Genetic tool for the transformation of <i>Clostridium </i>bacteria
11746346 · 2023-09-05
Assignee
- STICHTING WAGENINGEN RESEARCH (Pb Wageningen, NL)
- Ifp Energies Nouvelles (Rueil Malmaison, Cedex, FR)
Inventors
- Francois Wasels (Metz, FR)
- NICOLAS LOPES FERREIRA (CROISILLES, FR)
- Florent COLLAS (Aachen, DE)
- Ana Lopez Contreras (Utrecht, NL)
Cpc classification
Y02E50/10
GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
C12N15/74
CHEMISTRY; METALLURGY
C12N9/22
CHEMISTRY; METALLURGY
C12N15/63
CHEMISTRY; METALLURGY
International classification
C12N15/10
CHEMISTRY; METALLURGY
C12N15/63
CHEMISTRY; METALLURGY
C12N15/74
CHEMISTRY; METALLURGY
C12N15/90
CHEMISTRY; METALLURGY
C12N9/22
CHEMISTRY; METALLURGY
Abstract
The present invention relates to a genetic tool comprising at least two different nucleic acids allowing the transformation, by homologous recombination, of a bacterium of the genus Clostridium, typically of a solventogenic bacterium.
Claims
1. A genetic tool allowing the transformation by homologous recombination of a solventogenic bacterium of the genus Clostridium, wherein said genetic tool comprises: a first vector comprising a first nucleic acid sequence encoding at least Cas9, wherein the Cas9 coding sequence is placed under the control of a promoter, and a second vector comprising a second nucleic acid sequence containing a repair template allowing, by a homologous recombination mechanism, the replacement of a portion of a Cas9- targeted bacterial DNA by a sequence of interest, in that i) at least one of said first or second nucleic acid sequences further encodes one or more guide RNAs (gRNAs), or ii) the genetic tool further comprises one or more guide RNAs, each guide RNA comprising a Cas9-enzyme-binding RNA structure and a sequence complementary to the portion of the Cas9-targeted bacterial DNA, said complementary sequence comprising at least 10 nucleotides, wherein Cas9 causes double-stranded cleavage of the bacterial DNA and the bacterial DNA is the DNA of a solvent-forming bacterium of the genus Clostridium.
2. The tool according to claim 1, wherein the sequence encoding said one or more guide RNAs is preceded by a promoter and said promoter or the promoter controlling Cas9 is an inducible promoter.
3. The tool according to claim 1, wherein the solventogenic bacterium of the genus Clostridium is selected from C. acetobutylicum, C. cellulolyticum, C. phytofermentans, C. beijerinckii, C. saccharobutylicum, C. saccharoperbutylacetonicum, C. sporogenes, C. butyricum, C. aurantibutyricum and C. tyrobutyricum.
4. The tool according to claim 3, wherein when the solventogenic bacterium is C. acetobutylicum, said C. acetobutylicum bacterium is strain ATCC824, and when the solventogenic bacterium is C. beijerinckii, said C. beijerinckii bacterium is strain DSM 6423.
5. The tool according to claim 1, wherein the Cas9 protein comprises SEQ ID NO: 1.
6. The tool according to claim 1, wherein the Cas9 promoter is an inducible promoter.
7. The tool according to claim 1, wherein the DNA sequence of interest encodes at least one product promoting the production of solvent, at least one enzyme involved in the conversion of aldehydes to alcohol, a membrane protein, a transcription factor, or a combination thereof.
8. The tool according to claim 1, wherein each vector is a plasmid.
9. A kit for transforming a bacterium of the genus Clostridium or for producing at least one solvent using a bacterium of the genus Clostridium comprising the components of a genetic tool comprising: a first vector comprising a first nucleic acid sequence encoding at least Cas9, wherein the Cas9 coding sequence is placed under the control of a promoter, and a second vector comprising a second nucleic acid sequence containing a repair template allowing, by a homologous recombination mechanism, the replacement of a portion of a Cas9- targeted bacterial DNA by a sequence of interest, in that i) at least one of said first or second nucleic acid sequences further encodes one or more guide RNAs (gRNAs), or ii) the genetic tool further comprises one or more guide RNAs, each guide RNA comprising a Cas9- enzyme-binding RNA structure and a sequence complementary to the portion of the Cas9- targeted bacterial DNA, said complementary sequence comprising at least 10 nucleotides.
