DNase I 0.4 −20° C. Dnase dilution solution 0.6 −20° C. 1M DTT solution 1 −20° C.

    [1014] 2. The following reagents were added to 6 deep-well plates.

    TABLE-US-00048 TABLE 49 Addition of different reagent components and volumes to 6 deep-well plates Reagent component Volume (μL/well) 96-deep-well plate 1 Buffer WB1 150 96-deep-well plate 2 DNase I Mix solution 50 96-deep-well plate 3 Isopropanol 100 Magnetic bead 20 Cell lysate supernatant 200 96-deep-well plate 4 Buffer WB2 200 96-deep-well plate 5 Absolute ethanol 200 96-deep-well plate 6 Eluent RFW 50 Note: Absolute ethanol was added to each of the buffers WB1 and WB2 in the recommended amount on the label.

    [1015] Preparation of a cell lysate: 200 μL of lysis solution LB+3.5 μL of 1 M DTT solution; the culture supernatant in the 96-well plate was completely aspirated, the mixture of solutions was added at 200 μL/well, and lysis was performed for 5 min.

    DNase I Mix solution: 3.4 μL of DNase I+5 μL of DNase dilution solution+41.6 μL of 0.1% DEPC water (50 μL per well, mixed well). The prepared DNase I Mix was placed on ice.

    [1016] Instrument program selection: cell RNA 96.

    [1017] 3. The 6 deep-well plates were placed into 6 corresponding cartridges of a nucleic acid extractor and marked, and tip combs were placed into 96-deep-well plate 3. The instrument was started, and a cellular RNA extraction program was run. After 35 min, the program was paused. 96-deep-well plate 2 was taken out and 220 μL of buffer WB1 was added to it. Then the cellular RNA extraction program was resumed.

    [1018] 4. After completion of the nucleic acid extraction and concentration measurement, the 96-deep-well plates were sealed with aluminum foil sealing film and fully marked. The plates could be stored in a refrigerator at 4° C. before use in reverse transcription or stored in a freezer at −40° C.

    III. Reverse Transcription of Cellular RNA

    [1019] 1. Preparation: (1) reverse transcription kit (Takara PrimeScript™ II 1st Strand cDNA Synthesis Kit (6210A); the shelf life was checked and the kit components were all stored in a freezer at −40° C.).

    TABLE-US-00049 TABLE 50 Reverse transcription kit components Takara PrimeScript ™ II 1st Strand cDNA Synthesis Kit (6210A) Kit component and concentration Volume PrimeScript II RTase (200 U/μL) 50 μL 5 × PrimeScript II Buffer 200 μL RNase Inhibitor (40 U/μL) 25 μL dNTP Mixture (10 mM each) 50 μL Oligo dT Primer (50 μM) 50 μL Random 6 mers (50 μM) 100 μL RNase Free dH2O 1 ml

    [1020] 2. The following reaction mixture (Mix1) was prepared in a Microtube.

    TABLE-US-00050 TABLE 51 Reaction mixture Mix1 Reagent Amount Oligo dT Primer (50 μM) 1 μL dNTP Mixture (10 mM each) 1 μL Template RNA Total RNA: 1 μg RNase Free dH2O Up to 10 μL

    [1021] After 5 min of incubation at 65° C., the mixture was quickly cooled on ice for 2 min. (Note: the above treatment can denature the template RNA, improving the reverse transcription efficiency.)

    [1022] 3. The following reverse transcription reaction mixture (Mix2) was prepared in a Microtube.

    TABLE-US-00051 TABLE 52 Reaction mixture Mix2 Reagent Amount 5 × PrimeScript II Buffer 4 μL RNase Inhibitor (40 U/μL) 0.5 μL (20 U) PrimeScript II RTase (200 U/μL) 1 μL (200 U) RNase Free dH2O 4.5 μL Total 10 μL

    [1023] 10 μL of Mix2 was added to Mix1, making a total volume of 20 μL. Inversion was performed as follows: 42° C. 45 min, 95° C. 5 min, 4° C. Forever.

    [1024] 4. After the inversion was complete, 80 μL of DEPC water (final concentration: 10 ng/μL) was added to each tube, and the samples could be stored in a refrigerator at 4° C. before use in Taqman Q-PCR or stored in a freezer at −40° C.

    [1025] IV. Taqman probe Q-PCR assay. See Example 16 for the experimental procedure and Table 53 for the results.

