CELL LINES FOR RECOMBINANT AAV PRODUCTION AND AAV-IMPLEMENTED PROTEIN PRODUCTION
20230279427 · 2023-09-07
Inventors
- Wei-Shou Hu (Falcon Heights, MN)
- Zion LEE (Minneapolis, MN, US)
- Christopher Stanley STACH (Somerville, MA, US)
- Min LU (Minneapolis, MN, US)
Cpc classification
C12N2710/10022
CHEMISTRY; METALLURGY
C12N2710/10322
CHEMISTRY; METALLURGY
C12N2750/14152
CHEMISTRY; METALLURGY
C12N2750/14143
CHEMISTRY; METALLURGY
C12N2830/002
CHEMISTRY; METALLURGY
C12N2750/14122
CHEMISTRY; METALLURGY
C12N15/86
CHEMISTRY; METALLURGY
C12N9/1252
CHEMISTRY; METALLURGY
International classification
Abstract
Described herein are cell lines for recombinant adeno-associated virus (AAV) production, cell lines for AAV-implemented protein production, and cell lines for use in titering AAV; methods of making each of those cell lines; and methods of using each of those cell lines. In some aspects, the cell lines disclosed herein may be used in a manufacturing process that is seed virus-free, helper virus-free, and transfection-free that uses synthetic elements to control viral genes in a stable cell line.
Claims
1. A stable mammalian cell line comprising a first polynucleotide encoding an adeno-associated virus (AAV) large replicase (Rep) protein, wherein the first polynucleotide is operably linked to a promoter; a second polynucleotide encoding an adenovirus (Ad) E4orf6, wherein the second polynucleotide is operably linked to a promoter; and a third polynucleotide encoding an Ad DNA binding protein (DBP), wherein the third polynucleotide is operably linked to a promoter.
2. The stable mammalian cell line of claim 1, wherein at least one promoter is an exogenous promoter.
3. The stable mammalian cell line of claim 1, wherein at least one promoter is a non-AAV promoter.
4. The stable mammalian cell line of claim 1, wherein at least one promoter is an inducible promoter.
5. The stable mammalian cell line of claim 4, wherein the inducible promoter comprises a doxycycline-inducible promoter, a mifepristone-inducible promoter, or a cumate-inducible promoter.
6. The stable mammalian cell line of claim 4, wherein: a first inducible promoter comprises a doxycycline-inducible promoter, a mifepristone-inducible promoter, or a cumate-inducible promoter; and a second inducible promoter comprises a doxycycline-inducible promoter, a mifepristone-inducible promoter, or a cumate-inducible promoter.
7. The stable mammalian cell line of claim 1, wherein the first polynucleotide is tagged with a destabilization domain.
8. The stable mammalian cell line of claim 7, wherein the destabilization domain is ligand-responsive.
9. (canceled)
10. The stable mammalian cell line of claim 1, further comprising a gene of interest operably linked to a promoter, wherein the gene of interest is flanked by AAV inverted terminal repeats (ITRs), and wherein the gene of interest is integrated into the mammalian cell genome.
11. (canceled)
12. (canceled)
13. A stable mammalian cell line comprising a first polynucleotide encoding an adeno-associated virus (AAV) large replicase (Rep) protein, wherein the first polynucleotide is operably linked to a promoter; a second polynucleotide encoding adenovirus (Ad) E4orf6, wherein the second polynucleotide is operably linked to a promoter; a third polynucleotide encoding an Ad DNA binding protein (DBP), wherein the third polynucleotide is operably linked to a promoter; a fourth polynucleotide encoding an AAV capsid protein, wherein the fourth polynucleotide is operably linked to a promoter; and a fifth polynucleotide encoding an AAV small Rep protein, wherein the fifth polynucleotide is operably linked to a promoter.
14. The stable mammalian cell line of claim 13, wherein at least one promoter is an exogenous promoter.
15. The stable mammalian cell line of claim 13, wherein at least one promoter is a non-AAV promoter.
16. The stable mammalian cell line of claim 13, wherein at least one promoter is an inducible promoter.
17. (canceled)
18. (canceled)
19. The stable mammalian cell line of claim 13, wherein the first polynucleotide is tagged with a destabilization domain.
20. The stable mammalian cell line of claim 19, wherein the destabilization domain is ligand-responsive.
21. (canceled)
22. The stable mammalian cell line of claim 13, wherein the fourth polynucleotide encodes an mRNA missing at least one native intron.
23. The stable mammalian cell line of claim 13, wherein the fourth polynucleotide comprises an engineered inefficient translation start codon.
24. The stable mammalian cell line of claim 13, further comprising a gene of interest operably linked to a promoter, wherein the gene of interest is flanked by AAV inverted terminal repeats (ITRs), and wherein the gene of interest is integrated into the mammalian cell genome.
25. A method comprising transducing the cell line of claim 1 with recombinant AAV particles.
26. A method comprising transducing the cell line of claim 13 with recombinant AAV particles.
27-36. (canceled)
37. The method of claim 25, wherein: at least one promoter of the stable mammalian cell line is an inducible promoter; and the method further includes exposing the mammalian cell line to an inducer of the inducible promoter.
38. (canceled)
39. The method of claim 25, wherein: the first polynucleotide is tagged with a ligand-responsive destabilization domain; and the method further comprises exposing the mammalian cell line to a ligand of the ligand-responsive destabilization domain.
40. (canceled)
41. A method comprising stably integrating into a mammalian cell: a first polynucleotide encoding an adeno-associated virus (AAV) large replicase (Rep) protein, wherein the first polynucleotide is operably linked to a promoter; a second polynucleotide encoding an adenovirus (Ad) E4orf6, wherein the second polynucleotide is operably linked to a promoter; and a third polynucleotide encoding an Ad DNA binding protein (DBP), wherein the third polynucleotide is operably linked to a promoter.
42. The method of claim 41, wherein the method further comprises stably integrating into the mammalian cell a gene of interest flanked by inverted terminal repeats (ITRs).
43. The method of claim 42, wherein the method comprises integrating the gene of interest into the AAVS1 locus of the mammalian cell.
44. The method of claim 41, the method further comprising stably integrating into a mammalian cell a fourth polynucleotide encoding an AAV capsid protein, wherein the fourth polynucleotide is operably linked to a promoter; and a fifth polynucleotide encoding an AAV small Rep protein, wherein the fifth polynucleotide is operably linked to a promoter.
45. The method of claim 26, wherein: at least one promoter of the stable mammalian cell line is an inducible promoter; and the method further includes exposing the mammalian cell line to an inducer of the inducible promoter.
46. The method of claim 26, wherein: the first polynucleotide is tagged with a ligand-responsive destabilization domain; and the method further comprises exposing the mammalian cell line to a ligand of the ligand responsive destabilization domain.
Description
BRIEF DESCRIPTION OF THE FIGURES
[0034]
[0035]
[0036]
[0037]
DETAILED DESCRIPTION OF ILLUSTRATIVE EMBODIMENTS
[0038] This disclosure describes cell lines for recombinant adeno-associated virus (AAV) production, cell lines for AAV-implemented protein production, and cell lines for use in titering AAV; methods of making each of those cell lines; and methods of using each of those cell lines.
Adeno-Associated Virus (AAV)
[0039] AAV is a nonenveloped, capsid virus with a 4.7 kb long single-stranded DNA genome (Srivastava et al. Journal of Virology 45, 555-564 (1983)). The AAV genome encodes four replication proteins (rep) and three capsid proteins (cap) and one assembly-activating protein (AAP). Two secondary structures called inverted terminal repeats (ITRs), flank the coding region and serve as a self-primers for genome replication. During DNA replication, host cellular DNA polymerases first start leading strand DNA synthesis to turn the AAV genome into a double-stranded replicative form genome. Then, large rep proteins (Rep78/68) bind and nick the ITRs and use their helicase activity to unwind the ITR structure and allow its replication by host DNA polymerase (Brister et al. Journal of Virology 74, 7762-7771 (2000)). After ITR synthesis and ITR restoration, cellular DNA polymerases synthesize a new strand and displace the initial strand. This process is called single-strand displacement, which generates a new single-stranded genome and a double-stranded replicative form genome (Goncalves Virology Journal 2, 43 (2005)).
[0040] AAV is replication-defective in the absence of helper virus such as adenovirus (Ad) or herpes simplex virus (HSV) (Atchison et al. Science 149, 754-756 (1965), Weindler et al. Journal of Virology 65, 2476-2483 (1991)). Many components of Ad are involved in efficient AAV replication. Ad E1A promotes transcription from AAV promoters (Shi et al. Cell 67, 377-388 (1991), Chang et al. Journal of Virology 63, 3479-3488 (1989)) and Ad DBP increases DNA replication processivity (Ward et al. Journal of Virology 72, 420-427 (1998)). In the absence of Ad, the host cellular DNA repair complex, MRN, regards the ITR structure of AAV genomes as a double-strand break and binds to it, thus limiting AAV genome replication. The complex of Ad E1b55k and Ad E4orf6 functions as a ubiquitin ligase and targets the MRN complex, among others, for degradation, thus facilitating AAV genome replication (Schwartz et al. Journal of Virology 81, 12936-12945 (2007)). Ad also expresses a non-coding RNA, VA RNA, that can inhibit phosphorylation of eIF2α, a factor involved in translation initiation, thus augmenting AAV proteins expression (Nayak et al. Journal of Virology 81, 11908-11916 (2007)). These elements from helper virus play important roles in AAV genome replication.
[0041] To produce infectious AAV particles, the AAV genomes must be transferred into capsids. Single-stranded AAV genomes are packaged into a preformed capsids (King et al. EMBO Journal 20, 3282-3291 (2001)). Three cap isoforms, VP1, VP2 and VP3, assemble at a ratio of 1:1:10 (Sonntag et al. Proceedings of the National Academy of Sciences, USA 107, 10220-10225 (2010)). VP1 and VP2 share the entire VP3 coding sequence that is a core capsid-forming domain. VP1 has a unique N-terminus with phospholipase A2 domain that is significant for infectious activity (Girod et al. Journal of General Virology 83, 973-978 (2002)). VP2 shows no essential function for assembly and infection (Warrington et al. Journal of Virology 78, 6595-6609 (2004)). VP3 proteins form a core with beta-barrels that are interconnected by variable loops presented on the capsid surface. Both VP1's N-terminus and surface loops of VP3 play a critical role in serotypes specificity and receptor interaction (Xie et al. Proc Natl Acad Sci USA 99, 10405-10410 (2002)). The assembly activating protein (AAP) is encoded in an alternative reading frame within cap and it localizes capsid proteins to the host cell nucleolus and activates capsid assembly (Sonntag et al. Proceedings of the National Academy of Sciences, USA 107, 10220-10225 (2010)). Finally, the small Rep proteins (Rep52/40) use their helicase activity to insert AAV genomes into assembled capsids (King et al. EMBO Journal 20, 3282-3291 (2001)).