10. The kit according to claim 9, wherein the sequence encoding said one or more guide RNAs is preceded by a promoter and said promoter or the promoter controlling Cas9 is an inducible promoter.
11. The kit according to claim 10, said kit further comprising an inducer of said inducible promoter.
Description
FIGURES
(1)
(2)
(3)
(4)
(5)
(6)
(7)
(8)
(9) A: catP_fwd×catP_rev (expected size: 709 bp)
(10) B: RH_ctfB_R×V-CTFA-CAC2707_R (expected size: 351 bp)
(11) 1: 2-Log marker (NEB). 2: H.sub.2O, negative control. 3: Non-transformed ATCC824. 4: ATCC824 transformed with pEC500E-miniPthl-cas9. 5 & 6: ATCC824 transformed with pEC500E-miniPthl-cas9 and pEC750C (2 independent transformants). 7 & 8: ATCC824 transformed with pEC500E-miniPthl-cas9 and pEC750C-gRNA_adhE (2 independent transformants).
(12)
(13)
(14)
(15)
(16)
(17)
(18)
(19) A. Genetic organization around the upp gene. The coding sequences are indicated by arrows. The grey rectangle indicates the region absent from the upp_del template. The primers used are represented by triangles. CDS, coding sequence. PAM, protospacer adjacent motif, playing a role in Cas9 binding.
B. Amplification results. M: 2-Log marker (NEB). 1: H.sub.20, negative control. 2: Non-transformed ATCC824.
3: ATCC824 transformed with pFW0001-Pcm-2tetO1-cas9 and pEC750CgRNA_upp-upp_del before exposure to aTc. 4 & 5: ATCC824 transformed with pFW0001-Pcm-2tetO1-cas9 and pEC750CgRNA_upp-upp_del before exposure to aTc, isolated on 2YTG+5-FU (2 independent transformants).
(20)
(21)
(22)
(23)
(24)
(25)
(26)
(27)
(28)
EXAMPLES
(29) The inventors tested the genetic tool disclosed and claimed in the present text on two targets: the upp and adhE genes.
(30) Inactivation of the upp Gene
(31) The first target chosen makes it possible to validate the genetic modification technique designed, by a simple screening. The upp gene encodes a uracil phosphoribosyltransferase. This enzyme forms uracil monophosphate (UMP) from uracil, but also forms 5-fluorouracil monophosphate (5-FUMP) from 5-fluorouracil (5-FU). 5-FUMP is a toxic compound for the cell which blocks RNA synthesis. Consequently, a bacterium containing the upp gene in its genome will not be able to grow on medium containing 5-FU, in contrast with a strain not expressing this gene.
(32) Targeting this gene makes it possible to determine, simply and quickly, by simple phenotypic observation, if the modification strategy is effective. Three plasmids for targeting upp were constructed (see
Loss of the pSOL Plasmid
(33) The second target chosen is of interest in the fermentation process: the set of genes involved in solventogenesis, in particular adhE, is located on the pSOL megaplasmid, and it has been shown that its loss abolishes the production of acetone and butanol. After having removed these fermentation pathways using the pSOL targeting plasmid (see
(34) Constitutive Expression of cas9 in C. acetobutylicum ATCC824 The chosen strategy requires the concomitant use of two plasmids:
(35) the vector for constitutive expression of the nuclease, derived from the pEC500E plasmid: pEC500E-miniPthl-Cas9 (see
(36) The pEC500E-miniPthl-Cas9 expression vector was introduced into strain ATCC824, as well as a control plasmid corresponding an empty vector (pEC500E). The two strains obtained were then transformed with the targeting vectors, derived from vector pEC750C, used as control. The results of this second transformation step are indicated below in Table 1.
(37) TABLE-US-00001 TABLE 1 transformation results. pEC750C- pEC750C- pEC750C- gRNA_upp- gRNA_upp- pEC750C gRNA_upp upp_del upp_stop pEC750C-gRNA_adhE pEC500E ++ ++ ++ ++ ++ pEC500E- ++ − − + ++ miniPthl-cas9 ++, numerous transformants obtained (between 10.sup.2 and 10.sup.3 colonies obtained/transformation); −, no transformants obtained.