    TABLE-US-00052 TABLE 53 Multi-dose inhibitory activity of siRNAs against human ApoC3 in Huh7 cells Double strand 20 6.67 2.22 0.741 0.247 0.0823 No. nM nM nM nM nM nM TRD006884 1.7% 2.6% 4.1% 7.4% 25.1% 55.2% TRD006885 4.1% 2.4% 3.2% 5.7% 11.9% 30.0% TRD006886 2.8% 3.0% 4.5% 7.6% 17.4% 45.8% TRD006887 1.1% 1.3% 2.5% 6.0% 17.3% 51.6% TRD006888 1.1% 2.4% 1.8% 2.7% 4.9% 12.4% TRD006925 1.7% 1.2% 2.4% 2.8% 6.5% 21.3% TRD006928 0.9% 0.9% 1.2% 1.8% 2.6% 5.2% TRD006937 3.1% 2.1% 3.5% 6.9% 7.8% 22.5% TRD006964 3.2% 3.9% 2.4% 6.2% 8.8% 23.0% Huh7 cell Double strand 0.0274 0.00914 0.00305 0.00102 0.000339 IC50 value No. nM nM nM nM nM (nM) TRD006884 104.3% 168.0% 162.9% 129.1% 111.7% 0.0933 TRD006885 65.1% 107.4% 102.2% 112.7% 92.3% 0.0912 TRD006886 94.5% 110.2% 101.7% 115.6% 99.9% 0.138 TRD006887 65.9% 171.1% 135.3% 135.9% 105.2% 0.1096 TRD006888 32.3% 66.7% 116.0% 109.9% 101.0% 0.0288 TRD006925 54.8% 103.0% 116.4% 118.5% 104.3% 0.0871 TRD006928 11.1% 26.2% 47.0% 72.1% 64.9% 0.0031 TRD006937 38.9% 58.4% 102.3% 82.3% 78.7% 0.0195 TRD006964 53.0% 65.8% 102.7% 73.7% 106.9% 0.024

    Example 27. siRNAs' On-Target Activity and Off-Target Level Validation by psiCHECK

    [1026] In vitro molecular level simulation on-target and off-target level screening was performed on test compounds in HEK293A cells using 11 concentration gradients. The results show that the siRNAs of the present disclosure have low off-target activity while having high activity. The Psi-CHECK plasmids were purchased from Synbio Technologies (Suzhou) Co., Ltd. and Sangon Biotech (Shanghai) Co., Ltd. See Example 16 for the experimental procedure. To improve detection sensitivity, a GSSM-5 hits off-target plasmid, i.e. 5 identical GSSM sequences linked by TTCC, was constructed for the antisense strands of siRNAs.

    [1027] The results show that all 6 siRNAs had high-level in vitro on-target inhibitory activity (GSCM IC50 value less than 0.3 nM). The off-target evaluation (GSSM-5 hits, PSCM, PSSM) results of the siRNAs show that 5 siRNAs showed no significant off-target effect.

    [1028] In the HEK293A cell line, the activity of the 6 siRNAs was determined by performing psi-CHECK activity assays. The experimental results are detailed in Table 54 to Table 57.

    TABLE-US-00053 TABLE 54 Results of psiCHECK on-target activity screening of siRNAs (GSCM) Double strand 20 6.67 2.22 0.741 0.247 0.0823 No. nM nM nM nM nM nM TRD006884 15.9% 12.6% 12.7% 14.6% 21.4% 42.7% TRD006885 11.5% 8.4% 7.2% 6.7% 9.3% 23.7% TRD006886 10.3% 9.7% 9.5% 9.1% 10.5% 20.4% TRD006887 15.8% 13.2% 13.2% 18.3% 33.5% 60.9% TRD006888 5.8% 5.1% 4.9% 5.5% 8.1% 18.1% TRD005205 25.1% 18.8% 19.6% 24.8% 52.0% 75.8% TRD006925 6.8% 5.6% 5.5% 6.3% 10.9% 34.6% TRD006971 4.8% 4.5% 4.5% 4.3% 5.6% 11.7% TRD006973 14.2% 13.3% 12.4% 14.5% 24.6% 51.4% TRD006975 12.5% 11.5% 11.6% 11.2% 17.5% 35.9% TRD006926 6.1% 5.5% 5.3% 5.9% 8.2% 14.7% TRD006927 5.7% 5.5% 5.4% 5.7% 7.2% 11.8% TRD006928 5.1% 5.3% 5.2% 5.2% 7.0% 11.6% TRD006929 14.9% 13.2% 12.7% 14.7% 28.3% 53.0% TRD006930 14.5% 12.6% 13.1% 15.8% 28.4% 53.6% TRD006931 16.8% 14.1% 13.5% 15.2% 24.2% 44.3% TRD006932 10.7% 11.2% 11.4% 11.2% 13.7% 25.9% TRD006933 11.1% 10.5% 11.1% 10.6% 13.6% 21.2% TRD006934 11.3% 11.5% 12.0% 11.6% 12.7% 22.0% TRD006935 18.7% 15.2% 14.1% 15.9% 27.6% 52.5% TRD006936 18.0% 14.6% 13.5% 14.4% 22.1% 45.9% TRD006937 17.5% 13.9% 13.0% 13.4% 21.4% 41.5% TRD006938 12.3% 9.3% 8.3% 7.7% 10.7% 21.8% TRD006939 17.8% 11.2% 8.8% 8.0% 10.6% 23.9% TRD006940 9.9% 8.8% 8.4% 7.8% 11.0% 22.3% TRD006963 12.6% 10.1% 9.8% 11.4% 20.9% 46.7% TRD006964 11.8% 10.1% 10.5% 11.5% 20.1% 39.9% TRD006965 11.6% 10.3% 10.2% 11.7% 20.4% 40.9% TRD006966 13.5% 10.6% 11.8% 17.5% 39.2% 74.5% TRD005883 13.4% 10.8% 11.3% 18.9% 43.9% 77.6% GSCM Double strand 0.0274 0.00914 0.00305 0.00102 0.000339 IC50 value No. nM nM nM nM nM (nM) TRD006884 71.7% 97.5% 99.7% 100.3% 101.6% 0.0753 TRD006885 58.5% 83.0% 94.0% 96.9% 97.4% 0.0349 TRD006886 46.2% 79.6% 91.0% 102.6% 101.0% 0.0271 TRD006887 86.9% 93.0% 96.8% 99.6% 103.5% 0.1433 TRD006888 49.6% 81.3% 95.1% 100.4% 108.9% 0.0282 TRD005205 87.4% 97.2% 99.2% 103.3% 106.3% 0.2847 TRD006925 69.7% 90.8% 100.5% 103.7% 102.1% 0.0531 TRD006971 26.1% 60.0% 92.8% 99.6% 104.7% 0.014 TRD006973 75.9% 95.3% 100.6% 98.4% 97.4% 0.094 TRD006975 67.5% 88.2% 97.8% 98.9% 99.0% 0.0555 TRD006926 37.3% 78.0% 91.4% 100.4% 97.5% 0.0198 TRD006927 25.5% 63.2% 86.5% 95.5% 99.0% 0.0129 TRD006928 27.6% 72.2% 86.0% 101.4% 99.8% 0.0151 TRD006929 81.6% 113.2% 111.4% 108.1% 102.2% 0.0905 TRD006930 80.4% 95.9% 102.3% 97.9% 101.0% 0.0912 TRD006931 75.7% 95.7% 102.2% 105.3% 106.1% 0.0656 TRD006932 55.0% 92.9% 104.8% 109.0% 101.1% 0.0326 TRD006933 54.6% 83.1% 98.1% 101.1% 92.9% 0.03 TRD006934 48.2% 88.6% 97.3% 119.5% 105.7% 0.0261 TRD006935 81.8% 96.9% 97.9% 104.7% 102.6% 0.0891 TRD006936 76.5% 96.4% 100.2% 99.5% 90.3% 0.0687 TRD006937 70.0% 91.3% 93.3% 95.1% 92.3% 0.0589 TRD006938 58.1% 93.1% 96.3% 100.4% 94.1% 0.0336 TRD006939 61.5% 92.2% 97.3% 100.7% 98.4% 0.036 TRD006940 62.9% 88.7% 99.2% 87.3% 92.1% 0.0366 TRD006963 74.5% 83.7% 97.3% 98.6% 92.7% 0.0676 TRD006964 73.7% 94.1% 97.4% 105.6% 97.8% 0.0593 TRD006965 69.8% 90.4% 94.4% 98.5% 92.8% 0.0584 TRD006966 88.8% 101.9% 100.4% 102.5% 98.9% 0.1711 TRD005883 88.9% 101.2% 99.2% 98.6% 92.7% 0.1995