Current rAAV Production Methods and Challenges
[0042] As recombinant AAV (rAAV) preclinical and clinical trials increase, efficient production and manufacturing methods for rAAV have become increasingly important. Current production methods can provide up to 105 vector genomes per cell (Penaud-Budloo et al. Mol Ther Methods Clin Dev 8, 166-180 (2018)). One of the commonly used AAV production methods is multi-plasmid transfection with adherent or suspension HEK293 cells (a human cell line that already expresses the Ad E1 gene). In this method, rAAV is efficiently produced without infection of wild-type helper virus (Xiao et al. Journal of Virology 72, 2224-2232 (1998)). One plasmid with a gene of interest (GOI) flanked by ITR, another plasmid with rep/cap genes, and a third plasmid with Adenovirus E2A, E4, and VA RNA genes are co-transfected into the producing cells (Matsushita et al. Gene Therapy 5, 938-945 (1998)). Other production methods use recombinant helper viruses, such as herpes simplex virus and Baculovirus, to infect cells. The infected cells produce rAAV with the rAAV genome received by transduction and the helper function from helper virus, facilitating viral transcription and genome replication. However, these methods face several challenges. Inefficient transfection leads to a low percentage of cells receiving all essential plasmids and requires excessive amounts of plasmids. Using helper virus results in potential replication-competent Ad or rHSV copurified with AAV (Naso et al. BioDrugs 31, 317-334 (2017)).
Producer and Packaging Cell Lines for rAAV Production at the Time of the Invention
[0043] To achieve large-scale rAAV production, others have tried to create stable cells with partial essential elements integrated to avoid using transient transfection or infection. For example, Clark et al. introduced copies of rAAV vector genome and rep/cap genes into HeLa cells that could successfully produce rAAV with infection of Ad (Clark et al. Human Gene Therapy 6, 1329-1341 (1995)). Aside from the producer cell line, packaging cell lines (HeLa) integrated with only rep/cap genes were also developed. The infection of hybrid Ad that had the rAAV vector genome in the E1 region provided both the helper function and the rAAV vector genome to generate rAAV (Gao et al. Human Gene Therapy 9, 2353-2362 (1998), Liu et al. Gene Therapy 6, 293-299 (1999)). In HEK293 cells, constitutive expression of the E1A gene activates AAV promoters leading to cytotoxicity. To overcome this issue, Qiao et al. utilized a dual slicing switch to minimize leaky expression of four rep proteins for a HEK293 cell-based packaging cell line (Qiao et al. Journal of Virology 76, 13015-13027 (2002)). To eliminate the need for infection of Ad, Qiao et al. built a cell line integrated with inducible E1A-E1B, rAAV vector genome, and endogenous rep/cap, E2, E4, and VA RNA genes (Qiao et al. Journal of Virology 76, 1904-1913 (2002)). Even though this cell line could produce rAAV in the early passages, it lost stability gradually after several passages due to basal expression of cytotoxic E2 and E4 genes (Xiao et al. Journal of Virology 72, 2224-2232 (1998)).
[0044] These examples demonstrate that the cytotoxicity of both rep (Schmidt et al. Journal of Virology 74, 9441-9450 (2000)) and helper proteins (Xiao et al. Journal of Virology 72, 2224-2232 (1998)) pose a major obstacle for creating stable cell lines.
Cell Lines for Recombinant AAV Production
[0045] In one aspect, this disclosure describes a cell line that may be used for recombinant AAV (rAAV) production. Current methods of rAAV production either use transfections with multiple plasmids bearing viral genes, or multiple infections with recombinant adenoviruses or herpesviruses bearing AAV genes. These methods are cumbersome and inefficient for large-scale clinical manufacturing because the manufacturing processes must also include the production processes of the required plasmids or recombinant helper viruses.
[0046] In some embodiments, the cell lines disclosed herein may be used in a manufacturing process that is seed virus-free, helper virus-free, and transfection-free using synthetic elements controlling viral genes in a stable cell line. This production platform would be scalable and tunable for making different rAAVs.
Cell Lines Including AAV Large Rep Protein & Adenovirus E4orf6 and DBP
[0047] In some embodiments, the cell line includes a first polynucleotide encoding an adeno-associated virus (AAV) large replicase (Rep) protein, a second polynucleotide encoding an adenovirus (Ad) E4orf6, and a third polynucleotide encoding an Ad DNA binding protein (DBP). In some embodiments, the mammalian cell line further includes a gene of interest integrated into the genome of the mammalian cell line.
[0048] In some embodiments, the cell line is preferably a stable cell line (as opposed to a transiently transfected cell line). That is, each of the first, second, and third polynucleotides are integrated into the genome of the cell line and expression of the first, second, and third polynucleotides is not lost during cell culture.
[0049] Each of the first, second, and third polynucleotides is operably linked to a promoter. In some embodiments, the promoter may preferably be an exogenous promoter (e.g., a non-AAV promoter). For example, the first polynucleotide may be linked to a first promoter; the second polynucleotide may be linked to a second promoter; and the third polynucleotide may be linked to a third promoter. In some embodiments, however, some combination of the first, second, and third polynucleotides may be linked to the same promoter.
[0050] In an exemplary embodiment, the cell line is a mammalian cell line. The mammalian cell line, prior to incorporating the first, second, and third polynucleotides may include, for example, HEK293. The cell line may be selected for the presence in its genome of other helper genes. For example, adenovirus E1 gene is harbored in HEK293 cells.
[0051] The Ad E4orf6 and/or DBP may be derived from any suitable adenovirus or combination of adenoviruses. In some embodiments, adenovirus type 2 (Ad2) or adenovirus type 5 (Ad5) may be preferred. In an exemplary embodiment, the Ad E4orf6 may include Ad2 E4orf6. In an exemplary embodiment, the Ad DBP may include Ad2 DBP.
[0052] When the cell line includes a gene of interest integrated into the genome of the cell line, the gene of interest may be flanked by inverted terminal repeats (ITRs). The ITRs are preferably AAV ITRs. The ITRs may be from any suitable AAV serotype. In an exemplary embodiment, the ITRs may include AAV2 ITRs. In some embodiments, the gene of interest is preferably integrated into the AAVS1 locus.
[0053] The gene of interest may be operably linked to a promoter or terminator sequence, or both. The promoter may include any suitable promoter including, for example, an endogenous, an exogenous, or a synthetic promoter. In an exemplary embodiment, the promoter includes a CAG promoter. In another exemplary embodiment, the terminator sequence includes an SV40 terminator sequence.
[0054] In an exemplary embodiment, the gene of interest may include a marker protein. For example, the marker protein may include a fluorescent marker. Exemplary fluorescence marker proteins include, for example, green fluorescent proteins (GFPs) including, for example, enhanced green fluorescent protein (EGFP); GFP-like proteins including, for example, dsRed, eqFP611, Dronpa, TagRFPs, KFP, EosFP/IrisFP, Dendra, etc.; and monomeric red fluorescent proteins (mRFPs) including, for example, mCherry.
[0055] As noted above, the first polynucleotide encodes a large Rep protein. The large Rep proteins include Rep68 and Rep79. In some embodiments, the large Rep protein may preferably be Rep68.
[0056] In some embodiments, the first polynucleotide may be operably linked to a destabilizing domain (DD). Any suitable destabilizing domain may be used. Exemplary destabilizing domains include an FK506-binding protein 12 (FKBP12) DD, a CMP8/4-OHT-estrogen receptor destabilized domain (ER50 DD), a trimethoprim (TMP)-Escherichia coli dihydrofolate reductase (DHFR) DD, and combinations and mutants thereof. In some embodiments, the DD may include an FKBP12 or a mutant FKBP12. An exemplary mutant FKBP12 destabilization domain is one that is responsive to Shield-1 ligand. Shield1 stabilizes proteins tagged with a mutated FKBP12-derived destabilization domain (DD) used in ProteoTuner systems (Takara Bio, Inc., Shiga, Japan). It is used to protect DD-tagged proteins from proteasomal degradation, resulting in rapid accumulation of the protein.
[0057] In some embodiments, the first polynucleotide may be operably linked a polynucleotide encoding a marker and/or a marker protein. The marker protein may include a fluorescent marker. In an exemplary embodiment, the marker protein may include mCherry.
[0058] As noted above, the first polynucleotide is operably linked to a promoter. In some embodiments, the promoter may preferably be an exogenous promoter. In some embodiments, the first polynucleotide may be operably linked to an inducible promoter—that is, a promoter that is normally off but turned on in the presence of an inducer—or a repressible promoter—that is, a promoter that is normally on but is turned off in the presence of an inducer. Inducible promoters include positive inducible promoters and negative inducible promoters. In some embodiments, the inducible promoter may preferably be bound by a regulator. In an exemplary embodiment, an exogenous, inducible promoter includes a CMV5 promoter and a cumate operator sequence (P.sub.2CuO).
[0059] The cell line may further include a fourth polynucleotide encoding a regulator (for example, a transactivator or a repressor). When the first polynucleotide is operably linked to an inducible promoter, the fourth polynucleotide may encode a transactivator, wherein the transactivator binds to the inducible promoter only when an induction molecule is present, or a repressor, wherein the repressor binds to the inducible promoter unless an induction molecule is present. For example, when the inducible promoter includes a CMV5 promoter and CuO, the repressor may include the cumate repressor (CymR). In some embodiments, the fourth polynucleotide may be operably linked to a constitutive promoter. Any suitable constitutive promoter may be used. Exemplary constitutive promoters include human phosphoglycerate kinase promoter (PGK), CMV promoter (P.sub.CMV), and human elongation factor 1 alpha promoter (P.sub.EF1α). In an exemplary embodiment, the constitutive promoter may include P.sub.EF1α.
[0060] In some embodiments, the cell line includes a fifth polynucleotide encoding a selectable marker. Any suitable selectable marker may be used including, for example, resistance to an antibiotic. Exemplary antibiotics include, for example, puromycin, hygromycin, zeocin, geneticin, blasticidin, etc. In an exemplary embodiment, the selectable marker may include puromycin resistance (PuroR). In some embodiments, the fifth polynucleotide may be operably linked to constitutive promoter. Any suitable constitutive promoter may be used. Exemplary constitutive promoters include human phosphoglycerate kinase promoter (PGK), CMV promoter (P.sub.CMV), and human elongation factor 1 alpha promoter (P.sub.EF1α). In an exemplary embodiment, the constitutive promoter may include P.sub.EF1α.
[0061] In some embodiments, the fourth polynucleotide and the fifth polynucleotide are operably linked. If operably linked, the fourth polynucleotide and the fifth polynucleotide may be operably linked to a polynucleotide encoding a self-cleaving peptide. Any suitable self-cleaving peptide may be used including, for example, EGRGSLLTCGDVEENPGP (T2A; SEQ ID NO:1) or ATNFSLLKQAGDVEENPGP (P2A; SEQ ID NO:2). In an exemplary embodiment, the self-cleaving peptide includes T2A. If operably linked, the fourth polynucleotide and the fifth polynucleotide may be operably linked to the same constitutive promoter.
