CHIMERIC THERMOSTABLE AMINOACYL-TRNA SYNTHETASE FOR ENHANCED UNNATURAL AMINO ACID INCORPORATION

Abstract

The present invention describes methods to create chimeric aminoacyl-tRNA synthetases (aaRS) derived from bacteria which show optimal activity and high thermostability. These chimeric aaRSs can be more aggressively engineered to generate a wider assortment of Uaa-selective mutants that are stable at the physiological temperature. The invention further describes the composition of chimeric TyrRSs, generated from E. coli and G. stearothermophilus TyrRSs, which demonstrate enhanced stability relative to EcTyrRS and higher activity relative to both TyrRS enzymes.

Claims

1. A composition comprising a chimeric thermostable aminoacyl-tRNA synthetase derived from a nucleic acid sequence of a mesophilic bacterial aminoacyl-tRNA synthetase hybridized to a nucleic acid sequence of its bacterial thermostable aminoacyl-tRNA synthetase homolog.

2. The composition of claim 1, wherein the mesophilic bacterial aminoacyl-tRNA synthetase is a variant aminoacyl-tRNA synthetase comprising a mutation in its active site resulting in the alteration of the substrate specificity of the variant aminoacyl-tRNA synthetase relative to the wild-type aminoacyl-tRNA synthetase.

3. The composition of claim 1, wherein the thermostable bacteria is selected from the group consisting of: Geobacillus stearothermophilus, Bacillus stearothermophilus, Thermus thermophilis or a Thermoanaerobacter species.

4. The composition of claim 1, wherein the mesophilic bacteria is selected form the group consisting of: Escherichia coli, a Staphylococcus species, a Streptococcus species, or a Pseudomonas species.

5. The composition of claim 1, wherein the thermostable bacteria is Geobacillus stearothermophilus and the mesophilic bacteria is Escherichia coli.

6. The composition of claim 1, wherein the chimeric thermostable aminoacyl-tRNA synthetase has increased thermostability relative to the mesophilic wild-type aminoacyl-tRNA synthetase.

7. The composition of claim 6, wherein the chimeric thermostable aminoacyl-tRNA synthetase is soluble up to about 60° C.

8. The composition of claim 6, wherein the chimeric thermostable aminoacyl-tRNA synthetase aminoacylates/charges its cognate wild-type tRNA with a naturally occurring amino acid.

9. The composition of claim 1, wherein the chimeric aminoacyl-tRNA synthetase has increased biological activity relative to their individual wild-type progenitor aminoacyl-tRNA synthetases to aminoacylate/charge its cognate wild-type or variant tRNA with an unnatural amino acid.

10. The composition of claim 5, wherein the chimera comprises thermostable bacterial aminoacyl-tRNA synthetase GSTyrRS and the mesophilic bacterial aminoacyl-tRNA synthetase EcTyrRS.

11. The composition of claim 10, wherein the chimera comprises the nucleic acid sequence SEQ ID NO:1 or SEQ ID NO:41, or a nucleic acid sequence with at least 80% sequence identity to Seq ID NO: 1 or SEQ ID NO: 41.

12. The composition of claim 10, wherein the chimera comprises the nucleic acid sequence SEQ ID NO:2 or SEQ ID NO: 45, or a nucleic acid sequence with at least 80% sequence identity to Seq ID NO:2 or SEQ ID NO: 45.

13. The composition of claim 2, wherein the mutation in the active site results in the incorporation of the unnatural amino acid p-benzoylphenylalanine (pBpA) in a mammalian protein.

14. The composition of claim 13, wherein the amino acid sequence of the chimera comprises SEQ ID NO:43 or SEQ ID NO:47, or an amino acid sequence with at least 80% sequence identity to either SEQ ID NO:43 or SEQ ID NO:47.

15. The composition of claim 2, wherein the mutation in the active site results in the incorporation of the unnatural amino acid O-methyltyrosine (OMeY) in a mammalian protein.

16. The composition of claim 15, wherein the amino acid sequence comprises SEQ ID NO:44, or an amino acid sequence with at least 80% sequence identity to SEQ ID NO:44.

17. A cell comprising the chimeric aminoacyl-tRNA synthetase variant of claim 1.

18. The cell of claim 17, wherein the cell is a eukaryotic cell.

19. The cell of claim 18, wherein the cell is selected from the group consisting of a yeast cell, insect cell or a mammalian cell.

20. The cell of claim 17, wherein the cell is a bacterial cell.

21. The cell of claim 20, wherein the bacterial cell is an E. coli cell.

22. The cell of claim 21, wherein the E. coli is an engineered ATM E. coli strain.

23. A method of producing a chimeric thermostable aminoacyl-tRNA synthetase, comprising: a) identifying an aminoacyl-tRNA synthetase of interest in a mesophilic microorganism; b) identifying an aminoacyl-tRNA synthetase homolog of the aminoacyl-tRNA synthetase of part a), wherein the aminoacyl-tRNA synthetase homolog is derived from a thermophilic microorganism; c) constructing a chimera comprising the sequences of the thermostable aminoacyl-tRNA synthetase and the aminoacyl-tRNA synthetase identified in parts a) and b); and d) evaluating the chimera for thermostability and increased biological activity to aminoacylate/charge its cognate tRNA relative to their individual wild type progenitor aminoacyl-tRNA synthetases of parts a) and b), thereby producing a chimeric thermostable aminoacyl-tRNA synthetase.

24. The method of claim 23, wherein the mesophilic aminoacyl-tRNA synthetase of part a) is a variant aminoacyl-tRNA synthetase comprising a mutation in its active site resulting in the alteration of the substrate specificity of the variant aminoacyl-tRNA synthetase relative to the wild-type aminoacyl-tRNA synthetase.

25. The method of claim 24, wherein the active site mutation of the variant aminoacyl-tRNA synthetase results in the incorporation of an unnatural amino acid in a mammalian protein.

26. A method of producing a protein in a cell with one, or more, unnatural amino acids at specified positions in the protein, the method comprising, a. culturing the cell in a culture medium under conditions suitable for growth, wherein the cell comprises a nucleic acid that encodes a protein with one, or more, amber or opal selector codons, wherein the cell further comprises an Ec-tRNA.sup.UAA that recognizes the selector codon(s), and wherein the cell further comprises a chimeric thermostable aminoacyl-tRNA synthetase that preferentially aminoacylates the Ec-tRNA.sup.UAA with an unnatural amino acid; b. contacting the cell culture medium with one, or more, unnatural amino acid analogs corresponding to the Uaa of the Ec-tRNA.sup.UAA under conditions suitable for incorporation of the one, or more, unnatural amino acids into the protein in response to the selector codon(s), thereby producing the protein with one, or more unnatural amino acids at specified positions of the protein.

27. The method of claim 26, wherein the chimeric thermostable aminoacyl-tRNA synthetase comprises the chimera of claim 1.

28. The method of claim 27, wherein the chimera comprises the nucleic acid sequence SEQ ID NO:1 or SEQ ID NO: 41, or a nucleic acid sequence with at least 80% sequence identity to Seq ID NO: 1 or SEQ ID NO:41.

29. The method of claim 27, wherein the chimera comprises the nucleic acid sequence SEQ ID NO:2 or SEQ ID NO:45, or a nucleic acid sequence with at least 80% sequence identity to Seq ID NO:2 or SEQ ID NO:45.

30. The method of claim 26, wherein the unnatural amino acid to be incorporated into the protein is p-benzoylphenylalanine (pBpA) and the chimera is Ch2TryRS-pBpA or Ch6TryRS-pBpA.

31. The method of claim 30, wherein the amino acid sequence of the Ch2TryRS-pBpA chimera comprises SEQ ID NO:43 or SEQ ID NO: 47 or an amino acid sequence with at least 80% sequence identity to either SEQ ID NO:43 or SEQ ID NO:47.

32. The method of claim 26, wherein the unnatural amino acid to be incorporated into the protein is unnatural amino acid O-methyltyrosine (OMeY) and the chimera is Ch2TyrRS-poly.