    TABLE-US-00054 TABLE 55 Results of psiCHECK off-target activity screening of the seed regions of the AS strands of siRNAs (GSSM-5hits) Double strand 20 6.67 2.22 0.741 0.247 0.0823 No. nM nM nM nM nM nM TRD006884 92.8% 95.2% 108.1% 118.2% 112.6% 114.2% TRD006885 85.1% 93.6% 106.3% 115.6% 117.8% 107.1% TRD006886 89.9% 93.4% 102.7% 109.5% 112.2% 113.3% TRD006887 63.2% 63.6% 89.5% 106.7% 113.7% 106.5% TRD006888 71.9% 80.9% 95.5% 107.9% 110.9% 108.0% TRD005205 48.2% 42.9% 55.7% 78.9% 96.3% 104.2% TRD006971 72.8% 78.0% 89.4% 94.4% 97.3% 108.2% TRD006973 41.5% 44.2% 73.6% 93.8% 104.1% 122.2% TRD006975 37.2% 47.7% 75.0% 102.0% 104.1% 108.7% Fit IC50 value for Double strand 0.0274 0.00914 0.00305 0.00102 0.000339 GSSM- No. nM nM nM nM nM 5hits (nM) TRD006884 115.8% 111.6% 107.9% 115.5% 105.0% 309 TRD006885 113.1% 106.2% 110.9% 111.9% 108.6% 131 TRD006886 114.1% 113.4% 106.7% 107.1% 108.4% 180 TRD006887 107.0% 105.0% 105.0% 114.5% 113.3% 24 TRD006888 107.5% 101.4% 100.1% 104.4% 106.1% 46 TRD005205 103.8% 105.0% 112.0% 102.5% 106.4% 6 TRD006971 106.9% 102.9% 102.0% 96.2% 93.1% 41 TRD006973 111.2% 108.6% 110.8% 104.0% 97.8% 8 TRD006975 101.8% 103.5% 104.0% 103.9% 93.3% 8