[0062] In some embodiments the second polynucleotide (encoding an adenovirus E4orf6) and the third polynucleotide (encoding Ad DBP) may be operably linked. If operably linked, the second polynucleotide and the third polynucleotide may be operably linked to a polynucleotide encoding a self-cleaving peptide. Any suitable self-cleaving peptide may be used including, for example, EGRGSLLTCGDVEENPGP (T2A; SEQ ID NO:1) or ATNFSLLKQAGDVEENPGP (P2A; SEQ ID NO:2). In an exemplary embodiment, the self-cleaving peptide includes P2A. If operably linked, the second polynucleotide and the third polynucleotide may be operably linked to the same promoter. Any suitable promoter may be used. In some embodiments, the promoter may preferably be an exogenous promoter. In some embodiments, the promoter may be an inducible promoter. In an exemplary embodiment, an exogenous, inducible promoter includes TetOn.
[0063] In some embodiments, the cell line includes a sixth polynucleotide encoding a selectable marker. Any suitable selectable marker may be used including, for example, resistance to an antibiotic. Exemplary antibiotics include, for example, puromycin, hygromycin, zeocin, geneticin, blasticidin, etc. In an exemplary embodiment, the selectable marker may include a gene encoding Hygromycin B phosphotransferase (hph) that provides resistance to hygromycin B (HygroB). In some embodiments, the sixth polynucleotide may be operably linked to constitutive promoter. Any suitable constitutive promoter may be used. Exemplary constitutive promoters include human phosphoglycerate kinase promoter (PGK), CMV promoter (P.sub.CMV), and human elongation factor 1 alpha promoter (P.sub.EF1α). In an exemplary embodiment, the constitutive promoter may include PGK.
[0064] In some embodiments, the cell line includes a seventh polynucleotide encoding a regulator (for example, a transactivator or a repressor). When the second polynucleotide and/or third polynucleotide is operably linked to an inducible promoter, the seventh polynucleotide may encode a transactivator, wherein the transactivator binds to the inducible promoter only when an induction molecule is present, or a repressor, wherein the repressor binds to the inducible promoter unless an induction molecule is present. For example, when one of the exogenous, inducible promoters includes TetOn, the regulator may include a reverse tetracycline-controlled transactivator (rtTA). The rtTA protein is capable of binding the Tet operator only if bound by a tetracycline. Thus, transcription of the polynucleotide operably linked to the TetOn promoter is stimulated by rtTA only in the presence of a tetracycline. In some embodiments, the seventh polynucleotide may be operably linked to a constitutive promoter. Any suitable constitutive promoter may be used. Exemplary constitutive promoters include human PGK promoter (P.sub.PGK), CMV promoter (P.sub.CMV), and human elongation factor 1 alpha promoter (P.sub.EF1α). In an exemplary embodiment, the constitutive promoter may include P.sub.PGK.
[0065] In some embodiments, the sixth polynucleotide and the seventh polynucleotide are operably linked. If operably linked, the sixth polynucleotide and the seventh polynucleotide may be operably linked to a polynucleotide encoding a self-cleaving peptide. Any suitable self-cleaving peptide may be used including, for example, EGRGSLLTCGDVEENPGP (T2A; SEQ ID NO:1) or ATNFSLLKQAGDVEENPGP (P2A; SEQ ID NO:2). In an exemplary embodiment, the self-cleaving peptide includes T2A. If operably linked, the sixth polynucleotide and the seventh polynucleotide may be operably linked to the same constitutive promoter.
[0066] Construction of an exemplary cell line GR1-5 is described in Example 1A, and a schematic of both the polynucleotides and their incorporation into HEK293 cells are shown in
Methods of Using Cell Lines Including AAV Large Rep Protein & Adenovirus E4orf6 and DBP for Recombinant AAV Production
[0067] The cell line described above that may be used for recombinant AAV production may be used for any suitable purpose.
[0068] In some aspects, this disclosure describes a method using the cell line for Recombinant AAV Production.
[0069] In some embodiments, the method includes forming a clonal population of the stable mammalian cell line.
[0070] In some embodiments, the method includes modulating the expression of a component incorporated into the cell line including, for example, to maximize the fraction of particles that include the gene of interest or to maximize the viral titer.
[0071] The method may further include exposing the cell to an induction molecule. The induction molecule may be selected based on the promoters incorporated in the cell line. For example, in the exemplary cell line GR1-5, described above and in Example 1, the induction molecule may include cumate or doxycycline (an inducer of the TetON system.
[0072] For example, the method may include modulating the expression of the large Rep protein, E4orf6, or Ad DBP, or a combination thereof. In another example, the method may include modulating the expression of the gene of interest. In some embodiments, modulating the expression may include modulating the copy number of the polynucleotide encoding the protein or gene.
[0073] In some embodiments, the method includes transfecting a cell of the stable mammalian cell line with an eighth polynucleotide that encodes an AAV capsid protein operably linked to a first promoter and a ninth polynucleotide encoding a small Rep protein operably linked to a second promoter.
[0074] In some embodiments, the small Rep protein may preferably be Rep52.
[0075] The AAV capsid protein may include any protein encoded by the AAV cap gene including VP1, VP2, VP3, assembly-activating protein (AAP), or membrane-associated accessory protein (MAAP), or a mutant thereof, or a combination thereof. That is, the AAV capsid protein is not necessarily limited to those proteins that make up the AAV capsid (VP1, VP2, and VP3). In some embodiments, the eighth polynucleotide may include the AAV cap gene. Any suitable AAV cap gene may be used. In some embodiments, the cap gene may include the serotypes DJ, 2, and 8. The DJ serotype is a synthetic serotype with a chimeric capsid of AAV-2, 4, 5, 8, 9, Avian AAV, Bovine AAV, and Caprine AAV.
[0076] Any suitable promoter may be used for the first promoter and/or the second promoter. In some embodiments, the first promoter and/or the second promoter may preferably be constitutive promoters. Exemplary constitutive promoters include human phosphoglycerate kinase promoter (PGK), CMV promoter (P.sub.CMV), and human elongation factor 1 alpha promoter (P.sub.EF1α). In an exemplary embodiment, the constitutive promoter may include P.sub.EF1α. In an exemplary embodiment, the first promoter includes a CMV promoter. In another exemplary embodiment, the second promoter includes a phosphoglycerate kinase (PGK) promoter.
[0077] In some embodiments, the eighth polynucleotide and ninth polynucleotide may be operably linked. When operably linked, an internal ribosome entry site (IRES) may be operably linked to the eighth polynucleotide and ninth polynucleotide.
[0078] In some embodiments, the method may include harvesting an AAV particle and/or removing cellular components from an AAV particle.
[0079] In some embodiments, the method may include administering the AAV particle to a subject.
Methods of Making Cell Lines Including AAV Large Rep Protein & Adenovirus E4orf6 and DBP for Recombinant AAV Production
[0080] The components of a cell line for recombinant AAV production may be incorporated into a genome of a cell by any suitable means. In some embodiments, the cell is preferably a mammalian cell. The cell line may be selected for the presence in its genome of other helper genes. For example, adenovirus E1 gene is harbored in HEK293 cells.
[0081] In some embodiments, the components are preferably stably incorporated into a genome of a cell of a cell line.
[0082] For example, at least a first polynucleotide encoding an adeno-associated virus (AAV) large replicase (Rep) protein, a second polynucleotide encoding an adenovirus (Ad) E4orf6, and a third polynucleotide encoding an Ad DNA binding protein (DBP) may be stably incorporated into the cell. In some embodiments, as further described above, a fifth polynucleotide and/or a sixth polynucleotide encoding a selectable marker may also be stably incorporated into the cell. In some embodiments, as further described above, a fourth polynucleotide encoding a regulator (for example, a transactivator or a repressor) may also be stably incorporated into the genome of the cell. In some embodiments, as further described above, a seventh polynucleotide encoding a regulator (for example, a transactivator or a repressor) may also be stably incorporated into the genome of the cell.
[0083] The components may be stably integrated into the genome of the cell by any suitable means. Exemplary means include randomly integrating one or more of the components into the genome of the mammalian cell, integrating one or more of the components into the genome of the mammalian cell using CRISPR, integrating one or more of the components into the genome of the mammalian cell using a transposase, and/or integrating one or more of the components into the genome of the mammalian cell using a lentivirus. Some of the components may be integrated using one method or a combination of methods while other components are integrated using another method or combination of methods.
Cell Lines Including AAV Large and Small Rep Proteins, at Least One Capsid Protein, and Adenovirus E4orf6 and DBP
[0084] In some embodiments, the cell line includes a first polynucleotide encoding an adeno-associated virus (AAV) large replicase (Rep) protein, a second polynucleotide encoding an adenovirus (Ad) E4orf6, a third polynucleotide encoding an Ad DNA binding protein (DBP), a fourth polynucleotide encoding an AAV capsid protein, and a fifth polynucleotide encoding an AAV small Rep protein. In some embodiments, the mammalian cell line further includes a gene of interest integrated into the genome of the mammalian cell line.
[0085] In some embodiments, the cell line is preferably a stable cell line (as opposed to a transiently transfected cell line). That is, each of the first, second, third, fourth, and fifth polynucleotides are integrated into the genome of the cell line and expression of the first, second, and third, fourth, and fifth polynucleotides is not lost during cell culture.
[0086] Each of the first, second, third, fourth, and fifth polynucleotides is operably linked to a promoter. In some embodiments, the promoter may preferably be an exogenous promoter. For example, the first polynucleotide may be linked to a first promoter; the second polynucleotide may be linked to a second promoter; the third polynucleotide may be linked to a third promoter; the fourth polynucleotide may be linked to a fourth promoter; and the fifth polynucleotide may be linked to the fifth promoter. In some embodiments, however, some combination of the first, second, third, fourth, and fifth polynucleotides may be linked to the same promoter.
[0087] In an exemplary embodiment, the cell line is a mammalian cell line. The mammalian cell line, prior to incorporating the first, second, and third polynucleotides may include, for example, HEK293. The cell line may be selected for the presence in its genome of other helper genes. For example, adenovirus E1 gene is harbored in HEK293 cells.
[0088] The Ad E4orf6 and/or DBP may be derived from any suitable adenovirus or combination of adenoviruses. In some embodiments adenovirus type 2 (Ad2) or adenovirus type 5 (Ad5) may be preferred. In an exemplary embodiment, the Ad E4orf6 may include Ad2 E4orf6. In an exemplary embodiment, the Ad DBP may include Ad2 DBP.
[0089] When the cell line includes a gene of interest integrated into the genome of the cell line, the gene of interest may be flanked by inverted terminal repeats (ITRs). The ITRs are preferably AAV ITRs. The ITRs may be from any suitable AAV serotype. In an exemplary embodiment, the ITRs may include AAV2 ITRs.
[0090] In some embodiments, the gene of interest may be integrated into the AAVS1 locus. In other embodiments, however, the gene of interest may be randomly integrated into the genome of the mammalian cell line.
