Helper-dependent adenoviral gene therapy delivery and expression system

11746359 · 2023-09-05

Assignee

Inventors

Cpc classification

International classification

Abstract

The present invention relates to gene therapy delivery and expression systems comprising at least one helper-dependent adenoviral vector containing a nucleic acid sequence encoding for proteoglycan 4 (PRG4) or a biologically active fragment thereof. The invention further relates to a pharmaceutical composition comprising a therapeutically effective amount of at least one helper-dependent adenoviral vector containing said nucleic acid sequence encoding for proteoglycan 4 (PRG4), or a homolog thereof from any other species, or a biologically active fragment thereof. The invention also relates to the use of the novel gene therapy delivery and expression system according to the invention for use in the prevention and/or treatment of camptodactyly-arthropathy-coxa vara-pericarditis (CACP), or a musculoskeletal disorder such as a joint disorder or joint disease.

Claims

1. A pharmaceutical composition, comprising a therapeutically effective amount of at least one helper-dependent adenoviral vector containing a nucleic acid sequence encoding proteoglycan 4 (PRG4), or a biologically active fragment thereof, which has chondoprotective activity, a left and a right adenoviral inverted terminal repeats (L ITR and R ITR), adenoviral packaging signal sequences and non-viral, non-coding stuffer nucleic acid sequences, wherein i. the at least one helper-dependent adenoviral vector additionally comprises a nucleic acid sequence encoding interleukin-1 receptor antagonist (II-1Ra), or ii the composition comprises a second helper-dependent adenoviral vector comprising a nucleic acid sequence encoding Il-1Ra; wherein PRG4 expression is controlled by an elongation factor 1 alpha (EF 1 alpha) promoter and expression of Il-1Ra is controlled by an NF-κB promoter, and wherein the at least one helper-dependent adenoviral vector containing a nucleic acid sequence encoding PRG4, comprises a nucleic acid sequence which has at least 90% sequence homology with the nucleic acid sequence set forth in SEQ ID NO: 1, or SEQ ID NO: 2.

2. The pharmaceutical composition according to claim 1, wherein the nucleic acid sequence encoding PRG4 comprises a nucleic acid sequence set forth in SEQ ID NO 3, or SEQ ID NO 4, or a biologically active fragment thereof, or a homolog thereof from any other species, or a nucleic acid sequence which has at least 90% sequence homology with a nucleic acid sequence set forth in SEQ ID NO 3, or SEQ ID NO 4, or a biologically active fragment thereof, wherein the PRG4 encoded by the biologically active fragment of SEQ ID NO 3, or SEQ ID NO 4, or a nucleic acid sequence which has at least 90% sequence homology with a nucleic acid sequence set forth in SEQ ID NO 3, or SEQ ID NO 4, or a biologically active fragment thereof, has chondoprotective activity.

3. The pharmaceutical composition according to claim 1, wherein the amino acid sequence of PRG4 comprises an amino acid sequence set forth in SEQ ID NO 5, or SEQ ID NO 6, or a biologically active fragment thereof, or a homolog thereof from any other species, or an amino acid sequence which has at least 90% sequence homology with an amino acid sequence set forth in SEQ ID NO 5, or SEQ ID NO 6, or a biologically active fragment thereof, wherein the amino acid sequence of PRG4, which comprises a biologically active fragment of the amino acid SEQ ID NO 5, or SEQ ID NO 6, or has at least 90% sequence homology with an amino acid sequence set forth in SEQ ID NO 5, or SEQ ID NO 6, or a biologically active fragment thereof, has chondoprotective activity.

4. The pharmaceutical composition according to claim 1, wherein the at least one helper-dependent adenoviral vector comprising the nucleic acid sequence encoding Il-1Ra, comprises a nucleic acid sequence which has at least 90% sequence homology with a nucleic acid sequence set forth in SEQ ID NO 7, or SEQ ID NO 8, or SEQ ID NO 9, or a biologically active fragment thereof, wherein the at least one helper-dependent adenoviral vector comprising the nucleic acid sequence encoding II-1Ra, which comprises a nucleic acid sequence which has at least 90% sequence homology with a nucleic acid sequence set forth in SEQ ID NO 7, or SEQ ID NO 8, or SEQ ID NO 9, or a biologically active fragment thereof, has II-1Ra activity of inhibiting inflammatory and cartilage destructive mediators.

5. The pharmaceutical composition according to claim 1, wherein the nucleic acid sequence encoding Il-1Ra comprises a nucleic acid sequence set forth in SEQ ID NO 10, or SEQ ID NO 11, or SEQ ID NO 12, or a biologically active fragment thereof, or wherein the nucleic acid sequence encoding for Il-1Ra comprises a nucleic acid sequence which has at least 90% sequence homology with a nucleic acid sequence set forth in SEQ ID NO 10, or SEQ ID NO 11, or SEQ ID NO 12, or a biologically active fragment thereof, wherein the Il-1Ra encoded by the biologically active fragment of SEQ ID NO 10, or SEQ ID NO 11, or SEQ ID NO 12, or the nucleic acid sequence which has at least 90% sequence homology with a nucleic acid sequence set forth in SEQ ID NO 10, or SEQ ID NO 11, or SEQ ID NO 12, or the biologically active fragment thereof, mediates II1-Ra activity of inhibiting inflammatory and cartilage destructive mediators.

6. The pharmaceutical composition according to claim 1, wherein the amino acid sequence of Il-1Ra comprises the amino acid sequence of human IL-1Ra (SEQ ID NO 13), murine IL-1Ra (SEQ ID NO: 14), equine IL-1Ra (SEQ ID NO: 15), or a biologically active fragment thereof, or a homolog thereof from any other species, which has Il-1Ra activity of inhibiting inflammatory and cartilage destructive mediators.

Description

BRIEF DESCRIPTION OF THE FIGURES

(1) FIG. 1. Prg4 transgenic mice are protected from development of age-related osteoarthritis. A, Comparison of 10 month-old wild type mice and Prg4 transgenic mice knee joints by OARSI grade (*P<0.05, n=7. Wilcox rank test). B, Safranin O staining and immunohistochemistry (antibody used to the left) of 10 month-old wild type (Wt) and Prg4 transgenic mice. Black arrows indicate osteoarthritis changes in proximal tibial articular cartilage in sagittal section, Scale bar, 100 pm μm. C, Representative image of the reconstruction of articular cartilage in 10-month-old wild type and Prg4 transgenic mouse with femoral cartilage shown in blue and tibial cartilage shown in yellow. Red arrow indicates loss of cartilage. Scale bar, 500 μm. D, Quantification of articular cartilage volume and surface area of bone covered by cartilage in mouse knee joints by phase contrast μCT. (*P<0.01, n=5, t-test). Error bars indicate s.e.m.

(2) FIG. 2. Prg4 transgenic mice are protected from the development of post-traumatic osteoarthritis, A, Comparison of Prg4 transgenic mice and wild type mice knee joints by OARSI grade (*P<0.05, n=8, ANOVA). B, Safranin O staining and immunohistochemistry (antibody used listed above each column) of wild type sham (Wt Sham), wild type with transection (Wt Sx) and Prg4 transgenic mice with transection (Prg4 Sx). Black arrows indicate areas with osteoarthritis changes in saggital sections through the knee. Scale bar, 100 μm. C, Representative images of reconstruction of knee joints with phase contrast μCT with femoral cartilage shown in blue and tibial cartilage shown in yellow. Red arrow indicates loss of cartilage, Scale bar, 500 μm. D, Quantification of articular cartilage volume and surface area of bone covered by cartilage in mouse joints by phase contrast μCT (*P<0.01, **P<0.05, N.S.=not significant, n=5-6, ANOVA). E, Average time that mice stayed on rotating rod 2 months after cruciate ligament transection in rotarod analysis (*P<0.05, n=15, ANOVA). F, Response time of mice after placement onto a 55° C. platform in hotplate analysis (*P<0.05, n=10, ANOVA), Error bars indicate s.e.m.

(3) FIG. 3: PRG4 delivered by helper-dependent adenoviral vectors (HDAd) protects mice from development of osteoarthritis. A, Representative image comparing intra-articular injection of HDAd and different serotypes of AAV. Vectors (10.sup.9 viral particles) each expressing GFP were injected intraarticularly into the knee joint. The lower panels are enlarged images of the boxed areas in the upper panels. Green: GFP, blue: DAPI. C: cartilage, S: synovium. Scale bar, 100 μm. B, Comparison of luciferase expression after intra-articular injection of first-generation adenoviral vector (FGV) and helper-dependent adenoviral vector (HDAd) (n=6) into the knee joint. C, Representative image of expression patterns of intra-articular injections of different doses of HDAD encoding □-galactosidase. The bottom images are enlarged areas of the black box in the upper images of saggital sections through the knee joint. C: Cartilage; S: Synovium. Scale bar, 100 μm. D-G, Scheme of experiment comparing the preventive effect HDAd-PRG4 injection and evaluation by OARSI grade and cartilage volume (D). Before transection, wild type mice were injected with HDAd-PRG4 intra-articularly at 10.sup.9 vp/joint (Sx+PRG4 H) or 10.sup.8 vp/joint (Sx+PRG4 L). Sham, transection without treatment (Sx) and injection of virus without transgene before transection (Sx+Vector) served as controls. Degree of osteoarthritis is presented by OARSI grade (E), cartilage volume (F) and cartilage surface area (G) (*P<0.05, n=8-10 in OARSI grading, n=5-6 in cartilage volume analysis, ANOVA). H-K, Scheme of experiment comparing the protective effect HDAd-PRG4 injection and evaluation by OARSI grade and cartilage volume (H). Two weeks after transection, wild type mice were injected with HDAd-PRG4 intra-articularly at 10.sup.9 vp/joint (Sx+PRG4 L) or 10.sup.8 vp/joint (Sx+PRG4 L), Sham, no treatment (Sx) and HDAd-GFP injection (Sx+GFP) served as controls. Degree of OA is presented by OARSI grade (I), cartilage volume (J) and cartilage surface area (K) (*P<0.05, n=8-10 in OARSI grading, n=5-6 in cartilage volume analysis, ANOVA). Error bars indicate s.e.m.

(4) FIG. 4: PRG4 delays osteoarthritis by inhibiting cartilage catabolism and terminal hypertrophy. A, Microarray heat map analysis comparing superficial zone cartilage of wild type and Prg4 transgenic mice, Genes with expression changes larger than 1.5 fold and p-value less than 0.05 are plotted. B, Transcription factor activity changes predicted by Ingenuity Pathway Analysis. All transcription factors shown here were predicted to be suppressed by Ingenuity Pathway Analysis. X-axis indicates the number of genes/gene groups controlled by each transcription pathway in the gene list submitted. C, Changes in gene expression (Prg4, Hif3a, Vegf, Col10a1 and Mmp13) in C3H10T1/2 cells under hypoxia (1% oxygen for 8 hours). Cells are sham treated, infected with empty HDAd (vector) or with HDAd-PRG4 (PRG4) (*P<0.05, n=3, ANOVA). D, Changes of PRG4 and Hif3alpha expression under normoxia and hypoxia in TC71 Ewing sarcoma cells (*P<0.05, n=3, t-test). E, Changes of gene expression after Hif3alpha knockdown by siRNA (*P<0.05, n=3, ANOVA). F, Proposed model of PRG4 function in prevention of osteoarthritis development. Error bars indicate s.e.m.

(5) FIG. 5: PRG4 over-expression under the Col2al promoter does not adversely affect the development of mice. A, Schematic figure of the Prg4 transgenic mice construct. B, Rib cartilage expression levels of PRG4, Sox9 and Col2al in newborns (P1) PRG4 transgenic and wild type mice (*P<0.05, n=7-8, student t-test). C, Comparison of anti-PRG4 antibody stained femoral head section in wild type and Prg4 transgenic newborn mice. Scale bars, 100 μm. D, Comparison of anti-PRG4 antibody stained knee joints in Prg4 transgenic and wild type 3 month-old mice. The boxed areas to the left (articular area, distal femoral growth plate and proximal tibial growth plate) are enlarged at the right. Scale bars, 100 μm. E, Weight of Prg4 high expresser, low expresser and wild type mice (P<0.05, n=10-11). F, Representative image of BrdU (red) and DAPI (blue) staining in wild type and Prg4 transgenic P3 hind limbs. Staining signals were quantified by image J (P<0.05, n=7). Scale bars, 100 μm. G, Representative image of TUNEL (brown) and methyl green staining in wild type and Prg4 transgenic P3 hind limbs. No positive signals were visible in cartilage but they were present in overlying dermis and skin. Scale bar, 100 μm. Error bars indicate s.e.m.

