Mutant of Glutamate Dehydrogenase Gene Promoter and Application Thereof

Abstract

Provided are a mutant of a Corynebacterium glutamicum glutamate dehydrogenase gene promoter and applications thereof. The mutant has improved promoter activity compared to a wild-type promoter. Hence, it can be used to enhance the expression of a target gene, for example, operably ligating the mutant with a glutamate dehydrogenase gene, and the expression intensity of the glutamate dehydrogenase can be enhanced, thereby improving the amino acid production efficiency of a recombinant strain.

Claims

1. A mutant of a glutamate dehydrogenase gene promoter of Corynebacterium glutamicum, wherein the mutant is any one selected from the group consisting of the following (i) to (iv): (i) a nucleotide sequence of the mutant having one or more bases mutated at a position corresponding to positions 479 to 482 of SEQ ID NO: 30, and having one or more bases mutated at a position corresponding to positions 499 to 501 of SEQ ID NO: 30; (ii) comprising a reverse complementary sequence to the nucleotide sequence set forth in (i); (iii) comprising a reverse complementary sequence to a sequence capable of hybridizing with the nucleotide sequence set forth in (i) or (ii) under high-stringent hybridization conditions or very high-stringent hybridization conditions; and (iv) a nucleotide sequence having at least 90% sequence identity to the nucleotide sequence set forth in (i) or (ii), wherein the nucleotide sequence of the mutant set forth in any one of (i) to (iv) is not aattctttgtggtcatatctgtgcgacactgccataattgaacgtg at positions corresponding to position 469 to position 514 of the sequence set forth in SEQ ID NO: 30; and the mutant set forth in any one of (i) to (iv) has an enhanced promoter activity as compared to a glutamate dehydrogenase gene promoter having the sequence set forth in SEQ ID NO: 30.

2. The mutant of the glutamate dehydrogenase gene promoter according to claim 1, wherein the mutant has an enhanced promoter activity of 2 to 47 folds or more as compared to the glutamate dehydrogenase gene promoter having the sequence set forth in SEQ ID NO: 30.

3. The mutant of the glutamate dehydrogenase gene promoter according to claim 1, wherein a nucleotide sequence of a promoter core region of the mutant is one of the following sequences: TABLE-US-00008 (1) aattctttgtcagtatatctgtgcgacactggtataattgaacgtg; (2) aattctttgtctagatatctgtgcgacactggtataattgaacgtg; (3) aattctttgtgcctatatctgtgcgacactgatataattgaacgtg; (4) aattctttgtatttatatctgtgcgacactgttataattgaacgtg; (5) aattctttgtccgtatatctgtgcgacactggtataattgaacgtg; (6) aattctttgtgcatatatctgtgcgacactgatataattgaacgtg; (7) aattctttgtcggcatatctgtgcgacactggtataattgaacgtg; (8) aattctttgtagaaatatctgtgcgacacttttataattgaacgtg; (9) aattctttgtgcacatatctgtgcgacactgatataattgaacgtg; (10) aattctttgtggatatatctgtgcgacactactataattgaacgtg; (11) aattctttgtagttatatctgtgcgacactgttataattgaacgtg; (12) aattctttgtcccgatatctgtgcgacactggtataattgaacgtg; (13) aattctttgtgccgatatctgtgcgacactgttataattgaacgtg; (14) aattctttgtcgagatatctgtgcgacactgctataattgaacgtg; (15) aattctttgtactaatatctgtgcgacactgctataattgaacgtg; (16) aattctttgttgtgatatctgtgcgacactcgtataattgaacgtg; (17) aattctttgtgtaaatatctgtgcgacactggtataattgaacgtg; (18) aattctttgtcgcgatatctgtgcgacactgctataattgaacgtg; (19) aattctttgtatacatatctgtgcgacactgatataattgaacgtg; (20) aattctttgttgttatatctgtgcgacactgttataattgaacgtg; (21) aattctttgtggctatatctgtgcgacactgctataattgaacgtg; (22) aattctttgttgatatatctgtgcgacactcgtataattgaacgtg; (23) aattctttgttgcaatatctgtgcgacacttatataattgaacgtg; (24) aattctttgtggcaatatctgtgcgacactagtataattgaacgtg; (25) aattctttgttgaaatatctgtgcgacacttgtataattgaacgtg; (26) aattctttgtttgcatatctgtgcgacactgatataattgaacgtg; (27) aattctttgtcgatatatctgtgcgacactgctataattgaacgtg; (28) aattctttgttgagatatctgtgcgacactgttataattgaacgtg; and (29) aattctttgtggcgatatctgtgcgacacttgtataattgaacgtg.

4. The mutant of the glutamate dehydrogenase gene promoter according to claim 1, wherein the nucleotide sequence of the mutant is set forth in any one of SEQ ID NO: 1 to SEQ ID NO: 29.