[0091] The gene of interest may be operably linked to a promoter or terminator sequence, or both. The promoter may include any suitable promoter including, for example, endogenous, exogenous, or synthetic. In an exemplary embodiment, the promoter includes a CAG promoter. In another exemplary embodiment, the terminator sequence includes an SV40 terminator sequence.
[0092] In an exemplary embodiment, the gene of interest may include a marker protein. For example, the marker protein may include a fluorescent marker. Exemplary fluorescence marker proteins include, for example, green fluorescent proteins (GFPs) including, for example, enhanced green fluorescent protein (EGFP); GFP-like proteins including, for example, dsRed, eqFP611, Dronpa, TagRFPs, KFP, EosFP/IrisFP, Dendra, etc.; and monomeric red fluorescent proteins (mRFPs) including, for example, mCherry.
[0093] In some embodiments, the gene of interest may be operably linked to a polynucleotide encoding a selectable marker and/or a polynucleotide comprising the gene of interest may further include a polynucleotide encoding a selectable marker. Any suitable selectable marker may be used including, for example, resistance to an antibiotic. Exemplary antibiotics include, for example, puromycin, hygromycin, zeocin, geneticin, blasticidin, etc. In an exemplary embodiment, the selectable marker may include a gene encoding puromycin resistance (PuroR). Expression of a selectable marker may be controlled by a constitutive promoter. Any suitable constitutive promoter may be used. Exemplary constitutive promoters include human PGK promoter (P.sub.PGK), CMV promoter (P.sub.CMV), and human elongation factor 1 alpha promoter (P.sub.EF1α). In an exemplary embodiment, the promoter may include PGK.
[0094] As noted above, the first polynucleotide encodes a large Rep protein. The large Rep proteins include Rep68 and Rep78. In some embodiments, the large Rep protein may preferably be Rep68.
[0095] In some embodiments, the first polynucleotide may be operably linked to a destabilizing domain (DD). Any suitable destabilizing domain may be used. Exemplary destabilizing domains include an FK506-binding protein 12 (FKBP12) DD, a CMP8/4-OHT-estrogen receptor destabilized domain (ER50 DD), a trimethoprim (TMP)-Escherichia coli dihydrofolate reductase (DHFR) DD, and combinations and mutants thereof. In some embodiments, the DD may include an FKBP12 or a mutant FKBP12. An exemplary mutant FKBP12 destabilization domain is one that is responsive to Shield-1 ligand. Shield1 stabilizes proteins tagged with a mutated FKBP12-derived destabilization domain (DD) used in ProteoTuner systems (Takara Bio, Inc., Shiga, Japan). It is used to protect DD-tagged proteins from proteasomal degradation, resulting in rapid accumulation of the protein.
[0096] In some embodiments, the first polynucleotide may be operably linked a polynucleotide encoding a marker and/or a marker protein. The marker protein may include a fluorescent marker. In an exemplary embodiment, the marker protein may include mCherry.
[0097] The first polynucleotide may be operably linked to a terminator sequence. In another exemplary embodiment, the terminator sequence includes a beta globin terminator sequence (bGpA).
[0098] As noted above, the first polynucleotide is operably linked to a promoter. In some embodiments, the promoter may preferably be an exogenous promoter. In some embodiments, the first polynucleotide may be operably linked to an inducible promoter or a repressible promoter. In some embodiments, the inducible promoter is preferably bound by a regulator. In an exemplary embodiment, an exogenous, inducible promoter includes TetOn.
[0099] The cell line may further include a sixth polynucleotide encoding a regulator (for example, a transactivator or a repressor). When the first polynucleotide is operably linked to an inducible promoter, the sixth polynucleotide may encode a transactivator, wherein the transactivator binds to the inducible promoter only when an induction molecule is present, or a repressor, wherein the repressor binds to the inducible promoter unless an induction molecule is present. For example, when the inducible promoter includes TetOn, the transactivator may include a reverse tet transactivator 3 (rtTA3). In some embodiments, the sixth polynucleotide may be operably linked to a constitutive promoter. Any suitable constitutive promoter may be used. Exemplary constitutive promoters include human phosphoglycerate kinase promoter (PGK), CMV promoter (P.sub.CMV), and human elongation factor 1 alpha promoter (P.sub.EF1α). In an exemplary embodiment, the constitutive promoter may include PGK.
[0100] In some embodiments, the sixth polynucleotide may further include a selectable marker. Any suitable selectable marker may be used including, for example, resistance to an antibiotic. Exemplary antibiotics include, for example, puromycin, hygromycin, zeocin, geneticin, blasticidin, etc. In an exemplary embodiment, the selectable marker may include a gene encoding hygromycin resistance (HygroR). The transactivator and the selectable marker may be linked by a polynucleotide encoding a self-cleaving peptide. Any suitable self-cleaving peptide may be used including, for example, EGRGSLLTCGDVEENPGP (T2A; SEQ ID NO:1) or ATNFSLLKQAGDVEENPGP (P2A; SEQ ID NO:2). In an exemplary embodiment, the self-cleaving peptide includes T2A. If operably linked, the fourth polynucleotide and the fifth polynucleotide may be operably linked to the same constitutive promoter.
[0101] In some embodiments the second polynucleotide (encoding an adenovirus E4orf6) and the third polynucleotide (encoding an adenovirus DBP) may be operably linked. If operably linked, the second polynucleotide and the third polynucleotide may be operably linked to a polynucleotide encoding a self-cleaving peptide. Any suitable self-cleaving peptide may be used including, for example, EGRGSLLTCGDVEENPGP (T2A; SEQ ID NO:1) or ATNFSLLKQAGDVEENPGP (P2A; SEQ ID NO:2). In an exemplary embodiment, the self-cleaving peptide includes P2A.
[0102] As noted above, the second polynucleotide is operably linked to a promoter and the third polynucleotide is operably linked to a promoter. If operably linked, the second polynucleotide and the third polynucleotide may be operably linked to the same promoter. Any suitable promoter may be used. In some embodiments, the promoter of the second polynucleotide and/or the third polynucleotide may preferably be an exogenous promoter. In some embodiments, the promoter of the second polynucleotide and/or the third polynucleotide may preferably be an inducible promoter or a repressible promoter. In some embodiments, the inducible promoter is preferably bound by a regulator. In an exemplary embodiment, the exogenous promoter may include the GENESWITCH promoter (Thermo Fisher Scientific, Inc., Waltham, Mass.), a mifepristone-inducible hybrid promoter including Saccharomyces cerevisiae GAL4 upstream activating sequences (UAS) and a TATA box sequence from the adenovirus major late E1b gene.
[0103] The cell line may further include a seventh polynucleotide encoding a regulator (for example, a transactivator or a repressor). When the second polynucleotide and/or third polynucleotide is operably linked to an inducible promoter, the seventh polynucleotide may encode a transactivator, wherein the transactivator binds to the inducible promoter only when an induction molecule is present, or a repressor, wherein the repressor binds to the inducible promoter unless an induction molecule is present. For example, when the inducible promoter includes the GENESWITCH promoter (Thermo Fisher Scientific, Inc., Waltham, Mass.), the transactivator may include the GENESWITCH (Thermo Fisher Scientific, Inc., Waltham, Mass.) protein that includes a DNA binding domain from the yeast GAL4 protein, a truncated ligand binding domain from the human progesterone receptor, and an activation domain from the human NF-kB protein. In some embodiments, the seventh polynucleotide may be operably linked to a promoter. When the transactivator includes the GENESWITCH protein (Thermo Fisher Scientific, Inc., Waltham, Mass.), the promoter may preferably be a hybrid promoter including GAL4 upstream activating sequences (containing 4 copies of the GAL4 binding site) linked to a minimal promoter from the Herpes Simplex Virus thymidine kinase (TK) gene (P.sub.G4-TK).
[0104] The second polynucleotide and/or third polynucleotide may be operably linked to a terminator sequence. In another exemplary embodiment, the terminator sequence includes a beta globin terminator sequence (bGpA).
[0105] In an exemplary embodiment, as further described in Example 2, the first polynucleotide, second polynucleotide, third polynucleotide, sixth polynucleotide, and seventh polynucleotide may be included in a single module (also referred to herein an a “Replication Module”). In some embodiments, the first polynucleotide, second polynucleotide, third polynucleotide, sixth polynucleotide, and/or seventh polynucleotide may be included in a transposon integration construct. When the polynucleotide or polynucleotides are included in a transposon integration construct, they may be flanked by inverted terminal repeats (ITRs) of a transposon. Any suitable transposon may be used. Exemplary transposons include piggyBac, Sleeping Beauty, and Leap-in transposons (available from ATUM, Newark, Calif.).
[0106] As noted above, the fourth polynucleotide encodes an AAV capsid protein. The AAV capsid protein may include any protein encoded by the AAV cap gene including VP1, VP2, VP3, assembly-activating protein (AAP), or membrane-associated accessory protein (MAAP), or a mutant thereof, or a combination thereof. That is, the AAV capsid protein is not necessarily limited to those proteins that make up the AAV capsid (VP1, VP2, and VP3). In some embodiments, the fourth polynucleotide may include the AAV cap gene. Any suitable AAV cap gene may be used. In some embodiments, the cap gene may include the serotypes DJ, 2, and 8. The DJ serotype is a synthetic serotype with a chimeric capsid of AAV-2, 4, 5, 8, 9, Avian AAV, Bovine AAV, and Caprine AAV.
[0107] As noted above, the fifth polynucleotide encodes an AAV small Rep protein. The small Rep proteins include Rep40 and Rep52. In some embodiments, the small Rep protein may preferably be Rep52.
[0108] In some embodiments, the fourth polynucleotide and the fifth polynucleotide may be operably linked. When the fourth polynucleotide and the fifth polynucleotide are operably linked, fourth polynucleotide and the fifth polynucleotide may be operably linked to an internal ribosome entry site (IRES).
[0109] In some embodiments, the fourth polynucleotide and/or the fifth polynucleotide may be operably linked to an inducible promoter or a repressible promoter. In some embodiments, the inducible promoter is preferably bound by a regulator. In an exemplary embodiment, an exogenous, inducible promoter includes a CMV5 promoter and a cumate operator sequence (P.sub.2CuO).
[0110] The cell line may further include an eighth polynucleotide encoding a regulator (for example, a transactivator or a repressor). When the fourth polynucleotide and/or the fifth polynucleotide is operably linked to an inducible promoter, the eighth polynucleotide may encode a transactivator, wherein the transactivator binds to the inducible promoter only when an induction molecule is present, or a repressor, wherein the repressor binds to the inducible promoter unless an induction molecule is present. For example, when the inducible promoter includes CuO, the repressor may include the cumate repressor (CymR). In some embodiments, the eighth polynucleotide may be operably linked to a constitutive promoter. Any suitable constitutive promoter may be used. Exemplary constitutive promoters include human phosphoglycerate kinase promoter (PGK), CMV promoter (P.sub.CMV), and human elongation factor 1 alpha promoter (P.sub.EF1α). In an exemplary embodiment, the constitutive promoter may include P.sub.EF1α.