(38) The transformation results obtained indicate that Cas9 is functional. Indeed, when the nuclease is expressed and the upp gene is targeted by the gRNA, no transformant is obtained, due to the break caused in the genomic DNA and to the inability of the bacterium to carry out the repair of the genome (transformation with pEC500E-miniPthl-cas9 and pEC750C-gRNA_upp) in the absence of repair template.
(39) Targeting of upp
(40) The results obtained when the targeting vectors are introduced into the strain containing pEC500E show that the genome of strain ATCC824 does not contain a cas9 homologue, since transformants are obtained with each targeting vector.
(41) A transformant containing pEC500E-miniPthl-cas9 and pEC750C-gRNA_upp-upp_stop was then re-plated several times on a nonselective medium so that it loses the plasmids it contained. Once the colonies were cleared of their plasmids and sensitive to antibiotics, the upp gene (SEQ ID NO: 3) was sequenced (see
(42) The desired modifications are indeed present. The CRISPR-Cas9 genetic tool comprising the introduction of two plasmids and the expression of the cas9 gene by a strong and constitutive promoter is thus indeed functional.
(43) Targeting of adhE
(44) Transformants are obtained during transformations of the wild-type strain with the pEC500E-miniPthl-cas9 and pEC750C_gRNA_adhE plasmids. Since cas9 is active, this result indicates that a break in the pSOL megaplasmid does not affect the viability of ATCC824.
(45) In order to confirm the possible loss of pSOL, various tests were performed: PCR detection of a gene present on pSOL: ctfB
(46) PCR using catP_fwd×catP_rev allows detection of the thiamphenicol resistance gene, present on the pEC750C plasmids. Its detection confirms that the targeting vectors are present.
(47) PCR using RH_ctfB_R×V-CTFA-CAC2707_R allows detection of a portion of the ctfB gene, present on the pSOL megaplasmid, and makes it possible to know if the latter is present in the cell. Amplification seems to show that the pSOL megaplasmid is no longer present in the clones transformed with pEC500E-miniPthl-cas9 and pEC750C-gRNA_adhE (see
(48) Among the genes contained on the pSOL megaplasmid, amyP encodes an extracellular enzyme with α-amylase activity. This activity can be detected on solid medium containing starch and glucose (Sabathe et al., 2002). Dilutions of liquid cultures were deposited on an agar plate containing 0.2% glucose and 2% starch and incubated 72 h at 37° C. The α-amylase activity is then visualized by iodine staining. The clear halos around the colonies of bacteria indicate the presence of α-amylase activity. The absence of activity around ATCC824 containing pEC500E-miniPthl-cas9 and pEC750C-gRNA_adhE indicates that the amyP gene is not expressed in this strain, confirming that the megaplasmid is no longer present (see
(49) The ATCC824 wild-type strain and a transformant were grown for 24 h in Gapes medium in order to establish the fermentation results of the two strains. The fermentation results obtained show a reduction in ethanol production and an abolition of butanol and acetate production due to the absence of the adhE, adhE1 and adc genes (present on the pSOL megaplasmid) in the transformant (see
(50) Cas9 is thus capable of acting on the chromosome or on the natural plasmid of strain ATCC824, which makes it possible to broaden its action to the chromosome and to any extra-chromosomal genetic material present in the strain (plasmid, bacteriophage, etc.).