33. The method of claim 32, wherein the amino acid sequence of the Ch2TyrRS-poly chimera comprises SEQ ID NO:44 or an amino acid sequence with at least 80% sequence identity to either SEQ ID NO:44.

34. The cell of claim 26, wherein the cell is an E. coli cell or a eukaryotic cell.

35. The cell of claim 34, wherein the eukaryotic cell is a mammalian cell.

36. The E. coli cell of claim 34, wherein the E. coli is an ATMY strain of E. coli cell.

37. A kit for producing a protein in a cell, wherein the protein comprises one, or more pBpA residues, the kit comprising: a. a container containing a polynucleotide sequence encoding an Ec-tRNA.sup.pbpa that recognizes an amber or opal selector codon(s) in a nucleic acid of interest in the cell; and; b. a container containing a polynucleotide sequence encoding the chimeric thermostable aminoacyl-tRNA synthetase Ch2TryRS-pBpA or Ch6TyrRS-pBpA.

38. The kit of claim 37, wherein the polynucleotide encoding the chimera encodes the amino acid sequence of the chimera comprising SEQ ID NO:43 or SEQ ID NO:47, or an amino acid sequence with at least 80% sequence identity to either SEQ ID NO:43 or SEQ ID NO:47.

39. The kit of claim 37, wherein the kit further comprises one, or more, p-benzoylphenylalanine molecules.

40. The kit of claim 37, wherein the kit further comprises instructions for producing the protein.

41. A kit for producing a protein in a cell, wherein the protein comprises one, or more O-methyltyrosine (OMeY) residues, the kit comprising: a. a container containing a polynucleotide sequence encoding an Ec-tRNA.sup.poly that recognizes an amber or opal selector codon(s) in a nucleic acid of interest in the cell; and; b. a container containing a polynucleotide sequence encoding the chimeric thermostable aminoacyl-tRNA synthetase Ch2TyrRS-poly.

42. The kit of claim 41, wherein polynucleotide encoding the chimera encodes the amino acid sequence SEQ. ID. NO:44, or an amino acid sequence comprising at least 80% sequence identity to SEQ ID NO:44.

43. The kit of claim 41, wherein the kit further comprises one, or more, O-methyltyrosine (OMeY) molecules.

44. The kit of claim 41, wherein the kit further comprises instructions for producing the protein.

Description

BRIEF DESCRIPTION OF THE DRAWINGS

[0041] In the accompanying drawings, reference characters refer to the same parts throughout the different views. The drawings are not necessarily to scale; emphasis has instead been placed upon illustrating the principles of the invention. The patent or application file contains at least one drawing executed in color. Copies of this patent or patent application publication with color drawings(s) will be provided by the Office upon request and payment of the necessary fee. Of the drawings:

[0042] FIGS. 1A-1C show that engineered TyrRS mutants show lower thermostability. A) EcTyrRS active site, showing bound tyrosine in magenta, and highlighting mutated residues in engineered variants (shown below). B) Western blot analysis of soluble and insoluble fractions of E. coli cell free extract expressing EcTyrRS-WT and EcTyrRS-pBpA reveals that the latter is largely insoluble. C) Thermal shift assay of various TyrRS variants. Dot-blot was performed (using an anti-polyhistidine antibody) on the soluble fraction of E. coli cell-free extracts expressing the indicated TyrRS variants (left), after incubation at the indicated temperature (top).

[0043] FIGS. 2A-2C show that bacterial TyrRS chimeras created from GsTyrRS and EcTyrRS exhibit higher activity and intermediate thermostability. A) Two chimeras, Ch2TyrRS and Ch6TyrRS, created by fusing EcTyrRS (green) and GsTyrRS (magenta) sequences. The EcTyrRS crystal structure was used to highlight the progenitor sequences in the two chimeras. B) Thermal shift assay of the two chimeras, as well as their wild-type progenitors, in E. coli cell-free extract. Dot-blot was performed (using an anti-polyhistidine antibody) on the soluble fraction of E. coli cell-free extracts expressing the indicated TyrRS variants (left), after incubation at the indicated temperature (top). C) Activity of the TyrRS variants in ATMY E. coli strains, measured using the expression of sfGFP-151TAG reporter in the presence of tRNA.sub.CUA.sup.Tyr. Characteristic fluorescence of the full-length sfGFP-151-TAG reporter was measured in resuspended cells.

[0044] FIGS. 3A-3B show that chimeric TyrRS variants better tolerate pBpA-selective mutations. A) Thermal shift assay of the pBpA selective TyrRS mutants constructed from the two wild-type or chimeric scaffolds, in E. coli cell-free extract. Dot-blot was performed (using an anti-polyhistidine antibody) on the soluble fraction of E. coli cell-free extracts expressing the indicated TyrRS-pBpA variants (left), after incubation at the indicated temperature (top). B) Activity of the TyrRS-pBpA variants in the ATMY E. coli strain, measured using the expression of sfGFP-151TAG reporter in the presence of tRNA.sub.CUA.sup.Tyr and in the presence and absence of 1 mM pBpA. Characteristic fluorescence of the full-length sfGFP-151-TAG reporter was measured in resuspended cells.

[0045] FIGS. 4A-4C. FIGS. 4A and 4B show that chimeric TyrRS derived mutants exhibit improved activity for ncAA incorporation in mammalian cells. A) TyrRS-pBpA variants were co-expressed in HEK293T cells with tRNA.sub.CUA.sup.Tyr and EGFP-39-TAG, in the presence and absence of pBpA, and the expression of the full-length reporter was monitored by its characteristic fluorescence in cell-free extract. The expression level was reported as the % of an identical experiment where wild-type EGFP reporter (no TAG) was used as the reporter. B) The ncAA-incorporation efficiency of Ch2TyrRS-Poly is comparable to the highly active EcTyrRS-Poly. Activity was measured as described in section (A) in the presence and absence of 1 mM OMeY. See FIG. 9 for all associated fluorescence images. FIG. 4C shows that the ChTyrRS-pBpA show enhanced activity relative to either wild-type counterparts. Activity was measured by expressing a GFP-151-TAG reporter in E. coli cells in the presence of tRNA-EcTyr (TAG suppressor).

[0046] FIG. 5 shows the nucleic acid sequences of ChTyrRS-H2 (SEQ ID NO:1) and ChTyrRS-H6 (SEQ ID NO:2).

[0047] FIG. 6 shows that the activity of EcTyrRS-pBpA is significantly weaker than EcTyrRS-WT. Activity was evaluated using the sfGFP-151-TAG reporter, expressed in ATMY E. coli, by measuring the characteristic fluorescence of the full-length reporter in resuspended cells. For EcTyrRS-pBpA, the expression was measured in the presence or absence of 1 mM pBpA.

[0048] FIG. 7 shows the MjTyrRS mutants used in this study. The active site structure of MjTyrRS is also shown highlighting the key residues mutated to generate non-canonical amino acids (ncAA or Uaa)-selective variants.

[0049] FIG. 8 shows the sequence alignment of EcTyrRS-WT (SEQ ID NO: 29) and GsTyrRS-WT (SEQ ID NO: 30) and its consensus sequence.

[0050] FIG. 9 shows the fluorescence images of mammalian cells expressing EGFP-39-TAG reporter using various TyrRS/tRNA pairs (shown above), in the presence or absence of relevant ncAAs (left). These images correspond to the fluorescence values presented in FIG. 4.

[0051] FIG. 10 shows SDS-PAGE analysis of the EGFP-39-pBpA reporter expressed in HEK293T cells using Ch2TyrRS-pBpA.

[0052] FIGS. 11A-B show the deconvoluted ESI-MS analysis of EGFP-39-pBpA reporter expressed in HEK293T cells using Ch2TyrRS-pBpA. Two different magnifications of the same spectra are shown. The major species (29771 Da) corresponds to the expected mass; 29729 Da peak likely represents the same species lacking N-terminal acetylation (−42 Da), while 29787 Da peak likely arises from oxidation (+16 Da).

