BIOSENSORS FOR SELECTIVELY IDENTIFYING AZIDE IONS
20230279464 · 2023-09-07
Inventors
- Chandra Kanth Bandi (Piscataway, NJ, US)
- Shishir Chundawat (Piscataway, NJ, US)
- Kyle S. Skalenko (Piscataway, NJ, US)
Cpc classification
C12Q1/6897
CHEMISTRY; METALLURGY
C12N15/70
CHEMISTRY; METALLURGY
C12N15/635
CHEMISTRY; METALLURGY
C12Y302/01018
CHEMISTRY; METALLURGY
International classification
Abstract
The present disclosure provides, in one aspect, an azide-inducible system for controlled gene expression in E. coli. In another aspect, the present disclosure provides a high throughput screening method for the identification of new glycosynthases (e.g., mutant glycosyl hydrolases) with enhanced activity and unique substrate specificity.
Claims
1. A construct comprising a. a cyn promoter comprising an engineered −10 sequence and a consensus ribosome binding sequence; which is linked to b. a cynR promoter comprising an engineered −10 sequence, wherein the engineered −10 sequences comprise at least one nucleotide addition, subtraction, or mutation that improves protein expression from the respective promoters.
2. The construct of claim 1, wherein the cyn promoter and the independent constitutive promoter are separated by a spacer comprising about 10 to about 1000 nucleotides.
3. The construct of claim 1, wherein the cyn promoter and the independent constitutive promoter are directly linked to each other.
4. The construct of claim 1, wherein the constitutive cynR promoter is further engineered to regulate the expression of CynR protein.
5. The construct of claim 1, wherein the construct comprises nucleic acid sequence selected from the group consisting of SEQ ID NOs: 2-8.
6. A plasmid vector comprising: a. the construct of claim 1; b. an ampicillin resistance gene; and c. a gene encoding a protein of interest, wherein the gene is located downstream of the cyn promoter; wherein the expression of the gene encoding the protein of interest is inducible by azide or cyanate.
7. The plasmid of claim 6, wherein the construct comprises a sequence selected from the group consisting of SEQ ID NO: 2 and SEQ ID NO: 8.
8. The plasmid of claim 6, wherein the protein of interest is a reporter protein.
9. The plasmid of claim 8, wherein the reporter protein is a GFP.
10. An inducible protein expression system for a enhancing the expression of a protein of interest, wherein the protein expression system comprises a host cell transformed with the plasmid vector of claim 6.
11. The protein expression system of claim 10, wherein the host cell is an E. coli cell selected from the group consisting of BW25113, BW25113-sCB1, BW25113-sKS3, and BW25113-sKS4.
12. The protein expression system of claim 10, wherein expression of the protein of interest is enhanced by about 20 fold to about 180 fold relative to the protein expression system comprising the native cyn promoter.
13. The protein expression system of claim 10, wherein the protein of interest is a reporter protein.
14. The protein expression system of claim 13, wherein the reporter protein is a GFP.
15. A tunable synthetic biosensor for in vivo detection of an inorganic azide, wherein the biosensor comprises the inducible protein expression system of claim 10.
16. A method of screening activity and specificity of an enzyme in an enzymatic reaction that generates an azide ion, wherein the method comprises: a. contacting the biosensor of claim 15 with the azide ion generated during the enzymatic reaction, wherein the protein of interest is a reporter protein; and b. quantifying a signal generated from the reporter protein; wherein the quantified signal is positively correlated with the activity and the specificity of the enzyme.
17. The method of claim 16, wherein the enzyme is a carbohydrate active enzyme.
18. The method of claim 17, wherein the carbohydrate active enzyme is selected from the group consisting of glycosyl hydrolase and transglycosidase.
19. The method of claim 16, wherein the enzymatic reaction is a glycosynthase reaction that uses at least one of a glycosyl azide and a fucosyl azide as a donor sugar.
20. The method of claim 16, wherein the reporter protein is a GFP.
Description
BRIEF DESCRIPTION OF THE DRAWINGS
[0012] The following detailed description of specific embodiments of the disclosure will be better understood when read in conjunction with the appended drawings. For the purpose of illustrating the disclosure, exemplary embodiments are shown in the drawings. It should be understood, however, that the disclosure is not limited to the precise arrangements and instrumentalities of the embodiments shown in the drawings.
[0013]
[0014]
[0015]
[0016]
[0017]
[0018]
[0019]
[0020]
[0021]
[0022]
DETAILED DESCRIPTION
[0023] Azide detection inside the cells is critical to the study biotoxicity, stability of pharmaceutical azido-drugs, and carbohydrate active enzyme engineering. Several techniques have been developed to detect the presence of azide ions in the system. However, these techniques are either applicable only to in vitro based study or require expensive sensing reagents or cannot selectively identify only inorganic azide. The present disclosure provides an in vivo cell based azide biosensor for the selective detection of azide ions. In certain embodiments, a cyanate/azide ion inducible promoter regulating the expression of green fluorescent protein (GFP) is engineered. In certain embodiments, the promoter is optimized further to improve GFP expression inside E. coli cells. The application of this synthetic promoter as alternative protein expression system and as tool for enzyme engineering is described herein.
Definitions
[0024] Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which the disclosure pertains. Although any methods and materials similar or equivalent to those described herein can be used in the practice for testing of the present disclosure, selected materials and methods are described herein. In describing and claiming the present disclosure, the following terminology will be used.
[0025] It is also to be understood that the terminology used herein is for the purpose of describing particular embodiments only, and is not intended to be limiting.
[0026] The articles “a” and “an” are used herein to refer to one or to more than one (i.e., to at least one) of the grammatical object of the article. By way of example, “an element” means one element or more than one element.
[0027] “About” as used herein when referring to a measurable value such as an amount, a temporal duration, and the like, is meant to encompass variations of ±20% or ±10%, more preferably ±5%, even more preferably ±1%, and still more preferably ±0.1% from the specified value, as such variations are appropriate to perform the disclosed methods.
[0028] “Encoding” refers to the inherent property of specific sequences of nucleotides in a polynucleotide, such as a gene or an mRNA, to serve as templates for synthesis of other polymers and macromolecules in biological processes having either a defined sequence of nucleotides (i.e., rRNA, tRNA and mRNA) or a defined sequence of amino acids and the biological properties resulting therefrom. Thus, a gene encodes a protein if transcription and translation of mRNA corresponding to that gene produces the protein in a cell or other biological system. Both the coding strand, the nucleotide sequence of which is identical to the mRNA sequence and is usually provided in sequence listings, and the non-coding strand (i.e., template strand), used as the template for transcription of a gene, can be referred to as encoding the protein or other product of that gene.
[0029] The term “expression” as used herein is defined as the transcription and/or translation of a particular nucleotide sequence driven by its promoter and/or ribosome binding site.