(51) Inducible Expression of Cas9 in C. acetobutylicum ATCC824
(52) In order to enable the homologous recombination events between the genome and the repair templates, it is necessary to increase the number of cells in which the nuclease is active (up to 10.sup.3 when strain ATCC824 containing pEC500E-miniPthl-cas9 is transformed with a targeting vector). To that end, a system in which nuclease expression is controlled is necessary. Two vectors in which the cas9 gene is placed under the control of an anhydrotetracycline-inducible promoter were constructed, derived from the vector pFW0001: pFW0001-Pcm-2tetO1-cas9 (see
(53) The promoters controlling cas9 expression contain operator sequences, tetO1 and tetO2, to which the transcriptional repressor TetR is bound. This repression is released by the presence of anhydrotetracycline (aTc). This system allows controlled expression, with little leakage. In the presence of aTc, synthesis is higher starting from promoter Pcm-2tetO1 (see
(54) Transformation of C. acetobutylicum ATCC824:
(55) The expression vectors and the empty vector (pFW0001) were introduced into ATCC824. Subsequently, the following plasmids were introduced into each type of transformant (see Table 2): pEC750C-gRNA_upp, containing the gRNA targeting upp; pEC750C-gRNA_upp-upp_del, containing the gRNA targeting upp and the upp_del template; pEC750C-gRNA_upp-upp_stop, containing the gRNA targeting upp and the upp_stop template;
(56) The transformed colonies were streaked on various solid media, at different dilutions: 2YTG+erythromycin to verify cell viability, dilution by a factor of 10.sup.6; 2YTG+erythromycin+thiamphenicol to select the transformants; 2YTG+erythromycin+thiamphenicol+aTc (200 ng/mL) to select the transformants in the presence of the inducer.
(57) TABLE-US-00002 TABLE 2 number of colonies obtained on each type of medium for each transformation. pEC750C- pEC750C- pEC750C- gRNA_upp- gRNA_upp- pEC750C gRNA_upp upp_del upp_stop ery ery ery ery ery thiam ery thiam ery thiam ery thiam ery thiam aTc ery thiam aTc ery thiam aTc ery thiam aTc (10.sup.−6) (ND) (ND) (10.sup.−6) (ND) (ND) (10.sup.−6) (ND) (ND) (10.sup.−6) (ND) (ND) pFW0001 78 26 — 126 83 — 87 12 — 61 13 — pFW0001- Pcm-2tetO1- 229 129 3 157 27 0 232 5 0 169 7 0 cas9 pFW0001- Pcm-tetO2/1- 210 400 3 367 130 0 227 21 0 177 18 0 cas9 ery, erythromycin. thiam, thiamphenicol. aTc, anhydrotetracycline. Between brackets, dilution factors. ND, not diluted. —, not tested.
(58) A toxic effect of aTc is observed, since few transformants are obtained when it is present, even when the empty targeting vector (pEC750C, control) is used. As expected, no transformant is obtained when a pEC750C containing the gRNA_upp cassette is introduced into a cell expressing cas9, on medium containing aTc. On the other hand, numerous transformants are obtained for each plasmid combination on medium without aTc, indicating that cas9 is not expressed.
(59) Cas9 Expression in the Presence of aTc:
(60) The various transformants obtained on plates containing erythromycin and thiamphenicol were re-plated on the same type of medium, then used to inoculate liquid precultures containing both antibiotics. These precultures were then used to inoculate other liquid cultures containing varying concentrations of aTc in order to determine if the system is functional.
(61) Induction of Cas9:
(62) Three transformants were used to analyse the ability to induce cas9 expression in the presence of aTc:
(63) ATCC824 containing pFW0001 and pEC750C-gRNA_upp;
(64) ATCC824 containing pFW0001-Pcm-2tetO1-cas9 and pEC750C-gRNA_upp;
(65) ATCC824 containing pFW0001-Pcm-tetO2/1-cas9 and pEC750C-gRNA_upp;
(66) Liquid media containing erythromycin, thiamphenicol and increasing concentrations of aTc were inoculated from liquid precultures of these transformants (see
(67) The transformant not expressing the nuclease is affected little or not at all by the presence of aTc. On the other hand, even at low aTc concentrations, the transformant containing the plasmid expressing cas9 via promoter Pcm-2tetO1 (pFW0001-Pcm-2tetO1-cas9) and the plasmid containing only the gRNA (pEC750C-gRNA_upp) exhibit a significant growth delay. The transformant containing the plasmid expressing cas9 via promoter Pcm-tetO2/1 (pFW0001-Pcm-tetO2/1-cas9) and the plasmid containing only the gRNA (pEC750C-gRNA_upp) is not affected at low aTc concentrations.
(68) However, starting from 150 ng/mL a strong growth delay is observed, and no growth is observed at 300 ng/mL. Promoter Pcm-tetO2/1 thus seems to allow a better repression of the expression than Pcm-2tetO1 in the absence of inducer.