(6) FIG. 6: Generation and characterization of HDAd-PRG4. A, HDAd-PRG4 band is visible in the last step of cesium chloride ultracentrifugation. The purified virus is the white band in the tube. B, PCR determination of PRG4 expression of HEK293 cells infected with HDAd-PRG4 (PRG4), HDAd-GFP (GFP), and sham treatment (cells). Gapdh is used as loading control. C, Immunofluorescence of HEK293 cells infected with HDAd-PRG4 (PRG4, red) and HDAd-GFP (GFP, green). DAPI (blue) was used as counter-stain.

(7) FIG. 7: Gene expression profiling of wild type vs. Prg4 transgenic superficial layer chondrocytes. A, Laser capture micro-dissection of superficial layer chondrocytes. Left to right: tissue before capturing, captured tissue on HS cap, and remaining tissue on the slide. Scale bar, 100 μm. B, Evaluation of Hif3a expression in superficial layer chondrocytes of wild type vs. Prg4 mice (*Py0.05, n=3, t-test). C, Evaluation of PRG4 expression in ATDC5 and C3H10T1/2 cells under normoxic and hypoxic conditions (*P<0.05, n=3, t-test), Error bars indicate s.e.m.

(8) FIG. 8: A, Mice were treated with HDAd-PRG4 (PRG4), HDAd-Il-1Ra (Il1Ra) and combination therapy (PRG4+Il1Ra) according to the scheme shown in FIG. 3 H. All three groups showed significantly lower histological score compared to no treatment and placebo treatment, suggesting therapeutic effects to HDAd-PRG4 and HDM-Il-1Ra. The combination therapy showed a trend of being more effective, (ANOVA, N=8-10, *p<0.05); B, C, Mice were treated with HDAd-PRG4 (PRG4), HDAd-Il1-Ra (Il1Ra) and combination therapy according to the scheme shown in FIG. 3 H. Cartilage surface area (B) and cartilage volume (C) were quantified. All three groups showed significantly higher cartilage volume and surface area compared to no treatment and placebo treatment, suggesting therapeutic effects of HDAd-PRG4 and HDAd-Il1Ra. The knees under combination therapy had more preserved cartilage volume and surface area (ANOVA, N=5, *p<0.05).

DETAILED DESCRIPTION

(9) It is therefore an object of the present invention to provide an improved delivery and expression system that allows for long-term expression of biologically active proteoglycan 4 (PRG4) for use in the prevention and/or treatment of PRG4-dependent disorders such as camptodactyly-arthropathy-coxa vara-pericarditis (CACP) and disorders in which PRG4 overexpression is beneficial such as musculoskeletal disorders in particular joint disorders.

(10) The solution for the problem is provided by a gene therapy delivery and expression system, comprising the technical features as claimed in claim 1. Preferred embodiments of the invention are subject-matter of the dependent claims.

(11) The gene therapy delivery and expression system according to the present invention comprises at least one helper-dependent adenoviral vector containing a nucleic acid sequence encoding for proteoglycan 4 (PRG4), or a biologically active fragment thereof, left and right adenoviral inverted terminal repeats (L ITR and R ITR), adenoviral packaging signal sequences and non-viral, non-coding stuffer nucleic acid sequences.

(12) Any known left or right adenoviral inverted terminal repeats (L ITR and R ITR), adenoviral packaging signal sequences and non-viral, non-coding stuffer nucleic acid sequences can be used for the production of the helper-dependent adenoviral vector (Parks, R. J., Chen, L., Anton, M., Sankar, U., Rudnicki, M. A., and Graham, F. L. (1996). A helper-dependent adenovirus vector system: removal of helper virus by Cre-mediated excision of the viral packaging signal. Proc Natl Acad Sci USA 93, 13565-13570; Palmer, D. and Ng, P. (2003). Improved system for helper-dependent adenoviral vector production. Mol Ther 8, 846-852).

(13) The results and data shown herein are based on helper-dependent adenoviral constructs (HDAd) using in a first embodiment nucleic acid sequences or amino-acid sequences encoding for proteoglycan 4 (PRG4). Any homolog or variant showing a certain degree of sequence homology with either a nucleic acid sequence or an amino-acid sequence of proteoglycan 4 (PRG4) (or their variant such as lubricin, superficial zone protein or megakaryocyte stimulating factor precursor) is further comprised by the present invention. A homolog includes but is not limited to peptides, polypeptides, proteins or nucleic acid sequences from any species that shows homology with any proteoglycan (PRG4) described herein,

(14) For long-term expression of PRG4 in the affected tissue, for example in joints or osteoarthritic tissues, the at least one helper-dependent adenoviral vector of the invention is preferably controlled by a ubiquitous, constitutive promoter. Suitable promoters include, but are not limited to elongation factor 1 alpha (EF1 alpha) promoter, cytomegalovirus (CMV) promoter, beta-actin promoter, simian virus 40 (SV40) early promoter, ubiquitin c promoter, glyceraldehyde 3-phosphate dehydrogenase (GAPDH) promoter, phosphoglycerate kinase (PGK) promoter and other HDAd-suitable ubiquitous, constitutive promoters.

(15) In a preferred embodiment, the helper-dependent adenoviral vector comprising proteoglycan 4 (PRG4) comprises a nucleic acid sequence set forth in SEQ ID NO 1 (human HDAd) or SEQ ID NO 2 (murine HDAd). Preferably, the nucleic acid sequence comprises a cDNA sequence of the PRG4 gene or a fragment thereof. Furthermore, any biologically active fragment such as nucleic acid sequences having sequence identity or a certain degree of homology with the human or murine PRG4 sequence disclosed herein is comprised by the present invention. The HDAd of the invention may vary in its non-coding elements as well as in the length of its coding insert. Therefore, also smaller or greater vector sizes of the helper-dependent adenoviral vector of the invention can be utilized for the purpose of the present invention in order to achieve the desired biological effects.

(16) In a preferred embodiment, the helper-dependent adenoviral vector comprises a nucleic acid sequence which has at least 50%, 60%, 70%, 80% or 90% sequence homology with a vector sequence comprising a nucleic acid sequence set forth in SEQ ID NO 1 or SEQ ID NO 2, or a biologically effective fragment thereof.

(17) A sequence homology of at least 50% with a nucleic acid sequence set forth in SEQ ID NO 1 or SEQ ID NO 2 can be sufficient in order to generate long-term expression of PRG4 at the target sites as along as the expressed PRG4 protein is biologically active.

(18) In one embodiment the helper-dependent adenoviral vector comprises a nucleic sequence encoding for proteoglycan 4 (PRG4). The expression of human or mammalian PRG4 is preferred. The inserted nucleic acid sequence into the HDAd can be anyone, which shows sequence identity or sequence homology with a nucleic acid sequence set forth in SEQ ID NO 3 or SEQ ID NO 4. For the purpose of expression, it can be sufficient that only a part of the nucleic acid sequence set forth in SEC ID NO 3 or SEQ ID NO 4, or an extended version is sufficient for the generation of the vector and its biological activity. The biological activity can be measured by investigating chondoprotection.

(19) Furthermore, also mutants, variants and homologs containing nucleic acid replacements within the amino acid or nucleic acid sequence of proteoglycan 4 (PRG4) are comprised by the present invention. In particular, the invention comprises a homolog of PRG4 from any other animal species having sequence homology with a sequence set forth in SEQ ID NO 3 or SEQ ID NO 4. For example, a homolog containing a nucleic acid sequence encoding for proteoglycan 4 (PRG4) preferably comprises a nucleic acid sequence, which has at least 50%, 60%, 70%, 80% or 90% sequence homology with a nucleic acid sequence set forth in SEQ ID NO 3, or SEQ ID NO 4, or a biologically effective fragment thereof.

(20) The proteoglycan 4 (PRG4) used in the construction of the vector of the present invention can be also described by its amino acid sequence. Preferably, the proteoglycan 4 (PRG4) comprises an amino acid sequence set forth in SEQ ID NO 5 or SEQ ID NO 6, or a biologically active fragment thereof, or a homolog thereof from any other species. In a preferred embodiment, the amino acid sequence encoding for proteoglycan 4 (PRG4) comprises an amino acid sequence which has at least 50%, 60%, 70%, 80% or 90% sequence homology with an amino acid sequence set forth in SEQ ID NO 5, or SEQ ID NO 6, or a biologically active fragment thereof, or a homolog thereof from any other species.

(21) The inventors show herein that a helper-dependent adenoviral vector containing the cDNA sequence of murine or human proteoglycan 4 (PRG4) under the control of a ubiquitous, constitutive promoter results in an overexpression of PRG4 in joints, which results in protection of mice from osteoarthritis. Since overexpression of PRG4 can be beneficial in many other diseases, the helper-dependent vector of the invention can be used for the manufacture of a medicament for the treatment and/or prevention of a variety musculoskeletal diseases and PRG4-dependent diseases. In particular, musculoskeletal disorders, which benefit from PRG4 over-expression would be characterised as those disorders where high concentrations of PRG4 confer a therapeutic or preventive effect. PRG4-dependent diseases or disorders would be characterised in that natural PRG4 expression is limited or inhibited, or in that intracellular or extracellular PRG4 RNA or protein levels are significantly reduced.

(22) The inventors compared joint transduction efficiency of helper-dependent adenoviral vectors with different AAV serotype that had been reported by others to be useful in joint gene therapy approaches. Surprisingly, the inventors found that helper-dependent adenoviral vectors showed superior transduction compared with all tested AAV serotypes resulting in transduction of synoviocytes and chondrocytes. The inventors further showed that helper-dependent adenoviral vectors allow for transgene expression that persists for an extended period, whereby the need for repeated administrations of the medicament to an object suffering from a disease in which overexpression of PRG4 may be beneficial will be greatly reduced. In a model of osteoarthritis in mice, the inventors demonstrated that treatment of osteoarthritic joints with the HDAd-PRG4 results in lower osteoarthritis histology scores, indicating that PRG4 exhibits its biological effect by protecting the subject from post-traumatic osteoarthritis. Protection against osteoarthritis with HDAd-PRG4 was demonstrated using two different schemes. In the first scheme mice were injected with HDAd-PRG4 before osteoarthritis was induced. The results of this experiment show that HDAd-PRG4 can be used in the prevention of osteoarthritis. In the second scheme, osteoarthritis was induced before HDAd-PRG4 was injected. The results of this experiment demonstrate that HDAd-PRG4 can be used in the treatment of (pre-existing) osteoarthritis. In support of the biological effects of PRG4 in joints, experiments using Prg4-transgenic mice revealed a protection of the subjects against the development of osteoarthritis without other bone phenotypes.

(23) Thus, overexpression of PRG4 under the control of a suitable ubiquitous, constitutive promoter in a HDAd allows for prevention and/or treatment of a variety of musculoskeletal diseases such as arthropathies, all types of arthritis, including arthritis-related disorders, osteoarthritis, rheumatoid arthritis, gout and pseudo-gout, septic arthritis, psoriatic arthritis, ankylosing spondylitis, juvenile idiopathic arthritis. Still's disease, Reiter's syndrome, or tendinopathies including tendonitis, tendinosis, tenosynovitis; synovial disorders including synovitis; Bursa disorders including bursitis; equine musculoskeletal disorders including bone spavin, navicular syndrome, osselet.

(24) Surprisingly, the inventors further found that a combined expression of PRG4 as induced by HDAd-PRG4 and inhibitors of inflammatory and cartilage destructive mediators results in beneficial therapeutic and protective effects. In particular, a combination of expressing of PRG4 and expressing interleukin-1 receptor antagonist (Il-1Ra) resulted in an increased efficiency in the treatment and/or prevention of musculoskeletal disorders.

(25) In a preferred embodiment, the helper-dependent adenoviral vector therefore comprises a nucleic acid sequence encoding for inhibitors of inflammatory and cartilage destructive mediators such as cytokines including Il-1, TNFa, Il-6, Il-7 Il-8, Il-11, Il-15, Il-17, Il-18, Il-21, leukemia inhibitory factor (LIF), oncostatin M; matrix metalloproteases including MMP-1,3,9,13; aggrecanases including ADAMTS-1,4,5; toll-like receptors (TLR) such as TLR2, TLR4; and nuclear factor ‘kappa-light-chain-enhancer’ of activated B-cells (NF-κB).