[0030] “Expression vector” refers to a vector comprising a recombinant polynucleotide comprising expression control sequences operatively linked to a nucleotide sequence to be expressed. An expression vector comprises sufficient cis-acting elements for expression; other elements for expression can be supplied by the host cell or in an in vitro expression system. Expression vectors include all those known in the art, such as cosmids, plasmids (e.g., naked or contained in liposomes) and viruses (e.g., Sendai viruses, lentiviruses, retroviruses, adenoviruses, and adeno-associated viruses) that incorporate the recombinant polynucleotide.
[0031] The term “knockdown” as used herein refers to a decrease in gene expression of one or more genes.
[0032] The term “knockout” as used herein refers to the ablation of gene expression of one or more genes.
[0033] By the term “modified” or “engineered” as used herein, is meant a changed state or structure of a molecule or cell of the disclosure. Molecules may be modified in many ways, including chemically, structurally, and functionally. Cells may be modified through the introduction of nucleic acids.
[0034] Unless otherwise specified, a “nucleotide sequence encoding an amino acid sequence” includes all nucleotide sequences that are degenerate versions of each other and that encode the same amino acid sequence. The phrase nucleotide sequence that encodes a protein or an RNA may also include introns to the extent that the nucleotide sequence encoding the protein may in some version contain an intron(s).
[0035] The term “promoter” as used herein is defined as a DNA sequence recognized by the synthetic machinery of the cell (e.g., RNA polymerase), or introduced synthetic machinery, required to initiate the specific transcription of a polynucleotide sequence.
[0036] As used herein, the term “promoter/regulatory sequence” means a nucleic acid sequence which is required for expression of a gene product operably linked to the promoter/regulatory sequence. In some instances, this sequence may be the core promoter sequence and in other instances, this sequence may also include an enhancer sequence and other regulatory elements which are required for expression of the gene product. The promoter/regulatory sequence may, for example, be one which expresses the gene product in a tissue specific manner.
[0037] A “constitutive” promoter is a nucleotide sequence which, when operably linked with a polynucleotide which encodes or specifies a gene product, causes the gene product to be produced in a cell under most or all physiological conditions of the cell.
[0038] An “inducible” promoter is a nucleotide sequence which, when operably linked with a polynucleotide which encodes or specifies a gene product, causes the gene product to be produced in a cell substantially only when an inducer which corresponds to the promoter is present in the cell.
[0039] The term “ribosome binding sequence” or RBS, also called a “Shine-Dalgarno sequence” or SD sequence, is a series of nucleotides upstream of the start codon of a messenger RNA (mRNA) sequence, which allows the binding of ribosomes and the initiation of translation. Ribosome binding sequences are typically features of prokaryotic mRNA, however eukaryotic ribosome complexes can interact with similar internal ribosome entry sites (IRES) commonly found in viral and engineered mRNA molecules.
[0040] The term “consensus” or “consensus sequence” as used herein refers to a sequence of DNA, RNA, or protein that represents the most common or ideal sequence for a particular feature or motif. Consensus sequences are determined statistically by the alignment of similar sequence features across a large number of genes and/or species in order to determine the most common nucleotide or amino acid at each position. As such, a consensus sequence of a particular feature or motif often represents a highly efficient or optimized sequence for a particular feature or motif.
[0041] The phrase “under transcriptional control” or “operatively linked” as used herein means that the promoter is in the correct location and orientation in relation to a polynucleotide to control the initiation of transcription by RNA polymerase and expression of the polynucleotide.
[0042] A “vector” is a composition of matter which comprises an isolated nucleic acid and which can be used to deliver the isolated nucleic acid to the interior of a cell. Numerous vectors are known in the art including, but not limited to, linear polynucleotides, polynucleotides associated with ionic or amphiphilic compounds, plasmids, and viruses. Thus, the term “vector” includes an autonomously replicating plasmid or a virus. The term should also be construed to include non-plasmid and non-viral compounds which facilitate transfer of nucleic acid into cells, such as, for example, polylysine compounds, liposomes, and the like. Examples of viral vectors include, but are not limited to, Sendai viral vectors, adenoviral vectors, adeno-associated virus vectors, retroviral vectors, lentiviral vectors, and the like.
[0043] Ranges: throughout this disclosure, various aspects of the disclosure can be presented in a range format. It should be understood that the description in range format is merely for convenience and brevity and should not be construed as an inflexible limitation on the scope of the disclosure. Accordingly, the description of a range should be considered to have specifically disclosed all the possible subranges as well as individual numerical values within that range. For example, description of a range such as from 1 to 6 should be considered to have specifically disclosed subranges such as from 1 to 3, from 1 to 4, from 1 to 5, from 2 to 4, from 2 to 6, from 3 to 6 etc., as well as individual numbers within that range, for example, 1, 2, 2.7, 3, 4, 5, 5.3, and 6. This applies regardless of the breadth of the range.
[0044] The practice of the present disclosure employs, unless otherwise indicated, conventional techniques of molecular biology (including recombinant techniques), microbiology, cell biology, biochemistry and immunology, which are well within the purview of the skilled artisan. Such techniques are explained fully in the literature, such as, “Molecular Cloning: A Laboratory Manual”, second edition (Sambrook, 1989); “Oligonucleotide Synthesis” (Gait, 1984); “Animal Cell Culture” (Freshney, 1987); “Methods in Enzymology” “Handbook of Experimental Immunology” (Weir, 1996); “Gene Transfer Vectors for Mammalian Cells” (Miller and Calos, 1987); “Current Protocols in Molecular Biology” (Ausubel, 1987); “PCR: The Polymerase Chain Reaction”, (Mullis, 1994); “Current Protocols in Immunology” (Coligan, 1991). These techniques are applicable to the production of the polynucleotides and polypeptides of the disclosure, and, as such, may be considered in making and practicing the disclosure. Particularly useful techniques for particular embodiments will be discussed in the sections that follow.
[0045] The recitation of an embodiment for a variable or aspect herein includes that embodiment as any single embodiment or in combination with any other embodiments or portions thereof.
[0046] Any compositions or methods provided herein can be combined with one or more of any of the other compositions and methods provided herein.