    TABLE-US-00055 TABLE 56 Results of psiCHECK off-target activity screening of the SS strands of siRNAs (PSCM) Double strand 20 6.67 2.22 0.741 0.247 0.0823 No. nM nM nM nM nM nM TRD006884 81.7% 87.8% 102.8% 118.3% 116.1% 113.8% TRD006885 87.0% 106.7% 121.9% 127.4% 126.7% 111.9% TRD006886 104.0% 103.4% 99.3% 95.1% 105.1% 109.6% TRD006887 116.9% 117.1% 112.6% 111.7% 112.9% 104.0% TRD006888 79.0% 89.0% 95.1% 105.6% 110.0% 111.9% TRD005205 83.2% 98.0% 101.9% 110.4% 108.9% 107.9% TRD006925 76.7% 89.6% 103.4% 104.6% 110.0% 120.0% TRD006971 76.5% 86.2% 94.5% 99.8% 103.8% 119.7% TRD006973 111.6% 115.5% 109.3% 109.1% 102.4% 125.1% TRD006975 119.4% 118.6% 130.2% 107.8% 98.3% 104.0% Fit IC50 value for Double strand 0.0274 0.00914 0.00305 0.00102 0.000339 PSCM No. nM nM nM nM nM (nM) TRD006884 121.3% 105.8% 108.8% 110.9% 104.9% 90 TRD006885 114.1% 111.2% 112.8% 112.2% 108.5% 342  TRD006886 116.2% 107.2% 100.8% 107.9% 105.6% ND TRD006887 104.1% 102.0% 104.6% 108.1% 107.2% ND TRD006888 116.9% 104.8% 99.0% 105.5% 105.4% 72 TRD005205 113.2% 110.7% 120.9% 101.6% 118.9% 121  TRD006925 117.9% 107.5% 106.3% 97.9% 94.3% 70 TRD006971 113.0% 110.6% 112.3% 99.8% 102.4% 59 TRD006973 111.6% 104.2% 101.6% 98.4% 92.0% ND TRD006975 97.1% 98.8% 104.0% 97.8% 95.6% ND Note: ND = undetectable.

    TABLE-US-00056 TABLE 57 Results of psiCHECK off-target activity screening of the seed regions of the SS strands of siRNAs (PSSM) Double strand 20 6.67 2.22 0.741 0.247 0.0823 No nM nM nM nM nM nM TRD006884 108.3% 103.8% 77.5% 111.3% 105.7% 109.0% TRD006885 87.1% 102.6% 131.1% 133.4% 126.8% 113.6% TRD006886 105.4% 109.7% 110.3% 110.1% 107.9% 108.1% TRD006887 120.1% 123.7% 130.2% 118.6% 120.5% 109.6% TRD006888 69.5% 87.3% 94.1% 103.7% 108.1% 107.4% TRD005205 89.9% 97.9% 112.5% 113.1% 108.0% 115.1% TRD006925 81.3% 92.4% 102.2% 107.8% 109.2% 126.1% TRD006971 80.0% 83.9% 96.6% 94.8% 97.3% 125.7% TRD006973 109.0% 110.4% 109.1% 103.1% 102.5% 116.0% TRD006975 127.0% 128.9% 133.1% 117.0% 107.7% 121.5% Fit IC50 value for Double strand 0.0274 0.00914 0.00305 0.00102 0.000339 PSSM No. nM nM nM nM nM (nM) TRD006884 108.9% 98.8% 102.1% 104.9% 104.8% ND TRD006885 116.0% 114.0% 116.4% 112.9% 113.6% 340  TRD006886 110.5% 110.5% 105.6% 103.5% 98.7% ND TRD006887 107.5% 105.5% 108.9% 109.0% 109.8% ND TRD006888 110.4% 103.1% 99.8% 103.3% 105.2% 46 TRD005205 114.1% 112.3% 126.3% 114.3% 124.3% 251  TRD006925 111.4% 103.3% 104.9% 105.2% 91.6% 94 TRD006971 102.1% 101.0% 99.5% 89.8% 92.6% 66 TRD006973 108.6% 104.1% 101.3% 98.3% 95.7% ND TRD006975 106.9% 108.2% 116.3% 110.3% 97.0% ND Note: ND = undetectable.

    Example 28. Inhibition of Human ApoC3 in Hep3B Cells by siRNAs—11 Concentration Point Inhibitory Activity

    [1029] Hep3B cell viability screening was performed on test compounds in Hep3B cells using 11 concentration gradients. Each siRNA sample for transfection was serially diluted 3-fold from the starting final concentration 20 nM to 11 concentration points.

    [1030] Hep3B cells were cultured at 37° C. with 5% CO.sub.2 in a MEM medium containing 10% fetal bovine serum. 24 h prior to transfection, the Hep3B cells were inoculated into a 96-well plate at a density of 10 thousand cells per well. Each well contained 100 μL of medium.

    [1031] The cells were transfected with siRNAs at final concentrations of 20 nM, 6.67 nM, 2.22 nM, 0.741 nM, 0.247 nM, 0.0823 nM, 0.0274 nM, 0.00914 nM, 0.00305 nM, 0.00102 nM and 0.000339 nM using Lipofectamine RNAi MAX (ThermoFisher, 13778150) according to the instructions of the product. 24 h after treatment, the total cellular RNA was extracted from the cells using a high-throughput cellular RNA extraction kit, and RNA reverse transcription and quantitative real-time PCR detection were carried out. The human ApoC3 mRNA level was measured and corrected based on the ACTIN internal reference gene level.

    [1032] The results are expressed relative to the remaining percentage of human ApoC3 mRNA expression in cells treated with the control siRNA. The IC50 results of inhibition are shown in Table 58.