(26) In a preferred embodiment, the inhibitor of inflammatory and cartilage destructive mediator is interleukin-1 receptor antagonist (Il-1Ra). A combination of overexpression of PRG4 and Il-1Ra is beneficial for the treatment and/or prevention of the diseases mentioned therein. In a first embodiment, the cDNA sequence of interleukin-1 receptor antagonist can be contained in the same helper-dependent adenoviral vector, which contains the cDNA sequence encoding for proteoglycan 4 (PRG4). In a further embodiment, the cDNA sequence of interleukin-1 receptor antagonist can be contained in a second helper-dependent adenoviral vector, which only contains the cDNA sequence encoding for Il-1Ra.

(27) The delivery and expression system of the invention can therefore comprise a second or further helper-dependent adenoviral vector comprising a nucleic acid sequence encoding for inhibitors of inflammatory and cartilage destructive mediators such as interleukin-1 receptor antagonist (Il-1Ra).

(28) In a preferred embodiment, the cDNA of the inhibitor of inflammatory and cartilage destructive mediator (e.g. Il1-Ra cDNA) inserted into HDAd is controlled by an inflammation-inducible promoter. Preferred promoters include, but are not limited to promoters selected from the group consisting of NF-κB promoter, interleukin 6 (Il-6) promoter, interleukin-1 (Il-1) promoter, tumor necrosis factor (TNF) promoter, cyclooxygenase 2 (COX-2) promoter, complement factor 3 (C3) promoter, serum amyloid A3 (SAA3) promoter, macrophage inflammatory protein-1α (MIP-1α) promoter, or hybrid constructs of the above. The use of NF-κB promoter in HDAd for the purpose of an inflammation-dependent expression of Il-1Ra at the target sites is preferred.

(29) In a preferred embodiment, the helper-dependent adenoviral vector containing the interleukin-1 receptor antagonist (Il-1Ra) comprises a nucleic acid sequence which has at least 50%, 60%, 70%, 80% or 90% sequence homology with a nucleic acid sequence set forth in SEQ ID NO 7 (human Il-1Ra), or SEQ ID NO 8 (murine Il-1Ra), SEQ ID NO 9 (equine Il-1Ra), or a biologically effective fragment thereof.

(30) In a further embodiment, the nucleic acid sequence encoding for interleukin-1 receptor antagonist (Il-1Ra) comprises a nucleic acid sequence set forth in SEQ ID NO 10 (human Il-1Ra), or SEQ ID NO 11 (murine Il-1Ra), or SEQ ID NO 12 (equine Il-1Ra), or a biologically active fragment thereof, or a homolog thereof from any other species.

(31) In a preferred embodiment, the amino acid sequence encoding for interleukin-1 receptor antagonist (Il-1Ra) comprises an amino acid sequence set forth in SEQ ID NO 13 (human Il-1Ra), or SEQ ID NO 14 (murine Il-1Ra), or SEQ ID NO 15 (equine Il-1Ra), or a biologically active fragment thereof, or a homolog thereof from any other species.

(32) The present invention also relates to a pharmaceutical composition, comprising a therapeutically effective amount of at least one helper-dependent adenoviral vector containing a nucleic acid sequence encoding for proteoglycan 4 (PRG4), or a biologically active fragment thereof. Preferred embodiments of the pharmaceutical composition comprise helper-dependent adenoviral vectors or a combination of different helper-dependent adenoviral vectors comprising features as described above in more detail.

(33) The gene therapy delivery and expression system according to the present invention is suitable for the preparation of a medicament for the use in the prevention and/or treatment of a variety of PRG4-dependent diseases. In a first embodiment the gene therapy delivery and expression system is used in the treatment and/or prevention of camptodactyly-arthropathy-coxa vara-pericarditis (CACP). The helper-dependent adenoviral vectors of the invention can further be used in the prevention and/or treatment of a musculoskeletal disorder, in particular the prevention and/or treatment of a joint disorder or disease. Examples of such diseases are arthropathies, all types of arthritis, including arthritis-related disorders, osteoarthritis, rheumatoid arthritis, gout and pseudo-gout, septic arthritis, psoriatic arthritis, ankylosing spondylitis, juvenile idiopathic arthritis, Still's disease, Reiter's syndrome, or tendinopathies including tendonitis, tendinosis, tenosynovitis; synovial disorders including synovitis; Bursa disorders including bursitis; equine musculoskeletal disorders including bone spavin, navicular syndrome, osselet.

(34) The following examples show the beneficial therapeutic uses of the gene therapy delivery and expression system according to the present invention. In particular, it will be shown that intra-articular expression of proteoglycan 4 (PRG4) in mice protects against development of osteoarthritis (OA). The data are supported by long-term PRG4 expression under the type II collagen promoter (Col2a1) in transgenic mice. Accordingly long-term expression of PRG4 does not adversely affect skeletal development but protects from developing signs of age-related osteoarthritis.

(35) The protective effect is also shown in a model of post-traumatic osteoarthritis created by cruciate ligament transection (CLT). Moreover, intra-articular injection of helper-dependent adenoviral virus (HDAd) expressing PRG4 protected against the development of post-traumatic osteoarthritis when administered either before or after injury. Gene expression profiling of mouse articular cartilage and in vitro cell studies show that PRG4 expression inhibits the transcriptional programs that promote cartilage catabolism and hypertrophy through the up-regulation of hypoxia inducible factor 3 alpha. Analyses of available human osteoarthritis datasets are consistent with the predictions of this model. Hence, the data provide insight into the mechanisms for osteoarthritis development and offer a potential chondroprotective approach to its treatment.

(36) Moreover, injection of helper-dependent adenoviral vectors expressing PRG4 (HDAd-PRG4) and Il-1Ra (HDAd-Il1-Ra) in combination into joints of wild type mice after transection of cruciate ligaments exhibited protective effects against osteoarthritis. Co-injection of HDAd-PRG4 and HDAd-Il1-Ra at the same dose results in a greater extent of cartilage preservation compared to single vector injections.

(37) As such PRG4 in single application or in combination with Il-1Ra is a novel target in chondoprotection using the helper-dependent adenoviral vectors of the invention.

Examples

(38) Results

(39) PRG4 Prevents Development of Age Related Osteoarthritis Changes

(40) To investigate the long-term effect of Prg4 over-expression, the inventors generated transgenic mice expressing Prg4 under the cartilage specific type II collagen promoter (Col2a1) (FIG. 5A). PRG4 transgenic mice expressed Prg4 ectopically in growth plate cartilage and over-express Prg4 in articular cartilage throughout development and adulthood (FIG. 5B-D). Macroscopically, the inventors detected no differences in growth or skeletal development in Prg4 transgenic mice when assessed by weight (FIG. 5E). Microscopically, markers of chondrocyte proliferation or apoptosis remained the same in Prg4 mice vs. wild type mice as assessed by BrdU staining (p=n.s. in both proliferating and resting zone of P1 chondrocytes) (FIG. 5F) and TUNEL staining (no positive signals in P1 chondrocytes) (FIG. 5G), respectively. These data suggested that ectopic over-expression of Prg4 in cartilage did not significantly affect chondrocyte or skeletal homeostasis.

(41) The inventors sought to determine whether Prg4 over-expression in particular chondrocytes protected mice from age-related osteoarthritic changes. Relatively few studies have been performed to assess the development of age-related osteoarthritis in animal models (M. Silbermann, E. Livne, Age-related degenerative changes in the mouse mandibular joint. Journal of Anatomy 129, 507 (October, 1979). Moreover, no gain of function model has been shown to be protective against age-related osteoarthritis. In an aging cohort, as assessed by the Osteoarthritis Research Society International (OARSI) histological grading scale (S. S. Glasson, M. G. Chambers, W. B. van den Berg, C. B. Little, The OARSI histopathology initiative—recommendations for histological assessments of osteoarthritis in the mouse. Osteoarthritis and cartilage/OARSI, Osteoarthritis Research Society 18, S17 (Oct. 1, 2010), the inventors observed that wild type FVB/N mice developed changes consistent with moderate osteoarthritis by 10 months of age, with a mean OARSI grade of 3.5. However, PRG4 transgenic mice at the same age exhibited a mean OARSI grade of 2 (p<0.05), suggesting less severe signs of osteoarthritis (FIG. 1A). The inventors next assessed the molecular differences in particular chondrocytes between the PRG4 and wild type mice. As Collagen type X (Col10a1) and matrix metalloproteinase 13 (Mmp13) are markers of cartilage hypertrophy and degradation, respectively, increased expression of Mmp13 and Col10a1 above the tide marks are hallmarks of osteoarthritis (T. Saito et al., Transcriptional regulation of endochondral ossification by HIF-2α during skeletal growth and osteoarthritis development. Nature Medicine 16, 678 (Jun. 23, 2010)). Encouragingly, the inventors detected increased expression of Col10a1 and Mmp13 in wild type mice with aging, while Prg4 transgenic mice did not show a qualitative increase in either marker in the noncalcified region of articular cartilage (FIG. 1b). These results suggest that Prg4 overexpression had a protective effect against osteoarthritis at the molecular and histological levels.

(42) A disadvantage of conventional histological endpoints is the lack of three-dimensional quantification as well as ascertainment bias based on choice of sections. Hence, the inventors applied an approach to quantify cartilage properties (e.g., volume, surface area, bone area covered by cartilage) based on three-dimensional reconstructions of phase contrast μCT imaging data (M. Ruan et al., Quantitative imaging of murine osteoarthritic cartilage by phase contrast micro-computed tomography. Arthritis Rheum, (2012)). Using this imaging technique, the inventors found that wild type mice showed a decrease in articular cartilage volume as well as in the bone area covered by cartilage (FIG. 1C,D). In contrast, Prg4 transgenic mice showed preservation of articular cartilage volumes and surface area (p<0.01) (FIG. 1C,D). Thus, as compared to wild type mice after transection, Prg4 transgenic mice had none of the histological, molecular and imaging findings characteristic of osteoarthritis. These data suggested that PRG4 over-expression may have protective effects in the context of age-related osteoarthritic-like changes.

(43) PRG4 Prevents Development of Post-Traumatic Osteoarthritis

(44) To test whether PRG4 over-expression protects mice from the development of more aggressive, post-traumatic osteoarthritis, the inventors applied the knee cruciate ligament transection model recently developed in the inventors' lab, to both wild type and Prg4 transgenic mice (M. Ruan et al., Quantitative imaging of murine osteoarthritic cartilage by phase contrast micro-computed tomography. Arthritis Rheum, (2012). The inventors chose this approach because anterior cruciate ligament tears are a common cause of post-traumatic arthritis in humans. As assessed by the OARSI histological grading scale, wild type mice developed moderate and severe osteoarthritis one and two months after transection, respectively (FIG. 2A) (M. Ruan et al., Quantitative imaging of murine osteoarthritic cartilage by phase contrast micro-computed tomography. Arthritis Rheum, (2012). Prg4 transgenic mice showed a lower grade OARSI score compared to wild type mice one and two months after transection (FIG. 2A), Interestingly, one month after transection, the OARSI grade of cartilage from Prg4 transgenic mice was not significantly different from wild type mice after sham surgery (FIG. 2A), further supporting that PRG4 expression had a protective effect against osteoarthritis. In addition, the inventors detected increased expression of Col10a1 and Mmp13 in the noncalcified articular cartilage of wild type transected mice, but not in transected Prg4 transgenic mice or wild type mice after sham surgery (FIG. 2B).

(45) The inventors next assessed the cartilage volume and bone area covered by cartilage after surgical transection using phase-contrast microCT (M. Ruan et al., Quantitative imaging of murine osteoarthritic cartilage by phase contrast micro-computed tomography. Arthritis Rheum, (2012)). After transection, wild type mice showed decrease in both cartilage volume and bone area covered by cartilage (p<0.01). In contrast, Prg4 transgenic mice showed articular cartilage volumes and areas similar to wild type mice after sham surgery (FIG. 2C,D). Thus, as compared to wild type mice after transection, Prg4 transgenic mice had none of the histological, molecular or imaging findings characteristic of osteoarthritis.

(46) Pain and motor dysfunction are also hallmarks of osteoarthritis and are typical causes of chronic disability (M. B. Goldling, S. R. Goldring, Osteoarthritis. Journal of Cellular Physiology 213, 626 (2007)), They also serve as important clinical end points for interventional trials. Therefore, the inventors applied rodent behavioral testing, i.e., rotarod and hotplate analyses, to evaluate for potential motor and/or sensory dysfunction in wild type vs. Prg4 transgenic mice after osteoarthritis induction. Surgically transected wild type mice showed a decreased time on the rotarod (p<0.05) and increased time on the hotplate (p<0.05), while Prg4 transgenic mice with and without transection were indistinguishable from wild type mice after sham surgery (p=n.s.) (FIG. 2E,F). This suggested that Prg4 transgenic mice after transection had less motor or sensory impairments as compared to wild type mice, supporting that PRG4 prevented functional impairment in post-traumatic osteoarthritis.