DESCRIPTION
[0047] The E. coli genome consists of several operons (630-700), which are essential for bacterial metabolism, performing specific functions key for survival in harsh environments. One such operon enables E. coli to overcome the toxicity of exogenous cyanate and survive in cyanate-rich environments. In E. coli, this operon, called the cyn operon, contains three genes; cynT, cynS and cynX (
[0048] Along with cynTSX genes, the cynR gene encoding cynR protein is present as a part of cyn operon on the opposite strand. Cyanate is a linear small molecule, which binds strongly in the binding pocket of the cynR inducer binding domain. Azide ion is structurally homologous with cyanate and can function as an inducer for the cyn operon. To determine if azide can bind efficiently to cynR, Autodock vina was used to perform docking simulations of both cyanate and azide in the binding pocket of cynR. The binding orientation of docked ligands at minimum free energy reveal a good overlap in the binding site with similar predicted binding affinities (
Constructs
[0049] The disclosure provides a construct comprising a cyn promoter comprising a consensus ribosome-binding site (RBS) and an engineered −10 sequence and a cynR promoter comprising an engineered −10 sequence. In some embodiments, the engineered −10 sites comprise at least one insertion, deletion, and/or mutation as compared to the naturally-occurring promoter sequences. In some embodiments, the −10 site comprises a consensus sequence. Modifications to the −10 site serve to increase RNA polymerase binding for more efficient transcription. In some embodiments, the ribosome binding site is a consensus sequence that enables efficient ribosome binding and protein translation.
TABLE-US-00001 pCyn-V2-GFP Cyn promoter (SEQ ID NO: 36) TCGCAACCTATAAGTAAATCCAATGGAACTCGTCAGAAATGAGACTTTTACCTTA CCATG Legend: Sequence with border - −10 site Bold - Mutational changes Bold, italic - Additions Doubly underlined - Ribosomal binding site (SD sequence)
[0050] In certain embodiments, the construct comprises a nucleic acid sequence selected from the group consisting of SEQ ID NOs. 2-8.
[0051] In certain embodiments, the cyn promoter and the independent constitutive promoter are separated by a spacer comprising about 100 to about 1000 nucleotides. In certain embodiments, the cyn promoter and the independent constitutive promoter are separated by a spacer comprising about 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 200, 300, 400, 500, 600, 700, 800, 900, or 1000 nucleotides.
[0052] In certain other embodiments, the cyn promoter and the independent constitutive promoter are not separated by nucleotide spacer (i.e., are directly fused). In certain embodiments, the construct comprises a nucleic acid having the nucleic acid of SEQ ID NO. 1.
[0053] In certain embodiments, the constitutive cynR promoter is further engineered to regulate the expression of CynR protein.
[0054] In certain embodiments, the disclosure provides a plasmid comprising the construct described elsewhere herein. In certain embodiments, the plasmid comprises an antibiotic resistance gene. In certain embodiment, the antibiotic resistance gene is an ampicillin resistance gene.
[0055] In certain embodiments, the plasmid further comprises a gene encoding a protein of interest. In certain embodiments, the gene encoding the protein of interest is located downstream of the cyn operator or promoter region. In certain embodiments, the protein of interest is a reporter protein. In certain embodiments, the reporter protein is a GFP.
[0056] In certain embodiments, the expression of the gene encoding the protein of interest is inducible by an azide or a cyanate. In certain embodiments the azide is an inorganic azide. In certain embodiments, the inorganic azide is NaN.sub.3. In certain embodiments, the cyanate is NaOCN.
[0057] In certain embodiments, the disclosure provides an inducible protein expression system for enhancing the expression protein of interest, wherein the protein expression system comprises a host cell transformed with the plasmid described elsewhere herein.
[0058] In certain embodiments, the host cell is an E. coli selected from the group consisting of BW25113, BW25113-sCB1 (ΔcynS), BW25113-sKS3 (ΔcynX), and BW52113-sKS4 (ΔcynTSX).
[0059] In certain embodiments, the expression of the protein of interest is enhanced by about 20 to about 180 fold to as compared to the expression system comprising the native promoters. In certain embodiments, the expression of the protein of interest is enhanced by about 20, 30, 40, 50, 60, 70, 80, 90, 100, 110, 120, 130, 140, 150, 160, 170, and about 180 fold to as compared to the expression system comprising the native promoters.
[0060] In certain embodiments, the disclosure further provides a tunable synthetic biosensor for in vivo detection of inorganic azide, wherein the biosensor comprises the protein expression system, as described elsewhere herein.
Methods
[0061] In certain embodiments, the disclosure provides a method of screening activity and specificity of an enzyme in an enzymatic reaction that generates an azide ion. In certain embodiments, the method comprises contacting the biosensor, described elsewhere herein, wherein the protein of interest is a reporter protein, with the azide generated during the enzymatic reaction; and quantifying a signal generated by the reporter protein.
[0062] In certain embodiments, the signal comprises a fluorescence signal. In certain embodiments, intensity of the signal is quantified. In certain embodiments, the quantified signal is positively correlated with the activity and the specificity of the enzyme. In certain embodiments, the enzymes are carbohydrate active enzymes. In certain embodiments, the carbohydrate active enzymes are glycosyl hydrolases and transglycosidases. In certain embodiments, the enzymatic reaction is a glycosynthesis reaction that use at least one of a glycosyl azide and a fucosyl azide as donor sugars.
EXPERIMENTAL EXAMPLES
[0063] The disclosure is further described in detail by reference to the following experimental examples. These examples are provided for purposes of illustration only, and are not intended to be limiting unless otherwise specified. Thus, the disclosure should in no way be construed as being limited to the following examples, but rather, should be construed to encompass any and all variations which become evident as a result of the teaching provided herein.
[0064] Without further description, it is believed that one of ordinary skill in the art can, using the preceding description and the following illustrative examples, make and utilize the compounds of the present disclosure and practice the claimed methods. The following working examples therefore, specifically point out the preferred embodiments of the present disclosure, and are not to be construed as limiting in any way the remainder of the disclosure.
Materials and Methods:
Bacterial Strain Engineering
[0065] All the chemicals, reagents and solvents were purchased from Fisher Scientific and Sigma-Aldrich and used without purification. E. coli strain used for cloning was E. cloni® 10G (Lucigen, Wis., USA) and for protein expression using lac promoter was BL21-CodonPlus-RIPL [λDE3] (Stratagene, Santa Clara, Calif., USA). 2× Phusion high fidelity PCR master mix (0.04 U/μL Phusion DNA polymerase, 400 μM dNTPs, 2× Phusion HF buffer, 3 mM MgCl.sub.2) was purchased from Thermo Fisher Scientific (USA) and restriction enzymes were procured from New England BioLabs Inc. (USA). The primers used for site directed mutagenesis (SDM), sequence and ligation independent cloning (SLIC) and sequencing reactions were obtained from Integrated DNA Technologies, Inc (USA). Successfully cloned plasmids were isolated from E. cloni® 10 g cells using IBI Scientific (USA) plasmid extraction kit and the sequence was confirmed through Sanger sequencing performed by Genscript Inc. (NJ, USA). The carbohydrate substrates used in enzyme assays were purchased from Synthose Inc, Canada.