5. An expression cassette, comprising the mutant of the glutamate dehydrogenase gene promoter according to claim 1.

6. An expression vector, comprising the mutant of the glutamate dehydrogenase gene promoter according to claim 1.

7. A recombinant host cell, comprising the mutant of the glutamate dehydrogenase gene promoter according to claim 1.

8. The recombinant host cell according to claim 7, wherein the host cell is genus Enterobacter or genus Corynebacterium.

9. A method of enhancing a transcriptional level of a gene or preparing a reagent or kit for enhancing a transcriptional level of a gene, which comprises utilizing the mutant of the glutamate dehydrogenase gene promoter according to claim 1.

10. A method of producing a target product or preparing a reagent or kit for use in the production of a target product, which comprises utilizing the mutant of the glutamate dehydrogenase gene promoter according to claim 1, wherein the target product is selected from at least one of amino acids and derivatives thereof.

11. A method for enhancing expression of a target gene, the method comprising operably ligating the mutant of the glutamate dehydrogenase gene promoter according to claim 1 to a target RNA or a target gene.

12. A method for preparing a protein, wherein the method comprises a step of expressing the protein using the expression cassette according to claim 5, wherein the protein is a target product synthesis-associated protein, a membrane transport-associated protein, or a gene expression regulatory protein; and a step of isolating or purifying the protein.

13. A method for producing a target product, wherein the method comprises culturing a host cell containing the mutant of the glutamate dehydrogenase gene promoter according to claim 1 that is operably ligated to a target product synthesis-associated gene, and collecting the target product produced; wherein the target product is an amino acid.

14. The recombinant host cell according to claim 8, wherein the genus Corynebacterium is selected from the group consisting of Corynebacterium glutamicum ATCC 13032, Corynebacterium glutamicum ATCC 13869, Corynebacterium glutamicum B253, Corynebacterium glutamicum ATCC 14067, and derived strains thereof.

15. A method of preparing a protein or preparing a reagent or kit for use in the preparation of a protein, which comprises utilizing the mutant of the glutamate dehydrogenase gene promoter according to claim 1, wherein the protein is a target product synthesis-associated protein, a membrane transport-associated protein, or a gene expression regulatory protein.

16. The method according to claim 10, wherein the amino acids and derivatives thereof are one or a combination of two or more selected from: proline, hydroxyproline, lysine, glutamic acid, arginine, ornithine, glutamine, threonine, glycine, alanine, valine, leucine, isoleucine, serine, cysteine, methionine, aspartic acid, asparagine, histidine, phenylalanine, tyrosine, tryptophan, 5-aminolevulinic acid, or derivatives of any one of the amino acids described above.

17. The method according to claim 11, wherein the target RNA comprises at least one of tRNA or sRNA, and the target gene comprises at least one of a coding gene of a target product synthesis-associated protein, a coding gene of a gene expression regulatory protein, or a coding gene of a membrane transport-associated protein.

18. The method according to claim 11, wherein the target gene comprises at least one of the following coding genes of enzymes: glutamate dehydrogenase gdh gene, aspartate kinase lysC gene, threonine operon thrABC gene, aspartate-semialdehyde dehydrogenase asd gene, aspartate-ammonia lyase aspB gene, homoserine dehydrogenase hom gene, homoserine O-acetyltransferase metX gene, dihydrodipicolinate synthase dapA gene, dihydrodipicolinate reductase dapB gene, meso-diaminopimelate dehydrogenase ddh gene, glutamate kinase proB gene, glutamate-5-semialdehyde dehydrogenase proA gene, pyrroline-5-carboxylate dehydrogenase proC gene, proline dehydrogenase/pyrroline-5-carboxylate dehydrogenase putA gene, glutamyl-t-RNA reductase hemA gene, pyruvate carboxylase pyc gene, phosphoenolpyruvate carboxylase ppc gene, amino acid transport protein lysE gene, ptsG system-associated coding gene, pyruvate dehydrogenase aceE gene, glyceraldehyde-3-phosphate dehydrogenase gapN gene, and lysine decarboxylase cadA/ldcC gene.

19. The method according to claim 13, wherein the target product synthesis-associated gene is a gene associated with synthesis of the amino acid or derivatives thereof; wherein the amino acid or derivatives thereof is selected from one or more of: proline, hydroxyproline, lysine, glutamic acid, arginine, ornithine, glutamine, threonine, glycine, alanine, valine, leucine, isoleucine, serine, cysteine, methionine, aspartic acid, asparagine, histidine, phenylalanine, tyrosine, tryptophan, 5-aminolevulinic acid, or derivatives of any one of the amino acids described above.

Description

BRIEF DESCRIPTION OF THE DRAWINGS

[0088] FIG. 1: Plasmid vector map of pEC-XK99E-Pgdh-rfp plasmid.

[0089] FIG. 2: Fluorescent screening plate of gdh promoter mutants.

DETAILED DESCRIPTION

Definitions of Terms

[0090] When used in combination with the term “including” in the claims and/or specification, the word “a” or “an” may refer to “one”, or refer to “one or more”, “at least one”, and “one or more than one”.