(47) Gene Transfer with HDAd-PRG4 Effectively Treats Osteoarthritis

(48) To translate localized expression of PRG4 into a therapeutic approach, the inventors tested whether gene transfer into the joint could mediate long-term expression and chondroprotection in osteoarthritis. Since delivery of recombinant protein is often therapeutically limited by their short half-life, the inventors chose to use a viral gene transfer approach. The most studied viral vectors for gene transfer related to osteoarthritis treatment are adeno-associated virus (AAV) and adenovirus. Both have been shown to transduce chondrocytes in vitro in primary chondrocyte and cartilage organ cultures and in vivo in rabbit and rat knee joints (J. D. Kay et al., Intra-articular gene delivery and expression of interleukin-1Ra mediated by self-complementary adeno-associated virus. The journal of gene medicine 11, 605 (July, 2009); Y. Arai et al., Gene delivery to human chondrocytes by an adeno associated virus vector. journal of Rheumatol 27, 979 (April, 2000); J. Gouze, Adenovirus-mediated gene transfer of glutamine: fructose-6-phosphate amidotransferase antagonizes the effects of interleukin-1β on rat chondrocytes. Osteoarthritis and Cartilage 12, 217 (April, 2004)). However, no direct comparison has been made between the two viruses. After injection of GFP expressing helper-dependent adenovirus and AAVs of the serotypes 2; 2.5 and 6 into mouse knee joints (10.sup.9 viral particles per joint in 5 ul), helper-dependent adenovirus was noted to exhibit higher transduction efficiency at 2 weeks post-injection (FIG. 3A).

(49) While first generation adenovirus vectors (FGV) can mediate highly efficient tissue transduction, the immune response to viral proteins limits transgene expression. Previous studies performed by the inventors and others showed that helper-dependent adenoviral vectors (HDAd) devoid of viral coding genes could overcome this problem (D. J. Palmer, D. J. P. D. P. Ng, Helper-dependent adenoviral vectors for gene therapy. Human gene therapy 16, 1 (2005)). For example, a single injection of HDAd can mediate long-term transgene expression in small and large animal models for over 7 years in liver (N. Brunetti-Pierri, P. Ng, Helper-dependent adenoviral vectors for liver-directed gene therapy. Hum Mol Genet 20, R7 (Jun. 13, 2011)). Thus, the inventors tested whether HDAd could mediate long-term expression of luciferase in mouse joint compared to FGVs. Indeed, the inventors found that after a single infra-articular injection, HDAds mediated expression of luciferase in mouse knee joints for over one year, while FGV-mediated luciferase expression was lost by one month (FIG. 3B). To evaluate the dose response and cellular distribution of transduction, the inventors assessed mouse knee joints injected with 10.sup.9 vs. 10.sup.8 viral particles HDAd expressing beta-galactosidase. These doses were at least 10 and 100 times lower than the maximum tolerated systemic dose in humans (K. Relph, K. Harrington, H. Pandha, Recent developments and current status of gene therapy using viral vectors in the United Kingdom. BMJ (Clinical research ed.) 329, 839 (Oct. 9, 2004)).

(50) At the higher dose, HDAd transduced superficial layer chondrocytes and synoviocytes, while only synoviocytes were transduced at the lower dose (FIG. 3C). Thus, the inventors showed that HDAd was able to efficiently transduce synoviocytes and chondrocytes with maintaining transgene expression for at least one year.

(51) To compare the effects of PRG4 expression from superficial layer chondrocytes vs. synoviocytes, the inventors treated mice at both doses with HDAd expressing PRG4 (FIGS. 6A-C) 48 hours prior to surgical cruciate ligament transection. The inventors found that both low dose (mediating expression only in synoviocytes) and high dose (mediating expression in both synoviocytes and superficial zone chondrocytes) treatment with HDAd-PRG4 vector protected joints from osteoarthritis development (FIG. 3D-G). Since the clinical application of PRG4 for osteoarthritis would likely be administrated after an injury, the inventors next tested the efficacy of HDAd-PRG4 injection two weeks after osteoarthritis induction. In this context, injection of the lower dose of HDAd-PRG4 was sufficient to preserve cartilage volumes and prevent cartilage degradation as assessed by μCT, while higher dose injection showed protective effects both by histological OARSI grading and μCT assessment. Importantly, these data suggested that ectopic expression from synoviocytes was sufficient to achieve a certain degree of chondroprotection by acting in a non-cell-autonomous fashion (FIG. 3H-K).

(52) PRG4 Inhibits Transcriptional Programs of Chondrocyte Hypertrophy and Hypoxic Inducible Factors in Cartilage

(53) The potential mechanisms of the protective effects of PRG4 have only been partially deciphered. While previous studies have shown that PRG4 relieves mechanical stress in joints by changing synovial fluid dynamics and providing boundary lubrication (G. D. Jay, J. R, Torres, M. L. Warman, M. C. Laderer, K. S. Breuer, The role of lubricin in the mechanical behavior of synovial fluid. Proc Natl Acad Sci USA 104, 6194 (Apr. 10, 2007)), the inventors investigated whether PRG4 could directly affect cartilage metabolism and homeostasis. To assess the molecular effects of PRG4 on chondrocytes, the inventors performed transcriptional profiling on superficial layer chondrocytes obtained by laser capture in newborn wild type vs. Prg4 transgenic mice (FIG. 4A and FIG. 7A). Genes that were either up-regulated or repressed by greater than 1.5 fold (Dataset 1) were analyzed by Ingenuity Pathway Analysis to identify transcriptional programs that would be affected by Prg4 expression (Dataset 2). Interestingly, transcription factors that mediate chondrocyte hypertrophy and terminal differentiation (e.g. Mef2c, Runx2 and Atf4) showed decreased activity with PRG4 over-expression (K. S. Lee et al., Runx2 Is a Common Target of Transforming Growth Factor beta 1 and Bone Morphogenetic Protein 2, and Cooperation between Runx2 and Smad5 Induces Osteoblast-Specific Gene Expression in the Pluripotent Mesenchymal Precursor Cell Line C2C12. Molecular and cellular biology 20, 8783 (Dec. 1, 2000); X. Yang et al., ATF4 is a substrate of RSK2 and an essential regulator of osteoblast biology; implication for Coffin-Lowry Syndrome. Cell 117, 387 (May 30, 2004); M. A. Arnold et al., MEF2C Transcription Factor Controls Chondrocyte Hypertrophy and Bone Development. Developmental Cell 12, 377 (April, 2007)). In addition, the inventors also noted down-regulation of Smad7, an inhibitor of the TGFbeta signaling pathway (A. Nakao et al., Identification of Smad7, a TGFbeta-inducible antagonist of TGF-beta signalling. Nature 389, 631 (Oct. 9, 1997)). TGFbeta signaling negatively regulates terminal differentiation of chondrocytes, and hence. PRG4 again would suppress hypertrophy by its actions on Smad7 (X. Yang et al., TGF-beta/Smad3 signals repress chondrocyte hypertrophic differentiation and are required for maintaining articular cartilage. The Journal of cell biology 153, 35 (May 2, 2001)). Finally, Hypoxia inducible factor 1 alpha unit (Hif1alpha), an essential transcription factor induced in response to hypoxia, was also predicted to have lower activity (FIG. 4B), while Hif3alpha a post-translational negative regulator of Hif1alpha and Hif2alpha was up-regulated (Y. Makino et al., Inhibitory PAS domain protein is a negative regulator of hypoxia-inducible gene expression. Nature 414, 550 (Nov. 29, 2001)). (FIG. 4A and FIG. 7B).

(54) The inventors hypothesized that PRG4 could up-regulate Hif3alpha under hypoxic conditions to inhibit cartilage turnover. This effect would be mediated by down-regulating the Hif1alpha and Hif2alpha transcriptional activities. To test our hypothesis, the inventors measured Hif3alpha expression and downstream Hif target genes relevant to osteoarthritis progression under hypoxic conditions in C3H10T1/2 (mesenchymal stromal) cells. After injection of HDAd-PRG4, Hif3alpha was transcriptionally up-regulated while Vegf, Col101a1 and Mmp13, all markers of hypertrophy, were all down-regulated compared to empty vector (FIG. 4C) (T. Saito et al., Transcriptional regulation of endochondral ossification by HIF-2α during skeletal growth and osteoarthritis development. Nature Medicine 16, 678 (Jun. 23, 2010)). Next, the inventors assessed whether knock down of Hif3alpha suppressed the effects caused by over-expression of PRG4. Since the expression of Hif3alpha is low in C3H10T1/2 cells, the inventors tested its expression in alternative chondrogenic lines. Interestingly, compared to under normoxic conditions, all cell lines tested showed increased PRG4 expression under hypoxic conditions (FIG. 4D and FIG. 7C). Consistent with this, Genomatix analysis identified a hypoxia response element in the promoter region of PRG4. The inventors found that Hif3alpha was highly expressed in TC71 Ewing sarcoma cells and further increased with up-regulation of PRG4 under hypoxic conditions (FIG. 4D). As predicted by our previous transcriptomic analysis, knockdown of Hif3alpha in TC71 cells led to down regulation of Hif1alpha and Hif2alpha target genes in the face of PRG4 up regulation (FIG. 4E). Our findings suggested that the secreted protein PRG4 could modify the balance of anabolic and catabolic programs in the context of osteoarthritis pathogenesis.

(55) To investigate whether the signalling pathway discovered in mouse is conserved in humans, the inventors performed in silico analysis on gene expression profiling performed in human osteoarthritis patient samples available from the GEO database (S, Koelling et al., Migratory Chondrogenic Progenitor Cells from Repair Tissue during the Later Stages of Human Osteoarthritis, Stem Cell 4, 324 (May 3, 2009); T, Dehne, C. Karlsson, J. Ringe, M. Sittinger, A. Lindahl, Chondrogenic differentiation potential of osteoarthritic chondrocytes and their possible use in matrix-associated autologous chondrocyte transplantation. Arthritis research &amp; therapy 11, R133 (2009)). The inventors discovered PRG4 and the proposed downstream effector, HIF3alpha, are upregulated in chondrocyte progenitor cells in OA patients by 2.6 fold (p<0.05) and 1.5 fold (p<0.01) respectively. In an independent array set comparing 3 dimensional cultured chondrocytes from osteoarthritis and healthy donors, the inventors observed a similar trend: PRG4 was upregulated by 1.4 fold (p<0.05) and HIF3alpha upregulated by 1.3 fold (p<0.05). In the context of osteoarthritis development, PRG4 and H1F3alpha may both be upregulated as a repair response. In contrast to the sustained over expression of PRG4 in our therapeutic models, this normal response in humans may be insufficient to prevent disease progression.

(56) These data together showed that under the hypoxic conditions of cartilage, PRG4 over-expression may prevent osteoarthritis progression not only by exerting biomechanical effects on the synovial fluid and cartilage interface, but also by regulating the transcriptional networks that specify chondrocyte hypertrophy and catabolism. Cartilage turnover mediated by Hif1alpha and Hif2alpha was inhibited by up-regulation of Hif3alpha. As cartilage degradation and hypertrophy are two hallmarks of osteoarthritis progression, it is not surprising that PRG4 has chondroprotective effects both in age-related and post-injury osteoarthritis (FIG. 4F).

(57) Osteoarthritis Gene Therapy can be Enhanced by Combined Gene Transfer of PRG4 and Il-1Ra

(58) The inventors sought to evaluate whether the beneficial effect of over-expressing PRG4 in osteoarthritis joints can be further improved by combining it with gene therapy mediated expression of Il-1Ra. Il-1Ra blocks the effects of Il-1beta, which is one of the key drivers of inflammation and cartilage catabolism in osteoarthritis. Based on the different pathways that PRG4 and Il-1Ra exert their effects on, a combination of both might result in optimized inhibition of both cartilage breakdown and inflammation.

(59) Mice had osteoarthritis induced and were injected with gene therapy vectors two weeks later. HDAd-PRG4. HDAd-Il-1Ra and the combination of both resulted in significantly lower osteoarthritis histology scores compared to the control vector HDAd-GFP and the no treatment group (FIG. 8A). Cartilage surface area was significantly higher in the HDAd-PRG4, HDAd-Il-1Ra and combination group compared with HDAd-GFP (FIG. 8B). Furthermore, cartilage volume was significantly higher in the HDAd-PRG4, HDAd-Il-1Ra and combination group compared with HDAd-GFP (FIG. 8C). The combination of HDAd-PRG and HDAd-Il-1Ra resulted in significantly higher cartilage volume compared with single vector treatment. The combination therapy resulted also in lower average osteoarthritis score and higher average cartilage surface area; however, the difference in these parameters did not reach statistical significance although a trend to significance was present.