    TABLE-US-00057 TABLE 58 Multi-dose inhibitory activity of siRNAs against human ApoC3 in Hep3B cells 20 6.67 2.22 0.741 0.247 0.0823 No. nM nM nM nM nM nM TRD006884 2% 2.0% 3.5% 4.3% 12.6% 20.5% TRD006885 3% 5.1% 9.7% 13.5% 26.9% 41.5% TRD006886 5% 8.6% 14.0% 20.6% 53.2% 88.1% TRD006887 4% 10.9% 9.6% 25.5% 45.5% 82.2% TRD006888 3% 6.1% 10.6% 19.8% 12.4% 30.1% TRD006925 7% 2.1% 7.2% 12.0% 12.9% 33.1% TRD006966 4% 3.6% 12.1% 28.1% 40.0% 115.0% TRD006927 3% 5.5% 5.1% 7.0% 13.9% 33.9% TRD006928 3% 4.9% 3.6% 5.2% 11.0% 19.8% TRD006936 4% 5.8% 6.8% 24.7% 22.8% 58.2% TRD006937 10%  12.8% 17.6% 24.4% 19.1% 53.9% TRD006964 15%  21.2% 28.6% 20.2% 16.4% 54.4% TRD006965 36%  23.7% 30.3% 36.2% 37.7% 61.7% TRD006971 6% 3.5% 2.9% 2.5% 5.1% 16.1% TRD006973 5% 3.0% 5.0% 9.6% 29.8% 56.1% TRD006975 5% 2.1% 3.9% 7.4% 16.7% 53.5% Hep3B cell 0.0274 0.00914 0.00305 0.00102 0.000339 IC50 value No. nM nM nM nM nM (nM) TRD006884 39.8% 92.8% 97.5% 102.3% 106.3% 0.024 TRD006885 83.2% 115.9% 141.0% 118.3% 124.5% 0.0692 TRD006886 110.0% 190.3% 187.7% 162.3% 145.3% 0.2089 TRD006887 123.6% 160.3% 148.0% 179.4% 134.5% 0.195 TRD006888 53.1% 69.0% 94.0% 100.5% 73.5% 0.0288 TRD006925 53.7% 84.5% 94.6% 94.1% 118.4% 0.0363 TRD006966 187.9% 159.1% 130.2% 101.0% 118.8% 0.2089 TRD006927 65.7% 107.2% 121.5% 140.9% 106.7% 0.0457 TRD006928 42.4% 72.6% 99.9% 120.3% 102.4% 0.0214 TRD006936 88.2% 136.7% 106.2% 96.9% 111.7% 0.1 TRD006937 111.7% 116.2% 114.8% 109.3% 107.3% 0.0871 TRD006964 97.0% 101.5% 111.3% 108.0% 89.6% 0.0933 TRD006965 117.9% 156.2% 133.6% 147.2% 121.7% 0.1096 TRD006971 35.0% 57.8% 102.0% 104.3% 95.9% 0.0148 TRD006973 78.7% 114.1% 118.0% 124.7% 114.6% 0.0955 TRD006975 101.3% 108.0% 110.5% 131.6% 111.8% 0.0912

    Example 29. Inhibition of Human ApoC3 in Primary Human Hepatocytes (PHHs) by siRNAs—11 Concentration Point Inhibitory Activity

    [1033] Primary human hepatocyte (PHH) viability screening was performed on test compounds in primary human hepatocytes (PHHs) using 11 concentration gradients. Each siRNA sample for transfection was serially diluted 3-fold from the starting final concentration 20 nM to 11 concentration points.

    [1034] The primary human hepatocytes (PHHs) were cryopreserved in liquid nitrogen. 24 h prior to transfection, the primary human hepatocytes (PHHs) were thawed and then inoculated into a 96-well plate at a density of 40 thousand cells per well. Each well contained 100 μL of medium.

    [1035] The cells were transfected with siRNAs at gradient final concentrations of 20 nM, 6.67 nM, 2.22 nM, 0.741 nM, 0.247 nM, 0.0823 nM, 0.0274 nM, 0.00914 nM, 0.00305 nM, 0.00102 nM and 0.000339 nM using Lipofectamine RNAi MAX (ThermoFisher, 13778150) according to the instructions of the product. 24 h after treatment, the total cellular RNA was extracted from the cells using a high-throughput cellular RNA extraction kit, and RNA reverse transcription and quantitative real-time PCR detection were carried out. The human ApoC3 mRNA level was measured and corrected based on the ACTIN internal reference gene level.

    [1036] The results are expressed relative to the remaining percentage of human ApoC3 mRNA expression in cells treated with the control siRNA. The IC50 results of inhibition are shown in Table 59. All could effectively inhibit human ApoC3 mRNA expression.