[0091] As used in the claims and specification, the term “including”, “having”, “comprising”, or “containing” is intended to be inclusive or open-ended, and does not exclude additional or unrecited elements or methods and steps.

[0092] Throughout the application document, the term “about” means that a value includes the error or standard deviation caused by the device or method used to measure the value.

[0093] It is applicable to the content disclosed herein that the term “or” is defined only as alternatives and “and/or”, but the term “or” used herein refers to “and/or” unless otherwise expressly stated to be only alternatives or mutual exclusion between alternatives.

[0094] The selected/optional/preferred “numerical range”, when used in the claims or the specification, includes not only the numerical endpoints at both ends of the range, but also all natural numbers covered between the above numerical endpoints with respect to these numerical endpoints.

[0095] As used herein, the term “nucleic acid molecule” or “polynucleotide” refers to a polymer composed of nucleotides. A nucleic acid molecule or polynucleotide may be in the form of an individual fragment, or may be a constituent part of a larger nucleotide sequence structure, which is derived from the nucleotide sequence that has been isolated at least once in number or concentration, and could be recognized, operated, and sequence recovered as well as nucleotide sequence recovered by a standard molecular biological method (e.g., using a cloning vector). When a nucleotide sequence is represented by a DNA sequence (i.e., A, T, G, C), it also includes an RNA sequence (i.e., A, U, G, C), where “U” substitutes for “T”. In other words, “polynucleotide” refers to a nucleotide polymer knocked out from an additional nucleotide (an individual fragment or an entire fragment), or may be a constituent part or component of a larger nucleotide structure, such as an expression vector or a polycistronic sequence. Polynucleotides include DNA, RNA, and cDNA sequences.

[0096] As used herein, the terms “target gene” and “gene of interest” can be used interchangeably.

[0097] As used herein, the term “wild-type” refers to an object that can be found in nature. For example, a polypeptide or a polynucleotide sequence present in an organism that can be isolated from one source in nature and has not been intentionally modified by human in the laboratory is naturally occurring. As used herein, “naturally occurring” and “wild-type” are synonymous.

[0098] As used herein, the terms “sequence identity” and “percent identity” refer to the percentage of nucleotides or amino acids that are the same (i.e., identical) between two or more polynucleotides or polypeptides. The sequence identity between two or more polynucleotides or polypeptides may be determined by aligning the nucleotide sequences of polynucleotides or the amino acid sequences of polypeptides and scoring the number of positions at which nucleotide or amino acid residues are identical in the aligned polynucleotides or polypeptides, and comparing the number of these positions with the number of positions at which nucleotide or amino acid residues are different in the aligned polynucleotides or polypeptides. Polynucleotides may differ at one position by, e.g., containing a different nucleotide (i.e., substitution or mutation) or deleting a nucleotide (i.e., insertion or deletion of a nucleotide in one or two polynucleotides). Polypeptides may differ at one position by, e.g., containing a different amino acid (i.e., substitution or mutation) or deleting an amino acid (i.e., insertion or deletion of an amino acid in one or two polypeptides). The sequence identity may be calculated by dividing the number of positions at which nucleotide or amino acid residues are identical by the total number of nucleotide or amino acid residues in the polynucleotides or polypeptides. For example, the percent identity may be calculated by dividing the number of positions at which nucleotide or amino acid residues are identical by the total number of nucleotide or amino acid residues in the polynucleotides or polypeptides, and multiplying the result by 100.

[0099] In some embodiments, two or more sequences or subsequences, when compared and aligned at maximum correspondence by the sequence alignment algorithm or by the visual inspection measurement, have at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% “sequence identity” or “percent identity” of nucleotides. In some embodiments, the sequence is substantially identical over the full length of either or both of the compared biopolymers (e.g., polynucleotides).

[0100] As used herein, the term “complementary” refers to hybridization or base pairing between nucleotides or nucleotides, e.g., between two chains of a double-stranded DNA molecule or between an oligonucleotide primer and a primer binding site on a single-stranded nucleotide to be sequenced or amplified.

[0101] As used herein, the term “high-stringent conditions” means that following the standard DNA blotting procedures, a probe of at least 100 nucleotides in length pre-hybridizes or hybridizes for 12 to 24 hours at 42° C. in 5×SSPE (saline sodium phosphate EDTA), 0.3% SDS, 200 μg/ml of cleavaged and denatured salmon sperm DNA, and 50% formamide. Finally, the vector material is washed three times at 65° C. with 2×SSC and 0.2% SDS, each for 15 min.

[0102] As used herein, the term “very high-stringent conditions” means that following the standard DNA blotting procedures, a probe of at least 100 nucleotides in length pre-hybridizes or hybridizes for 12 to 24 hours at 42° C. in 5×SSPE (saline sodium phosphate EDTA), 0.3% SDS, 200 μg/ml of cleavage and denatured salmon sperm DNA, and 50% formamide. Finally, the vector material is washed three times at 70° C. with 2×SSC and 0.2% SDS, each for 15 min.