Discussion

(60) The invention shows by using both transgenic mice expressing Proteoglycan 4 (PRG4), and intra-articular, helper-dependent adenoviral virus (HDAd) gene transfer that PRG4 is protective against the development of both post-traumatic and age-related osteoarthritis, without significant adverse effects on cartilage development. Gene therapy treatment with HDAd-PRG4 was effective when injected before and after onset of osteoarthritis suggesting that the treatment is both preventive and therapeutic. The beneficial effect can be further improved by combining PRG4 with anti-inflammatory Il-1Ra gene therapy. The protective effects are demonstrated at molecular, histological and functional levels. The inventors further show that PRG4 over-expression inhibits transcriptional programs that promote cartilage catabolism and hypertrophy in part through the up-regulation of Hif3alpha. The concordant changes of PRG4 and HIF3alpha expression is also observed in gene expression profiling in human osteoarthritic patient samples.

(61) Most genetics models reported to date show protection from osteoarthritis using histological endpoints at one month after surgical destabilization of the medical meniscus (DMM) to induce a mild, single condylar post-traumatic osteoarthritis, In addition, studies on osteoarthritis have been largely focused on loss of function mutations of genes in bone development such as Adamts5, Mmp13, Hif2alpha and Syndecan4 (F. Echtermeyer et al., Syndecan-4 regulates ADAMTS-5 activation and cartilage breakdown in osteoarthritis. Nature Medicine, 1 (Mar. 30, 2102); T. Saito et al., Transcriptional regulation of endochondral ossification by HIF-2α during skeletal growth and osteoarthritis development. Nature Medicine 16, 678 (Jun. 23, 2010); S, S. Glasson et al., Deletion of active ADAMTS5 prevents cartilage degradation in a murine model of osteoarthritis. Nature 434, 644 (Apr. 31, 2005); C. B. Little et al., Matrix metalloproteinase 13-deficient mice are resistant to osteoarthritic cartilage erosion but not chondrocyte hypertrophy or osteophyte development. Arthritis & Rheumatism 60, 3723 (December, 2009)). In contrast to these studies, the inventors report the gain of function genetic model with a secreted protein PRG4 that protects against osteoarthritis development at least 2 months after transection of cruciate ligaments, This model mimics a common injury in humans and leads to osteoarthritis in both condylar structures of the knee. The establishment of a gain of function model using an endogenously produced secreted protein may make for easier clinical translation as compared to previous approaches targeting inhibition of specific matrix enzymes and/or intracellular transcription factors. Moreover, the demonstration of a beneficial effect on age-related cartilage changes supports the further study of this approach beyond injury model.

(62) The established mechanisms that protect animals from osteoarthritis development mostly depend on inhibition of cartilage catabolic enzymes. ADAMTS5 was the first target to be discovered via in vivo genetic experiments (S. S. Glasson et al., Deletion of active ADAMTS5 prevents cartilage degradation in a murine model of osteoarthritis. Nature 434, 644 (Apr. 31, 2005)). Loss of Syndecan 4, similarly, works through ADAMTS5 inhibition (F. Echtermeyer et al., Syndecan-4 regulates ADAMTS-5 activation and cartilage breakdown in osteoarthritis. Nature Medicine, 1 (Mar. 30, 2102)). Recently, the discovery of the protective effects of Hif2alpha loss of function in OA extends this approach as Hif2alpha transcriptionally regulates the expression of catabolic enzymes including several MMPs and ADAMTSs (T. Saito et al., Transcriptional regulation of endochondral ossification by HIF-2α during skeletal growth and osteoarthritis development. Nature Medicine 16, 678 (Jun. 23, 2010)). However, targeting anabolic pathways, including cell growth, differentiation and matrix synthesis, is equally important in osteoarthritis since chondrocyte proliferation, metaplasia and abnormal matrix synthesis have been long observed in osteoarthritis progression (K. P. Pritzker et al., Osteoarthritis cartilage histopathology: grading and staging. Osteoarthritis Cartilage 14, 13 (January, 2006)). An interaction between cartilage anabolic and catabolic pathways is required to maintain homeostasis and their imbalance leads to osteoarthritis progression. A therapy that can affect both programs would potentially be most effective.

(63) Low-grade inflammation is commonly observed in osteoarthritic joints (Felson D T. 2006. Clinical practice. Osteoarthritis of the knee. N Engl J Med 354:841-848). Besides maintaining and amplifying inflammation, the key inflammatory mediators in osteoarthritis such as Il-1beta also trigger the expression of cartilage degrading enzymes such as collagenases and aggrecanases (Daheshia, M., and YAO, J. Q. (2008). The Interleukin 1p Pathway in the Pathogenesis of Osteoarthritis. J Rheumatol 35, 2306). Therefore, it seems important to inhibit both cartilage catabolism and joint inflammation in order to achieve efficient osteoarthritis treatment. Along these lines, the inventors show here that a gene therapy treatment combining helper-dependent adenoviral vectors expressing PRG4 and the anti-inflammatory Il-1Ra seems to further improve osteoarthritis treatment over gene therapy with PRG4.alone.

(64) Materials and Methods

(65) Generation of transgenic mice. FVB/N mice were purchased from Jackson Laboratories (Bar Harbor, Me.). This strain is the common background strain for transgenic mouse lines. All studies were performed with approval from the Baylor College of Medicine Institutional Animal Care and Use Committee (IACUC). All mice were housed under pathogen-free conditions in less than five per cage. Mice had free access to feed and water. Transgenic mice were generated by pronuclear microinjection. Founders were outcrossed for at least 3 generations to eliminate multiple insertions. Different lines were tested at the beginning to rule out position effect. Genotyping primers were designed to detect the VVPRE element in the transgene cassette: F: TCTCTTTATGAGGAGTTGTGGCCC (SEQ ID NO: 40), R: CGACAACACCACGGAATTGTCAGT (SEQ ID NO: 41). To avoid the effects of potential post-menopausal bone loss, all the mice used in OA evaluation were males.

(66) Cruciate ligament transection (CLT) surgery. CLT surgery and sham were performed as previously described in 8-week old male FVB/N mice and PRG4 transgenic mice (M. Ruan et al., Quantitative imaging of murine osteoarthritic cartilage by phase contrast micro-computed tomography. Arthritis Rheum, (2012). Investigators were blinded to the genotype of the mice when surgery was performed.

(67) Histology and immunohistochemistry. Mice were euthanized and samples were fixed with 4% paraformaldehyde (Sigma-Aldrich) overnight in 4° C. on a shaker. Samples from mice older than 4 days were decalcified in 14% EDTA for 5 days in 4° C. on a shaker. Samples from mice younger than 3 days were not decalcified. Paraffin embedding was performed as previously described. Samples were sectioned at 6 μm. Samples were stained with safranin O and fast green using standard protocols. Samples were scored by two independent pathologists masked to the procedure and genotypes. Immunohistochemistry were performed using primary antibody: anti-PRG4 (Abcam, ab 28484), anti-MMP13 (Millipore, MAB 13424), anti-ColX (generous gift from Dr. Greg Lunstrum, Shriners Hospital for Children, Portland, Oreg.), and secondary antibody: one-dropper-bottle HRP polymer conjugates (Invitrogen). BrdU staining was performed using anti-BrdU Alexa Fluor 594 (A21304, Invitrogen). Histomark trueblue (KPL) was used as developing reagent. TUNEL staining was performed using ApopTag Plus Peroxidase In situ Apoptosis Detection (Millipore Kit S7101) following manufacturer's protocol. All staining in the same experiment were done at the same time. Observer who quantified of BrdU and TUNEL staining was blinded to the genotype of the mice.

(68) Beta-galactosidase staining. Staining was performed on samples embedded in optimal cutting temperature compound after fixation and decalcification. Samples were sectioned at 6 μm and stained with X-gal (X428IC Gold biotechnology) overnight and nuclear fast red (N3020 Sigma) as counter stain.

(69) Rotarod analysis. Mice were placed onto an accelerating rotarod (UGO Basile, Varese, Italy). The duration to first failure to stay atop the rod was marked as first ride-around time. To rule out differences in learning skills between the two groups of mice, each group was assessed over three trials per day for 2 consecutive days (trials 1 to 6) before surgery. Mice were then randomly assigned into different groups. Another 6 trials were performed using the same conditions at the different time points after the surgery. Mice were given a 30 minutes inter-trial rest interval. Each trial had a maximum time of 5 minutes. Observer was blinded to the genotype and the procedure of the mice.

(70) Hotplate analysis. Mice were placed on the hotplate at 55° C. (Columbus Instruments, Columbus, Ohio). The latency period for hind limb response (e.g. shaking, jumping, or licking) was recorded as response time before at different time points after surgery. Observer was blinded to the genotype and the procedure of the mice.

(71) Phase contrast μCT scanning. Samples were prepared as previously described and scanned by Xradia μXCT at source voltage=40 kV, source power=8 W, detector distance from sample=75 mm, source distance from sample=100 mm, image number taken=500, and exposure time for each image=30 (M. Ruan et al., Quantitative imaging of murine osteoarthritic cartilage by phase contrast micro-computed tomography. Arthritis Rheum, (2012)). The resolution of the scanning is 4 μm. After scanning, a random number was assigned to each sample to ensure blinded assessment during image processing.

(72) Reconstruction and analysis of μCT data. Reconstruction of the data was performed using Xradia software and was transformed into dicom files. Reconstruction involves correction for beam hardening (constant=0.3), and correcting for center shift effects caused by difference between the center of sample rotation and the center of the detector. Samples were analyzed using TriBON software (RATOC, Tokyo, Japan). Observers were blinded to the procedure and sample number (M. Ruan et al., Quantitative imaging of murine osteoarthritic cartilage by phase contrast micro-computed tomography. Arthritis Rheum, (2012)).

(73) Intra-articular Injection. Mice were anesthetized using 3% isoflurane. Joint area was shaved. HDAds were diluted in sterile PBS in 5 μl and injected by 25 μl CASTIGHT syringes (1702 Hamilton Company) and 33 gauge needles (7803-05 Hamilton Company).

(74) Luciferase assay. Mice were injected with 2 mg D-luciferin (L9504 SIGMA) diluted in 100 μl PBS per mouse (25 grams) intraperitoneally. Mice were anesthetized using 3% isoflurane. Images were taken by Xenogen IVIS optical in vivo imaging system. Quantification was performed by living Imaging 4.2 using default settings. Image was collected for 10 minutes after the injection and normalized to control mice without luciferase injection.

(75) Laser capture microdissection and RNA purification. Hind limbs of P1 littermates were collected and snap-frozen in liquid nitrogen. Then, samples were embedded in optimal cutting temperature compound. Frozen sections of 10 μm were generated on polyethylene napthalate (PEN)-membrane slides. Superficial layer chondrocytes were captured using HS Capsure LCM caps by Applied Biosciences Acturus Systems. RNA was then purified by Picopure RNA isolation kit.

(76) Mouse Microarray and analysis. Microarrays were performed using Mouse WG-6 v2.0 Expression BeadChip (Illumina). Data was processed using the lumi package within the R statistical package. Variance-stabilizing trans-formation (VST) was performed, followed by quantile normalization of the resulting expression values. Differential expression was calculated using the limma package within R. Heat map was generated using normalized fold change. The resulting lists were then annotated and reviewed for candidates.

(77) Human gene expression analysis. GEO archives GSE10575 titled “Migratory chondrogenic progenitor cells from repair tissue during the later stages of human osteoarthritis” (PMID: 19341622) and GSE16464, titled “Chondrogenic differentiation potential of osteoarthritis chondrocytes and their use in autologous chondrocyte transplantation” (PMID: 19723327) were both downloaded and analyzed using the web-based GEO2R, using the default settings, available through the GEO site. In archive GSE10575, three arrays of chondrogenic progenitor cells from osteoarthritis males were compared to two control arrays of the same cell type. Female samples were excluded because control samples are males (shown by the level of Xist expression). In archive GSE 16464, 3D-cultured chondrocytes from normal donors and 3D-cultured chondrocytes from OA donors were compared. Both archives used the Affymetrix Human Genome U133 Plus 2.0 Array platform.