[0053] The text of the final plasmid maps and sequences are provided below with the following color coding: aaRS highlighted red, antibiotic selectable marker highlighted blue, tRNA highlighted purple, lacI highlighted green, and the origin of replication highlighted orange. The images are not color coded.

[0054] FIG. 12 shows the plasmid map and sequences of pBK MCS GsYRS WT and where the active site mutations are located in Ch2TyrRS-pBpA variant, and also where the active site mutations are located in the Ch6TyrRS-pBpA variant. (SEQ ID NOS 31, 1 and 2), respectively, in order of appearance).

[0055] FIG. 13 shows the plasmid map and sequences of pET22b 10×N-term His GsYRS (SEQ ID NOS 32-36, respectively, in order of appearance).

[0056] FIG. 14 shows the plasmid map and sequences of pBIU Gs-BPA-RS and where the active site mutations are located in the Ch2YyrRS-OMeY variant. (SEQ ID NOS 37-40, respectively, in order of appearance).

[0057] FIG. 15 shows the following sequences in order of appearance: [0058] Ch2TyrRS-WT nucleotide sequence (SEQ ID NO: 41) and its encoded amino acid sequence (SEQ ID NO: 42). [0059] Ch2TyrRS-pBpA amino acid SEQ ID NO: 43. Mutations are highlighted in red: Y37G, D179G, L183A. [0060] Ch2TyrRS-poly amino acid SEQ ID NO: 44. Mutations are highlighted in red; Y37V, D176S, F180M, L183A. [0061] Ch6TyrRS-WT nucleotide sequence (SEQ ID NO: 45) and its encoded amino acid sequence (SEQ ID NO: 46). [0062] Ch6TyrRS-pBpA amino acid SEQ ID NO: 47. Mutations are highlighted in red: Y37G, D182G, L186A.

DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

[0063] While this invention has been particularly shown and described with references to preferred embodiments thereof, it will be understood by those skilled in the art that various changes in form and details may be made therein without departing from the scope of the invention encompassed by the appended claims.

[0064] Non-canonical amino acid (ncAA) mutagenesis of proteins in living cells has emerged as a powerful technology with enormous potential..sup.1-5 A ncAA of interest can be co-translationally incorporated using an orthogonal aminoacyl-tRNA synthetase (aaRS)/tRNA pair in response to a nonsense or frameshift codon..sup.1-5 Central to this technology is the ability to engineer the substrate specificity of a natural aaRS through directed evolution. Many useful ncAAs have been genetically encoded in E. coli using the Methanocaldococcus jannaschii derived tyrosyl-tRNA synthetase (MjTyrRS)/tRNA pair, including those containing bioconjugation handles, photo-affinity probes, biophysical probes, models for natural post-translational modification, etc..sup.1, 2, 5 While some of these functionalities can also be genetically encoded using other aaRS/tRNA pairs, several others (e.g., those modeling natural post-translational modifications) are reliant on the unique architecture of the TyrRS active site..sup.1, 2, 5 Unfortunately, however, this enabling toolset cannot be used in eukaryotic cells, as the archaea-derived MjTyrRS/tRNA pair cross-reacts with its eukaryotic counterpart. Typically, bacteria-derived aaRS/tRNA pairs are suitable for ncAA incorporation in eukaryotes, as they tend to be orthogonal in these cells..sup.1, 3, 5-7 Indeed, the E. coli derived tyrosyl-tRNA synthetase (EcTyrRS)/tRNA pair has been established for ncAA incorporation in eukaryotic cells..sup.8-12 It was first engineered to incorporate ncAAs into proteins expressed in eukaryotic cells nearly two decades ago. Yet, the ncAA-toolbox developed using this pair remains surprisingly limited, particularly when compared to the remarkable success of the MjTyrRS/tRNA pair during the same time period..sup.1-3, 5, 13 The ability to recapitulate the success of the MjTyrRS/tRNA platform using a bacterial TyrRS/tRNA pair will significantly expand the scope of the genetic code expansion (GCE) technology in eukaryotes by providing access to structurally unique ncAAs that are challenging to genetically encode using alternative aaRS/tRNA pairs.

[0065] The limited success of the EcTyrRS/tRNA pair can be, at least partially, attributed to the challenges associated with the directed evolution platform used to alter its substrate specificity..sup.1, 3, 7, 13 Unlike MjTyrRS, which can be readily engineered using a facile E. coli based directed evolution system, a more cumbersome yeast-based selection scheme is needed to engineer EcTyrRS..sup.8 To address this challenge, a novel strategy was developed that involves the development of unique E. coli strains (ATMY strains), where the endogenous EcTyrRS/tRNA pair is functionally substituted with an archaeal counterpart..sup.1, 3, 7, 13 (see also U.S. patent Ser. No. 10/717,975). It was demonstrated that such strains can be generated without incurring a significant growth penalty..sup.13 The ‘liberated’ EcTyrRS/tRNA pair can be subsequently established in the resulting ATMY strains as an orthogonal nonsense suppressor. This has enabled the use of the facile E. coli based directed evolution platform to engineer the substrate specificity of EcTyrRS..sup.13

[0066] Although the ability to rapidly engineer the EcTyrRS/tRNA pair using this facile directed evolution platform has provided access to several new ncAAs, in some instances, the resulting engineered mutants demonstrated poor activity. For example, it was attempted to develop an EcTyrRS mutant that efficiently charges p-benzoylphenylalanine (pBpA), a powerful photoaffinity probe that has been useful for capturing weak and transient molecular interactions..sup.8, 14-17 Even though EcTyrRS was previously engineered using the yeast-based selection platform to selectively charge pBpA, the utility of this mutant has been limited due to its weak activity. When a large EcTyrRS active site mutant library was subjected to the facile selection system, the same mutant was identified that was previously developed by selection in yeast. This indicated that the observed set of mutations indeed optimally recodes the EcTyrRS active site for charging pBpA. The activity of this pBpA-selective EcTyrRS was somewhat low, as measured in the ATMY E. coli strain using the sfGFP-151-TAG reporter (FIG. 6). A systematic investigation identified that the EcTyrRS-pBpA mutant was largely insoluble in E. coli, potentially explaining its poor activity (FIG. 1B). Western blot analysis of the soluble and insoluble fractions of cell-free extracts of E. coli expressing polyhistidine-tagged EcTyrRS-WT and EcTyrRS-pBpA revealed that the latter is nearly exclusively found in the insoluble fraction (FIG. 1B). In contrast, a large portion of the wild-type EcTyrRS was found in the soluble fraction.

[0067] It has been previously observed that when a protein is subjected to directed evolution to attain an altered function, the stability of the resulting mutants is often compromised..sup.18-21 Consequently, the extent to which a protein can be engineered is often limited by how stable it is. It was hypothesized that the success in engineering MjTyrRS, an enzyme derived from a thermophilic archaeon, is likely facilitated by its high structural stability. In contrast, EcTyrRS, derived from mesophilic bacteria, may be a less stable scaffold and have a lower tolerance for active site mutations. To test this notion, a modified cellular thermal shift assay (CETSA) was utilized..sup.22, 23 In this assay, cell-free extract expressing a target protein is heated to increasing temperatures, and the amount of remaining protein in the soluble fraction is subsequently tested by immunoblotting. The temperature range at which a protein is lost from the soluble fraction provides an estimate of its thermostability. In addition to EcTyrRS-WT and EcTyrRS-pBpA, a polyspecific EcTyrRS mutant (EcTyrRS-Poly) was also tested that is highly active (FIG. 1A). For comparison, MjTyrRS-WT was include, as well as two of its comparable engineered mutants: one selective for pBpA (MjTyrRS-pBpA),.sup.24 and another that exhibits ncAA polyspecificity (MjTyrRS-Poly) (FIG. 7)..sup.25 All of these proteins encoded an N-terminal hexahistidine tag (SEQ ID NO: 3) to facilitate their detection in a dot-blot assay using an anti-polyhistidine antibody. As expected, MjTyrRS was found to be highly thermostable, maintaining solubility up to 80° C. (FIG. 1C). In contrast, EcTyrRS was much less stable, and was lost from the soluble fraction between 50° C. and 60° C. (FIG. 1C). These values are consistent with previously reported thermostability measurements..sup.26 All of the engineered mutants exhibited reduced stability relative to their wild-type counterparts. MjTyrRS-pBpA mutant was slightly less stable than its polyspecific counterpart, but both were soluble at physiological temperature. In contrast, for EcTyrRS, only the polyspecific mutant was soluble at physiological temperature; the pBpA selective mutant was not detected in the soluble fraction even at the lowest temperature tested (FIG. 1C). These observations support the hypothesis that the lower stability of EcTyrRS negatively impacts its engineerability. While some of its active site mutants, such as EcTyrRS-Poly, are adequately stable and active under physiological conditions, more destabilizing mutants such as EcTyrRS-pBpA are not viable.