(69) Generation of Mutants
(70) Liquid cultures of the transformant containing the targeting plasmids for repairing double-strand breaks were also prepared, in the absence or in the presence (100 ng/mL) of aTc. The transformants used contained one of the 12 plasmid combinations appearing in Table 3.
(71) TABLE-US-00003 TABLE 3 Plasmid combinations present in the transformants. Expression plasmid Targeting plasmid pFW0001 pEC750C pFW0001-Pcm-2tetO1-cas9 x pEC750C-gRNA_upp pFW0001-Pcm-tetO2/1-cas9 pEC750C-gRNA_upp-upp_del pEC750C-gRNA_upp-upp_stop
(72) After 72 h of culture, aliquots were deposited on various solid media: 2YTG containing thiamphenicol and erythromycin; 2YTG containing thiamphenicol, erythromycin, and 100 ng/mL aTc; 2YTG containing 5-fluorouracil.
(73) Only the transformants in which homologous recombination events allowed the insertion of the repair template are able to grow on 2YTG+5-FU (see
(74) Analysis of the upp_Del Transformants:
(75) The clones isolated on 2YTG+5-FU were analysed by PCR (see
(76) PCR using catP_fwd×catP_rev allows detection of the thiamphenicol resistance gene, present on the pEC750C plasmids. Its detection confirms that the targeting vectors are present.
(77) PCR using LHA_upp_fwd×RHA_upp_rev allows amplification of the upp gene as well as the flanking regions. The primers appearing below were used in the construction of the upp_del repair template (see
(78) TABLE-US-00004 TABLE 4 Name Sequence (5′-3′) catP_fwd GTGGGCAAGTTGAAAAATTCAC catP_rev TTAACTATTTATCAATTCCTGCAATTCG RH_ctfB_R CTTGAGACTTTGCCGTGAGGG V_ctfA_CAC2707_R TAGTTGGAATGGGCGCTAGT LHA_upp_fwd ATGAAGATAGCAATAGGTAGTGATCATGC RHA_upp_rev ACGCTTATATTATCAATATTATTTAGCTTT ATAG upp_template_fwd TGTCCAACCTTAGCAGCAGG upp_template_rev GTAGAAGAAGTAGCAATGCTAATGGC
(79) PCR using upp_template_fwd×upp_template_rev allows amplification of an internal fragment of the upp gene, absent from the upp_del repair template.
(80) The results obtained confirm the deletion within the upp gene in the transformants analysed.
(81) Analysis of the upp_Stop Mutants:
(82) The upp gene was sequenced in three clones isolated on 2YTG+5-FU after exposure to aTc (see
(83) The strategy aimed at developing a genetic modification system by the use of the cas9 gene under the control of an inducible promoter and of the gRNA present in a second plasmid is thus functional.
(84) Compared with the use of the constitutive promoter miniPthl, the induction of the cas9 gene makes it possible to control the action of the enzyme and to facilitate the selection of transformants having undergone the desired modifications.
(85) Replacement of the upp Gene by the Operon Ipa8
(86) The modification made consists of the insertion within the C. acetobutylicum ATCC 824 genome of the operon ipa8 containing the adh gene from C. beijerinckii DSM6423 (allowing the conversion of acetone to isopropanol) and the adc, ctfA, ctfB genes of strain ATCC 824 (allowing the re-assimilation of the acids produced and the formation of acetone) under the control of the constitutive promoter of the thl gene. This 3614-bp operon is inserted in place of the upp gene.
(87) A repair template made up of the operon flanked by 1-kb sequences located on each side of the upp gene was inserted into the pEC750-gRNA_upp plasmid to obtain the pEC750C-gRNA_upp-Δupp::ipa8 plasmid (see
(88) This plasmid was introduced into competent ATCC 824 cells containing the pFW0001-Pcm-tetO2/1-cas9 plasmid. The induction of cas9 expression was carried out on 2YTG medium containing thiamphenicol, erythromycin, and the inducer aTc.
(89) The colonies obtained were analysed by PCR with primer pair CA_C2877 and CA_C2882 which allows the amplification of a 2720-bp product in strain ATCC 824:
(90) TABLE-US-00005 CA_C2877: (SEQ ID NO: 27) 5′-CTTTTTAAAAAAGTTAAATAAGGAAGG-3′; CA_C2882: (SEQ ID NO: 28) 5′-GTTTAACTTAAGTTACAGAAAAGCTAGG-3′.