(78) Cell culture, transfection and infection. C3H10T1/2 cells were maintained in DMEM with 10% FBS; TC71 cells were maintained in RPMI 1640 with 10% FBS; ATDC5 cells were maintained in DMEM/F-12 1:1 mixture supplemented with 10% FBS. Cells were plated the day before transfection/infection so that it reached 70% confluency the next day. Lipofectamine 2000 was used as transfection reagent following protocols provided by manufacturer. Dharmacon on-target siRNA was used in the knockdown assay. HDAds were generated as previously described (M. Suzuki et al., Large-scale production of high-quality helper-dependent adenoviral vectors using adherent cells in all factories. Human gene therapy 21,120 (February, 2010)). HDAd-PRG4 carries the murine PRG4 gene controlled by the constitutive EF1 promoter. HDAd-Il-1Ra carries the murine Il-1Ra gene controlled by an inflammation-inducible NF-κB promoter. To infect cells. HDAds were diluted at 5000 vp/cell and added in serum free media with minimal volume covering cells after aspiration. Two hours later, media containing virus was aspirated and culturing media was added back. For hypoxia experiments, cells were transferred to hypoxia chamber with 1% oxygen.

(79) RNA purification and quantitative PCR. Cells were lysed with Trizol reagents (Invitrogen) and RNA was purified following manufacturer's protocol. To eliminate DNA contamination, samples were treated with RNase-free recombinant DNaseI (Roche). Reverse-transcript PCR was conducted by superscript III first strand (18080-051Invitrogen) following manufacturer's protocol. Taqman Universal PCR mastermix (Applied biosciences) and PerfeCTa SYBR Green SuperMix (Quanta BioSciences) were used in quantitative PCR. Primers used in quantitative PCR are listed as follows: mouse

(80) TABLE-US-00001 F: (SEQ ID NO: 16) ACTTCAGCTAAAGAGACACGGAGT, R: (SEQ ID NO: 17) GTTCAGGTGGTTCCTTGGTTGTAGTAA; Sox9: F: (SEQ ID NO: 18) AAGCCACACGTCAAGCGACC, R: (SEQ ID NO: 19) GTGCTGCTGATGCCGTAACT; Col2a1: F: (SEQ ID NO: 20) GCTCATCCAGGGCTCCAATGATGTAG, R: (SEQ ID NO: 21) CGGGAGGTCTTCTGTGATCGGTA; Gapdh: F: (SEQ ID NO: 22) GCAAGAGAGGCCCTATCCCAA; R: (SEQ ID NO: 23) CTCCCTAGGCCCCTCCTGTTATT; Vegf: F: (SEQ ID NO: 24) TGGACTTGTGTTGGGAGGAGGATG, R: (SEQ ID NO: 25) GCCTCTTCTTCCACCACCGTGTC; Mmp13: F: (SEQ ID NO: 26) GCAATCTTTCTTTGGCTTAGAGGT, R: (SEQ ID NO: 27) GGTGTTTTGGGATGCTTAGGGT; Col10a1: F: (SEQ ID NO: 28) AAAGCTTACCCAGCAGTAGG, R: (SEQ ID NO: 29) ACGTACTCAGAGGAGTAGAG; GAPDH: F: (SEQ ID NO: 30) ATACCAGGAAATGAGCTTGACAAA, R: (SEQ ID NO: 31) TGAAGGTCGGAGTCAACGGA; VEGF: F: (SEQ ID NO: 32) GATCGGTGACAGTCACTAGCTTATCT, R: (SEQ ID NO: 33) TACACACAAATACAAGTTGCCA; MMP13: F: (SEQ ID NO: 34) TGCCCTTCTTCACACAGACACTAACGAAA, R: (SEQ ID NO: 35) GGCCACATCTACTATTCTTACCACTGCTC; COL10A1: F: (SEQ ID NO: 36) GCCCACTACCCAAGACCAAGAC; R: (SEQ ID NO: 37) GACCCCTCTCACCTGGACGAC; HIF3A: F: (SEQ ID NO: 38) GGCTGTTCCGCCTACGAGTA; R: (SEQ ID NO: 39) AGCAAGGTGGATGCTCTTG; PRG4: Hs00981633_m1 (applied biosciences); mouse Hif3a: Mm00469375_m1 (applied bicsciences).

(81) Statistics. Statistical significance comparing two groups with parametric data was assessed by Student's t test, Statistical analysis comparing multiple groups with parametric data was performed by one-way ANOVA followed by Tukey's post-hoc. Statistical analysis comparing different genotype with different procedure was performed by two-way ANOVA followed by Tukey's post-hoc, Normality was tested by Shapiro-Wilk Normality test. Histological grades were compared by Wilcox rank test. All analyses were performed by SPSS software or Sigma Plot. A P value of <0.05 was considered statistically significant.