[0068] To overcome this challenge, the possibility of adapting a TyrRS from a thermophilic bacterium was considered, which might offer a higher degree of engineerability relative to EcTyrRS. Several aminoacyl-tRNA synthetases derived from the thermophilic bacterium Geobacillus stearothermophilus have been purified and structurally characterized..sup.27-29 TyrRS from this bacterium (GsTyrRS) is homologous to EcTyrRS (FIG. 8) but is significantly more thermostable, offering an attractive scaffold for engineering ncAA-selective mutants..sup.26 The stability and the activity of GsTyrRS was tested using the CETSA and the sfGFP-151-TAG expression assay, as described above (FIG. 2B). GsTyrRS was indeed significantly more stable than EcTyrRS, but its activity was somewhat lower in E. coli (FIGS. 2B, 2C). It was previously investigated whether enzymes derived from thermophilic bacteria exhibit weaker activity at lower temperature..sup.30

[0069] A chimera from EcTyrRS and GsTyrRS was then constructed that exhibited an optimal balance of stability and activity. It has been previously shown that such chimeric enzymes can be excellent scaffolds for protein engineering..sup.31, 32 As described herein, the technique of DNA shuffling was used to produce the chimeras of the present invention. Briefly, DNA shuffling involves the digestion of a gene or homologous genes into random fragments, and the reassembly of those fragments into a full-length gene by PCR. The gene fragments prime on each other based on sequence homology, and recombination occurs when fragments from one copy of a gene anneal to fragments from another copy, causing a template switch, or crossover event. As described herein, naturally occurring homologous genes such as aminoacyl-tRNA synthetases from mesophilic and thermophilic microorganisms are used as the progenitor sources for the hybrids. The gene(s) are digested/cut into random segments with appropriate restriction enzymes to fragments of about 100 to 300 base pairs long. The segments are then reassembled by using a suitable a DNA polymerase with overlapping segments or by using some version of overlap PCR (see for example, Sheryl B. Rubin-Pitel, et. al., in Bioprocessing for Value-Added Products from Renewable Resources, 2007; H. Kamada, S.-I. Tsunoda, in Biomaterials for Cancer Therapeutics, 2013; David P. Clark, Nanette J Pazdernik, in Biotechnology (Second Edition), 2016). The resulting constructs can then be sequenced and evaluated for the desired characteristics using known protocols.

[0070] Several chimeras were constructed and tested between EcTyrRS and GsTyrRS and two were identified, Ch2TyrRS and Ch6TyrRS (FIG. 2A), which show higher levels of activity (FIG. 2C) and intermediate thermostability (FIG. 2B) relative to their wild-type progenitors, when expressed in ATMY E. coli. Next, pBpA-selective mutants of these TyrRS variants were generated and tested. Both Ch2TyrRS-pBpA and Ch6TyrRS-pBpA were more thermostable than EcTyrRS-pBpA and were also soluble at physiological temperature (FIG. 3A). This was reflected by the significantly higher degree of activity observed for these enzymes (FIG. 3B). Interestingly, even though GsTyrRS was the most thermostable, the corresponding pBpA-selective mutant was found to be largely insoluble and poorly active when expressed in E. coli (FIG. 3A, 3B). While the basis of this observation is unclear, it indicates that the chimeras may be better suited for engineering new ncAA-selective variants.

[0071] The activity of these engineered pairs was evaluated in the ATMY E. coli strain, where it is significantly easier to control parameters affecting the assay performance, such as the expression level of the aaRS/tRNA pairs. To demonstrate the utility of these new tools in eukaryotic cells, the activity of the pBpA-selective TyrRS variants were tested in HEK293T cells. EcTyrRS-pBpA, GsTyrRS-pBpA, Ch2TyrRS-pBpA, and Ch6TyrRS-pBpA were each cloned into a mammalian expression vector under a UbiC promoter, which also encodes 16 copies of the tRNA.sup.Tyr.sub.CUA expression cassette. The resulting plasmids were co-transfected into HEK293T cells with another plasmid encoding an EGFP-39-TAG reporter, and the full-length reporter expression was monitored in the presence or absence of 1 mM pBpA in the media (FIG. 4A, and FIG. 9). Expression of a wild-type EGFP reporter (no in-frame TAG codon) was also included as a control. All four TyrRS-pBpA variants enabled successful incorporation of pBpA into the reporter. However, Ch2TyrRS-pBpA and Ch6TyrRS-pBpA demonstrated significantly higher activity (up to 36% of wild-type EGFP) relative to EcTyrRS-pBpA and GsTyrRS-pBpA (FIG. 4A). The reporter protein expressed using Ch2TyrRS-pBpA was isolated using Ni-NTA affinity chromatography and characterized by SDS-PAGE (FIG. 10) and mass-spectrometry analysis (FIGS. 11A-B) to confirm successful pBpA incorporation. It is worth noting that the activity of GsTyrRS-pBpA in mammalian cells was found to be significantly higher than what is expected from its assessment in ATMY E. coli, where it was found to be nearly inactive. It is possible that the more sophisticated protein folding machinery of the mammalian cells is able to better process unstable engineered proteins like GsTyrRS-pBpA. The TyrRS variants are also expressed more strongly in mammalian cells than in E. coli, which may also contribute to the observed difference.

[0072] Nonetheless, these results demonstrate that the chimeric TyrRS variants provide improved platforms for the GCE technology in eukaryotes. To further highlight the generality of this approach, Ch2TyrRS-Poly was constructed by introducing previously reported active site mutations for generating EcTyrRS-Poly (FIG. 1A), an engineered mutant that charges several different ncAAs including O-methyltyrosine (OMeY). When tested in HEK293T cells, both EcTyrRS-Poly and Ch2TyrRS-Poly exhibited comparable activity for EGFP-39-TAG reporter expression (FIG. 4B and FIG. 9), confirming that the chimeric TyrRS is able to recapitulate the activity of well-behaved bacterial engineered EcTyrRS mutants, while providing a better scaffold for those with suboptimal stability.

[0073] Work in the last two decades have provided a deep insight into how the biophysical properties of a protein influence its evolution..sup.18-21 It is now clear that the function-altering mutations acquired during experimental or natural evolution can often negatively impact the structural stability of a protein. The work described herein highlights its impact on the GCE technology, which relies on engineered aaRSs that selectively charge ncAAs of interest. The structural robustness of MjTyrRS has been shown and has contributed to its remarkable success as a powerful GCE platform. In contrast, the lower stability of EcTyrRS compromises the extent to which its active site can be altered. It is important to note that the same limitation likely affects the engineerability of several other aaRS/tRNA pairs, derived from mesophilic organisms (e.g., E. coli or yeast),.sup.3, 6, 33-35 which have been adapted for ncAA incorporation. Indeed, the success of engineering these platforms for ncAA incorporation has been limited. As a result of the work described herein, a strategy to overcome this challenge by taking advantage of more thermostable aaRS homologs derived from thermophilic organisms is now available.