    TABLE-US-00058 TABLE 59 Multi-dose inhibitory activity of siRNAs against human ApoC3 in primary human hepatocytes (PHHs) Double strand 20 6.67 2.22 0.741 0.247 0.0823 No. nM nM nM nM nM nM TRD006884 7% 5.5% 9.2% 28.2% 22.4% 46.8% TRD006885 6% 10.2% 11.5% 11.1% 23.3% 30.3% TRD006888 7% 5.8% 10.1% 13.8% 20.2% 40.8% TRD006925 5% 6.1% 9.2% 13.3% 13.5% 26.2% TRD006928 10%  7.1% 8.0% 7.5% 12.5% 25.5% TRD006937 5% 7.9% 9.5% 17.3% 26.2% 54.2% TRD006886 6.1%.sup.  9.2% 10.3% 14.1% 22.0% 39.9% TRD006971 3.9%.sup.  5.6% 6.2% 6.9% 9.4% 14.2% TRD006964 5% 6.1% 17.0% 17.6% 28.2% 63.7% Primary human hepatocyte Double strand 0.0274 0.00914 0.00305 0.00102 0.000339 IC50 value No. nM nM nM nM nM (nM) TRD006884 80.2% 97.8% 105.7% 112.9% 85.3% 0.0756 TRD006885 64.5% 85.2% 115.5% 98.5% 112.2% 0.0427 TRD006888 66.9% 99.8% 95.3% 107.6% 106.1% 0.0574 TRD006925 86.9% 84.2% 107.3% 89.9% 80.3% 0.0336 TRD006928 44.8% 86.5% 107.2% 107.7% 111.6% 0.0267 TRD006937 84.7% 114.7% 110.1% 118.6% 107.4% 0.0953 TRD006886 78.2% 100.0% 115.3% 111.1% 115.2% 0.0631 TRD006971 19.6% 42.8% 69.5% 95.3% 105.3% 0.0071 TRD006964 81.3% 113.8% 112.6% 90.9% 97.1% 0.1202

    Example 30. Inhibition of Monkey ApoC3 in Primary Monkey Hepatocytes by siRNAs—11 Concentration Point Inhibitory Activity

    [1037] Primary monkey hepatocyte viability screening was performed on test compounds in primary monkey hepatocytes using 11 concentration gradients. Each siRNA sample for transfection was serially diluted 3-fold from the starting final concentration 20 nM to 11 concentration points.

    [1038] The cells were transfected with siRNAs at gradient final concentrations of 20 nM, 6.67 nM, 2.22 nM, 0.741 nM, 0.247 nM, 0.0823 nM, 0.0274 nM, 0.00914 nM, 0.00305 nM, 0.00102 nM and 0.000339 nM using Lipofectamine RNAi MAX (ThermoFisher, 13778150) according to the instructions of the product. Treatment solutions with the above concentrations were prepared in advance and added to a 96-well plate. The primary monkey hepatocytes were cryopreserved in liquid nitrogen. The primary monkey hepatocytes were thawed and then inoculated into the 96-well plate (with siRNA samples in it) at a density of 30 thousand cells per well. Each well contained 100 μL of medium.

    [1039] 24 h after reverse transfection treatment, the culture media were changed, and the culture was continued for 24 h. Then the total cellular RNA was extracted from the cells using a high-throughput cellular RNA extraction kit, and RNA reverse transcription and quantitative real-time PCR detection were carried out. The monkey ApoC3 mRNA level was measured and corrected based on the GAPDH internal reference gene level.

    [1040] The results are expressed relative to the remaining percentage of monkey ApoC3 mRNA expression in cells treated with the control siRNA. The IC50 results of inhibition are shown in Table 61. All could effectively inhibit monkey ApoC3 mRNA expression in primary monkey hepatocytes.

    TABLE-US-00059 TABLE 60 Taqman probe primers (10 μM working concentration) Primer name SEQ ID NO Primer sequence mkApoc3-PF SEQ ID NO: 439 GCCTGCCTGCTCTGTTCATC mkApoc3-PR SEQ ID NO: 440 AAGCCAAGAAGGGAGGTGTCC mkApoc3-P SEQ ID NO: 441 5′6-FAM-TTGTTGCTGCCGT GCTGTCACTCCTGG-3′BHQ1 mkGAPDH-PF SEQ ID NO: 442 TCAAGATCGTCAGCAACGCC mkGAPDH-PR SEQ ID NO: 443 ACAGTCTTCTGGGTGGCAGT mkGAPDH-P SEQ ID NO: 444 5′TET-ACCAACTGCTTAGC ACCCCTGGCCA-3′BHQ2

    TABLE-US-00060 TABLE 61 Multi-dose inhibitory activity of siRNAs against monkey ApoC3 in primary monkey hepatocytes 20 6.67 2.22 0.741 0.247 0.0823 Compound No. nM nM nM nM nM nM TRD006884 12.8% 12.3% 15.5% 27.7% 50.6% 76.5% TRD006888 1.6% 3.0% 4.7% 5.1% 7.3% 9.5% TRD006886 5.7% 3.7% 10.6% 7.3% 16.1% 17.0% TRD006964 2.4% 2.9% 4.7% 5.4% 10.5% 15.4% TRD006971 1.4% 1.7% 2.3% 3.2% 3.6% 5.7% TRD006925 1.4% 1.6% 2.3% 2.6% 3.6% 6.1% TRD006885 1.5% 3.6% 5.1% 4.1% 6.1% 7.7% 0.0274 0.00914 0.00305 0.00102 0.000339 IC50 value Compound No. nM nM nM nM nM (nM) TRD006884 112.6% 114.3% 131.3% 108.6% 112.1% 0.2291 TRD006888 12.8% 27.9% 67.4% 110.7% 100.9% 0.0051 TRD006886 42.1% 74.9% 87.6% 110.4% 100.9% 0.0204 TRD006964 36.5% 82.6% 82.1% 108.0% 92.6% 0.0214 TRD006971 8.1% 21.7% 52.4% 90.1% 100.2% 0.0036 TRD006925 11.3% 27.0% 58.6% 100.8% 97.7% 0.0045 TRD006885 19.1% 29.3% 65.4% 94.2% 93.3% 0.0052

    Example 31. In Vivo Testing of siRNA Agents in Apoc3 Transgenic Mice

    [1041] To assess and evaluate the in vivo effect of certain ApoC3 siRNA agents, ApoC3 transgenic mice (The Jackson Laboratory, 006907-B6; CBA-Tg (APOC3)3707Bres/J) were purchased and used. Experiments were carried out with the ApoC3 transgenic mice and the human ApoC3 protein, triglyceride and total cholesterol levels in serum were measured as recommended by the manufacturers of the kits (Roche Cobas C311: CHOL2 & TRIGL; MSD Human ApoC3 antibody set (B21ZV-3)).