[0103] Unless otherwise defined, all technical and scientific terms used herein have the same meanings as typically understood by one of ordinary skill in the art to which the present disclosure belongs. Although any methods and materials similar or equivalent to those described herein may be used to implement or test the present disclosure, the methods and materials described herein are preferred.

[0104] The present disclosure will be further illustrated with reference to specific examples. It should be appreciated that these examples are merely intended to illustrate the present disclosure and are not intended to limit the scope of the present disclosure. The experimental techniques and experimental methods used in the examples, unless otherwise specified, are all conventional techniques and methods, for example, experimental methods for which no specific conditions are indicated in the following examples are generally performed according to conventional conditions such as those described by Sambrook et al., Molecular Cloning: A Laboratory Manual (New York: Cold Spring Harbor Laboratory Press, 1989), or those recommended by manufacturers. The materials, reagents, etc. used in the examples, unless otherwise specified, are all commercially available.

Example 1. Construction of Plasmid Characterizing the Strength of Gdh Gene Promoter of Corynebacterium glutamicum

[0105] In order to characterize the strength of the gdh gene promoter of Corynebacterium glutamicum, the present disclosure firstly constructed a characterizing vector, and based on the pEC-XK99E plasmid skeleton, 60 amino acids at the N-terminus of the gdh gene, a C-peptide, and a red fluorescence protein gene were expressed by the gdh gene promoter. Based on the disclosed genome sequence and gdh gene annotation information of Corynebacterium glutamicum ATCC13032, a primer gdh-FIR was designed, and a 180-bp DNA fragment of the gdh gene promoter along with the N-terminus was obtained by PCR amplification using the ATCC13032 genome as a template. The pEC-XK99E-rfp.sup.[5] plasmid reported in the literature was used as a template and pEC-F/R as a primer to amplify the DNA fragment of the pEC-XK99E plasmid skeleton, the C-peptide, along with the red fluorescence protein gene. The above two fragments were ligated via Vazyme's One Step Cloning Kit to obtain a pEC-XK99E-Pgdh-rfp characterizing vector, and its plasmid vector map was shown in FIG. 1. The sequences of the primers as used above were listed in Table 1.

TABLE-US-00002 TABLE 1 Primer Nucleotide Sequence SEQ ID NO. gdh-F CCTGATGCGGTATTTTCTCCGTGTCA SEQ ID NO: 31 GTATGCCTTTCTGTTATGG gdh-R CTGACGCTCAGGCTCGCACAG SEQ ID NO: 32 pEC-F TGTGCGAGCCTGAGCGTCAGGGCGGT SEQ ID NO: 33 GGCTCTGGAGGTGGTGGGTCCGGCGG TGGCTCTGCTTCCTCCGAAGACGTTA TCAAAG pEC-R GGAGAAAATACCGCATCAGGC SEQ ID NO: 34

Example 2. Screening and Strength Characterization of Gdh Gene Promoter Mutants of Corynebacterium glutamicum

[0106] (1) Construction of Library of Gdh Gene Promoter Mutants of Corynebacterium glutamicum

[0107] The present disclosure performed mutations on the core region of the gdh gene promoter of Corynebacterium glutamicum “AATTCTTTGTGGTCATATCTGTGCGACACTGCCATAATTGAACGTG”, where the underlined parts were the main sequences of the −35 region and the −10 region of the promoter. The present disclosure performed mutations on the corresponding positions of the above core region, obtaining “AATTCTTTGTNNNNATATCTGTGCGACACTNNNATAATTGAACGTG”. The two fragments of the plasmid were amplified using gdh-M1/M2 and gdh-M3/M4 primers respectively, and ligated via Vazyme's One Step Cloning Kit. All of the resulting cloned bacteria were collected and plasmids were extracted to obtain a library of the gdh gene promoter mutants. The above library and the wild-type control pEC-XK99E-Pgdh-rfp obtained in Example 1 were transformed into Corynebacterium glutamicum ATCC13032 respectively, and coated on a TSB plate. The plate, on which hundreds of clones were grown, was fluorescence photographed with a fluorescence imaging system. Mutants with improved expression intensity were preliminarily screened according to the fluorescence brightness of the clones. The ingredients (g/L) of the medium of the TSB plate were as follows: glucose, 5 g/L; yeast powder, 5 g/L; soy peptone, 9 g/L; urea, 3 g/L; succinic acid, 0.5 g/L; K.sub.2HPO.sub.4.Math.3H.sub.2O, 1 g/L; MgSO.sub.4.Math.7H.sub.2O, 0.1 g/L; biotin, 0.01 mg/L; vitamin B1, 0.1 mg/L; MOPS, 20 g/L; and agar powder, 15 g/L. The present disclosure performed initial screening on more than 10,000 clones, and about 40 mutants with enhanced fluorescence intensity were obtained (the screening plate was as shown in FIG. 2). The sequences of the primers as used above were listed in Table 2.