[0074] The chimeras generated from thermophilic and mesophilic aaRS homologs may be even better suited for this purpose. Analogous strategies have been used to create optimal starting points for the directed evolution of enzymes such as cytochrome P450..sup.31 It is possible that instead of simple aaRS chimeras like the ones reported here, more sophisticated counterparts with even better properties can be created by constructing and selecting a DNA-shuffling library of EcTyrRS and GsTyrRS. Additionally, as shown herein, the relative performance of the same aaRS in different expression systems can be different. For example, the GsTyrRS-pBpA mutant, which is largely insoluble and inactive in E. coli, demonstrated robust activity in mammalian cells. This might stem from differences in protein folding machinery in different host cells, as well as other factors such as variable expression level of the aaRS, speed of translation, codon usage, etc.

[0075] In summary, here is established the structural robustness of an aaRS as an important factor that significantly impacts its engineerability for GCE. A roadmap for creating more engineerable bacterial aaRS variants by hybridizing homologs from mesophilic and thermophilic bacteria is provided. Mutants generated from such chimeric TyrRSs show robust activity in both ATMY E. coli strain as well as in mammalian cells, suggesting that these are more attractive scaffolds for extensive engineering. Directed evolution of these using the facile ATMY E. coli based selection system should provide access to new enabling ncAAs. Finally, improved pBpA-incorporation activity of ChTyrRS-pBpA will further facilitate the application of this important photo-crosslinker ncAA for uncovering new biomolecular interactions in eukaryotic cells.

[0076] Without further elaboration, it is believed that one skilled in the art can, based on the above description, utilize the present invention to its fullest extent. The following specific embodiments and examples are, therefore, to be construed as merely illustrative, and not limitative of the remainder of the disclosure in any way whatsoever.

EXAMPLES

[0077] The following examples are provided to illustrate embodiments of the present invention but are by no means intended to limit its scope. The examples described herein will be understood by one of ordinary skill in the art as exemplary protocols. One of ordinary skill in the art will be able to modify these procedures appropriately and as necessary.

[0078] Introduction

[0079] The present invention describes the composition of thermostable bacteria-derived TyrRS variants that can be more aggressively engineered for Uaa incorporation than their wild-type counterparts. The invention is not restricted to TyrRS, however; the method to generate such active and thermostable mutants, which is described as a part of this invention, can also be readily extended to all other bacteria-derived aaRSs that can be engineered for Uaa incorporation in eukaryotic cells.

[0080] The work described herein with E. coli derived TyrRS (EcTyrRS) has revealed that many of the engineered mutants that have already been developed show poor folding and stability in cells. Expression of these mutants followed by analysis of the soluble and insoluble fractions of the proteome by Western blot reveals the majority of the mutant proteins are insoluble. Further analysis using CETSA (Cellular Thermal Stability Assay) show that the EcTyrRS is not as thermostable as its archaea derived counterpart that has been successfully engineered to incorporate numerous Uaas in bacteria. Furthermore, it has been found that the mutants derived from the archaeal TyrRS are also less stable than their wild-type counterpart, but still sufficiently viable at the physiological temperature, highlighting the importance of having a thermostable wild-type aaRS for developing Uaa-selective mutants.

[0081] To overcome the poor thermostability of EcTyrRS, a homologous TyrRS from the thermophilic bacteria Geobacillus stearothermophilus (GsTyrRS) was identified and evaluated. Although GsTyrRS was more stable, it exhibited significantly lower activity relative to EcTyrRS. This was not unexpected, as the stability and activity of enzymes are often negatively correlated.

[0082] The present invention describes a method to generate chimeric aaRS mutants that demonstrate optimal balance between thermostability and activity. By generating a chimera between two homologous aaRS—one highly active but less stable, and the other highly stable (from a thermophile such as Geobacillus stearothermophilus)—it is possible to create chimeras that exhibit such optimal properties. For example, by generating chimeras between EcTyrRS and GsTyrRS, novel sequences have been generated that are still significantly more stable than EcTyrRS yet have higher activity in both bacterial and eukaryotic cells. Such chimeras can be generated either by rational fusion of homologous stretches, or by DNA shuffling of the thermostable and the active aaRS sequences.

[0083] The method described in this invention for creating stable yet active bacterial aaRS variants is not restricted to any one particular aaRS. The same strategy can be applied to generate optimal chimeric variants of any other bacterial aaRS including, but not limited to, those charging alanine, glycine, serine, cysteine, methionine, tryptophan, phenylalanine, leucine, isoleucine, valine, proline, threonine, selenocysteine, lysine, arginine, asparagine, glutamine, glutamic acid, aspartic acid, and histidine.

[0084] The chimeric aaRS variants generated by this method can be more aggressively engineered to create mutants that selectively charge various Uaas. Due to their improved robustness, these would provide access to a wider range of Uaa-selective mutants. In addition to unnatural amino acids, the aaRS mutants can also be used to charge other nonnatural substrates including, but not limited to, hydroxyl-acids, thio-acids, R-amino acids, etc.

[0085] These engineered aaRS mutants can be used in any eukaryotic cell along with the appropriate cognate tRNA (suppressing a nonsense or frameshift codon, or a codon composed of one or more nonnatural nucleobases). Such expression hosts include, but are not limited to, yeast, insect cells, and mammalian cells. Additionally, these aaRS/tRNA pairs can also be used for Uaa incorporation in engineered ATM E. coli strains, where this bacterial pair has been functionally replaced with a eukaryotic or archaeal counterpart. The present invention describes the composition of thermostable bacteria-derived TyrRS variants that can be more aggressively engineered for Uaa incorporation than their wild-type counterparts. The invention is not restricted to TyrRS, however; the method to generate such active and thermostable mutants, which is described as a part of this invention, can also be readily extended to all other bacteria-derived aaRSs that can be engineered for Uaa incorporation in eukaryotic cells.

Example 1

[0086] Materials and Methods

[0087] General Materials:

[0088] All cloning and plasmid propagation were done in DH10B E. coli cells. Restriction enzymes, Phusion HS II High-Fidelity DNA polymerase, and IPTG were obtained from Fisher. T4 DNA ligase was obtained from Enzymatic. DNA extraction and PCR clean up were conducted with Macherey-Nagel Binding Buffer NTI and Epoch mini spin columns from Thermo Fisher Scientific. Media components were obtained from Fisher Scientific. The following antibiotic stock concentrations were used: ampicillin 100 μg/mL, kanamycin 50 μg/mL, spectinomycin 100 μg/mL, chloramphenicol 35 μg/mL for LB Agar plates and cultures. A Cole Parmer Ultrasonic Processor was used for making E. coli lysate by sonication. Protein purification was conducted with a HisPur Ni-NTA resin from ThermoScientific. Dot blots were done with GE Healthcare life sciences nitrocellulose blotting membrane (0.45 um). Western blots were conducted with a PVDF membrane, antibodies, and SuperSignal West Dura Extended Duration Substrate for western blot from Thermo Fisher Scientific.

[0089] Accession Codes: [0090] E. coli tyrosyl-tRNA synthetase (EcTyrRS, NCBI BAA15398.2) [0091] G. stearothermophilus tyrosyl-tRNA synthetase (GsTyrRS, NCBI KOR92528.1)

TABLE-US-00001 Bacterial and virus strains Strain Source Catalog Number ATMY6 Chatterjee lab N/A E. coli Thermo Fisher 18297010 DH10B Scientific

TABLE-US-00002 Chemicals, peptides, and recombinant proteins Reagent Source Catalog Number para-benzoyl-1- Chem-Impex 05110 phenylalanine International O-methyl tyrosine Fisher Scientific AAH6309606

TABLE-US-00003 Experimental models: cell lines Strain Source Catalog Number HEK293T ATCC CRL-1573

[0092] Construction of plasmids to express aaRS for ncAA incorporation into sfGFP and EGFP: The G. stearothermophilus tyrosyl-aaRS was PCR amplified from a gBlock purchased from IDT, digested with NdeI/NcoI, and inserted into the pBK vector backbone. The mutant G. stearothermophilus tyrosyl-aaRS mutants were then generated via standard site-directed mutagenesis of the appropriate active site residues. The pBK E. coli tyrosyl-aaRS wild type and mutants were previously reported..sup.36,37

[0093] The chimeric H2 and H6 aaRS' were constructed by PCR amplification of the E. coli tyrosyl-aaRS N-terminus and the G. stearothermophilus C-terminus. The inserts were then made through overlap amplification, digested with NdeI/NcoI, and inserted into the pBK vector backbone. The mutant chimeric aaRS were then generated via standard site-directed mutagenesis..sup.38

[0094] For expression of the aaRS in mammalian cells, terminal primers were used to PCR amplify the aaRS' from their respective pBK plasmids. This was followed by digestion of the PCR products with NheI/XhoI into the pB1U vector backbone.