(91) The results of PCR assays carried out on the various controls and on 4 independent colonies obtained after induction confirm the replacement of the upp gene by the operon ipa8 (
(92) Fermentations were carried out in Gapes medium (Gapes et al., 1996) for 72 h at 34° C. and 150 rpm on the mutants obtained, as well as on the WT strain and Δupp mutants used as controls. The fermentation supernatants were analysed by HPLC using a 0.5 g/L propanol solution as internal standard. Carbohydrate concentrations were quantified on an Aminex®HXP-87P column (Biorad, 300 mm×7.8 mm) equipped with a refractive index detector (Varian 350 RI). The column temperature was 80° C. and the eluent consisted of sulphuric acid at a flow rate of 0.4 mL/min (Spectra System RI 150).
(93) The results obtained show that the Δupp::ipa8 mutants are able to reduce acetone to isopropanol, in contrast with the WT strain or a Δupp mutant (
(94) Insertion of the celA Gene into the Genome of Clostridium beijerinckii NCIMB8052
(95) The modification made consists of the insertion within the C. beijerinckii NCIMB8052 genome of the celA gene from Neocallimastix patriciarum under the control of the eglA promoter from Clostridium saccharobutylicum NCP262. This gene encodes an enzyme capable of degrading a cellulose substrate, called CMC (carboxymethyl cellulose). The gene and its promoter, 1667 bp in size, are inserted after the hbd gene, and allows the strain to degrade CMC (
(96) To carry out this insertion, two plasmids were used: the pEC500E_X_cas9 plasmid: expressing the cas9 gene under the control of the xylB inducible promoter from Clostridium dificile 630 (Nariya et al., 2011) (see
(97) These two plasmids were introduced sequentially into NCIMB8052. The induction of cas9 expression was carried out on CGM (6.25 g/L yeast extract; 0.5 g/L MgSO.sub.4.7H.sub.2O; 0.95 g/L KH.sub.2HPO.sub.4; 0.95 g/L K.sub.2HPO.sub.4; 0.013 g/L MnSO.sub.4.7H.sub.2O; 0.013 g/L FeSO.sub.4.7H.sub.2O; 1.25 g/L NaCl; 2.5 g/L (NH.sub.4).sub.2SO.sub.4; 2.5 g/L asparagine) containing spectinomycin and erythromycin as well as increasing concentrations of xylose inducer (
(98) The colonies obtained after induction on CGM containing 6% xylose were analysed by PCR with primer pair Cbei_325_F and Cbei_325_R which allows the amplification of a 2070-base pair product in strain NCIMB8052 and a 3718-base pair product in the case of integration of the celA gene:
(99) TABLE-US-00006 Cbei_325_F (celA) (SEQ ID NO: 31) 5′-AGATAATTATGAAGTTAATCCTTAG-3′; Cbei_326_R (celA) (SEQ ID NO: 32) 5′-CATTTGCTTTCAGGTCTTCTTTTGCTG-3′.