[0066] The E. coli strains used for protein expression using cyn promoter were constructed using the following protocol and reagents outlined in Datsenko (2000). Strains sCB1 (BW25113 cynS::FRT) and sKS3 (BW25113 cynX::FRT) were constructed by first streaking out the strains JW0331 (BW25113 cynS::Kan) and JW0332 (BW25113 cynX:Kan) respectively from the Keio collection onto LB-agar kanamycin (50 μg/ml) plate. The kanamycin marker was then removed by transforming the individual strains with pCP20, following the protocol outlined in Datsenko 2000, and curing the strain of the plasmid. The final strain was diagnosed by PCR and for loss of kanamycin.
[0067] Strain sKS4, BW25113 cynR,cynTSX::FRT, was constructed by first transforming the Keio parent strain, BW25113, with pKD46 and plated onto carbenicillin (100 μg/mL) plates. 5 mL overnights of BW25113+pKD46 in LB+carbenicillin (100 μg/mL) were grown at 30° C. and then back-diluted 1:100 into 50 mL LB+carbenicillin (100 μg/mL)+0.2% L-arabinose. The 50 mL culture was grown to an OD.sub.600 of 0.8, at 30° C., and cells were washed 4 times with 50 mL of ice-cold water. The final cell pellet was resuspended 1:250 the starting culture volume with fresh water and sat on ice until ready to electroporate. The linear DNA fragment, that was used to knockout the cynR gene and cynTSX operon, was synthesized by amplifying the kanamycin gene (Kan) from pKD4 using primers k1 and k2. The linear DNA fragment was checked by gel electrophoresis for purity and was then cleaned-up and concentrated using Qiagen's PCR clean-up kit, the product was eluted in water. The intermediate strain sKS1 (BW25113 cynR, cynTSX::Kan) was made by mixing 100 ng of linear DNA with 50 μL electrocompetent BW25113+pKD46 cells, shocking immediately with 1.8 kV (with a pulse constant of 5.2 ms), and recovered in 900 μL of SOC at 37° C. for 3 hours. After recovery, cells were spun down at 10,000×g for 2 minutes at room temperature, resuspended to 100 plated everything onto kanamycin (50 μg/mL) plates, and grew at 37° C. overnight. sKS1 was transformed with pCP20 to remove the kanamycin selection marker, following the protocol in Datsenko (2000), making the final strain sKS4 (BW25113 cynR,cynSTX:FRT). sKS4 was diagnosed by loss of kanamycin and PCR.
Design and Construction of pCyn Vectors
[0068] The cloning of the plasmid constructs used in this study were performed using Sequence and Ligation-Independent Cloning (SLIC) protocol as outlined elsewhere herein. Briefly, to create the pCyn-v1-GFP, the gene fragment consisting of native cynR and cyn promoter/operator region (gblock1) was custom synthesized from Genscript Inc, USA. The GFP gene fragment was taken from pEC-GFP plasmid. Both the gene fragments were cloned into the parent plasmid, ptrc99a while getting rid of the intrinsic lac promoter using the primers p1-p4 and following the SLIC protocol (Table 1). To generate pCyn-v2-GFP, an optimized promoter region was designed in silico and the corresponding DNA fragment (gblock2) was custom synthesized and pCynv-1-GFP was used as starting DNA with primers used being p5-p8. The spacer region of 100 bp from the pCyn-v2-GFP was removed using primers p9-p10 to get pCyn-v3-GFP while an additional random sequence of 900 bp (gblock3) was added using p11-p14 to generate pCyn-v4-GFP. Further, pCyn-v5-GFP was constructed from pCyn-v2-GFP by site directed mutagenesis of the cynR constitutive promoter using primers p15-p16. In the end, the pCyn-v5-GFP was the parent DNA used to create pCyn-v6-GFP, pCyn-v7-GFP and pCyn-v8-GFP using the primers p17-p18, p19-p20 and p21-p22, respectively. All the constructs were diagnosed using Sanger sequences and the sequencing verified plasmids were preserved at −80° C. and their corresponding transformed E. coli cells were stored in 15% glycerol stocks at −80° C.
Induction of pCyn-v1/v2-GFP Expression
[0069] The pCyn-GFP plasmid constructs were transformed into BW25113 strains (wt, sCB1) and individual colonies were obtained on LB agar plates supplemented with 100 μg/mL Carbenicillin antibiotic. The transformants were inoculated into 10 mL of LB media with carbenicillin and grown at 37° C. for 16 hrs. The 10 mL of overnight grown culture was transferred to 200 mL of fresh LB media with carbenicillin and incubated at 37° C. until mid-exponential phase (OD 0.4-0.6) was reached. At this point, the 200 mL culture was split into six 25 mL falcon tubes. Two of the tubes were induced with 1 mM sodium azide and two tubes with 1 mM cyanate while the remaining two tubes were used as no induction control. The cultures were placed in the 37° C. shaking incubator and 2 mL of sample for bulk fluorescence measurement and 200 μL of sample for flow cytometer runs were collected at every time point.
Induction of pCyn-v2/v3/v4-GFP Expression
[0070] The pCyn-GFP plasmid constructs were transformed into BW25113 strains (wt, sCB1, sKS3, sKS4) and individual colonies were obtained on LB agar plates supplemented with 100 μg/ml Carbenicillin antibiotic. The transformants were inoculated into 10 mL of LB media with carbenicillin and grown at 37° C. for 16 hrs. The 10 mL of overnight grown culture was transferred to 200 mL of fresh LB media with carbenicillin and incubated at 37° C. until mid-exponential phase (OD 0.4-0.6) was reached. At this point, the 200 mL culture was split into six 25 mL falcon tubes. Three of the tubes were induced with 1 mM sodium azide and remaining three tubes were used as no induction control. The cultures were placed in the 37° C. shaking incubator and 2 mL of sample was collected at every time point for bulk fluorescence measurement and 200 μL was sampled to measure OD600.
Induction of pCyn-v2/v5/v6/v7/v8-GFP Expression
[0071] The pCyn-GFP plasmid constructs were transformed into BW25113 strains (wt, sCB1, sKS3, sKS4) and individual colonies were obtained on LB agar plates supplemented with 100 μg/mL Carbenicillin antibiotic. The transformants were inoculated into 10 mL of LB media with carbenicillin and grown at 37° C. for 16 hrs. Then, 400 μL of overnight grown culture was transferred to 20 mL of fresh LB media with carbenicillin and incubated at 37° C. until an OD.sub.600 of 0.3-0.4 was reached. At this point, 1 mL of culture was added to 12 wells in a 96 deep well plate. Three wells each were induced with 10 μM, 100 μM 1000 μM of sodium azide and three wells were left uninduced. The 96 well plate was placed in the 37° C. shaking incubator for 2 hours. 200 μL of the sample was used for OD.sub.600 measurements and the residual sample was used for bulk GFP fluorescence measurement.