[0095] Construction of plasmids to express aaRS for CETSA: The E. coli, G. stearothermophilus, and chimeric aaRS' were PCR amplified from their respective pBK constructs, digested with NdeI/HindIII, and inserted into the pET22b vector backbone. The N-terminal primer appended a 10×-Histidine tag (SEQ ID NO: 4) to each aaRS for future imaging.

[0096] sfGFP* fluorescence analysis and expression: For E. coli expression, the pBK aaRS and pEvol T5 EcY-TAG sfGFP151* reporter plasmids were co-transformed into ATMY6 cells..sup.36 A 5 mL overnight culture was inoculated with a single colony and the appropriate antibiotics. The overnight starter culture was then used to inoculate a 20 mL LB Media culture supplemented with antibiotics. Cultures were grown to an OD600 of 0.6 then induced with a final concentration of 1 mM IPTG, the appropriate ncAA (1 mM), and incubated for 16 hours at 30° C. with shaking (250 rpm). The cultures were then spun down, the LB media was removed, and the cells were resuspended in 1×PBS. Fluorescence readings were collected in a 96-well plate using a SpectraMAX M5 (Molecular Devices) (ex=488 nm and em=534 nm). Mean of two independent experiments were reported, and error bars represent standard deviation.

[0097] EGFP* fluorescence analysis, expression and purification: For fluorescence analysis, HEK 293T cells were seeded at a density of 600,000 cells per well for a 12-well plate the day before transfection. A total amount of 1.5 μg DNA (0.75 μg of each plasmid for two-plasmids)+3.5 μL PEI+17.5 μL DMEM was used for transfection of each well. Fluorescence images and EGFP expression analysis were performed 48 hours post transfection following previously mentioned protocols..sup.39 Fluorescence readings were collected in a 96-well plate using a SpectraMAX M5 (Molecular Devices) (ex=488 nm and em=510 nm). Mean of four independent experiments were reported, and error bars represent standard deviation.

[0098] For EGFP protein purification incorporating one ncAA, HEK293T cells were seeded in 100 mm cell culture dishes (5 million per dish) 24 hours prior to transfection.

[0099] CETSA assay: For aaRS expression, TOP10 E. coli cells were transformed with a single pET22b-N-terminal-10×-Histidine tagged-aaRS plasmid. Overnight cultures were inoculated with a single colony, then used to inoculate 20 mL LB Media cultures with the appropriate antibiotics, grown to an OD600 of 0.6, and induced with IPTG (final concentration of 1 mM) for 15 minutes at 30° C. with shaking. The cultures were then spun down, the LB Media was removed, and the cell pellets were resuspended in 500 μL of sonication buffer (100 mM NaCl, 25 mM Tris HCl, pH 8.0).

[0100] For lysate preparation, the cell pellets were treated to three freeze thaw cycles followed by three cycles of sonication (75% power, 20 pulses), spun down, and the supernatant was collected. Each supernatant was divided into 50 μL aliquots and heated at varying temperatures for 5 minutes on a Perkin Elmer Cetus DNA Thermal Cycler 480 and spun down at maximum speed for 10 minutes. Then 3 μL of the supernatant was inoculated on a nitrocellulose membrane and treated to western blot analysis following previously described protocols..sup.39 Antibodies used for imaging include: mouse anti-Histidine 6× tag (SEQ ID NO: 3) antibody (1:1000 dilution), chicken anti-mouse IgG secondary antibody-HRP conjugate (1:5000 dilution).

[0101] Solubility Western: DH10B cells were transformed with a pET22b-N-term-10×-His-aaRS plasmid and an overnight 5 mL culture was inoculated with a starter colony. A 20 mL culture was then inoculated and grown to an OD600 of 0.6, allowed to grow for 4 hours at 30° C., spun down, and lysed by sonication following the same protocol as the aforementioned CETSA assay. This was resolved using 12% SDS-PAGE gel and worked up for a western following previously described protocols..sup.4 The antibodies used for this protocol were the same as those for the CETSA assay.

[0102] Primers and Other DNA Sequences:

TABLE-US-00004 EcYRS NdeI-F (SEQ ID NO: 5) TTTGAGGAATCCCATATGGCAAGCAGTAACTTGATT AAACAATTGCAAGAG EcYRS NcoI-R (SEQ ID NO: 6) AATTCCATGGTTATTTCCAGCAAATCAGACACTAATTC GsYRS NdeI-F (SEQ ID NO: 7) ATTATTATGAATCCCATATGATGGACCTGCTGGCGG AACTGCAATG pBK MCS JI sq-R (SEQ ID NO: 8) GAGATCATGTAGGCCTGATAAGCGTAGC H2 EcYRS-IR (SEQ ID NO: 9) GCGATCGGACGGTGACCCGCCTGCTGGAAGCGTTTC AGGCATAACAATG H2 Gs YRS-iF (SEQ ID NO: 10) CCTGAAACGCTTCCAGCAGGCGGGTCACCGTCCGATC GCGCTGGTTG H6 EcYRS-IR (SEQ ID NO: 11) CCGCTTTCGGTTTTGCCAAATTTGGTGCCATCTGCT TTAGTGATCAGCGGAACG H6 GsYRS-iF (SEQ ID NO: 12) CACTAAAGCAGATGGCACCAAATTTGGCAAAACCGA AAGCGGTACCATTTG EcYRS NheI-F (SEQ ID NO: 13) TTTGAGGAATCCGCTAGCGCAAGCAGTAACTTGATT AAACAATTGCAAGAG EcYRS XhoI-R (SEQ ID NO: 14) AATTCTCGAGTTATTTCCAGCAAATCAGACACTAATTC GsYRS NheI-F (SEQ ID NO: 15) AATAATGCTAGCATGGACCTGCTGGCG GsYRS XhoI-R (SEQ ID NO: 16) AATTCTCGAGTTACGCATAACGAATCAGATAGTATTTC EcYRS-nterm 10XHis-NdeI-F (SEQ ID NO: 17) GAAATTACATATGCATCATCACCATCACCATCATCA TCATCACGCAAGCAGTAACTTGATTAAACAATTGCA AGAG EcYRS-HindIII-R (SEQ ID NO: 18) AATTAAGCTTTTATTTCCAGCAAATCAGACACTAATTC GsYRS-nterm10XHis-NdeI-F (SEQ ID NO: 19) GAAATTACATATGCATCATCACCATCACCATCATCA TCATCACGACCTGCTGGCGGAACTGCAATGG GsYRS-HindIII-R (SEQ ID NO: 20) AATTAAGCTTTTACGCATAACGAATCAGATAGTATTTC MjYRS-nterm 10XHis-NdeI-F (SEQ ID NO: 21) GAAATTACATATGCATCATCACCATCACCATCATCA TCATCACgacgaatttgaaatgataaagagaaacacatctg MjYRS-HindIII-R (SEQ ID NO: 22) AATTAAGCTTTTATAATCTCTTTCTAATTGGCTCTA AAATC GeobacYRS-Y34G-R (SEQ ID NO: 23) GCTATCCGCGGTCGGGTCGAAACCGCAACCCAGGGT CACACGTTCCTCGTTCAGC GeobacYRS-D176G-R (SEQ ID NO: 24) CAGCCTTCGGTTTCGTACAGACGCAGGAAACCATAC GCTTGCAGCATCATGTAGCTAAAC GeobacYRS-GGFL-L180A-R (SEQ ID NO: 25) CAGACGGCAGCCTTCGGTTTCGTAGGCACGCAGGAA ACCATACGCTTG GeobacYRS-D176G-F (SEQ ID NO: 26) GTTTAGCTACATGATGCTGCAAGCGTATGGTTTCCT GCGTCTGTACGAAACCGAAGGCTG GeobacYRS-GGFL-L180A-F (SEQ ID NO: 27) CAAGCGTATGGTTTCCTGCGTGCCTACGAAACCGAA GGCTGCCGTCTG gBlock sequence of G. stearothermophilus tyrosyl aminoacyl-tRNA synthetase (SEQ ID NO: 28) ATGGCGAGCAGCGACCTGCTGGCGGAACTGCAATGG CGTGGCCTGGTTAATCAGACCACCGACGAAGATGGC CTGCGTAAACTGCTGAACGAGGAACGTGTGACCCTG TATTGCGGTTTCGACCCGACCGCGGATAGCCTGCAC ATCGGCAACCTGGCGGCGATTCTGACCCTGCGTCGT TTTCAGCAAGCGGGTCACCGTCCGATCGCGCTGGTT GGTGGTGCGACCGGTCTGATTGGCGACCCGAGCGGC AAGAAAAGCGAGCGTACCCTGAACGCGAAGGAAACC GTTGAAGCGTGGAGCGCGCGTATCAAAGAACAGCTG GGTCGTTTCCTGGACTTTGAGGCGGATGGCAACCCG GCGAAGATTAAAAACAACTATGACTGGATCGGTCCG CTGGATGTGATTACCTTCCTGCGTGATGTGGGCAAG CACTTTAGCGTTAACTACATGATGGCGAAAGAGAGC GTTCAGAGCCGTATCGAAACCGGTATTAGCTTCACC GAGTTTAGCTACATGATGCTGCAAGCGTATGACTTC CTGCGTCTGTACGAAACCGAAGGCTGCCGTCTGCAG ATCGGTGGCAGCGATCAATGGGGTAACATCACCGCG GGCCTGGAACTGATTCGTAAGACCAAAGGTGAAGCG CGTGCGITTGGCCTGACCATCCCGCTGGTGACCAAA GGAGAAAACCAGCCCGTACGAATTCTATCAGTTTTG GATCAACACCGACGATCGTGACGTTATTCGTTACCT GAAGTATTICACCTTTCTGAGCAAAGAGGAAATCGA AGCGCTGGAGCAGGAACTGCGIGAGGCGCCGGAAAA GCGIGCGGCGCAAAAAGCGCTGGCGGAGGAAGTGAC CAAACTGGTTCACGGTGAGGAAGCGCTGCGTCAGGC GATCCGTATTAGCGAAGCGCTGTTTAGCGGTGATAT CGCGAACCTGACCGCGGCGGAGATTGAACAAGGCTT CAAGGACGTGCCGAGCTTTGTTCACGAAGGTGGCGA TGTGCCGCTGGTTGAGCTGCTGGTTAGCGCGGGTAT CAGCCCGAGCAAACGTCAGGCGCGTGAAGACATCCA AAACGGTGCGATTTACGTGAACGGCGAGCGTCTGCA AGATGTTGGCGCGATTCTGACCGCGGAACACCGTCT GGAAGGTCGTTTTACCGTTATCCGTCGTGGCAAGAA GAAATACTATCTGATTCGTTATGCGTAA