[0111] In some embodiments, the stable mammalian cell line may further include a ninth polynucleotide encoding a selectable marker. Any suitable selectable marker may be used including, for example, resistance to an antibiotic. Exemplary antibiotics include, for example, puromycin, hygromycin, zeocin, geneticin, blasticidin, etc. In an exemplary embodiment, the selectable marker may include a gene encoding blasticidin resistance (BlastR).
[0112] In an exemplary embodiment, as further described in Example 2, the fourth polynucleotide, fifth polynucleotide, the eighth polynucleotide, and the ninth polynucleotide may be included in a single module (also referred to herein a “Packaging Module”). In some embodiments, the fourth polynucleotide, fifth polynucleotide, the eighth polynucleotide, and/or the ninth polynucleotide may be included in a transposon integration construct. When the polynucleotide or polynucleotides are included in a transposon integration construct, they may be flanked by inverted terminal repeats (ITRs) of a transposon. Any suitable transposon may be used. Exemplary transposons include piggyBac, Sleeping Beauty, and Leap-in transposons (available from ATUM, Newark, Calif.).
[0113] Construction of an exemplary cell line GR2C3 is described in Example 2, and a schematic of both the polynucleotides and their incorporation into HEK293 cells are shown in
Methods of Using Cell Lines Including AAV Large and Small Rep Proteins, at Least One Capsid Protein, and Adenovirus E4orf6 and DBP
[0114] The cell line described above that may be used for recombinant AAV production may be used for any suitable purpose.
[0115] In some aspects, this disclosure describes a method using the cell line for Recombinant AAV Production.
[0116] In some embodiments, the method includes forming a clonal population of the stable mammalian cell line.
[0117] In some embodiments, the method includes modulating the expression of a component incorporated into the cell line including, for example, to maximize the fraction of particles that include the gene of interest or to maximize the viral titer.
[0118] The method may further include exposing the cell to an induction molecule. The induction molecule may be selected based on the promoters incorporated in the cell line. For example, in the exemplary cell line GR2C3, described above and in Example 2, the induction molecule may include cumate, doxycycline (an inducer of the TetON system), and/or mifepristone (an inducer of the GENESWITCH system (Thermo Fisher Scientific, Inc., Waltham, Mass.)).
[0119] For example, the method may include modulating the expression of the large Rep protein, the small Rep protein, E4orf6, Ad DBP, an AAV capsid protein, or a combination thereof. In another example, the method may include modulating the expression of the gene of interest. In some embodiments, modulating the expression may include modulating the copy number of the polynucleotide encoding the protein or gene.
[0120] In some embodiments, the method may include harvesting an AAV particle and/or removing cellular components from an AAV particle.
[0121] In some embodiments, the method may include administering the AAV particle to a subject.
Methods of Making Cell Lines Including AAV Large and Small Rep Proteins, at Least One Capsid Protein, and Adenovirus E4orf6 and DBP
[0122] The components of a cell line for recombinant AAV production may be incorporated into a genome of a cell by any suitable means. In some embodiments, the cell is preferably a mammalian cell. The cell line may be selected for the presence in its genome of other helper genes. For example, adenovirus E1 gene is harbored in HEK293 cells.
[0123] In some embodiments, the components are preferably stably incorporated into a genome of a cell of a cell line.
[0124] For example, at least a first polynucleotide encoding an adeno-associated virus (AAV) large replicase (Rep) protein, a second polynucleotide encoding an adenovirus (Ad) E4orf6, and a third polynucleotide encoding an Ad DNA binding protein (DBP), a fourth polynucleotide encoding an AAV capsid protein, and a fifth polynucleotide encoding an AAV small Rep protein may be stably incorporated into the cell. In some embodiments, as further described above, a sixth polynucleotide encoding a regulator may also be stably incorporated into the genome of the cell. In some embodiments, as further described above, a seventh polynucleotide encoding a regulator may also be stably incorporated into the genome of the cell. In some embodiments, as further described above, a ninth polynucleotide encoding a selectable marker may also be stably incorporated into the cell. In some embodiments, as further described above, the polynucleotides may be included in modules, including, for example, a Replication Module and/or a Packaging Module.
[0125] The components may be stably integrated into the genome of the cell by any suitable means. Exemplary means include randomly integrating one or more of the components into the genome of the mammalian cell, integrating one or more of the components into the genome of the mammalian cell using CRISPR, integrating one or more of the components into the genome of the mammalian cell using a transposase, and/or integrating one or more of the components into the genome of the mammalian cell using a lentivirus. Some of the components may be integrated using one method or a combination of methods while other components are integrated using another method or combination of methods.
Cell Lines for AAV-Implemented Protein Production
[0126] A cell line including AAV Large Rep Protein, Adenovirus (Ad) E4orf6, and Ad DBP as described above in the “Cell Lines Including AAV Large Rep Protein & Adenovirus E4orf6 and DBP” section may also be used for AAV-implemented protein production.
[0127] To use the cell lines described above for protein production, the gene of interest includes a polynucleotide encoding a protein. To ensure that the protein is expressed, the polynucleotide encoding the protein preferably comprises a transcription start site and a terminator sequence.
[0128] In some embodiments, the gene of interest includes a polynucleotide encoding an antibody or a fragment thereof. For example, the gene of interest may include a polynucleotide encoding an immunoglobulin heavy chain or a polynucleotide encoding an immunoglobulin light chain or both a polynucleotide encoding an immunoglobulin heavy chain and a polynucleotide encoding an immunoglobulin light chain.
[0129] In some embodiments, when the gene of interest includes a polynucleotide encoding an immunoglobulin heavy chain and a polynucleotide encoding an immunoglobulin light chain, the polynucleotide encoding an immunoglobulin heavy chain and the polynucleotide encoding an immunoglobulin light chain are operably linked to a polynucleotide encoding a self-cleaving peptide. Any suitable self-cleaving peptide may be used including, for example, EGRGSLLTCGDVEENPGP (T2A; SEQ ID NO:1) or ATNFSLLKQAGDVEENPGP (P2A; SEQ ID NO:). In an exemplary embodiment, the self-cleaving peptide includes P2A.
[0130] In some embodiments, the gene of interest may include a polynucleotide encoding a fluorescent marker. When the gene of interest may include a polynucleotide encoding a fluorescent marker, the polynucleotide encoding a fluorescent marker may be operably linked to the polynucleotide encoding the protein. The polynucleotide encoding the fluorescent marker and the polynucleotide encoding the protein may be operably linked to an internal ribosome entry site.
[0131] Construction of an exemplary cell line IR1-10 is described in Example 3, and a schematic of both the polynucleotides and their incorporation into HEK293 cells are shown in
Methods of Using Cell Lines for AAV-Implemented Protein Production
[0132] The cell lines described in the “Cell Lines for AAV-Implemented Protein Production” section may be used for any suitable use.
[0133] In some embodiments, a method of using the cells includes forming a clonal population of the stable mammalian cell line.
[0134] In some embodiments, a method of using the cells includes inducing the expression of the third polynucleotide encoding an adenovirus (Ad) DNA binding protein (DBP).
[0135] In some embodiments, a method of using the cells includes inducing the stable mammalian cell line to amplify the copy number of the gene of interest.
[0136] In some embodiments, a method of using the cells includes inducing stable mammalian cell line to express a protein encoded by the gene of interest.
[0137] The method may include exposing the cell to an induction molecule. The induction molecule may be selected based on the promoters incorporated in the cell line. For example, in the exemplary cell line IR1-10, described above and in Example 3, the induction molecule may include cumate, doxycycline (an inducer of the TetON system), and/or mifepristone (an inducer of the GENESWITCH system; Thermo Fisher Scientific, Inc. Waltham, Mass.).
[0138] Once the protein has been expressed, the method may include removing cellular components from the protein, recovering the protein, and/or isolating the protein.
[0139] In some embodiments, a method may include administering the protein to a subject.
Methods of Making Cell Lines for AAV-Implemented Protein Production
[0140] The components of a cell line for AAV-implemented protein production may be incorporated into a genome of a cell by any suitable means. In some embodiments, the cell is preferably a mammalian cell. The cell line may be selected for the presence in its genome of other helper genes. For example, adenovirus E1 gene is harbored in HEK293 cells.
[0141] In some embodiments, the components are preferably stably incorporated into a genome of a cell of a cell line.
[0142] For example, at least a first polynucleotide encoding an adeno-associated virus (AAV) large replicase (Rep) protein, a second polynucleotide encoding an adenovirus (Ad) E4orf6, a third polynucleotide encoding an Ad DNA binding protein (DBP), and a fourth polynucleotide encoding the protein to be produced may be stably incorporated into the cell. In some embodiments, as further described above, a fifth polynucleotide and/or a sixth polynucleotide encoding a selectable marker may also be stably incorporated into the cell. In some embodiments, as further described above, a seventh polynucleotide encoding a regulator may also be stably incorporated into the genome of the cell. In some embodiments, as further described above, an eighth polynucleotide encoding a regulator may also be stably incorporated into the genome of the cell.
[0143] The components may be stably integrated into the genome of the cell by any suitable means. Exemplary means include randomly integrating one or more of the components into the genome of the mammalian cell, integrating one or more of the components into the genome of the mammalian cell using CRISPR, integrating one or more of the components into the genome of the mammalian cell using a transposase, and/or integrating one or more of the components into the genome of the mammalian cell using a lentivirus. Some of the components may be integrated using one method or a combination of methods while other components are integrated using another method or combination of methods.
Cell Lines for AAV Titering
[0144] In another aspect, this disclosure describes a cell line that may be used to titer AAV including, for example, recombinant AAV (rAAV).
[0145] In producing viral vectors for gene therapy, it is important to know the titer of infectious viral particles as those viruses are the ones that can deliver the gene of interest (GOI) to the target cells. Among the particles produced there are many that are defective in their structure and cannot enter the cell or cannot express the GOI because the particle has a defective viral genome. Commonly used infectious titering schemes coinfect the assay cells with the rAAV and helper adenovirus. Upon entry to the assay cell the single-stranded rAAV cannot express its payload gene unless it becomes double stranded, either through hybridizing with a co-infected opposite-sense rAAV or by second-strand synthesis mediated by the host DNA polymerase. The adenovirus provides mechanisms for second-strand synthesis and assists the expression of the rAAV gene. In the laboratory, the payload gene is often a marker protein such as GFP or lacZ, and infectious titer can be effectively measured by counting the number of cells expressing the marker protein. For therapeutic applications, marker proteins are not used, so infectious titer can be measured by quantitative PCR of infected cells or by immunostaining to develop fluorescence.
[0146] Using adenovirus virions also has the unintended effect of assisting endosomal trafficking and release of rAAV vectors that can lead to over-estimating infectious titer for end-user applications where adenoviruses would not be present. To address this issue, Example 4 describes the construction of an assay cell line that does not require co-infection with a helper virus to quantify the infectious titer of rAAV that is replication defective. The assay cell line has in its engineered genome the helper gene from adenovirus that facilitates second-strand synthesis, as well as AAV and adenovirus genes that enable incoming rAAV to replicate. Yet, it lacks the capsid proteins to form and release virus particles. The resulting cell pool, called R2, allows for replication of incoming rAAV genomes, amplifying the copies of the payload gene and therefore its transcription and translation expression signal.