TABLE-US-00003 TABLE 2 Primer Nucleotide Sequence SEQ ID NO. gdh-M1 CGCGTTTTGGCGATACAAAATTGATAA SEQ ID NO: 35 ACCTAAAGAAATTTTCAAACAATTTTA ATTCTTTGTNNNNATATCTGTGCGACA CTNNNATAATTGAACGTGAGCATTTAC CAGCC gdh-M2 AACCTTCCATACGAACTTTGAAACG SEQ ID NO: 36 gdh-M3 CAAAGTTCGTATGGAAGGTTCCG SEQ ID NO: 37 gdh-M4 TTTTGTATCGCCAAAACGCG SEQ ID NO: 38

[0108] (2) Strength Characterization of Library of Gdh Gene Promoter Mutants of Corynebacterium glutamicum

[0109] All mutants with the enhanced fluorescence intensity observed in the plate as described above were cultured in a 96-well plate to characterize the strength of the promoters. The ingredients (g/L) of the TSB liquid medium were as follows: glucose, 5 g/L; yeast powder, 5 g/L; soy peptone, 9 g/L; urea, 3 g/L; succinic acid, 0.5 g/L; K.sub.2HPO.sub.4.Math.3H.sub.2O, 1 g/L; MgSO.sub.4.Math.7H.sub.2O, 0.1 g/L; biotin, 0.01 mg/L; vitamin B1, 0.1 mg/L; and MOPS, 20 g/L. The strains resulting from the plate were inoculated with toothpicks into a 96-well plate containing 200 μl of TSB liquid medium in each well. Three samples were set for each strain. The rotating speed of the plate shaker was 800 rpm. After culturing at 30° C. for 24 h, the fluorescence intensities of the strains were measured, and the strains with improved fluorescence intensity as compared to the wild-type control were sequenced. The results were listed in Table 3. Some of the promoter mutants have the same sequence. Finally, the present disclosure successfully obtained 29 different promoter mutants with improved expression intensity as compared to the wild-type promoter, and the range of the increased folds was from 2.3 folds to 46.4 folds. The promoter mutants were sequentially numbered as P.sub.gdh-1 to P.sub.gdh-29, which could provide abundant elements for modifying the expression of genes such as gdh.

TABLE-US-00004 TABLE 3 Fluorescence Folds Increased Intensity Than Mutations in Mutations in Promoter No. (RFU/OD600) Wild-Type −35 Region −10 Region SEQ ID NO. WT   246 ± 11 GGTC GCC SEQ ID NO: 30 P.sub.gdh-1   821 ± 30  2.3 CAGT GGT SEQ ID NO: 1 P.sub.gdh-2   853 ± 51  2.5 CTAG GGT SEQ ID NO: 2 P.sub.gdh-3   974 ± 57  3.0 GCCT GAT SEQ ID NO: 3 P.sub.gdh-4  1007 ± 79  3.1 ATTT GTT SEQ ID NO: 4 P.sub.gdh-5  1021 ± 34  3.2 CCGT GGT SEQ ID NO: 5 P.sub.gdh-6  1047 ± 40  3.3 GCAT GAT SEQ ID NO: 6 P.sub.gdh-7  1064 ± 109  3.3 CGGC GGT SEQ ID NO: 7 P.sub.gdh-8  1075 ± 54  3.4 AGAA TTT SEQ ID NO: 8 P.sub.gdh-9  1237 ± 54  4.0 GCAC GAT SEQ ID NO: 9 P.sub.gdh-10  1252 ± 81  4.1 GGAT ACT SEQ ID NO: 10 P.sub.gdh-11  1290 ± 52  4.2 AGTT GTT SEQ ID NO: 11 P.sub.gdh-12  1313 ± 60  4.3 CCCG GGT SEQ ID NO: 12 P.sub.gdh-13  1348 ± 53  4.5 GCCG GTT SEQ ID NO: 13 P.sub.gdh-14  1352 ± 348  4.5 CGAG GCT SEQ ID NO: 14 P.sub.gdh-15  1372 ± 107  4.6 ACTA GCT SEQ ID NO: 15 P.sub.gdh-16  1556 ± 93  5.3 TGTG CGT SEQ ID NO: 16 P.sub.gdh-17  1677 ± 128  5.8 GTAA GGT SEQ ID NO: 17 P.sub.gdh-18  1987 ± 108  7.1 CGCG GCT SEQ ID NO: 18 P.sub.gdh-19  2109 ± 185  7.6 ATAC GAT SEQ ID NO: 19 P.sub.gdh-20  2170 ± 150  7.8 TGTT GTT SEQ ID NO: 20 P.sub.gdh-21  2222 ± 109  8.0 GGCT GCT SEQ ID NO: 21 P.sub.gdh-22  2245 ± 53  8.1 TGAT CGT SEQ ID NO: 22 P.sub.gdh-23  2507 ± 111  9.2 TGCA TAT SEQ ID NO: 23 P.sub.gdh-24  2650 ± 407  9.8 GGCA AGT SEQ ID NO: 24 P.sub.gdh-25  3359 ± 341 12.7 TGAA TGT SEQ ID NO: 25 P.sub.gdh-26  3519 ± 284 13.3 TTGC GAT SEQ ID NO: 26 P.sub.gdh-27  3822 ± 208 14.5 CGAT GCT SEQ ID NO: 27 P.sub.gdh-28  3916 ± 78 14.9 TGAG GTT SEQ ID NO: 28 P.sub.gdh-29 11660 ± 2358 46.4 GGCG TGT SEQ ID NO: 29