Example 2

[0103] Construction of Tyrosyl-tRNA Synthetase Chimeric Libraries Through DNA Shuffling:

[0104] The G. stearothermophilus and E. coli TyrRS are PCR amplified using external primers that anneal ˜70 bp upstream and downstream of the target sequence. The amplified target genes are gel-purified, mixed in equimolar ratio, and were partially digested with DNASe I. The fragmented inserts were gel purified and reassembled following an established stepwise amplification protocol..sup.40 The reassembled product was then PCR amplified with a second set of primers that anneal ˜40 bp upstream and downstream of the target sequence, and cloned into a plasmid behind a constitutively active promoter.

[0105] Construction of Tyrosyl-tRNA Synthetase Chimeric Libraries Through StEP:

[0106] The G. stearothermophilus and E. coli TyrRS are PCR amplified using external primers that anneal ˜70 bp upstream and downstream of the target sequence. The amplified target genes were gel-purified, mixed at an equimolar ratio, and PCR amplified with Taq-polymerase for 80 cycles (short low-temperature cycles, such as 5 s at 55° C.) with a second set of primers that anneal ˜40 bp upstream and downstream of the target sequence..sup.41 During this amplification, short stretches of the sequences are generated, which can reanneal to a different template in the following cycle, resulting in chimeric constructs. The resulting chimeric constructs were cloned into a plasmid behind a constitutively active promoter.

[0107] Construction and Selection of aaRS-GFPmut3 Fusion Fluorescence Reporter Construct:

[0108] The library of chimeric TyrRS mutants are first selected for activity. This selection uses the ability of the active TyrRS mutants to enable the expression of a TAG-inactivated antibiotic resistance gene (such as ampicillin or chloramphenicol) and allow the host survive the corresponding antibiotic treatment. Next, the library of active chimeric TyrRS mutants was PCR amplified and fused with a GFP reporter (e.g., the GFPmut3 reporter) using overlap-extension PCR. The full-length fusion insert.sup.42 was cloned into a plasmid under a strong and inducible promoter such as T5-lac. The resulting plasmid library is then transformed into E. coli cells and the chimeric proteins are expressed. Those with lower stability would render the fused GFP non-fluorescent, while the stable variants will keep the GFP fluorescent. A FACS selection is then used to enrich the most stable and active mutants. Isolated mutants are individually screened for both their stability and activity.