[0147] In some embodiments, the cell that may be used to titer AAV includes a first polynucleotide encoding an adeno-associated virus (AAV) large replicase (Rep) protein, a second polynucleotide encoding an adenovirus (Ad) E4orf6, and a third polynucleotide encoding an Ad DNA binding protein (DBP).
[0148] In some embodiments, the cell line is preferably a stable cell line (as opposed to a transiently transfected cell line). That is, each of the first, second, and third polynucleotides are integrated into the genome of the cell line and expression of the first, second, and third polynucleotides is not lost during cell culture.
[0149] Each of the first, second, and third polynucleotides is operably linked to a promoter. In some embodiments, the promoter may preferably be an exogenous promoter. For example, the first polynucleotide may be linked to a first promoter; the second polynucleotide may be linked to a second promoter; and the third polynucleotide may be linked to a third promoter. In some embodiments, however, some combination of the first, second, and third polynucleotides may be linked to the same promoter.
[0150] In an exemplary embodiment, the cell line is a mammalian cell line. The mammalian cell line, prior to incorporating the first, second, and third polynucleotides may include, for example, HEK293. The cell line may be selected for the presence in its genome of other helper genes. For example, adenovirus E1 gene is harbored in HEK293 cells.
[0151] The Ad E4orf6 and/or DBP may be derived from any suitable adenovirus or combination of adenoviruses. In some embodiments adenovirus type 2 (Ad2) or adenovirus type 5 (Ad5) may be preferred. In an exemplary embodiment, the Ad E4orf6 may include Ad2 E4orf6. In an exemplary embodiment, the Ad DBP may include Ad2 DBP.
[0152] As noted above, the first polynucleotide encodes a large Rep protein. The large Rep proteins include Rep68 and Rep78. In some embodiments, the large Rep protein may preferably be Rep68.
[0153] In some embodiments, the first polynucleotide may be operably linked to a destabilizing domain (DD). Any suitable destabilizing domain may be used. Exemplary destabilizing domains include an FK506-binding protein 12 (FKBP12) DD, a CMP8/4-OHT-estrogen receptor destabilized domain (ER50 DD), a trimethoprim (TMP)-Escherichia coli dihydrofolate reductase (DHFR) DD, and combinations and mutants thereof. In some embodiments, the DD may include an FKBP12 or a mutant FKBP12. An exemplary mutant FKBP12 destabilization domain is one that is responsive to Shield-1 ligand. Shield1 stabilizes proteins tagged with a mutated FKBP12-derived destabilization domain (DD) used in ProteoTuner systems (Takara Bio, Inc., Shiga, Japan). It is used to protect DD-tagged proteins from proteasomal degradation, resulting in rapid accumulation of the protein.
[0154] In some embodiments, the first polynucleotide may be operably linked a polynucleotide encoding a marker and/or a marker protein. The marker protein may include a fluorescent marker. In an exemplary embodiment, the marker protein may include mCherry.
[0155] As noted above, the first polynucleotide is operably linked to a promoter. In some embodiments, the promoter may preferably be an exogenous promoter. In some embodiments, the first polynucleotide may be operably linked to an inducible promoter or a repressible promoter. In some embodiments, the inducible promoter is preferably bound by a regulator. In an exemplary embodiment, an exogenous, inducible promoter includes a TetOn promoter.
[0156] The first polynucleotide may be operably linked to a terminator sequence. In an exemplary embodiment, the terminator sequence includes a beta-Globin poly A (bGpA).
[0157] The cell line may further include a fourth polynucleotide encoding a regulator (for example, a transactivator or a repressor). When the first polynucleotide is operably linked to an inducible promoter, the fourth polynucleotide may encode a transactivator, wherein the transactivator binds to the inducible promoter only when an induction molecule is present, or a repressor, wherein the repressor binds to the inducible promoter unless an induction molecule is present. For example, when the inducible promoter includes TetOn, the transactivator may include a reverse tet transactivator 3 (rtTA3). In some embodiments, the fourth polynucleotide may be operably linked to a constitutive promoter. Any suitable constitutive promoter may be used. Exemplary constitutive promoters include human phosphoglycerate kinase promoter (PGK), CMV promoter (P.sub.CMV), and human elongation factor 1 alpha promoter (P.sub.EF1α). In an exemplary embodiment, the constitutive promoter may include PGK.
[0158] In some embodiments, the fourth polynucleotide may further include a selectable marker. Any suitable selectable marker may be used including, for example, resistance to an antibiotic. Exemplary antibiotics include, for example, puromycin, hygromycin, zeocin, geneticin, blasticidin, etc. In an exemplary embodiment, the selectable marker may include a gene encoding hygromycin resistance (HygroR). The transactivator and the selectable marker may be linked by a polynucleotide encoding a self-cleaving peptide. Any suitable self-cleaving peptide may be used including, for example, EGRGSLLTCGDVEENPGP (T2A; SEQ ID NO:1) or ATNFSLLKQAGDVEENPGP (P2A; SEQ ID NO:2). In an exemplary embodiment, the self-cleaving peptide includes T2A.
[0159] As noted above, the second polynucleotide is operably linked to a promoter and the third polynucleotide is operably linked to a promoter. If operably linked, the second polynucleotide and the third polynucleotide may be operably linked to the same promoter. Any suitable promoter may be used. In some embodiments, the promoter of the second polynucleotide and/or the third polynucleotide may preferably be an exogenous promoter. In some embodiments, the promoter of the second polynucleotide and/or the third polynucleotide may preferably be an inducible promoter or a repressible promoter. In some embodiments, the inducible promoter is preferably bound by a regulator. In an exemplary embodiment, the exogenous promoter may include the GENESWITCH promoter (Thermo Fisher Scientific, Inc., Waltham, Mass.), a mifepristone-inducible hybrid promoter including Saccharomyces cerevisiae GAL4 upstream activating sequences (UAS) and a TATA box sequence from the adenovirus major late E1b gene.
[0160] The second polynucleotide and/or the third polynucleotide may be operably linked to a terminator sequence. In an exemplary embodiment, the terminator sequence includes a beta-Globin poly A (bGpA).
[0161] The cell line may further include a fifth polynucleotide encoding a regulator (for example, a transactivator or a repressor). When the second polynucleotide and/or third polynucleotide is operably linked to an inducible promoter, the fifth polynucleotide may encode a transactivator, wherein the transactivator binds to the inducible promoter only when an induction molecule is present, or a repressor, wherein the repressor binds to the inducible promoter unless an induction molecule is present. For example, when the inducible promoter includes the GENESWITCH promoter (Thermo Fisher Scientific, Inc., Waltham, Mass.), the transactivator may include the GENESWITCH protein (Thermo Fisher Scientific, Inc., Waltham, Mass.) that includes a DNA binding domain from the yeast GAL4 protein, a truncated ligand binding domain from the human progesterone receptor, and an activation domain from the human NF-kB protein. In some embodiments, the fifth polynucleotide may be operably linked to a promoter. When the transactivator includes the GENESWITCH protein (Thermo Fisher Scientific, Inc., Waltham, Mass.), the promoter may preferably be a hybrid promoter including GAL4 upstream activating sequences (containing 4 copies of the GAL4 binding site) linked to a minimal promoter from the Herpes Simplex Virus thymidine kinase (TK) gene (P.sub.G4-TK). In some embodiments, the fifth polynucleotide may be operably linked to a terminator sequence. In an exemplary embodiment, the terminator sequence includes a bovine growth hormone terminator sequence (BGHpA).
[0162] In addition to the fourth polynucleotide including a polynucleotide encoding a selectable marker or as an alternative to the fourth polynucleotide including a polynucleotide encoding a selectable marker, the cell line may further include a sixth polynucleotide encoding a selectable marker. Any suitable selectable marker may be used including, for example, resistance to an antibiotic. Exemplary antibiotics include, for example, puromycin, hygromycin, zeocin, geneticin, blasticidin, etc.
[0163] In an exemplary embodiment, as further described in Example 4, the first polynucleotide, second polynucleotide, the third polynucleotide, fourth polynucleotide, and the fifth polynucleotide may be included in a single module. (See
[0164] Construction of an exemplary cell line R2 is described in Example 4, and a schematic of both the polynucleotides and their incorporation into HEK293 cells is shown in
Methods of Using Cell Lines for Titering AAV
[0165] The cell line described above that may be used to titer AAV including may be used for any suitable purpose. In some aspects, the cell line may preferably be used to titer an AAV preparation.
[0166] To use the cell line to titer AAV, a cell of the cell line must be exposed to the sample to be tested. The cell line is preferably exposed to the sample under conditions to allow AAV (if any) in the sample to infect a cell (or, more preferably, cells) of the cell line.
[0167] The method may further include exposing the cell to an induction molecule. The induction molecule may be selected based on the promoters incorporated in the cell line. For example, in the exemplary cell line R2, described above and in Example 4, the induction molecule may include doxycycline (an inducer of the TetON system) and/or mifepristone (an inducer of the GENESWITCH system; Thermo Fisher Scientific, Inc., Waltham, Mass.).
[0168] The method may further include measuring the number of cells of the stable mammalian cell line infected with AAV. If, for example, the AAV expresses a fluorescent molecule (for example GFP), the presence of AAV in a cell may detected by detecting the fluorescent protein. If the AAV expresses another product protein, the presence of the AAV in the cell may be detected by detecting the presence of the product protein, including, for example, by immunofluorescence staining of product protein. Additionally or alternatively, the presence of the AAV in the cell may be detected by in situ fluorescent labelled hybridization of rAAV DNA or by qPCR.
Methods of Making Cell Lines for Titering AAV
[0169] The components of a cell line for titering AAV may be incorporated into a genome of a cell by any suitable means. In some embodiments, the cell is preferably a mammalian cell. The cell line may be selected for the presence in its genome of other helper genes. For example, adenovirus E1 gene is harbored in HEK293 cells.
[0170] In some embodiments, the components are preferably stably incorporated into a genome of a cell of a cell line.
[0171] For example, at least a first polynucleotide encoding an adeno-associated virus (AAV) large replicase (Rep) protein, a second polynucleotide encoding an adenovirus (Ad) E4orf6, and a third polynucleotide encoding an Ad DNA binding protein (DBP) may be stably incorporated into the cell. As further described above, a fifth polynucleotide encoding a regulator and/or a sixth polynucleotide encoding a regulator may also be stably incorporated into the cell. Additionally or alternatively, a seventh polynucleotide encoding a selectable marker may also be stably incorporated into the genome of the cell.
[0172] The components may be stably integrated into the genome of the cell by any suitable means. Exemplary means include randomly integrating one or more of the components into the genome of the mammalian cell, integrating one or more of the components into the genome of the mammalian cell using CRISPR, integrating one or more of the components into the genome of the mammalian cell using a transposase, and/or integrating one or more of the components into the genome of the mammalian cell using a lentivirus. Some of the components may be integrated using one method or a combination of methods while other components are integrated using another method or combination of methods.