(100) The results of the PCR assays carried out on the control strain and on an independent colony obtained after induction confirm the insertion of the celA gene into NCIMB8052 (
REFERENCES
(101) Al-Hinai. M. A. et al. Novel system for efficient isolation of Clostridium double-crossover allelic exchange mutants enabling markerless chromosomal gene deletions and DNA integration. Appl. Environ Microbiol. 2012. 78(22): 8112-21. Ran, F. A. et al. Genome engineering using the CRISPR-Cas9 system. Nature protocols. 2013. 8(11): 2281-308. Barrangou, R. et al. CRISPR provides acquired resistance against viruses in prokaryotes. Science. 2007, 315(5819): 1709-12. Banerjee, A. et al. Lactose-inducible system for metabolic engineering of Clostridium ljungdahlii. Appl. Environ. Microbiol. 2014.80(8): 2410-6. Cartman, S. T. et al. Precise manipulation of the Clostridium difficile chromosome reveals a lack of association between the tcdC genotype and toxin production. Appl. Environ. Microbiol. 2012. 78(13): 4683-90. Currie, D. H. et al. Functional heterologous expression of an engineered full length CipA from Clostridium thermocellum in Thermoanaerobacterium saccharolyticum. Biotechnol. Biofuels. 2013. 6(1): 32. DiCarlo, J. E. et al. Genome engineering in Saccharomyces cerevisiae using CRISPR-Cas systems. Nucleic Acids Res.2013, 41(7): 4336-43. Dong, H. et al. Development of an anhydrotetracycline-inducible gene expression system for solvent-producing Clostridium acetobutylicum: A useful tool for strain engineering. Metab. Eng. 2012. 14(1): 59-67. D'Urzo, N. et al. High-level intracellular expression of heterologous proteins in Brevibacillus choshinensis SP3 under the control of a xylose inducible promoter. Microb. Cell Fact. 2013. 12: 12. Egholm, M. et al. Peptide nucleic acids (PNA). Oligonucleotide analogs with an achiral peptide backbone. J. Am. Chem. Soc. 1992. 114(5): 1895-7. Fonfara, I. et al. Phylogeny of Cas9 determines functional exchangeability of dual-RNA and Cas9 among orthologous type II CRISPR-Cas systems. Nucleic acids res. 2013, 42(4): 2577-90. Gapes, J. R., Nimcevic, D., & Friedl, A. (1996). Long-Term Continuous Cultivation of Clostridium beijerinckii in a Two-Stage Chemostat with On-Line Solvent Removal. Applied and environmental microbiology, 62(9), 3210-3219. Hartman, A.H. et al. Construction and characterization of a lactose-inducible promoter system for controlled gene expression in Clostridium perfringens. Appl. Environ. Microbiol. 77(2): 471-8. Jinek, M. et al. A programmable dual-RNA-guided DNA endonuclease in adaptive bacterial immunity. Science 2012. 337(6096): 816-21. Lee, J. et al. Metabolic engineering of Clostridium acetobutylicum ATCC 824 for isopropanol-butanol-ethanol fermentation. Appl. Environ. Microbiol; 2012. 78(5): 1416-23. Lopez-Contreras A M, Smidt H, van der Oost J, Claassen P A M, Mooibroek H, de Vos W M. 2001. Clostridium beijerinckii Cells Expressing Neocallismatix patriciarum Glycoside Hydrolases Show Enhanced Lichenan Utilization and Solvent Production. Appl Environ Microbiol 67:5127-5133. Lütke-Eversloh, T. Application of new metabolic engineering tools for Clostridium acetobutylicum. Appl. Microbiol. Biotechnol. 2014. 98(13): 5823-37. Mali, P. et al. Cas9 as a versatile tool for engineering biology. Nat. methods. 2013, 10(10): 957-63. Makarova, K. S., et al. Evolution and classification of the CRISPR-Cas systems. Nat. Rev. Microbiol. 2011, 9(6): 467-77. Mearls, E. B. et al. Development of a regulatable plasmid-based gene expression system for Clostridium thermocellum, Appl. Microbiol. Biotechnol. 2015.99(18): 7589-99. Nariya, H. et al., Development and characterization of a xylose-inducible gene expression system for Clostridium perfringens, Appl. Environ. Microbiol. 2011.77(23): 8439-41. Nariya H, Miyata S, Kuwahara T, Okabe A. 2011. Development and characterization of a xylose-inducible gene expression system for Clostridium perfringens. Appl Environ Microbiol 77:8439-8441. Newcomb, M. et al. Co-transcription of the celC gene cluster in Clostridium thermocellum, Appl. Microbiol. Biotechnol. 2011. 90(2): 625-34. Wang, Y. et al. Markerless chromosomal gene deletion in Clostridium beijerinckii using CRISPR/Cas9 system. J. Biotechnol. 2015. 200: 1-5. Xu, T. et al. Efficient genome editing in Clostridium cellulolyticum via CRISPR-Cas9 nickase. Appl. Environ. Microbiol. 2015 AEM-00873. Zhang, N. et al. I-SceI-mediated scarless gene modification via allelic exchange in Clostridium. J. Microbiol. Methods. 2015, 108: 49-60. Zhang, J. et al. A novel arabinose-inducible genetic operation system developed for Clostridium cellulolyticum, Biotechnol. Biofuels. 2015.8: 36.