REFERENCES

[0109] The following references are herein incorporated by reference in their entirety. [0110] [1] Chin, J. W. (2017) Expanding and reprogramming the genetic code, Nature 550, 53. [0111] [2] Dumas, A., Lercher, L., Spicer, C. D., and Davis, B. G. (2015) Designing logical codon reassignment-Expanding the chemistry in biology, Chemical Science 6, 50-69. [0112] [3] Italia, J. S., Zheng, Y., Kelemen, R. E., Erickson, S. B., Addy, P. S., and Chatterjee, A. (2017) Expanding the genetic code of mammalian cells, Biochemical Society transactions 45, 555-562. [0113] [4] Mukai, T., Lajoie, M. J., Englert, M., and Söll, D. (2017) Rewriting the genetic code, Annual review of microbiology 71, 557-577. [0114] [5] Young, D. D., and Schultz, P. G. (2018) Playing with the molecules of life, ACS chemical biology. [0115] [6] Vargas-Rodriguez, O., Sevostyanova, A., Söll, D., and Crnković, A. (2018) Upgrading aminoacyl-tRNA synthetases for genetic code expansion, Current opinion in chemical biology 46, 115-122. [0116] [7] Italia, J. S., Addy, P. S., Wrobel, C. J., Crawford, L. A., Lajoie, M. J., Zheng, Y., and Chatterjee, A. (2017) An orthogonalized platform for genetic code expansion in both bacteria and eukaryotes, Nature chemical biology 13, 446-450. [0117] [8] Chin, J. W., Cropp, T. A., Anderson, J. C., Mukherji, M., Zhang, Z., and Schultz, P. G. (2003) An expanded eukaryotic genetic code, Science 301, 964-967. [0118] [9] Sakamoto, K., Hayashi, A., Sakamoto, A., Kiga, D., Nakayama, H., Soma, A., Kobayashi, T., Kitabatake, M., Takio, K., and Saito, K. (2002) Site-specific incorporation of an unnatural amino acid into proteins in mammalian cells, Nucleic acids research 30, 4692-4699. [0119] [10] Chatterjee, A., Xiao, H., Bollong, M., Ai, H. W., and Schultz, P. G. (2013) Efficient viral delivery system for unnatural amino acid mutagenesis in mammalian cells, Proceedings of the National Academy of Sciences of the United States of America 110, 11803-11808. [0120] [11] Zheng, Y., Addy, P. S., Mukherjee, R., and Chatterjee, A. (2017) Defining the current scope and limitations of dual noncanonical amino acid mutagenesis in mammalian cells, Chem Sci 8, 7211-7217. [0121] [12] Zheng, Y., Lewis, T. L., Jr., Igo, P., Polleux, F., and Chatterjee, A. (2017) Virus-Enabled Optimization and Delivery of the Genetic Machinery for Efficient Unnatural Amino Acid Mutagenesis in Mammalian Cells and Tissues, ACS synthetic biology 6, 13-18. [0122] [13] Italia, J. S., Latour, C., Wrobel, C. J., and Chatterjee, A. (2018) Resurrecting the bacterial tyrosyl-tRNA Synthetase/tRNA pair for expanding the genetic code of both E. coli and eukaryotes, Cell chemical biology 25, 1304-1312. e1305. [0123] [14] Dugan, A., Majmudar, C. Y., Pricer, R., Niessen, S., Lancia, J. K., Fung, H. Y.-H., Cravatt, B. F., and Mapp, A. K. (2016) Discovery of enzymatic targets of transcriptional activators via in vivo covalent chemical capture, Journal of the American Chemical Society 138, 12629-12635. [0124] [15] Krishnamurthy, M., Dugan, A., Nwokoye, A., Fung, Y.-H., Lancia, J. K., Majmudar, C. Y., and Mapp, A. K. (2011) Caught in the act: Covalent cross-linking captures activator-coactivator interactions in vivo, ACS chemical biology 6, 1321-1326. [0125] [16] Hino, N., Okazaki, Y., Kobayashi, T., Hayashi, A., Sakamoto, K., and Yokoyama, S. (2005) Protein photo-cross-linking in mammalian cells by site-specific incorporation of a photoreactive amino acid, Nature methods 2, 201. [0126] [17] Wilkins, B. J., Rall, N. A., Ostwal, Y., Kruitwagen, T., Hiragami-Hamada, K., Winkler, M., Barral, Y., Fischle, W., and Neumann, H. (2014) A cascade of histone modifications induces chromatin condensation in mitosis, Science 343, 77-80. [0127] [18] Tokuriki, N., and Tawfik, D. S. (2009) Stability effects of mutations and protein evolvability, Current opinion in structural biology 19, 596-604. [0128] [19] Tokuriki, N., and Tawfik, D. S. (2009) Protein dynamism and evolvability, Science 324, 203-207. [0129] [20] Socha, R. D., and Tokuriki, N. (2013) Modulating protein stability-directed evolution strategies for improved protein function, The FEBS journal 280, 5582-5595. [0130] [21] Trudeau, D. L., and Tawfik, D. S. (2019) Protein engineers turned evolutionists—the quest for the optimal starting point, Current opinion in biotechnology 60, 46-52. [0131] [22] Martinez Molina, D., and Nordlund, P. (2016) The cellular thermal shift assay: a novel biophysical assay for in situ drug target engagement and mechanistic biomarker studies, Annual review of pharmacology and toxicology 56, 141-161. [0132] [23] Martinez, D. M., Jafari, R., Ignatushchenko, M., Seki, T., Larsson, E. A., Dan, C., Sreekumar, L., Cao, Y., and Nordlund, P. (2013) Monitoring drug target engagement in cells and tissues using the cellular thermal shift assay, Science (New York, N.Y.) 341, 84-87. [0133] [24] Chin, J. W., Martin, A. B., King, D. S., Wang, L., and Schultz, P. G. (2002) Addition of a photocrosslinking amino acid to the genetic code of Escherichia coli, Proceedings of the National Academy of Sciences 99, 11020-11024. [0134] [25] Young, D. D., Young, T. S., Jahnz, M., Ahmad, I., Spraggon, G., and Schultz, P. G. (2011) An evolved aminoacyl-tRNA synthetase with atypical polysubstrate specificity, Biochemistry 50, 1894-1900. [0135] [26] Guez-Ivanier, V., Hermann, M., Baldwin, D., and Bedouelle, H. (1993) Mapping the stability determinants of bacterial tyrosyl transfer RNA synthetases by an experimental evolutionary approach, Journal of molecular biology 234, 209-221. [0136] [27] Laowanapiban, P., Kapustina, M., Vonrhein, C., Delarue, M., Koehl, P., and Carter, C. W., Jr. (2009) Independent saturation of three TrpRS subsites generates a partially assembled state similar to those observed in molecular simulations, Proceedings of the National Academy of Sciences of the United States of America 106, 1790-1795. [0137] [28] Sakurama, H., Takita, T., Mikami, B., Itoh, T., Yasukawa, K., and Inouye, K. (2009) Two crystal structures of lysyl-tRNA synthetase from Bacillus stearothermophilus in complex with lysyladenylate-like compounds: insights into the irreversible formation of the enzyme-bound adenylate of L-lysine hydroxamate, Journal of biochemistry 145, 555-563. [0138] [29] Brick, P., Bhat, T. N., and Blow, D. M. (1989) Structure of tyrosyl-tRNA synthetase refined at 2.3 A resolution. Interaction of the enzyme with the tyrosyl adenylate intermediate, J Mol Biol 208, 83-98. [0139] [30] Wolf-Watz, M., Thai, V., Henzler-Wildman, K., Hadjipavlou, G., Eisenmesser, E. Z., and Kern, D. (2004) Linkage between dynamics and catalysis in a thermophilic-mesophilic enzyme pair, Nature structural & molecular biology 11, 945. [0140] [31] Li, Y., Drummond, D. A., Sawayama, A. M., Snow, C. D., Bloom, J. D., and Arnold, F. H. (2007) A diverse family of thermostable cytochrome P450s created by recombination of stabilizing fragments, Nature biotechnology 25, 1051. [0141] [32] Jermutus, L., Tessier, M., Pasamontes, L., van Loon, A. P., and Lehmann, M. (2001) Structure-based chimeric enzymes as an alternative to directed enzyme evolution: phytase as a test case, Journal of biotechnology 85, 15-24. [0142] [33] Zheng, Y., Mukherjee, R., Chin, M. A., Igo, P., Gilgenast, M. J., and Chatterjee, A. (2017) Expanding the scope of single- and double-noncanonical amino acid mutagenesis in mammalian cells using orthogonal polyspecific leucyl-tRNA synthetases, Biochemistry 57, 441-445. [0143] [34] Chatterjee, A., Xiao, H., Yang, P. Y., Soundararajan, G., and Schultz, P. G. (2013) A Tryptophanyl-tRNA Synthetase/tRNA Pair for Unnatural Amino Acid Mutagenesis in E. coli, Angewandte Chemie International Edition 52, 5106-5109. [0144] [35] Wu, N., Deiters, A., Cropp, T. A., King, D., and Schultz, P. G. (2004) A genetically encoded photocaged amino acid, Journal of the American Chemical Society 126, 14306-14307. [0145] [36] J. S. Italia, C. Latour, C. J. J. Wrobel, A. Chatterjee, Cell Chem. Biol, 2018, 25, 1304-1312. [0146] [37] J. W. Chin, A. B. Martin, D. S. King, L. Wang, P. G. Schultz, Proc. Natl. Acad Sci. U.S.A., 2002, 99, 11020-11024. [0147] [38] V. Guez-Ivanier, M. Hermann, D. Baldwin, H. Bedouelle, J. Mol. Biol., 1993, 234, 209-221. [0148] [39] Y. Zheng, T. L. Lewis, P. Igo, F. Polleux, A. Chatterjee, ACS Synth. Biol, 2017, 6, 13-18. [0149] [40] A. J. Meyer, J. W. Ellefson, A. D. Ellington, Curr Protoc Mol Biol., 2015, 105, Unit-15.12. [0150] [41] H. Zhao, W. Zha, Nature Protocols, 2006, 1, 1865-1871. [0151] [42] E. E. Wrenbeck, M. A. Bedewitz, J. R. Klesmith, S. Noshin, C. S. Barry, T. A. Whitehead, ACS Synth. Biol., 2019, 8, 3, 474-481.

[0152] While this invention has been particularly shown and described with references to preferred embodiments thereof, it will be understood by those skilled in the art that various changes in form and details may be made therein without departing from the scope of the invention encompassed by the appended claims.