Example 3. Application of Gdh Gene Promoter Mutants of Corynebacterium glutamicum for Proline Production

[0110] (1) Evaluation of Construction of Proline-Producing Base Strain SLCgP2

[0111] It had been reported in literatures that the introduction of a G149K mutation in the glutamate kinase ProB could relieve the proline feedback inhibition, and introduction of this mutation in the genome of the Corynebacterium glutamicum ATCC13032 strain enabled production of proline. In the present disclosure, the G149K mutation was introduced in the Corynebacterium glutamicum ATCC13032 strain, and the codon was mutated from GGT to AAG, thereby obtaining a SLCgP1 strain.

[0112] The SLCgP1 strain was further applied in the present disclosure to integrate the expression cassette, which was over-expressed using the P.sub.pyc-20 promoter (the nucleotide sequence of the core region was CGGGCCTTGATTGTAAGATAAGACATTTAGTATAATTAG as set forth in SEQ ID NO: 68, and the nucleotide sequence of the promoter was set forth in SEQ ID NO: 69), of the glutamate kinase proB.sup.G149K which relieves the feedback inhibition, glutamate-5-semialdehyde dehydrogenase proA along with pyrroline-5-carboxylate dehydrogenase proC into the proline dehydrogenase/pyrroline-5-carboxylate dehydrogenase putA gene, to obtain a proline-producing strain designated as a SLCgP2 strain.

[0113] The SLCgP2 strain was specifically constructed as follows: 1) Firstly, constructing the expression cassette of proB.sup.G149K, proA, and proC along with P.sub.pyc-20 promoter on the pEC-XK99E plasmid. The P.sub.pyc-20 promoter fragment was amplified using a plasmid containing the P.sub.pyc-20 promoter as a template and pyc-a/b as primers; the fragments of proB.sup.G149K, proA, and proC were amplified using the genome of the SLCgP1 strain as a template and proB-112, proA-112, and proC-1/2 as primers, respectively; and at the same time, the pEC-XK99E skeleton was amplified using pEC-1/2 as primers. The above 5 fragments were ligated via Vazyme's One Step Cloning Kit to obtain a pEC-proB.sup.G149KproAproC plasmid. 2) Constructing a recombinant vector that inserts the above expression cassette into the putA gene on the chromosome. The upstream and downstream homologous arms inserted into the putA gene were amplified using the genome of the SCgL30-P.sub.pyc-20 strain as a template and putA-1/2 and putA-3/4 as primers, respectively; the expression cassette fragment was amplified using the pEC-proB.sup.G149KproAproC plasmid as a template and ABC-FIR as primers; and at the same time, the pK18mobsacB skeleton was amplified using pK18-1/2 as primers. The above PCR fragments were ligated via Vazyme's One Step Cloning Kit to obtain a pK18-proB.sup.G149KproAproC recombinant vector. 3) The pK18-proB.sup.G149KproAproC recombinant vector was transformed into the SLCgP1 strain. The strain was coated on an LBHIS solid medium containing 5 g/L of glucose and 25 μg/mL of kanamycin and cultured at 30° C. to obtain the first recombinant transformants. The correct first recombinant transformants were inoculated into LB media containing 5 g/L of glucose respectively, and cultured overnight. Thereafter, 1% of the culture was transferred into an LB medium containing 100 g/L of sucrose and cultured overnight at 30° C., and then coated respectively on an LB solid medium containing 100 g/L of sucrose for screening. Correct mutants were confirmed by PCR with universal and specific primers and sequencing to obtain SLCgP2 strains, respectively. The sequences of the primers as used above were listed in Table 4.