First Exemplary Cell Lines for Recombinant AAV Production Embodiments
[0173] 1. A stable mammalian cell line comprising [0174] a first polynucleotide encoding an adeno-associated virus (AAV) large replicase (Rep) protein, wherein the first polynucleotide is operably linked to a promoter; [0175] a second polynucleotide encoding an adenovirus (Ad) E4orf6, wherein the second polynucleotide is operably linked to a promoter; and [0176] a third polynucleotide encoding an Ad DNA binding protein (DBP), wherein the third polynucleotide is operably linked to a promoter.
2. The stable mammalian cell line of Embodiment 1, further comprising a gene of interest, wherein the gene of interest is flanked by AAV inverted terminal repeats (ITRs), and wherein the gene of interest is integrated into the genome.
3. The stable mammalian cell line of Embodiment 2, wherein AAVS1 locus comprises the gene of interest.
4. The stable mammalian cell line of Embodiment 2 or 3, wherein the gene of interest is operably linked to promoter or a terminator sequence or both.
5. The stable mammalian cell line of Embodiment 4, wherein the promoter comprises a CAG promoter.
6. The stable mammalian cell line of Embodiment 4 or 5, wherein the terminator sequence comprises an SV40 terminator sequence.
7. The stable mammalian cell line of any one of Embodiments 2 to 6, wherein the gene of interest encodes a marker protein.
8. The stable mammalian cell line of any one of Embodiments 2 to 7, wherein the gene of interest comprises a fluorescent marker.
9. The stable mammalian cell line of any one of the preceding Embodiments, wherein the first polynucleotide comprises a nucleotide sequence encoding Rep78 or Rep68.
10. The stable mammalian cell line of any one of the preceding Embodiments, wherein the first polynucleotide is operably linked to a destabilizing domain (DD).
11. The stable mammalian cell line of Embodiment 10, wherein the DD comprises a mutant FKBP12 DD.
12. The stable mammalian cell line of any one of the preceding Embodiments, wherein the first polynucleotide is operably linked to an inducible promoter.
13. The stable mammalian cell line of Embodiment 12, wherein the inducible promoter comprises a CMV5 promoter and a cumate operator sequence.
14. The stable mammalian cell line of any one of the preceding Embodiments, wherein the first polynucleotide is operably linked to a polynucleotide encoding a marker.
15. The stable mammalian cell line of any one of Embodiments 12 to 14, the stable mammalian cell line further comprising a fourth polynucleotide encoding a regulator, wherein the regulator binds to the inducible promoter.
16. The stable mammalian cell line of Embodiment 15, wherein the fourth polynucleotide is operably linked to a promoter.
17. The stable mammalian cell line of Embodiment 15 or 16, wherein the regulator comprises cumate repressor (CymR).
15. The stable mammalian cell line of any one of the preceding Embodiments, the stable mammalian cell line further comprising a fifth polynucleotide encoding a selectable marker.
16. The stable mammalian cell line of Embodiment 15, wherein the selectable marker comprises Puromycin Resistance (PuroR).
17. The stable mammalian cell line of Embodiment 15 or 16, wherein the fifth polynucleotide is operably linked to a promoter.
18. The stable mammalian cell line of any one of Embodiments 15 to 17, wherein the fourth polynucleotide and the fifth polynucleotide are operably linked and, optionally, wherein the fourth polynucleotide and the fifth polynucleotide are operably linked to a polynucleotide encoding a self-cleaving peptide.
19. The stable mammalian cell line of Embodiment 18, wherein, the self-cleaving peptide comprises T2A.
20. The stable mammalian cell line of Embodiment 18 or 19, wherein the fourth polynucleotide and the fifth polynucleotide are operably linked to the same promoter.
21. The stable mammalian cell line of Embodiment 20, wherein the promoter comprises EF1α.
22. The stable mammalian cell line of any one of the preceding Embodiments, wherein the second polynucleotide and the third polynucleotide are operably linked and, optionally, wherein the second polynucleotide and the third polynucleotide are operably linked to a polynucleotide encoding a self-cleaving peptide.
23. The stable mammalian cell line of Embodiment 22, wherein, the self-cleaving peptide comprises P2A.
24. The stable mammalian cell line of Embodiment 22 or 23, wherein the second polynucleotide and the third polynucleotide are operably linked to the same promoter.
25. The stable mammalian cell line of Embodiment 24, wherein the promoter comprises TetOn.
26. The stable mammalian cell line of any one of the preceding Embodiments, the stable mammalian cell line further comprising a sixth polynucleotide encoding a second selectable marker.
27. The stable mammalian cell line of Embodiment 26, wherein the sixth polynucleotide is operably linked to a promoter.
28. The stable mammalian cell line of any one of the preceding Embodiments, the stable mammalian cell line further comprising a seventh polynucleotide encoding a reverse tetracycline transactivator.
29. The stable mammalian cell line of Embodiment 28, wherein the reverse tetracycline transactivator comprises rtTA3.
30. The stable mammalian cell line of Embodiment 29, wherein the seventh polynucleotide is operably linked to a promoter.
31. The stable mammalian cell line of any one of Embodiments 28 to 30, wherein the sixth polynucleotide and the seventh polynucleotide are operably linked to the same promoter.
32. The stable mammalian cell line of Embodiment 31, wherein the promoter comprises PGK.
33. The stable mammalian cell line of any one of Embodiments 28 to 32, wherein the sixth polynucleotide and the seventh polynucleotide are operably linked and, optionally, wherein the sixth polynucleotide and the seventh polynucleotide are operably linked to a polynucleotide encoding a self-cleaving peptide.
34. The stable mammalian cell line of Embodiment 33, wherein, the self-cleaving peptide comprises T2A.
35. The stable mammalian cell line of any one of the preceding Embodiments, wherein the Ad E4orf6 comprises Ad2 E4orf6.
36. The stable mammalian cell line of any one of the preceding Embodiments, wherein the Ad DBP comprises Ad2 DBP.
37. The stable mammalian cell line of any one of the preceding Embodiments, wherein the stable mammalian cell line comprises GR1-5.
First Exemplary Methods of Using the Cell Lines for Recombinant AAV Production
[0177] 1. A method of using the stable mammalian cell line of any one of the First Exemplary Cell Lines for Recombinant AAV Production Embodiments.
2. The method of Embodiment 1, the method comprising forming a clonal population of the stable mammalian cell line.
3. The method of any one of the preceding Embodiments, the method comprising modulating the expression of the large Rep protein, the expression of E4orf6, the expression of adenovirus (Ad) DNA binding protein (DBP), or the expression of the gene of interest, or a combination thereof, to maximize the fraction of particles comprising a gene of interest.
4. The method of any one of the preceding Embodiments, the method comprising transfecting a cell of the stable mammalian cell line with an eighth polynucleotide encoding an adeno-associated virus (AAV) capsid protein operably linked to a first promoter and a ninth polynucleotide encoding a small Rep protein operably linked to a second promoter.
5. The method of Embodiment 4, wherein the eighth polynucleotide comprises AAV cap.
6. The method of Embodiment 5, wherein the wherein the cap gene comprises serotypes DJ, 2, or 8.
7. The method of any one of Embodiments 4 to 6, wherein the AAV capsid protein comprises VP1, VP2, VP3, assembly-activating protein (AAP), or membrane-associated accessory protein (MAAP), or a mutant thereof, or a combination thereof.
8. The method of any one of Embodiments 4 to 7, wherein the first promoter comprises a CMV promoter.
9. The method of any one of Embodiments 4 to 8, wherein the second promoter comprises a phosphoglycerate kinase (PGK) promoter.
10. The method of any one of Embodiments 4 to 7, wherein the eighth polynucleotide and ninth polynucleotide are operably linked and wherein an internal ribosome entry site (IRES) is operably linked to the eighth polynucleotide and ninth polynucleotide.
11. The method of any one of Embodiments 4 to 10, the method comprising harvesting adeno-associated virus (AAV) particles.
12. The method of Embodiment 11, the method comprising removing cellular components from the AAV particle.
13. The method of Embodiment 11 or 12, the method comprising administering the AAV particle to a subject.
Second Exemplary Cell Lines for Recombinant AAV Production Embodiments
[0178] 1. A stable mammalian cell line comprising [0179] a first polynucleotide encoding an adeno-associated virus (AAV) large replicase (Rep) protein, wherein the first polynucleotide is operably linked to a promoter; [0180] a second polynucleotide encoding adenovirus (Ad) E4orf6, wherein the second polynucleotide is operably linked to a promoter; [0181] a third polynucleotide encoding an Ad DNA binding protein (DBP), wherein the third polynucleotide is operably linked to a promoter; [0182] a fourth polynucleotide encoding an AAV capsid protein, wherein the fourth polynucleotide is operably linked to a promoter; and [0183] a fifth polynucleotide encoding an AAV small Rep protein, wherein the fifth polynucleotide is operably linked to a promoter.
2. The stable mammalian cell line of Embodiment 1, further comprising a gene of interest, wherein the gene of interest is flanked by AAV inverted terminal repeats (ITRs), and wherein the gene of interest is integrated into the genome.
3. The stable mammalian cell line of Embodiment 2, wherein a polynucleotide comprising the gene of interest further comprises a polynucleotide encoding a selectable marker.
4. The stable mammalian cell line of Embodiment 2 or 3, wherein the gene of interest is operably linked to a promoter or a terminator sequence or both.
5. The stable mammalian cell line of Embodiment 4, wherein the promoter comprises a CAG promoter.
6. The stable mammalian cell line of Embodiment 4 or 5, wherein the wherein the terminator sequence comprises an SV40 terminator sequence.
7. The stable mammalian cell line of any one of Embodiments 2 to 6, wherein the gene of interest encodes a marker protein.
8. The stable mammalian cell line of any one of Embodiments 2 to 7, wherein the gene of interest comprises a fluorescent marker.
9. The stable mammalian cell line of any one of the preceding Embodiments, wherein the first polynucleotide comprises a nucleotide sequence encoding Rep78 or Rep68.
10. The stable mammalian cell line of any one of the preceding Embodiments, wherein the first polynucleotide is operably linked to a destabilizing domain (DD).
11. The stable mammalian cell line of Embodiment 10, wherein the DD comprises a mutant FKBP12 DD.
12. The stable mammalian cell line of any one of the preceding Embodiments, wherein the first polynucleotide is operably linked to TetOn.
13. The stable mammalian cell line of any one of the preceding Embodiments, wherein the first polynucleotide is operably linked to polynucleotide encoding a marker.
14. The stable mammalian cell line of any one of the preceding Embodiments, wherein the second polynucleotide is operably linked to an inducible promoter.
15. The stable mammalian cell line of Embodiment 14, wherein the inducible promoter comprises a mifepristone-inducible hybrid promoter comprising Saccharomyces cerevisiae GAL4 upstream activating sequences (UAS) and a TATA box sequence from the adenovirus major late E1b gene.