Bulk GFP Fluorescence Measurement
[0072] The samples collected from each experiment were first centrifuged to remove the LB media. The pelleted cells were resuspended in 250 μL of BPER reagent (Bacterial Protein Extraction Reagent) and incubated at room temperature for 10 min to lyse the cells. The resultant samples were centrifuged and 200 μL of the supernatant was used to measure GFP fluorescence in a black opaque bottom 96 well plate using a spectrophotometer.
Flow Cytometer Data Acquisition and Analysis
[0073] For measuring the GFP expression in individual cells, flow cytometer analysis was performed. At each timepoint for a given induction experiment, 200 μL of cells were collected. The cells were centrifuged to remove the LB media components, resuspended in 1× PBS buffer (phosphate buffered saline) and run through the Guava® easyCyte™ flow cytometer to measure the fluorescence distribution at 488 nm excitation and 525 nm emission. The raw data was analyzed using FlowJo software.
Determining if Azide can Bind Efficiently to cynR
[0074] To determine if azide can bind efficiently to cynR, Autodock vina was used to perform docking simulations of both cyanate and azide in the binding pocket of cynR. The binding orientation of docked ligands at minimum free energy reveal a good overlap in the binding site with similar predicted binding affinities (
Example 1: Improving the Promoter Strength to Enhance the Protein Expression
[0075] The regulatory segment consisting of cynR gene and cyn operator region were subcloned into a plasmid vector with ampicillin resistance and a green fluorescent protein (GFP) gene. The regulatory segment was placed upstream of the GFP reporter gene to facilitate GFP expression using cyanate and azide molecules (
[0076] To improve the promoter strength to express high amounts of protein, the native cyn promoter was engineered to contain consensus −10 and SD sequences. The cynR gene which is negatively regulated by cyn promoter was placed under the control of an independent constitutive promoter. Additional to these modifications, to avoid interference and steric hinderances between the two promoters, the promoters were separated by inserting random DNA spacer sequence of 100 bp (pCyn-v2-GFP) and 1000 bp (pCyn-v4-GFP) (
[0077] All the three engineered constructs showed a 30-fold increase in the fluorescence signal in the cell lysate, indicating a significant increase in GFP expression as compared to the native promoter (
[0078] The promoter regulation is primarily facilitated by the bending of DNA due to the binding of cynR protein and altering the DNA bending could lead to excess expression. Decreasing the length between the promoters largely reduced the leaky expression under no induction while preserving the improved GFP yield when induced with azide (
[0079] The 30-fold increase in GFP fluorescence observed was promising to with regard to the pCyn-v2-GFP engineered design for sensing azide inside the cells. To determine the minimal azide amount required to induce protein expression, the cells containing the pCyn-v2-GFP plasmid were induced with varying concentrations of azide. The maximum amount of azide used for induction was limited to 5 mM, as higher amounts show dramatic influence on the growth of the cells (
[0080] CynR protein acts as a repressor for the promoter by causing a bend at −35 site hindering the binding of RNA polymerase. The cynR protein consists of two domains: an inducer binding domain and a DNA binding domain. The inducer binding domain binds to the inducer (cyanate or azide), which decreases the bend at promoter site to facilitate transcription. In regulating protein expression, along with the inducer amount, the relative amounts of cynR protein is also critical. The cynR constitutive promoter was further engineered to adjust the repressor protein expressed. Four different constructs (v5, v6, v7 and v8) were constructed by creating mutations at the −10 site, regions between −10 and −35 site and between RBS and translation start site (TSS) (
[0081] The optimized designs (pCyn-v2-GFP and pCyn-v8-GFP) function as a tunable synthetic biosensor for in vivo detection of azide. The amount of GFP expressed within 2 hours of 1 mM azide induction in BW25113-Wt strain was estimated to be 0.4 mg and 0.9 mg from 1 mL culture for pCyn-v2-GFP and pCyn-v8-GFP, respectively based on calibration curve between protein concentration and GFP fluorescence (
[0082] The synthetic cyn promoter in BW25113-Wt (
Example 2: Use as an Azide Biosensor
[0083] In addition to functioning as an expression system, the developed promoter can prove to be useful in chemical biology especially for enzyme engineering. This method is a powerful tool to selectively identify inorganic azide amongst other chemically linked azides. Enzymatic reactions which result in the release of azide ions can be identified using this promoter. Carbohydrate active enzymes involving glycosyl hydrolases and transglycosidases are such enzymes that have been shown to release azide from azido-sugars for hydrolysis and carbohydrate synthesis. Multiple glycosyl azides such as galactosyl-, glucosyl- and mannosyl-azides were hydrolyzed by galactosidases, glucosidases, and mannosidases respectively. Similarly, engineered glycosidases (e.g., transglycosidases and glycosynthases) used these azido-hexoses and their N-acetyl derivatives as donor sugars for oligosaccharides synthesis. β-glucosidases from Aspergillus sp., and Agrobacterium sp. belonging to glycosyl hydrolase family GH3 and GH1 actively cleaved azide group from glucosyl azide. Two β-glucosidases from the GH1 and GH3 families are present in E. coli which can potentially show similar substrate specificity to release azide when incubated with glucosyl azide.