    [1042] For normalization, the ApoC3 protein, triglyceride and total cholesterol levels for each animal at a time point were divided by the pre-treatment level of expression in that animal to determine the ratio of expression “normalized to pre-dose”.

    [1043] The ApoC3 protein, triglyceride and total cholesterol levels can be measured at various times before and after administration of ApoC3 siRNA agents. Unless otherwise noted herein, blood samples were collected from the submandibular area into centrifuge tubes with heparin sodium in them. After the blood samples were well mixed with heparin sodium, the tubes were centrifuged at 3,000×g for 5 min to separate the serum and stored at 4° C.

    [1044] The ApoC3 transgenic mouse model described above was used. On day 0, each mouse was given a single subcutaneous administration of 200 μL of the respective siRNA agent dissolved in PBS (1×) or control (PBS (1×)) (i.e., the Vehicle group), which included the administration groups shown in Table 62 below.

    TABLE-US-00061 TABLE 62 Administration groups of ApoC3 transgenic mice Route of No. Group Dose (mg/kg) administration 1 Vehicle NA s.c. 2 TRD006884 3 s.c. 3 TRD006888 3 s.c. 4 TRD006886 3 s.c. 5 TRD006925 3 s.c. 6 TRD006971 3 s.c.

    [1045] The injections of ApoC3 siRNA agents were performed between the skin and muscle (i.e. subcutaneous injections). Six mice in each group were tested (n=6). Serum was collected from the mice on day −2 (pre-dose blood collection with an overnight fast), and day 7, day 14, day 21, day 28, day 35 and day 42. Mice were fasted overnight prior to each collection. The ApoC3 protein, triglyceride and total cholesterol levels in serum were determined on an instrument according to the recommendations of the agent manufacturers.

    [1046] The ApoC3 protein, triglyceride and total cholesterol levels of each animal were normalized. For normalization, the ApoC3 protein, triglyceride and total cholesterol levels for each animal at a time point were each divided by the pre-treatment level of expression in that animal (in that case, on day −2) to determine the ratio of expression “normalized to pre-treatment”.

    [1047] Data from the experiments are shown below in Table 63 to Table 65 and in FIG. 7 to FIG. 9. Each of the ApoC3 siRNA agents in each of the administration groups (i.e., groups 2 to 6) showed significant reductions in the ApoC3 protein, triglyceride and total cholesterol levels as compared to the control (group 1).

    TABLE-US-00062 TABLE 63 Average total cholesterol (TC) normalized to pre-treatment D 7 D 14 D 21 D 28 Standard Standard Standard Standard Group Compound Average deviation Average deviation Average deviation Average deviation ID No. TC (+/−) TC (+/−) TC (+/−) TC (+/−) 1 Vehicle 1.141 0.275 1.,112 0.154 0.962 0.270 1.054 0.297 2 TRD006884 0.413 0.156 0.467 0.176 0.448 0.141 0.552 0.175 3 TRD006888 0.357 0.211 0.391 0.190 0.321 0.148 0.355 0.191 4 TRD006886 0.274 0.135 0.331 0.184 0.519 0.219 0.718 0.309 5 TRD006925 0.355 0.132 0.488 0.204 0.522 0.214 0.746 0.269 6 TRD006971 0.359 0.153 0.380 0.165 0.344 0.147 0.333 0.129

    TABLE-US-00063 TABLE 64 Average triglyceride (TG) normalized to pre-treatment D 7 D 14 D 21 D 28 Standard Standard Standard Standard Group Compound Average deviation Average deviation Average deviation Average deviation ID No. TG (+/−) TG (+/−) TG (+/−) TG (+/−) 1 Vehicle 0.992 0.574 0.770 0.289 0.805 0.324 0.910 0.456 2 TRD006884 0.143 0.102 0.165 0.178 0.264 0.200 0.428 0.332 3 TRD006888 0.103 0.080 0.147 0.129 0.113 0.069 0.168 0.131 4 TRD006886 0.105 0.075 0.189 0.152 0.391 0.311 0.573 0.380 5 TRD006925 0.121 0.061 0.241 0.149 0.279 0.134 0.627 0.208 6 TRD006971 0.102 0.080 0.106 0.086 0.129 0.117 0.087 0.076

    TABLE-US-00064 TABLE 65 Average ApoC3 protein normalized to pre-treatment D 7 D 14 D 21 Standard Standard Standard Group Compound Average deviation Average deviation Average deviation ID No. Apoc3 (+/−) Apoc3 (+/−) Apoc3 (+/−) 1 Vehicle 0.702 0.454 0.560 0.159 0.751 0.245 2 TRD006884 0.065 0.041 0.056 0.039 0.151 0.167 3 TRD006888 0.049 0.037 0.027 0.017 0.086 0.094 4 TRD006886 0.085 0.062 0.115 0.058 0.259 0.098 5 TRD006925 0.081 0.036 0.124 0.084 0.225 0.093 6 TRD006971 0.043 0.028 0.030 0.017 0.052 0.041

    Example 32. Evaluation of Different Modifications in Positions 9 and Position 10 of AS Strand

    [1048] In this experiment, the in vivo inhibition efficiency of the siRNA conjugates of the present disclosure with 2′-fluoro modifications at different sites against the target gene's mRNA expression level was investigated.