(82) TABLE-US-00002 Dataset 1: List of genes showing more than 1.5 fold change in the microarray analysis. WTP1_1 WTP1_2 WTP1_3 PG4P1_1 PG4P1_2 PG4P1_3 4930546H06Rik_ILMN_2717117 1.256363 1.360731 1.425929 −1.48447 −1.59768 −1.52108 Sesn1_ILMN_2654074 −1.25604 −1.26072 −1.28391 1.234927 1.170478 1.226371 Ypel5_ILMN_1251071 1.224517 1.294585 1.311664 −1.44517 −1.32632 −1.38253 Bglap-rs1_ILMN_1233122 1.301868 2.023561 1.628096 −3.0338 −3.05449 −2.56761 AK038070_ILMN_2466021 1.257255 1.181603 1.204158 −1.30391 −1.20282 −1.31808 AK011460_ILMN_2452717 −1.52912 −1.85077 −1.48354 1.474372 1.352955 1.304319 Bglap1_ILMN_2610166 1.404137 2.037433 1.6235 −4.09687 −3.29889 −2.57926 Med18_ILMN_1214050 −1.48231 −1.26813 −1.3871 1.212726 1.267995 1.335163 Bglap1_ILMN_3101908 1.459117 2.042785 1.496434 −3.82431 −3.03438 −2.43533 Ppp1r3c_ILMN_2667091 −1.65083 −1.56199 −1.48727 1.4376 1.167941 1.476123 Bglap-rs1_ILMN_1220829 1.261849 2.094587 1.691356 −3.64532 −3.48459 −2.55816 Zfp46_ILMN_1215740 −1.35114 −1.26299 −1.37143 1.277394 1.136789 1.32476 Hist1h1c_ILMN_2855315 1.196666 1.423895 1.348674 −1.49333 −1.34167 −1.62396 Zfand2a_ILMN_1230489 1.273059 1.140929 1.34758 −1.36636 −1.26743 −1.39361 Ddx21_ILMN_2546724 1.305544 1.217222 1.179125 −1.34811 −1.20085 −1.382 Hist1h1c_ILMN_2774537 1.170861 1.384453 1.428754 −1.41392 −1.42079 −1.65332 Ddx54_ILMN_2689678 1.130087 1.286618 1.299302 −1.39565 −1.2461 −1.30723 Rps15a_ILMN_2717621 1.315098 1.139016 1.449143 −1.36561 −1.52841 −1.40807 Bglap-rs1_ILMN_2944508 1.303982 2.185122 1.520279 −3.70241 −3.45533 −2.31957 Slc7a5_ILMN_2711948 1.201827 1.326767 1.430059 −1.67471 −1.48398 −1.29808 Csnk1d_ILMN_2739965 1.11045 1.255629 1.292397 −1.37356 −1.22945 −1.24982 Dyrk1b_ILMN_3053158 −1.46521 −1.31006 −1.19201 1.182241 1.294858 1.238163 Hist2h3b_ILMN_2934120 1.254913 1.119073 1.304197 −1.38431 −1.299 −1.20538 Nmd3_ILMN_1228859 1.262366 1.122484 1.224622 −1.20301 −1.36721 −1.20793 1190005F20Rik_ILMN_2697918 −1.21616 −1.40512 −1.44745 1.36511 1.269442 1.140632 Lrrc59_ILMN_1252817 1.334493 1.222121 1.168151 −1.47501 −1.29518 −1.21186 Dusp8_ILMN_1228031 1.288724 1.069707 1.275318 −1.27037 −1.24915 −1.28446 AK053260_ILMN_1228804 −1.53513 −1.52115 −1.78747 1.594074 1.424237 1.113431 Eif1a_ILMN_2698107 1.399002 1.348068 1.07882 −1.44405 −1.34553 −1.35426 AK021349_ILMN_1258961 1.382804 1.270095 1.173873 −1.34656 −1.59361 −1.2452 Csnk1d_ILMN_1231035 1.104983 1.305878 1.354114 −1.47277 −1.23751 −1.33697 Cirbp_ILMN_2761594 1.08657 1.233789 1.298241 −1.23605 −1.35285 −1.20021 Plekhf2_ILMN_2798694 1.124677 1.171659 1.32521 −1.2892 −1.34384 −1.16463 Nfatc1_ILMN_1216522 1.286293 1.080945 1.308693 −1.21468 −1.39646 −1.27436 Clk1_ILMN_2428301 −1.36643 −1.38464 −1.9415 1.450046 1.301662 1.279182 Trove2_ILMN_1252725 1.195356 1.139589 1.272322 −1.22692 −1.41043 −1.15117 EG639396_ILMN_2877059 −1.19236 −1.20876 −1.39289 1.317211 1.11903 1.179859 Heatr1_ILMN_1214036 1.317403 1.264432 1.223294 −1.64477 −1.32574 −1.20107 BC027809_ILMN_1252263 1.357622 1.055984 1.444709 −1.34453 −1.47672 −1.38744 Ccdc130_ILMN_2756733 −1.17101 −1.26787 −1.41093 1.342647 1.169009 1.136904 Tmcc1_ILMN_1249710 −1.26174 −1.39677 −1.70812 1.477478 1.22952 1.199067 Arrdc4_ILMN_2648967 1.045261 1.574252 1.593893 −1.83439 −1.7299 −1.50742 AK044963_ILMN_1247942 1.321698 1.257721 1.270333 −1.18779 −1.38985 −1.69824 Arf2_ILMN_1214810 1.546019 1.353128 1.087012 −1.4972 −1.66445 −1.34205 2610101N10Rik_ILMN_1252490 −1.14039 −1.40709 −1.51568 1.290925 1.162057 1.299667 Lrrc47_ILMN_2628551 1.117726 1.123233 1.383986 −1.31904 −1.23011 −1.2438 Srm_ILMN_2809611 1.485302 1.196046 1.150938 −1.54798 −1.39998 −1.23852 Gprc5a_ILMN_2854943 1.320606 1.042922 1.353049 −1.29647 −1.25915 −1.39294 Ddx11_ILMN_2700550 −1.20131 −1.24547 −1.33501 1.353463 1.204601 1.057541 Deb1_ILMN_2652971 1.548657 1.086404 1.190474 −1.36664 −1.38753 −1.38497 Mif_ILMN_2867835 1.125532 1.187658 1.327057 −1.3999 −1.32759 −1.12086 Hoxd3_ILMN_1219807 −1.19061 −1.30954 −1.55302 1.334377 1.316337 1.101846 Cdc7_ILMN_1238374 −1.31242 −1.26666 −1.86596 1.253473 1.281007 1.378172 Zfp187_ILMN_3067831 −1.18727 −1.40885 −1.54414 1.457655 1.221198 1.121467 3300001P08Rik_ILMN_2727004 −1.16879 −1.39116 −1.32235 1.224787 1.064016 1.380551 Hoxc6_ILMN_1217328 −1.33051 −1.47422 −1.40075 1.339994 1.496705 1.019485 Rbm5_ILMN_2942492 −1.29365 −1.62199 −1.68464 1.66198 1.236204 1.11868 AK012053_ILMN_2469320 −1.10834 −1.3099 −1.40348 1.32378 1.110387 1.187654 Tmem128_ILMN_1248235 1.125965 1.138522 1.441919 −1.45467 −1.29997 −1.19488 Rbm5_ILMN_2942499 −1.45228 −1.59992 −1.84238 1.607189 1.534819 1.001613 E130016E03Rik_ILMN_3161959 −1.2783 −1.50572 −1.71101 1.568022 1.337492 1.063614 Tnfrsf12a_ILMN_2424299 1.680884 1.277593 1.075987 −1.78329 −1.46531 −1.38442 Prdm2_ILMN_1250454 1.173017 1.20632 1.256779 −1.14469 −1.19644 −1.52795 Srm_ILMN_1225880 1.332372 1.120064 1.166016 −1.4506 −1.22663 −1.14034 Cpt2_ILMN_2775123 −1.20532 −1.33083 −1.38724 1.104396 1.131549 1.462135 Twf1_ILMN_1244219 1.25757 1.126966 1.235596 −1.49415 −1.20089 −1.13911 AK076052_ILMN_2429108 1.076837 1.140505 1.40668 −1.19618 −1.25719 −1.34308 Farsa_ILMN_1257639 1.213878 1.216622 1.352934 −1.12429 −1.38604 −1.65116 Zfp84_ILMN_2506757 −1.16964 −1.18995 −1.49011 1.301893 1.104954 1.226727 Rnase4_ILMN_1235657 −1.46403 −1.24206 −1.12261 1.323919 1.163284 1.133851 Pim3_ILMN_2717667 1.123427 1.144501 1.541166 −1.42121 −1.21509 −1.50536 Rab5b_ILMN_1237467 −1.54934 −1.50901 −1.79875 1.824154 1.27382 1.037959 Tk1_ILMN_2605890 −1.14797 −1.19726 −1.52316 1.200172 1.303368 1.13359 Nrp1_ILMN_1247094 −1.34674 −1.14618 −1.60363 1.244615 1.403199 1.113605 6030458C11Rik_ILMN_1234196 −1.5397 −1.45778 −2.22228 1.702852 1.461039 1.050668 Pold1_ILMN_2655577 −1.24471 −1.24541 −1.4781 1.425738 1.253099 1.038272 Prss35_ILMN_2609897 1.480951 −1.03832 1.608742 −1.44299 −1.64698 −1.54549 Tppp3_ILMN_2655929 −1.08048 −1.39071 −1.3892 1.218015 1.318692 1.098879 Clec2d_ILMN_2603647 −1.73457 −1.2971 −2.52661 1.280941 1.696474 1.279334 Hif3a_ILMN_2649671 −1.78312 −1.6431 −1.32223 1.73224 1.313779 1.028263 Pnrc2_ILMN_2861331 −1.12969 −1.18773 −1.58246 1.161941 1.19852 1.280471 Myd116_ILMN_2722938 1.38863 1.149001 1.09759 −1.13863 −1.23126 −1.4829 Eln_ILMN_2697304 1.09603 1.310437 1.235098 −1.20273 −1.1346 −1.54888 Fbxo31_ILMN_2452855 −1.16259 −1.1719 −1.62377 1.23252 1.296053 1.142115 Zmym2_ILMN_2781493 −1.1322 −1.205 −1.65697 1.259404 1.17403 1.249941 Rad54l_ILMN_2741985 −1.14435 −1.14233 −1.57512 1.210268 1.2324 1.17319 Nedd9_ILMN_2654186 1.300471 1.369214 1.006802 −1.27054 −1.16693 −1.47168 Gadd45g_ILMN_2744890 1.159873 1.093824 1.401321 −1.50495 −1.10425 −1.29047 Syncrip_ILMN_1258420 1.212463 1.238146 1.1686 −1.42916 −1.42482 −1.02121 Ier3_ILMN_1216764 1.881239 1.019378 1.168521 −1.48139 −1.66306 −1.52784 Galt_ILMN_2677567 −1.21625 −1.36275 −1.40341 1.540977 1.172451 1.018011 Map3k1_ILMN_2614380 −1.22523 −1.25855 −1.72004 1.286516 1.479816 1.041544 Rrp12_ILMN_2728118 1.330091 1.265982 1.182798 −1.73253 −1.45231 −1.0467 Dbp_ILMN_2616226 −1.3989 −1.2558 −2.17137 1.654516 1.166472 1.207322 Sfrs7_ILMN_2552490 −1.09319 −1.37266 −1.50612 1.421972 1.225556 1.045249 Tmem100_ILMN_1224014 −1.53254 −1.20266 −1.67189 1.499528 1.458731 −1.04208 Rpap1_ILMN_1238065 −1.22594 −1.19869 −1.41188 1.480394 1.120412 1.040978 AK017419_ILMN_2416218 1.258403 −1.04994 1.597254 −1.40368 −1.39738 −1.30912 Trpc2_ILMN_1220948 −1.1478 −1.20737 −1.48702 1.435121 1.116418 1.076493 Il11ra1_ILMN_1229957 −1.17181 −1.34116 −1.36512 1.51528 1.033071 1.120113 AK007736_ILMN_1258587 −1.30198 −1.1931 −1.5084 1.02934 1.151676 1.549816 Atpbd4_ILMN_1230688 1.212165 1.044319 1.518026 −1.1629 −1.29912 −1.67838 Tuba1c_ILMN_2476139 1.185176 1.22582 1.255489 −1.65104 −1.03071 −1.31991 Abhd14b_ILMN_3007862 −1.17428 −1.31793 −1.82363 1.555108 1.207257 1.078925 Ifi27l2a_ILMN_2762944 1.023728 1.619691 1.164394 −1.58706 −1.19828 −1.37445 Mll5_ILMN_1217776 −1.08848 −1.35305 −1.70073 1.363244 1.345082 1.045908 AK029312_ILMN_1246692 −1.1321 −1.22047 −1.47253 1.301738 −1.00965 1.326047 Cars2_ILMN_1218543 −1.15407 −1.26682 −1.75735 1.471686 1.249823 1.053571 Raver2_ILMN_1213278 −1.20699 −1.23934 −1.94009 1.342784 1.066234 1.440154 Mid1_ILMN_3159435 1.127098 1.038972 1.460931 −1.13274 −1.25072 −1.44792 AK078053_ILMN_1222351 −1.10161 −1.27506 −1.55656 1.45516 1.108898 1.101466 AK028672_ILMN_1246030 1.223792 1.161685 1.206628 −1.02194 −1.2642 −1.56654 AK043421_ILMN_2575994 −1.26016 −1.2699 −2.19263 1.481949 1.406903 1.07406 AK085118_ILMN_2505392 −1.11638 −1.20699 −1.48486 1.360363 1.232508 1.009408 Lpp_ILMN_2463260 1.144334 1.172656 1.289494 1.004724 −1.44657 −1.43369 NR_001461_ILMN_2445958 −1.33534 −1.58378 −1.69795 1.861753 1.221821 −1.05574 Zfp52_ILMN_2838139 −1.25077 −1.21913 −1.67899 1.544861 1.244823 −1.00507 AK004187_ILMN_2513451 −1.30128 −1.18771 −1.30172 1.256082 1.421114 −1.05914 Gp1bb_ILMN_2653205 1.310991 −1.01749 1.499583 −1.20277 −1.26174 −1.71629 BC037034_ILMN_1257019 −1.07956 −1.19392 −1.58424 1.197539 1.32752 1.079839 AK086317_ILMN_2580737 1.974206 1.266016 1.059287 −1.17028 −2.25587 −2.48319 NR002848_ILMN_2966602 −1.34056 −1.63363 −1.01451 1.281704 1.267341 1.107163 Asns_ILMN_2643513 1.12627 1.082326 1.473384 −1.63603 −1.22191 −1.12562 AK005089_ILMN_2451115 1.054101 1.319016 1.421071 −1.13881 −1.24881 −1.89777 6430706D22Rik_ILMN_3011719 −1.33993 −1.32228 −1.58013 1.622833 1.345146 −1.11534 5330401P04Rik_ILMN_2520011 −1.1508 −1.17966 −1.63107 1.427003 1.221601 1.021642 Flcn_ILMN_1213483 −1.17513 −1.1274 −1.55513 1.410583 1.179933 1.028483 Per2_ILMN_2987862 −1.21694 −1.06498 −1.65428 1.267989 1.067504 1.299293 Ppm1m_ILMN_1224437 −1.16175 −1.17068 −1.91121 1.437044 1.159707 1.165048 AK084113_ILMN_2451389 −1.16976 −1.13767 −1.70942 1.283512 1.371085 1.026543 AK007605_ILMN_1239776 1.119895 1.118125 1.47604 −1.14506 −1.18395 −1.76057 Depdc6_ILMN_3163001 −1.13115 −1.20253 −1.78263 1.08135 1.165515 1.47653 Mterf_ILMN_2624809 −1.0454 −1.20426 −1.5987 1.344071 1.147785 1.095675 AK014695_ILMN_2748880 −1.23553 −1.24466 −2.42903 1.564719 1.31189 1.098905 Vat1l_ILMN_1226356 −1.17602 −1.20391 −1.46333 1.144397 −1.02032 1.511196 Ankzf1_ILMN_2703321 −1.20097 −1.19701 −1.82856 1.447617 1.36439 −1.02771 Tha1_ILMN_2594768 −1.09096 −1.25311 −1.78214 1.402023 1.303303 1.018911 Plekhf1_ILMN_2993334 −1.08624 −1.16026 −1.78844 1.297336 1.242747 1.118284 Gprasp1_ILMN_3142384 −1.15055 −1.14972 −1.66918 1.014435 1.224737 1.422807 Pdgfra_ILMN_1235932 −1.28478 −1.3484 −1.50982 1.62719 1.311287 −1.13736 Mcm10_ILMN_2970532 −1.0688 −1.14651 −1.70048 1.161108 1.296402 1.146574 Fbp2_ILMN_2634905 −1.67939 −1.76924 −2.20592 −1.36206 1.508826 2.142995 1110007M04Rik_ILMN_2734060 1.125411 1.216839 1.439906 −1.77901 −1.60341 1.032062 Suv420h2_ILMN_1260420 −1.06155 −1.32955 −2.05337 1.396444 1.349127 1.073276 Adat2_ILMN_2705097 1.042499 1.080097 1.530343 −1.07116 −1.36781 −1.46542 1200016B10Rik_ILMN_1236716 −1.08228 −1.17359 −1.66229 1.410154 1.112488 1.099721 AK021262_ILMN_2546861 −2.55735 −2.96551 −2.04609 2.589175 1.589228 −1.65394 NR_002848_ILMN_2438819 −1.04157 −1.19208 −1.62472 1.102605 1.130335 1.352612 Iqcb1_ILMN_2635348 −1.25858 −1.51247 −1.07587 1.479027 1.112991 1.022781 Sirpa_ILMN_2722996 −1.55085 1.020695 −1.42422 1.095271 1.397855 1.139231 Kif1b_ILMN_2587761 −1.10748 −1.26856 −1.71852 −1.03298 1.275994 1.482789 Gtpbp2_ILMN_2600113 −1.03362 −1.24214 −1.75238 1.314034 1.280253 1.062528 Akap8l_ILMN_1242769 −1.70634 −1.79935 −1.46855 1.863393 1.552434 −1.31333 AK029270_ILMN_1246021 −1.36249 −1.13168 −2.29819 1.675332 1.15085 1.121103 Timm8a1_ILMN_2896552 1.183976 1.065901 1.33591 −1.5964 −1.26281 −1.0041 Cpt2_ILMN_2775122 −1.31568 −1.57523 −1.10064 −1.0034 1.133167 1.566763 Mif_ILMN_1260512 1.004975 1.323347 1.316609 −1.60996 −1.34456 −1.0099 Cenpl_ILMN_2676726 −1.07561 −1.16457 −1.74209 1.300334 1.282306 1.05495 Ccdc86_ILMN_2730003 1.079631 1.174875 1.493109 −1.81679 −1.39094 −1.01727 Cited2_ILMN_2477221 −1.25941 −1.07229 −1.54732 −1.01603 1.188502 1.45439 Tle6_ILMN_2900617 −1.25696 −1.29766 −2.43442 1.763195 1.23855 1.021292 Mrm1_ILMN_2649654 −1.12291 −1.18885 −1.88148 1.496945 1.102948 1.136915 Tsc22d3_ILMN_3150811 −1.46991 −1.23229 −1.52848 1.715752 1.257691 −1.13571 Wnk1_ILMN_1234955 −1.1436 −1.18321 −1.62288 1.476736 1.220566 −1.03422 Gstt3_ILMN_2665715 −1.15761 −1.16266 −1.67614 1.531124 1.053215 1.095113 Ppm1k_ILMN_2923615 −1.08558 −1.15334 −1.64931 1.404428 1.134997 1.066046 Clk4_ILMN_2851710 −1.15318 −1.33127 −1.79737 1.595963 1.307868 −1.08522 Il11ra2_ILMN_2619594 −1.04918 −1.28561 −1.57792 1.475052 1.023734 1.136498 Cars2_ILMN_2670601 −1.09189 −1.14083 −1.62876 1.389033 1.161988 1.042614 Pbx1_ILMN_2559669 −1.2673 −1.25299 −2.278 1.703366 1.314599 −1.04615 Acot11_ILMN_1227579 −1.16373 −1.10948 −1.73831 1.422989 1.008933 1.232184 Neat1_ILMN_2493030 −1.1433 −1.74898 −4.34058 1.651763 1.528512 1.142921 AK020467_ILMN_2506727 −1.09908 −1.81523 −1.30434 1.576618 1.226821 −1.03184 Calb2_ILMN_2827729 −1.13166 −1.24465 −1.58857 1.188467 1.548766 −1.05688 Rassf4_ILMN_2956092 −1.19773 −1.02283 −1.71608 1.100194 1.347195 1.157291 Tia1_ILMN_1215055 −1.07031 −1.11087 −1.74002 1.144017 1.141023 1.305753 Csnk2a1_ILMN_1218670 −1.22304 −1.30599 −2.00138 1.579869 1.464052 −1.14536 INV_ILMN_1257729 −1.19494 −1.45406 −1.54665 1.780692 1.124428 −1.08257 Fam109a_ILMN_2668178 −1.1457 −1.10631 −2.07282 1.126329 1.371624 1.242875 Clspn_ILMN_2858359 −1.09104 −1.12459 −2.01152 1.193798 1.211273 1.292024 AK051059_ILMN_2419748 −1.0608 −1.16991 −1.93243 1.379757 1.164043 1.141268 Unc5c_ILMN_2461668 −1.01081 1.174419 1.441474 −1.35249 −1.00552 −1.51306 AK078921_ILMN_2462678 −1.11083 −1.23212 −1.74051 1.561371 1.188618 −1.03775 Sgk_ILMN_1213954 1.274151 1.55087 −1.15069 −1.29135 −1.183 −1.4572 Disp1_ILMN_2772288 −1.08894 −1.41679 −1.49469 1.632533 1.126658 −1.05526 Gadd45g_ILMN_2903945 1.451953 1.318414 1.04743 −2.13919 1.014627 −1.42835 LOC100040259_ILMN_1244853 −1.18313 1.187774 1.974228 −1.83552 −1.42003 −1.34451 _ILMN_1245646 −1.02956 1.218253 1.413033 −1.59167 −1.26363 −1.02272 Tmem129_ILMN_2429215 −1.09374 −1.11964 −2.07634 1.200101 1.167903 1.342939 Tusc4_ILMN_2454195 −1.08831 −1.10728 −1.85511 1.369108 1.179966 1.089908 Map3k12_ILMN_2725370 −1.12888 −1.35818 −2.18302 1.726495 1.263127 −1.07506 Ndrg2_ILMN_2771991 −1.07046 −1.1445 −2.06977 1.291192 1.095454 1.322285 Rrp15_ILMN_2629856 1.004134 −1.02887 1.835562 −1.43385 −1.48925 −1.22032 Mum1_ILMN_1215647 −1.06142 −1.13778 −1.74536 1.418322 1.083703 1.103988 AK052106_ILMN_1255302 −1.05526 −1.20509 −1.60772 1.39953 1.257665 −1.06004 Tlcd1_ILMN_2781458 −1.02375 −1.3448 −2.10692 1.475982 1.34724 −1.0186 Trps1_ILMN_1226073 −1.06444 −1.5275 −1.78979 1.757446 1.159398 −1.07492 Ly6a_ILMN_1255416 −3.17206 −1.0932 −1.29711 1.461767 1.331041 1.206246 Accs_ILMN_2776485 −1.22008 −1.009 −1.65779 1.41732 1.13865 1.030122 Appl2_ILMN_1219978 −1.24559 −1.27531 −2.11094 1.865122 1.161517 −1.09567 Cox4i2_ILMN_2612178 1.089127 1.158668 1.326957 1.008061 −1.18331 −1.74794 Clk1_ILMN_1254814 −1.07911 −1.22534 −2.01559 1.568467 1.193925 −1.00131 Clspn_ILMN_2623056 −1.05233 −1.08879 −1.82761 1.147235 1.150539 1.28634 Ncrna00166_ILMN_1222196 −1.03988 −1.16428 −1.98635 1.39944 1.094827 1.181747 C4b_ILMN_3049559 −1.10606 −1.15706 −2.05407 1.351722 1.414119 −1.0215 Nfatc4_ILMN_2647331 −1.37338 −1.25155 −1.20467 1.5856 1.183728 −1.14491 AK036974_ILMN_1222598 −1.0959 −1.17652 −1.59093 1.5362 1.079376 −1.00664 Slc5a3_ILMN_1233078 −1.17885 −1.23164 −1.89385 1.499145 1.458686 −1.17105 Abcd4_ILMN_1245547 −1.16716 −1.03031 −1.70307 1.428297 1.110164 1.047001 Spnb2_ILMN_1214394 −1.0152 −1.12231 −1.88513 1.152147 1.231002 1.210335 Prelp_ILMN_2739760 −1.11189 −1.53571 −1.7425 1.801632 1.224774 −1.17762 5830411K21Rik_ILMN_1217032 −1.39544 −1.00477 −1.90468 1.069172 1.653072 1.04086 Bmp4_ILMN_1215252 −1.23614 −1.17177 −1.52917 1.595397 1.230579 −1.16592 Hoxd8_ILMN_2693052 −1.07822 −1.07856 −1.81581 1.155206 1.051639 1.387814 1810013L24Rik_ILMN_2616630 −1.18506 1.006997 −2.02702 1.342216 1.132491 1.18112 5430432N15Rik_ILMN_2622089 −1.48775 −1.75547 1.115626 1.119898 1.119461 1.403214 Stxbp3a_ILMN_1245393 −1.41728 −1.33413 −1.13258 1.577382 1.23735 −1.18035 Ehd1_ILMN_2628757 −1.17445 1.186862 1.650685 −1.45395 −1.2074 −1.25788 Raf1_ILMN_1237730 −1.07621 −1.19935 −1.61396 1.5239 1.171328 −1.08435 Tbc1d2b_ILMN_2819859 −1.07046 −1.08129 −2.17266 1.290826 1.221243 1.168665 Ppox_ILMN_2826816 −1.06553 −1.21576 −1.96091 1.443881 1.371369 −1.09439 Eraf_ILMN_2619200 −1.14473 1.597198 1.416693 −2.1079 1.035463 −1.65928 Hbb-b1_ILMN_1244316 1.271854 1.441461 1.216162 −2.80858 1.193409 −1.91916 Chst5_ILMN_2665754 1.01614 −1.33756 −1.72423 1.103901 −1.00597 1.558293