[0084] Here, E. coli BW25113-Wt cells containing the engineered pCyn-v2-GFP plasmid were incubated with 1-azido-β-D-glucopyranosyl azide (1-Glc-N.sub.3) for 4 hours. As illustrated in
Example 3: Glycosynthase Enzyme Engineering and Screening Using Flow Cytometry
[0085] E. coli containing two plasmids, pEC-TmAFc and pCyn-v2-GFP, comprising lac and cyn promoters, respectively, were incubated with glycosynthases reaction substrates (e.g., fucosyl azide and pNP-xylose). Induced expression of TmAfc-D224G results in the mutant enzyme, which alone catalyzes the glycosynthase (GS) reaction, thereby generating azide ion as a by-product. The azide ion product further induces the azide promoter on the secondary plasmid (i.e., pCyn-v2-GFP) resulting in GFP expression (
[0086] Flow cytometry analysis of E. coli cells containing dual plasmids (i.e. pEC-TmAFc and pCyn-v2-GFP) with glycosynthase substrates and various controls to demonstrate the utility of the azide promoter system. It was found that only cells expressing the TmAFc-D224G mutant and in the presence of both GS and reaction donor/acceptor sugar substrates provided a clear shift in cell fluorescence, a result of azide ion release during the GS reaction (
TABLE-US-00002 Sequence Listing SEQ ID NO. 1: Promoter region for pCyn-v1-GFP TCGCAACCTATAAGTAAATCCAATGGAACTCATCATAAATGAGACTTTTACCTTATGACAAT CGGCGAGTAGTCTGCCTCTCATTCCAGAGACAGACAGAGGTTAACGATG SEQ ID NO. 2: Promoter region for pCyn-v2-GFP GGTTCCTCATTACCGTTATCATATGAACACACCATAACAAAGATGCATGCAGCTGTCTAAAT CCCGCGGCCATGGCGGCCGGGAGCATGCGACGTCGGGCCCAATTCGCCCGATCTTAATGAAT GGCCGGAAGAGGTACGGACGCGATATGCGGGGGTGAGAGGGCAAATAGGCAGGTTCGCCTTC GTCACGCTAGGAGGCAATTCTATAAGGATCCTCGCAACCTATAAGTAAATCCAATGGAACTC GTCAGAAATGAGACTTTTACCTTATGACAATCGGCTGGTATAATGCCTCTACTTCCAGAGAC AGACATAAGGAGATTACGCATG SEQ ID NO. 3: Promoter region for pCyn-v3-GFP GGTTCCTCATTACCGTTATCATATGAACACACCATAACAAAGATGCATGCAGCTGTCTAAAT CCCGCGGCCATGGCGGCCGGGAGCATGCGACGTCGGGCCCAATTCGGGATCCTCGCAACCTA TAAGTAAATCCAATGGAACTCGTCAGAAATGAGACTTTTACCTTATGACAATCGGCTGGTAT AATGCCTCTACTTCCAGAGACAGACATAAGGAGATTACGCATG SEQ ID NO. 4: Promoter region for pCyn-v4-GFP GGTTCCTCATTACCGTTATCATATGAACACACCATAACAAAGATGCATGCAGCTGTCTAAAT CCCGCGGCCATGGCGGCCGGGAGCATGCGACGTCGGGCCCAATTCGCCCGATCTTAATGAAT GGCCGGAAGAGGTACGGACGCGATATGCGGGGGTGAGAGGGCAAATAGGCAGGTTCGCCTTC GTCACGCTAGGAGGCAATTCTATAAGATTGGACCGTACGCATGTCAAACTGCTGGCGAACCG CGATTCCACGACCGGTGCACGATTTAACTACGCCGACGTGACGACATTCCTGCTAATGCCTC GCCCGCCGGACCGCCCTCGTGATGGGGTAGCTGGGCATGACCTTGTGACATATAACGAGAGT CTACTTGTTTAATCATCTCACGGCGAAAGTCGGGGGGACAGCAGCCGCTGCAGACATTATAC CGCAACTACACCAAGCTGAGATAACTCCGTAGTTGACTACGCATCCCTCTAGGCCTTACTTA ACCGGATACAGTGACTTTGACAGGTTTGTGGGCTACAGCAATCACTTGCATAGCTGCGTATG GAGGAAGCAACTCTTGGGTGTTAGTATGTTGACCCCTGTATTAGGGATGCGGGTAGTAGATG TGGGCAGAGACACCCAGGTCAAGTACACGACCCTCTCGTAGGAGGTGTTCCAGATCACCATA CCACCATACCATTCGAGCATGGCACTATGTACGCTGTCCCCATTCTGGTAGTCATCATCCCT ATCACGGTTTCGAGTGACTGGTGACGGATATCCCCCACGAATGGAGATCTTATTCACAGTCG GTCACATTGGAGTGCTCCTTGACTAATCAGCTTGGCCAGGTCTGTTGGGCCTCCGTGCCCCG AGTTTCGGCGCTGTGCTGCCGAGAGTCGGCCATTGTCATTGGGGCCTCACTTGTGGATACCC CGACCTATTTTGACGGGACCACTCGCGGTAGTCGTTGGGCTTATGCACCGTGAAGTCCTCCG CCGGCCTCCCCCCTACAAAAGATGATAAGCTCCGGCAAGCAATATTGAACAACGCAAGGATC GGCGATATAAACAGAGAAACGGCTGATTACTCTTGTTGGTGTGGTATCGCTAAACTGGGATC CTCGCAACCTATAAGTAAATCCAATGGAACTCGTCAGAAATGAGACTTTTACCTTATGACAA TCGGCTGGTATAATGCCTCTACTTCCAGAGACAGACATAAGGAGATTACGCATG SEQ ID NO. 5: Promoter region for pCyn-v5-GFP GGTTCCTCATTACCGTTATCATATGAACACACCATAAGGAAGATGCATGCAGCTGTCTAAAT CCCGCGGCCATGGCGGCCGGGAGCATGCGACGTCGGGCCCAATTCGCCCGATCTTAATGAAT GGCCGGAAGAGGTACGGACGCGATATGCGGGGGTGAGAGGGCAAATAGGCAGGTTCGCCTTC GTCACGCTAGGAGGCAATTCTATAAGGATCCTCGCAACCTATAAGTAAATCCAATGGAACTC GTCAGAAATGAGACTTTTACCTTATGACAATCGGCTGGTATAATGCCTCTACTTCCAGAGAC AGACATAAGGAGATTACGCATG SEQ ID NO. 6: Promoter region for pCyn-v6-GFP GGTTCCTCATTACCGTTATCATATGAACACGCCATAAGGAAGATGCATGCAGCTGTCTAAAT CCCGCGGCCATGGCGGCCGGGAGCATGCGACGTCGGGCCCAATTCGCCCGATCTTAATGAAT GGCCGGAAGAGGTACGGACGCGATATGCGGGGGTGAGAGGGCAAATAGGCAGGTTCGCCTTC GTCACGCTAGGAGGCAATTCTATAAGGATCCTCGCAACCTATAAGTAAATCCAATGGAACTC GTCAGAAATGAGACTTTTACCTTATGACAATCGGCTGGTATAATGCCTCTACTTCCAGAGAC AGACATAAGGAGATTACGCATG SEQ ID NO. 7: Promoter region for pCyn-v7-GFP GTTCCTCATTACCGTTATCATATGAACACACCATAAGGAAAAGATGCATGCAGCTGTCTAAA TCCCGCGGCCATGGCGGCCGGGAGCATGCGACGTCGGGCCCAATTCGCCCGATCTTAATGAA TGGCCGGAAGAGGTACGGACGCGATATGCGGGGGTGAGAGGGCAAATAGGCAGGTTCGCCTT CGTCACGCTAGGAGGCAATTCTATAAGGATCCTCGCAACCTATAAGTAAATCCAATGGAACT CGTCAGAAATGAGACTTTTACCTTATGACAATCGGCTGGTATAATGCCTCTACTTCCAGAGA CAGACATAAGGAGATTACGCATG SEQ ID NO.8: Promoter region for pCyn-v8-GFP GGAGAGTTCCTCATTACCGTTATCATATGAACACACCATAAGGAAGATGCATGCAGCTGTCT AAATCCCGCGGCCATGGCGGCCGGGAGCATGCGACGTCGGGCCCAATTCGCCCGATCTTAAT GAATGGCCGGAAGAGGTACGGACGCGATATGCGGGGGTGAGAGGGCAAATAGGCAGGTTCGC CTTCGTCACGCTAGGAGGCAATTCTATAAGGATCCTCGCAACCTATAAGTAAATCCAATGGA ACTCGTCAGAAATGAGACTTTTACCTTATGACAATCGGCTGGTATAATGCCTCTACTTCCAG AGACAGACATAAGGAGATTACGCATG