TABLE-US-00005 TABLE 4 Primer Nucleotide Sequence SEQ ID NO. pEC-1 GGAGAAAATACCGCATCAGGC SEQ ID NO: 39 pEC-2 CTGTTTTGGCGGATGAGAGAAG SEQ ID NO: 40 pyc-a CCTGATGCGGTATTTTCTCCGAAAAC SEQ ID NO: 41 CCAGGATTGCTTTGTG pyc-b TTGGAGATGCGCTCACGCATTAGAGT SEQ ID NO: 42 AATTATTCCTTTCAACAAGAG proB-1 ATGCGTGAGCGCATCTCCAAC SEQ ID NO: 43 proB-2 TTACGCGCGGCTGGCGTAGTTG SEQ ID NO: 44 proA-1 ACTACGCCAGCCGCGCGTAAGCCTTT SEQ ID NO: 45 TATGGTGTGATCCGAC proA-2 TTAAGGCCTAATTTGTCCTGTGCC SEQ ID NO: 46 proC-1 CAGGACAAATTAGGCCTTAATTTGTC SEQ ID NO: 47 GTTTTGGGCCCCC proC-2 TCTCTCATCCGCCAAAACAGCTAGCG SEQ ID NO: 48 CTTTCCGAGTTCTTCAG putA-1 CAGGAAACAGCTATGACATGTTCTAG SEQ ID NO: 49 GGCATCGACGAACCAG putA-2 GAAATTGTTAAAAGCGCAGCGC SEQ ID NO: 50 ABC-F GCTGCGCTTTTAACAATTTCGAAAAC SEQ ID NO: 51 CCAGGATTGCTTTGTG ABC-R TCGAAGCCGCACGTCATCTAG SEQ ID NO: 52 putA-3 TAGATGACGTGCGGCTTCGATCCGTG SEQ ID NO: 53 AACGCCTATCTGTACG putA-4 TGTAAAACGACGGCCAGTGCGATCGA SEQ ID NO: 54 TTCCACGCCCAAAC pK18-1 GCACTGGCCGTCGTTTTAC SEQ ID NO: 55 pK18-2 CATGTCATAGCTGTTTCCTGTGTG SEQ ID NO: 56

[0114] (2) Construction of Recombinant Vector of Gdh Gene Promoter Mutant of Corynebacterium glutamicum

[0115] Based on the reported genome sequence of Corynebacterium glutamicum ATCC13032, the upstream homologous arm was amplified using ATCC13032 genome as a template and gdh-UF/gdh-UR as primers respectively, and the downstream homologous arms of the Pgdh-1, P.sub.gdh-7, P.sub.gdh-16, P.sub.gdh-23, P.sub.gdh-26, and P.sub.gdh-29 promoter mutants were amplified using gdh-DF1/gdh-DR, gdh-DF7/gdh-DR, gdh-DF16/gdh-DR, gdh-DF23 gdh-DR, gdh-DF26/gdh-DR, and gdh-DF29/gdh-DR as primers, respectively; and at the same time, the pK18mobsacB skeleton was amplified using pK18-1/2 as primers. The above PCR fragments were recovered and then ligated via Vazyme's One Step Cloning Kit, and recombinant vectors pK18-P.sub.gdh-1, pK18-P.sub.gdh-7, pK18-P.sub.gdh-16, pK18-P.sub.gdh-23, pK18-P.sub.gdh-26, and pK18-P.sub.gdh-29 with mutated promoters were obtained, respectively. The sequences of the primers as used above were listed in Table 5.

TABLE-US-00006 TABLE 5 Primer Nucleotide Sequence SEQ ID NO. gdh-UF CAGGAAACAGCTATGACATGAGTATG SEQ ID NO: 57 CCTTTCTGTTATGGCG gdh-UR GGTTTATCAATTTTGTATCGCC SEQ ID NO: 58 gdh-DF1 GGCGATACAAAATTGATAAACCTAAA SEQ ID NO: 59 GAAATTTTCAAACAATTTTAATTCTT TGTCAGTATATCTGTGCGACACTGGT ATAATTGAACGTG gdh-DF7 GGCGATACAAAATTGATAAACCTAAA SEQ ID NO: 60 GAAATTTTCAAACAATTTTAATTCTT TGTCGGCATATCTGTGCGACACTGGT ATAATTGAACGTG gdh-DF16 GGCGATACAAAATTGATAAACCTAAA SEQ ID NO: 61 GAAATTTTCAAACAATTTTAATTCTT TGTTGTGATATCTGTGCGACACTCGT ATAATTGAACGTG gdh-DF23 GGCGATACAAAATTGATAAACCTAAA SEQ ID NO: 62 GAAATTTTCAAACAATTTTAATTCTT TGTTGCAATATCTGTGCGACACTTAT ATAATTGAACGTG gdh-DF26 GGCGATACAAAATTGATAAACCTAAA SEQ ID NO: 63 GAAATTTTCAAACAATTTTAATTCTT TGTTTGCATATCTGTGCGACACTGAT ATAATTGAACGTG gdh-DF29 GGCGATACAAAATTGATAAACCTAAA SEQ ID NO: 64 GAAATTTTCAAACAATTTTAATTCTT TGTGGCGATATCTGTGCGACACTTGT ATAATTGAACGTG gdh-DR TGTAAAACGACGGCCAGTGCCTGACG SEQ ID NO: 65 CTCAGGCTCGCACAG pK18-1 GCACTGGCCGTCGTTTTAC SEQ ID NO: 66 pK18-2 CATGTCATAGCTGTTTCCTGTGTG SEQ ID NO: 67

[0116] (3) Construction of Gdh Gene Promoter Mutants in Proline-Producing Strain of Corynebacterium glutamicum