(83) TABLE-US-00003 Dataset 2: List of transcription factors predicted by Ingenuity Pathway Analysis to be activated or inhibited. Positive z score suggests activation and negative z score. Transcription Regulation p-value Regulator z-score of overlap Target molecules in dataset Molecular Type PPARA 2.196 1.89E−01 ASNS, CHKA, Clec2d (includes ligand-dependent others), CPT2, FABP3, HIST1H1C, IGFBP5, nuclear receptor KIF2C, LGALS4, RETSAT, SRM, TOP2A STAT5B 2.038 1.42E−01 MYL2, TNNC1, TNNT1, TPM3, TROVE2 transcription regulator PPARD 2.036 1.29E−01 ACTG2, CPT2, FABP3, FN1, LGALS4, ligand-dependent TNFRSF12A nuclear receptor ESR1 2.021 3.42E−01 BMP4, Clec2d (includes others), DDX21, ligand-dependent HOXC6, IER3, IGFBP5, SGK1, TGFB3 nuclear receptor FOXO3 −2.188 2.97E−01 IER3, PPP1R15A, SGK1, SLC1A4 transcription regulator MEF2C −2.359 2.06E−02 Bglap (includes others), IBSP, MYL2, TNNC1 transcription regulator FOS −2.58 3.37E−01 CASZ1, CDON, FN1, HBA1/HBA2, HBB, IBSP, transcription regulator IGFBP5, KIF1B, LGALS4, NFATC1, S100A8, S100A9, SIRPA GATA4 −2.64 1.61E−02 ACTC1, ACTG2, MYL4, MYLPF, TNNC1 transcription regulator MYOCD −2.976 1.88E−04 ACTG2, GJA5, LPP, MYL2, MYL4, MYLPF transcription regulator SRF −3.454 1.05E−03 ACTC1, ACTG2, GADD45G, HIF3A, LBH, transcription regulator MYL2, MYL3, MYL4, Myl9, MYLPF, RAF1, TNNC1, TNNT1, ZMYM2 GLI1 1.845 1.78E−01 LMNA, NDRG2, PDGFRA, S100A9, TMEM100, transcription regulator WIF1 E2F1 1.844 3.83E−01 BMP4, DDX11/DOX12P, MCM10 transcription regulator (includes EG: 307126), NRP1 (includes EG: 18186), POLD1, PRDM2, RAD54L, TK1, TOP2A SATB1 0.865 3.41E−02 ABTB1, HBB, HSPA8, SGK1, TSC22D3, transcription regulator YPEL5 CEBPD 0.795 3.70E−02 ASNS, IGFBP5, MBP, MIA, PDGFRA transcription regulator TFAP2C 0.427 3.11E−03 HIST1H1C, MBP, NRP1 (includes transcription regulator EG: 18186), TK1, ZMYND11 SMARCB1 0.271 3.27E−02 C4B (includes others), CDC7 (includes transcription regulator EG: 12545), KIF23, MCM10 (includes EG: 307126), PLXNB2, PPP1R3C, RAB5B, RAD54B RUNX2 −0.09 7.90E−03 ACTG2, Bglap (includes others), C4B transcription regulator (includes others), COL24A1, FN1, IBSP SMAD7 −0.265 4.16E−02 ACTG2, CITED2, FN1, MYLPF, TGFB3, TPM3 transcription regulator PGR (includes −0.275 5.84E−03 CPT2, DDX21, IER3, IGFBP5, NEDD9, ligand-dependent EG: 18667) SRSF7, TGFB3, TK1, TSC22D3 nuclear receptor TP53 (includes −0.709 1.68E−03 ASNS, BMP1, CCDC80, CDC7 (includes transcription regulator EG: 22059) EG: 12545), CSNK1D, DBP, FABP3, FN1, GADD45G, GSTM1, HDC, HJURP, HK2, HSPA8, IER3, IGF3P5, IKBIP, IQCB1, KIF23, LPP, Ly6a (includes others), MYL4, Myl9, NDRG2, NRP1 (includes EG: 18186), PDGFRA, PEG3, PLXNB2, POLD1, PPP1R15A, PQLC3, RAD54B, RAF1, RNASE4, SESN1, SGK1, TOP2A, TSC22D3 CEBPB (includes −1.133 2.42E−02 ACTG2, ARPP19, ASNS, CIRBP, Gnas transcription regulator EG: 1051) (mouse), HBB, HDC, IER3, MBP, MIA, NRP1 (includes EG: 18186), PDGFRA, PPP1R15A, SGK1 MITF −1.373 3.65E−02 CHKA, CMA1, EDNRB, GPNMB, MBP, MYL4, transcription regulator Tpsab1 KDM5B −1.459 1.71E−02 EHD1, IARS2, KIF2C, NEDD9, PPOX, transcription regulator PSIP1, TOP2A GATA1 −1.697 1.36E−02 AHSP, ALAS2, GP1BB, HBA1/HBA2, HBB, transcription regulator MBP HIF1A −1.714 3.60E−03 ACTG2, ASNS, CHKA, CITED2, FN1, HIF3A, transcription regulator HIST1H1C, HK2, IGFBP5, MIF, PFKL, SC29A1, TGFB3, TMEM128 SMARCA4 −1.791 9.94E−03 ACTG2, ASNS, Bglap (includes others), transcription regulator BMP4, CLK1, FN1, HBB, IGFBP5, LMNA, MYH3, MYL4, MYLPF, NRP1 (includes EG: 18186) MYOD1 −1.839 6.25E−03 ACTC1, ACTG2, GADD45G, IGFBP5, MYH3, transcription regulator MYL4, MYLPF, SPT8N1, TNNC1, TNNT1 ATF4 −1.848 7.63E−03 ASNS, Bglap (includes others), IBSP, transcription regulator IGFBP5, PPP1R15A, SLC7A5, TNFRSF12A

SEQUENCE LISTING OVERVIEW

(84) SEQ ID NO 1 HDAd-huPRG4

(85) SEQ ID NO 2 HDAd-muPRG4

(86) SEQ ID NO 3 huPRG4

(87) SEQ ID NO 4 muPRG4

(88) SEQ ID NO 5 huPRG4 protein

(89) SEQ ID NO 6 muPRG4 protein

(90) SEQ ID NO 7 HDAd-hulL1 Ra

(91) SEQ ID NO 8 HDAd-mulI1 Ra

(92) SEQ ID NO 9 HDAd-eqlI1 Ra

(93) SEQ ID NO 10 huIl1Ra

(94) SEQ ID NO 11 muIl1 Ra

(95) SEQ ID NO 12 eqIl1Ra

(96) SEQ ID NO 13 huIl1 Ra protein

(97) SEQ ID NO 14 muIl1 Ra protein

(98) SEQ ID NO 15 eqIl1Ra protein

(99) hu=human; mu=murine; eq=equine