TABLE-US-00003 TABLE 1 SEQ ID Primer NO. name Sequence 9. k1 TGATAAGCGTAGCGCATCAGGCAATTCCAGCCGCAGACCTGTGTCAGCGGGTGTAGG CTGGAGCTGCTTCGAAG 10. k2 TCTACATTAGCCGCATCCGGCATGAACAAAGCGCAGGAACAAGCGTCGCACATATGA ATATCCTCCTTAGTTCC 11. p1 AACCAGGATAATGATACAGATTAAATCAGAACGCAGAAG 12. p2 TTGTAATCGATAACGTAAATGCATGCCGCTTC 13. p3 GCATTTACGTTATCGATTACAAACGTTGAACGAC 14. p4 AATCTGTATCATTATCCTGGTTCTTTCCCCCA 15. p5 CGGTGGCAGCTCCAAAGGTGAAGAACTG 16. p6 AATGAGGAACCATGCTCTCTCGACATATC 17. p7 CGAGAGAGCATGGTTCCTCATTACCGTTATCATATG 18. p8 CCTTTGGAGCTGCCACCGCCATG 19. p9 CGGGCCCAATTCGGGATCCTCGCAACCTATAAGTAAATCC 20. p10 CGAGGATCCCGAATTGGGCCCGACGTC 21. p11 CGCTAAACTGGGATCCTCGCAACCTATAAGT 22. p12 GTACGGTCCAATCTTATAGAATTGCCTCCTAGCGTG 23. p13 CAATTCTATAAGATTGGACCGTACGCATGTC 24. p14 GCGAGGATCCCAGTTTAGCGATACCACACCA 25. p15 ATGAACACACCATAAGGAAGATGCATGCAGCT 26. p16 AGCTGCATGCATCTTCCTTATGGTGTGTTCAT 27. p17 GTTATCATATGAACACGCCATAAGGAAGATGCA 28. p18 TGCATCTTCCTTATGGCGTGTTCATATGATAAC 29. p19 CATATGAACACACCATAAGGAAAAGATGCATGCAGCTGTC 30. p20 GACAGCTGCATGCATCTTTTCCTTATGGTGTGTTCATATG 31. p21 AGAGTTCCTCATTACCGTTATCATATG 32. p22 CTCTCCATGCTCTCTCGACATATC SEQ DNA ID fragment NO. name Sequence 33. gblock1 ATCGATTACAAACGTTGAACGACTGGGTTACAGCGAGCTTAGTTTATGCCGGA TGCGGCGTGAACGCCTTATCCGGCCTACGTAGAGCACTGAACTCGTAGGCCTG ATAAGCGTAGCGCATCAGGCAATTCCAGCCGCTGATCTGTGTCAGCGGCTACC GTGATTCATTCCCGCCAACAACCGCGCATTCCTCCAACGCCATGTGCAAAAAT GCCTTCGCAGCGGCTGTCTGCCAGCTGTAGTTTATGCCGGATGCGGCGTGAAC GCCTTATCCGGCCTACGTAGAGCACTGAACTCGTAGGCCTGATAAGCGTAGCG CATCAGGCAATTCCAGCCGCAGACCTGTGTCAGCGGCTACCGTGATTCATTTC CGCCAACAACCGCGCATTTATCCAACGCCATGTGCAAAAATGCCTTCGCGGCG GCTGTCTGCCAGCTATTTTTCCGCCGCAACAAAACCGCCGTTCTCTCCAGTAG TGGCGGGGCAAGAGAAATAGCTTTAAGCCCGTCATGTTGTGTGGCAATCGCTG CTGGTAACAATGTGGAAAGGGAAGTGCGGCGAATCAGCTCCAGAACCGCGCTA ATTGAGTTCGCCTCAATGACCACCTGTGGATGTAGCCCCGCTTTCTCGCAGTA GTGGTCAATTTGCTCTCTGGTGGCAAATTCCGCGCTGAGCAGGACCAGTTTTT CATCATGCAAGCGACTCAACGCCACCTGTTCATGGACGGCCAGCGGATGATGT TGCGCCACGACTAACGCTAAACTTTCTGTCAGTAAAGGAATTGCCTCCAGCTC CGGCGAATGCACAGGCGCGAAGGCAATCCCAACGTCCAACTCGTCGCGGCAAA GCATATCCTCGATTTTCTCCTGCGACATTTCCTGTAGCTGGAGCGTGATGCTG GGATAGCGCGCATAGAAATCCGCCATTAAGGGGCCGATAAAGTAGCTCGTAAA GGTGGGGGTGACGGCGATACGCAGCGATCCTCGCGTCAGATCGGCAACATCAT GAATCGCCCGTTTACCCGCCCCCAGTTCCTGTAACGCCCGGCTGGCGTACTGT CGCCAGACTTCTCCTGCATCAGTGAGACGAATCGTTCGCCCGCTACGGTCAAA CAGCGGCACGCCTAAACTCTCCTCTAACTGGCGAATCTGCTGGGAAAGCGCAG GTTGGGAGACGTGCAACGCACTGGCGGCACGGGTGAAGCTGCCATGTTCAGCC ACGGCAAGAAAATAATTGATATGTCGAGAGAGCATTCGCAACCTATAAGTAAA TCCAATGGAACTCATCATAAATGAGACTTTTACCTTATGACAATCGGCGAGTA GTCTGCCTCTCATTCCAGAGACAGACAGAGGTTAACGATG 34. gblock2 GGTTCCTCATTACCGTTATCATATGAACACACCATAACAAAGATGCATGCAGC TGTCTAAATCCCGCGGCCATGGCGGCCGGGAGCATGCGACGTCGGGCCCAATT CGCCCGATCTTAATGAATGGCCGGAAGAGGTACGGACGCGATATGCGGGGGTG AGAGGGCAAATAGGCAGGTTCGCCTTCGTCACGCTAGGAGGCAATTCTATAAG GATCCTCGCAACCTATAAGTAAATCCAATGGAACTCGTCAGAAATGAGACTTT TACCTTATGACAATCGGCTGGTATAATGCCTCTACTTCCAGAGACAGACATAA GGAGATTACGCATGCATCACCATCATCACCATCACCATGGCGGTGGCAGC 35. gblock3 GATTGGACCGTACGCATGTCAAACTGCTGGCGAACCGCGATTCCACGACCGGT GCACGATTTAACTACGCCGACGTGACGACATTCCTGCTAATGCCTCGCCCGCC GGACCGCCCTCGTGATGGGGTAGCTGGGCATGACCTTGTGACATATAACGAGA GTCTACTTGTTTAATCATCTCACGGCGAAAGTCGGGGGGACAGCAGCCGCTGC AGACATTATACCGCAACTACACCAAGCTGAGATAACTCCGTAGTTGACTACGC ATCCCTCTAGGCCTTACTTAACCGGATACAGTGACTTTGACAGGTTTGTGGGC TACAGCAATCACTTGCATAGCTGCGTATGGAGGAAGCAACTCTTGGGTGTTAG TATGTTGACCCCTGTATTAGGGATGCGGGTAGTAGATGTGGGCAGAGACACCC AGGTCAAGTACACGACCCTCTCGTAGGAGGTGTTCCAGATCACCATACCACCA TACCATTCGAGCATGGCACTATGTACGCTGTCCCCATTCTGGTAGTCATCATC CCTATCACGGTTTCGAGTGACTGGTGACGGATATCCCCCACGAATGGAGATCT TATTCACAGTCGGTCACATTGGAGTGCTCCTTGACTAATCAGCTTGGCCAGGT CTGTTGGGCCTCCGTGCCCCGAGTTTCGGCGCTGTGCTGCCGAGAGTCGGCCA TTGTCATTGGGGCCTCACTTGTGGATACCCCGACCTATTTTGACGGGACCACT CGCGGTAGTCGTTGGGCTTATGCACCGTGAAGTCCTCCGCCGGCCTCCCCCCT ACAAAAGATGATAAGCTCCGGCAAGCAATATTGAACAACGCAAGGATCGGCGA TATAAACAGAGAAACGGCTGATTACTCTTGTTGGTGTGGTATCGCTAAACTG
TABLE-US-00004 SEQ ID NO.36: pCyn-V2-GFP Cyn promoter TCGCAACCTATAAGTAAATCCAATGGAACTCGTCAGAAATGAGACTTTTACCTTATGACAAT
Enumerated Embodiments
[0087] The recitation of a listing of elements in any definition of a variable herein includes definitions of that variable as any single element or combination (or sub-combination) of listed elements. The recitation of an embodiment herein includes that embodiment as any single embodiment or in combination with any other embodiments or portions thereof.