[0117] The recombinant vectors pK18-P.sub.gdh-1, pK18-P.sub.gdh-7, pK18-P.sub.gdh-16, pK18-P.sub.gdh-23, pK18-P.sub.gdh-26, and pK18-P.sub.gdh-29 as constructed above were transformed into the proline-producing strains SLCgP2 of Corynebacterium glutamicum, respectively. The strains were coated on LBHIS solid media containing 5 g/L of glucose and 25 μg/mL of kanamycin and cultured at 30° C. to obtain the first recombinant transformants. The correct first recombinant transformants were inoculated into LB media containing 5 g/L of glucose respectively, and cultured overnight. Thereafter, 1% of the culture was transferred into an LB medium containing 100 g/L of sucrose and cultured overnight at 30° C., and then coated respectively on LB solid media containing 100 g/L of sucrose for screening. Correct mutants were confirmed by PCR and sequencing to obtain strains SLCgP3, SLCgP4, SLCgP5, SLCgP6, SLCgP7, and SLCgP8 with the mutated gdh promoters, respectively.

[0118] (4) Evaluation of Proline Productivity of Gdh Gene Promoter Mutants in Proline-Producing Strain of Corynebacterium glutamicum

[0119] In order to test how the mutation of the gdh promoter of Corynebacterium glutamicum affected production of proline by strains, fermentation tests were performed on SLCgP2, SLCgP3, SLCgP4, SLCgP5, SLCgP6, SLCgP7, and SLCgP8, respectively. The ingredients of the fermentation medium were as follows: glucose, 72 g/L; yeast powder, 1 g/L; soy peptone, 1 g/L; NaCl, 1 g/L; ammonium sulfate, 1 g/L; urea, 10 g/L; K.sub.2HPO.sub.4.Math.3H.sub.2O, 1 g/L; MgSO.sub.4.Math.7H.sub.2O, 0.45 g/L; FeSO.sub.4.Math.7H.sub.2O, 0.05 g/L; biotin, 0.4 mg/L; vitamin B1, 0.1 mg/L; MOPS, 40 g/L; and initial pH7.2. The strains were firstly inoculated into TSB liquid media and cultured for 8 h. The cultures were inoculated as seeds into a 24-well plate containing 800 μl of fermentation media in each well at an inoculation amount of 12 and cultured at 30° C. for 18 h. The rotating speed of the plate shaker was 800 rpm. Three samples were set for each strain. After the fermentation, the proline yields were measured. The results were listed in Table 6. The proline yields of the strains after mutation of the gdh promoter were all significantly increased.

TABLE-US-00007 TABLE 6 Strain Proline Yield (g/L) SLCgP2 5.48 ± 0.23 SLCgP3 6.11 ± 0.19 SLCgP4 7.07 ± 1.05 SLCgP5 7.50 ± 0.43 SLCgP6 7.74 ± 0.62 SLCgP7 7.85 ± 0.17 SLCgP8 7.28 ± 0.62

[0120] The above results suggest that mutants with enhanced expression intensity of the gdh gene promoter are applicable to the production of target products dependent upon the reaction from α-ketoglutaric acid to glutamic acid, for example, biological production of amino acids with glutamic acid as a product or a major synthesis precursor, such as proline, lysine, glutamic acid, hydroxyproline, arginine, ornithine, and glutamine. Asakura Y et al. have reported that the yield of glutamic acid could be increased by enhancing the Gdh activity using the gdh promoter mutant .sup.[6]. Xu, J et al. have reported that the lysine yield could be increased by enhancing the Gdh activity through substitution of the Ptac-M promoter for the promoter of the gdh gene .sup.[7]. Hydroxyproline can be produced by one-step hydroxylation using proline as a precursor. The modification for improving the synthesis of proline described herein is also useful for production of hydroxyproline.

REFERENCES

[0121] [5] Wang, Y C et al. Screening efficient constitutive promoters in Corynebacterium glutamicum based on time-series transcriptome analysis. Chinese Journal of Biotechnology, 2018, 34(11):1760-1771. [0122] [6] Asakura Y, Kimura E, Usuda Y, et al. Altered metabolic flux due to deletion of odhA causes L-glutamate overproduction in Corynebacterium glutamicum, Appl Environ Microbiol, 2007, 73(4):1308-1319. [0123] [7] Xu, J., Wu, Z., Gao, S. et al. Rational modification of tricarboxylic acid cycle for improving L-lysine production in Corynebacterium glutamicum. Microb Cell Fact 17, 105 (2018).

[0124] All technical features disclosed in the present specification may be combined in any combination manner. Each of the technical features disclosed in the present specification may be substituted by other features having the same, equivalent or similar effects. Thus, unless specifically stated, each of the features disclosed herein is only an example of a series of equivalent or similar features.

[0125] In addition, with the foregoing descriptions of the present disclosure, the key features of the present disclosure become apparent to a person skilled in the art. Many modifications may be made to the invention without departing from the spirit and scope of the present disclosure, so as to adapt the invention to various application purposes and conditions. Therefore, such modifications are also intended to fall within the scope of the appended claims.