    [1049] 6- to 8-week-old male C57BL/6 mice were randomized into groups of 6, 3 mice per time point, and each group of mice was given test conjugates (TRD007047 and TRD006870), a control conjugate (TRD002218) and PBS.

    [1050] All the animals were dosed once by subcutaneous injection based on their body weight. The siRNA conjugates were administered at a dose of 1 mg/kg (calculated based on siRNA) in a volume of 5 mL/kg. The mice were sacrificed 7 days after administration, and their livers were collected and stored with RNA later (Sigma Aldrich). Then, the liver tissue was homogenized using a tissue homogenizer, and the total RNA was extracted from the liver tissue using a tissue RNA extraction kit (FireGen Biomedicals, FG0412) by following the procedure described in the instructions. The total RNA was reverse-transcribed into cDNA, and the TTR mRNA expression level in liver tissue was measured by real-time fluorescence quantitative PCR. In the fluorescence quantitative PCR method, the glyceraldehyde 3-phosphate dehydrogenase (GAPDH) gene was used as an internal reference gene, and the TTR and GAPDH mRNA expression levels are measured using Taqman probe primers for TTR and GAPDH, respectively.

    [1051] The TTR mRNA expression level was calculated according to the equation below:


    TTR mRNA expression=[(TTR mRNA expression in test group/GAPDH mRNA expression in test group)/(TTR mRNA expression in control group/GAPDH mRNA expression in control group)]×100%

    [1052] The compounds are shown in Table 66, the test compound grouping in mice is shown in Table 67, and the sequences of detection primers are shown in Table 68.

    TABLE-US-00065 TABLE 66 Compounds Compound SEQ ID SEQ ID No. NO SS strand NO AS strand TRD002218 SEQ ID CmsAmsGmUmGfUmUfCfUf SEQ ID UmsUfsAmUmAmGfAmGm NO: 445 UmGmCmUmCmUm NO: 446 CmAmAmGmAmAfCmAfCm AmUmAm Am-L96 UmGmsUmsUm TRD007047 SEQ ID CmsAmsGmUmGfUmUfCfUf SEQ ID UmsUfsAmUfAmGf(−)hmpN NO: 447 UmGmCmUmCmUm NO: 448 A(A)GmCfAmAmGfAmAfC AmUmAms Ams-NAG1 mAfCmUfGmsUmsUm TRD006870 SEQ ID CmsAmsGmUmGfUmUfCfUf SEQ ID UmsUfsAmUfAmGf(−)hmpN NO: 449 UmGmCmUmCmUm NO: 450 A(A)GmCmAfAmGfAmAfC AmUmAms Ams-NAG1 mAfCmUfGmsUmsUm

    TABLE-US-00066 TABLE 67 Test compound grouping in mice mRNA Number of Compound No. Dose quantification animals Note PBS — D7, 28 6 3 mice per time point TRD002218 1 mpk s.c. D7, 28 6 3 mice per time point TRD007047 1 mpk s.c. D7, 28 6 3 mice per time point TRD006870 1 mpk s.c. D7, 28 6 3 mice per time point

    TABLE-US-00067 TABLE 68 Sequences of detection primers Primer name SEQ ID NO Forward primer mTTR-F SEQ ID NO: 451 GGGAAGACCGCGGAGTCT mTTR-R SEQ ID NO: 452 CAGTTCTACTCTGTACACTCCTTCTACAAA mTTR-P SEQ ID NO: 453 5′6-FAM-CTGCACGGGCTCACCACAGATGA-3′BHQ1 mGAPDH-F SEQ ID NO: 454 CGGCAAATTCAACGGCACAG mGAPDH-R SEQ ID NO: 455 CCACGACATACTCAGCACCG mGAPDH-P SEQ ID NO: 456 5′TET-ACCATCTTCCAGGAGCGAGACCCCACT-3`BHQ2

    [1053] 28 days after administration, the in vivo inhibition efficiency of the siRNA conjugates of the present disclosure with F modifications at different sites against the target gene's mRNA expression level was shown in Table 69. siRNA compounds with F modifications at different sites inhibited more TTR mRNA expression than the positive control compound TRD002218 on day 28 after administration. The 9F and 10F modifications both showed high inhibition efficiency and the inhibitory effects were not significantly different, which indicates that the 9F and 10F modifications can mediate higher siRNA inhibition efficiency.

    TABLE-US-00068 TABLE 69 Experimental results 7 days 28 days Platform Remaining Remaining 9/10F Compound No. mRNA SD mRNA SD PBS 100%  11%  100%  9% PC TRD002218 31% 7% 49% 5% mTTR 9F TRD007047 15% 5% 39% 10%  mTTR 10F TRD006870 13% 4% 36% 3%