[0088] Embodiment 1 provides a construct comprising [0089] a. a cyn promoter comprising an engineered −10 sequence and a consensus ribosome binding sequence; which is linked to [0090] b. a cynR promoter comprising an engineered −10 sequence, wherein the engineered −10 sequences comprise at least one nucleotide addition, subtraction, and/or mutation that improves protein expression from the respective promoters.
[0091] Embodiment 2 provides the construct of Embodiment 1, wherein the cyn promoter and the independent constitutive promoter are separated by a spacer comprising about 10 to about 1000 nucleotides.
[0092] Embodiment 3 provides the construct of any of Embodiments 1-2, where in the cyn promoter and the independent constitutive promoter are directly linked to each other.
[0093] Embodiment 4 provides the construct of any of Embodiments 1-3, wherein the constitutive cynR promoter is further engineered to regulate the expression of CynR protein.
[0094] Embodiment 5 provides the construct of any of Embodiments 1-4, wherein the construct comprises nucleic acid sequence selected from the group consisting of SEQ ID NOs: 2-8.
[0095] Embodiment 6 provides a plasmid vector comprising: [0096] a. the construct of Embodiment 1; [0097] b. an ampicillin resistance gene; and [0098] c. a gene encoding a protein of interest, wherein the gene is located downstream of the cyn promoter; [0099] wherein the expression of the gene encoding the protein of interest is inducible by azide or cyanate.
[0100] Embodiment 7 provides the plasmid vector of Embodiment 6, wherein the construct comprises a sequence selected from the group consisting of SEQ ID NO: 2 and SEQ ID NO: 8.
[0101] Embodiment 8 provides the plasmid vector of any of Embodiments 6-7, wherein the protein of interest is a reporter protein.
[0102] Embodiment 9 provides the plasmid vector of Embodiment 8, wherein the reporter protein is a GFP.
[0103] Embodiment 10 provides an inducible protein expression system for a enhancing the expression of a protein of interest, wherein the protein expression system comprises a host cell transformed with the plasmid vector of any of Embodiments 6-8.
[0104] Embodiment 11 provides the protein expression system of Embodiment 10, wherein the host cell is an E. coli cell selected from the group consisting of BW25113, BW25113-sCB1, BW25113-sKS3, and BW25113-sKS4.
[0105] Embodiment 12 provides the protein expression system of any of Embodiments 10-11, wherein expression of the protein of interest is enhanced by about 20 fold to about 180 fold relative to the protein expression system comprising the native cyn promoter.
[0106] Embodiment 13 provides the protein expression system of any of Embodiments 10-12, wherein the protein of interest is a reporter protein.
[0107] Embodiment 14 provides the protein expression system of Embodiment 13, wherein the reporter protein is a GFP.
[0108] Embodiment 15 provides a tunable synthetic biosensor for in vivo detection of an inorganic azide, wherein the biosensor comprises the protein expression system of any of Embodiments 10-14.
[0109] Embodiment 16 provides a method of screening activity and specificity of an enzyme in an enzymatic reaction that generates an azide ion, wherein the method comprises: [0110] a. contacting the biosensor of Embodiment 15 with the azide ion generated during the enzymatic reaction, wherein the protein of interest is a reporter protein; and [0111] b. quantifying a signal generated from the reporter protein; [0112] wherein, the quantified signal is positively correlated with the activity and the specificity of the enzyme.
[0113] Embodiment 17 provides the method of Embodiment 16, wherein the enzyme is a carbohydrate active enzyme.
[0114] Embodiment 18 provides the method of Embodiment 17, wherein the carbohydrate active enzyme is selected from the group consisting of glycosyl hydrolase and transglycosidase.
[0115] Embodiment 19 provides the method of any of Embodiments 16-18, wherein the enzymatic reaction is a glycosynthase reaction that uses at least one of a glycosyl azide and a fucosyl azide as a donor sugar.
[0116] Embodiment 20 provides the method of any of Embodiments 16-19, wherein the reporter protein is a GFP.
[0117] The disclosures of each and every patent, patent application, and publication cited herein are hereby incorporated herein by reference in their entirety. While this disclosure has been disclosed with reference to specific embodiments, it is apparent that other embodiments and variations of this disclosure may be devised by others skilled in the art without departing from the true spirit and scope of the disclosure. The appended claims are intended to be construed to include all such embodiments and equivalent variations.