16. The stable mammalian cell line of any one of the preceding Embodiments, wherein the second polynucleotide and the third polynucleotide are operably linked and, optionally, wherein the second polynucleotide and the third polynucleotide are operably linked to a polynucleotide encoding a self-cleaving peptide.
17. The stable mammalian cell line of Embodiment 16, wherein, the self-cleaving peptide comprises P2A.
18. The stable mammalian cell line of Embodiment 16 or 17, wherein the second polynucleotide and the third polynucleotide are operably linked to the same promoter.
19. The stable mammalian cell line of Embodiment 14, 16, or 18, wherein the inducible promoter comprises a mifepristone-inducible hybrid promoter comprising Saccharomyces cerevisiae GAL4 upstream activating sequences (UAS) and a TATA box sequence from the adenovirus major late E1b gene.
20. The stable mammalian cell line of any one of the preceding Embodiments wherein the fourth polynucleotide comprises AAV cap.
21. The method of Embodiment 20, wherein the wherein the cap gene comprises the serotypes DJ, 2, or 8.
22. The method of any one of the preceding Embodiments, wherein the AAV capsid protein comprises VP1, VP2, VP3, assembly-activating protein (AAP), or membrane-associated accessory protein (MAAP), or a combination thereof.
23. The stable mammalian cell line of any one of the preceding Embodiments, wherein the AAV small Rep protein comprises Rep40 or Rep52.
24. The stable mammalian cell line of any one of the preceding Embodiments, wherein the fourth polynucleotide and the fifth polynucleotide are operably linked and, optionally, wherein the fourth polynucleotide and the fifth polynucleotide are operably linked to an internal ribosome entry site.
25. The stable mammalian cell line of any one of the preceding Embodiments, wherein the fourth polynucleotide and/or the fifth polynucleotide are operably linked to an inducible promoter.
26. The stable mammalian cell line of Embodiment 25, wherein the inducible promoter comprises a CMV5 promoter and a cumate operator sequence.
27. The stable mammalian cell line of any one the preceding Embodiments, the stable mammalian cell line further comprising a sixth polynucleotide encoding a regulator, and wherein the sixth polynucleotide is operably linked to a promoter.
28. The stable mammalian cell line of Embodiment 27, wherein the sixth polynucleotide encodes a reverse tetracycline transactivator.
29. The stable mammalian cell line of Embodiment 28, wherein the reverse tetracycline transactivator comprises rtTA3.
30. The stable mammalian cell line of any one the preceding Embodiments, the stable mammalian cell line further comprising a seventh polynucleotide encoding a regulator of the mifepristone-inducible hybrid promoter.
31. The stable mammalian cell line of Embodiment 30, wherein the regulator of the mifepristone-inducible hybrid promoter comprises a DNA binding domain from the yeast GAL4 protein, a truncated ligand binding domain from the human progesterone receptor, and an activation domain from the human NF-kB protein.
32. The stable mammalian cell line of any one of Embodiments 14 to 31, the stable mammalian cell line further comprising an eighth polynucleotide encoding a regulator, wherein the regulator binds to the inducible promoter.
33. The stable mammalian cell line of Embodiment 32, wherein the eighth polynucleotide is operably linked to an inducible promoter, and wherein the regulator comprises cumate repressor (CymR).
34. The stable mammalian cell line of any one of the preceding Embodiments, the stable mammalian cell line further comprising a ninth polynucleotide encoding a selectable marker.
35. The stable mammalian cell line of Embodiment 34, wherein the selectable marker comprises Puromycin Resistance (PuroR), Hygromycin B resistance (HygroR), or Blasticidin resistance (BlastR), or a combination thereof.
36. The stable mammalian cell line of Embodiment 34 or 35, wherein the ninth polynucleotide is operably linked to a promoter.
37. The stable mammalian cell line of any one of the preceding Embodiments, wherein the gene of interest, the first polynucleotide, the second polynucleotide, the third polynucleotide, the fourth polynucleotide, the fifth polynucleotide, the sixth polynucleotide, or the seventh polynucleotide, or a combination thereof are flanked by inverted terminal repeats (ITRs) of a transposon.
38. The stable mammalian cell line of any one of the preceding Embodiments, wherein the stable mammalian cell line comprises GR2C3.
Second Exemplary Methods of Using the Cell Lines for Recombinant AAV Production
[0184] 1. A method of using the stable mammalian cell line of any one of the Second Exemplary Cell Lines for Recombinant AAV Production Embodiments.
2. The method of Embodiment 1, the method comprising forming a clonal population of the stable mammalian cell line.
3. The method of Embodiment 1 or 2, the method comprising modulating the expression of the large Rep protein, the expression of Ad E4orf6, the expression of Ad DBP, the expression of an AAV capsid protein, or the expression of the AAV small Rep protein, or a combination thereof, to maximize the fraction of particles comprising a gene of interest.
4. The method of Embodiment 1 or 2, the method comprising modulating the expression of the large Rep protein, the expression of Ad E4orf6, the expression of Ad DBP, the expression of an AAV capsid protein, or the expression of the AAV small Rep protein, or a combination thereof, to maximize virus titer.
5. The method of any one of the preceding Embodiments, the method further comprising harvesting an associated virus (AAV) particle.
6. The method of Embodiment 5, the method comprising removing cellular components from the AAV particle.
7. The method of Embodiment 5 or 6, the method comprising administering the AAV particle to a subject.
Exemplary Methods of Making the Cell Lines for Recombinant AAV Production
[0185] 1. A method comprising stably integrating into a mammalian cell [0186] a first polynucleotide encoding an adeno-associated virus (AAV) large replicase (Rep) protein, wherein the first polynucleotide is operably linked to a promoter; [0187] a second polynucleotide encoding an adenovirus (Ad) E4orf6, wherein the second polynucleotide is operably linked to a promoter; [0188] a third polynucleotide encoding an Ad DNA binding protein (DBP), wherein the third polynucleotide is operably linked to a promoter; and [0189] a gene of interest, wherein the gene of interest is flanked by inverted terminal repeats (ITRs).
2. The method of Embodiment 1, wherein method comprises integrating the gene of interest into the AAVS1 locus of the mammalian cell.
3. The method of Embodiment 1 or 2, the method further comprising stably integrating into a mammalian cell [0190] a fourth polynucleotide encoding an AAV capsid protein, wherein the fourth polynucleotide is operably linked to a promoter; and [0191] a fifth polynucleotide encoding an AAV small Rep protein, wherein the fifth polynucleotide is operably linked to a promoter.
4. The method of any one of the preceding Embodiments, wherein the first polynucleotide, the second polynucleotide, the third polynucleotide, the fourth polynucleotide, or the fifth polynucleotide, or a combination thereof, are randomly integrated into the genome of the mammalian cell.
5. The method of any one of the preceding Embodiments, wherein the first polynucleotide, the second polynucleotide, the third polynucleotide, the fourth polynucleotide, or the fifth polynucleotide, or a combination thereof are integrated into the genome of the mammalian cell using CRISPR.
6. The method of any one of the preceding Embodiments, wherein the first polynucleotide, the second polynucleotide, the third polynucleotide, the fourth polynucleotide, or the fifth polynucleotide, or a combination thereof are integrated into the genome of the mammalian cell using a transposase.
7. The method of any one of the preceding Embodiments, wherein the first polynucleotide, the second polynucleotide, the third polynucleotide, the fourth polynucleotide, or the fifth polynucleotide, or a combination thereof are integrated into the genome of the mammalian cell using lentiviral integration.
Exemplary Cell Lines for AAV-Implemented Protein Production Embodiments
[0192] 1. The stable mammalian cell line of any one of the First Exemplary Cell Lines for Recombinant AAV Production Embodiments, wherein the gene of interest comprises a polynucleotide encoding a protein.
2. The stable mammalian cell line of Embodiment 1, wherein the polynucleotide encoding the protein comprises a transcription start site and a terminator sequence.
3. The stable mammalian cell line of Embodiment 1 or 2, wherein the gene of interest comprises a polynucleotide encoding an antibody or a fragment thereof.
4. The stable mammalian cell line of Embodiment 3, wherein the gene of interest comprises a polynucleotide encoding an immunoglobulin heavy chain, or a polynucleotide encoding an immunoglobulin light chain, or both.
5. The stable mammalian cell line of Embodiment 3 or 4, wherein the gene of interest comprises a polynucleotide encoding an immunoglobulin heavy chain and a polynucleotide encoding an immunoglobulin light chain, wherein the polynucleotide encoding an immunoglobulin heavy chain and the polynucleotide encoding an immunoglobulin light chain are operably linked to a polynucleotide encoding a self-cleaving peptide.
6. The stable mammalian cell line of Embodiment 5, wherein, the self-cleaving peptide comprises P2A.
7. The stable mammalian cell line of any one of the preceding Embodiments, wherein the gene of interest further comprises a polynucleotide encoding a fluorescent marker.
8. The stable mammalian cell line of Embodiment 7, wherein the polynucleotide encoding a fluorescent marker is operably linked to the polynucleotide encoding a protein, and wherein the polynucleotide encoding a fluorescent marker and the polynucleotide encoding a protein are operably linked to an internal ribosome entry site.
9. The stable mammalian cell line of any one of the preceding Embodiments, wherein the stable mammalian cell line comprises IR1-10.
Exemplary Methods of Using the Cell Lines for Protein Production
[0193] 1. A method of using the stable mammalian cell line of any one of the Exemplary Cell Lines for AAV-Implemented Protein Production Embodiments.
2. The method of Embodiment 1, the method comprising forming a clonal population of the stable mammalian cell line.
3. The method of any one of the preceding Embodiments, the method comprising inducing the expression of the third polynucleotide encoding an adenovirus (Ad) DNA binding protein (DBP).
4. The method of any one of the preceding Embodiments, the method comprising inducing the stable mammalian cell line to amplify the copy number of the gene of interest.
5. The method of any one of the preceding Embodiments, the method comprising inducing the stable mammalian cell line to express a protein encoded by the gene of interest.
6. The method of Embodiment 5, the method comprising removing cellular components from the protein.
7. The method of Embodiment 5 or 6, the method comprising isolating the protein.
8. The method of any one of Embodiments 5 to 7, the method comprising administering the protein to a subject.
Exemplary Methods of Making the Cell Lines for Recombinant AAV Production
[0194] 1. A method comprising stably integrating into a mammalian cell [0195] a first polynucleotide encoding an adeno-associated virus (AAV) large replicase (Rep) protein, wherein the first polynucleotide is operably linked to a promoter; [0196] a second polynucleotide encoding an adenovirus (Ad) E4orf6, wherein the second polynucleotide is operably linked to a promoter; [0197] a third polynucleotide encoding an Ad DNA binding protein (DBP), wherein the third polynucleotide is operably linked to a promoter; and [0198] a gene of interest, wherein the gene of interest is flanked by inverted terminal repeats (ITRs).
2. The method of Embodiment 1, wherein the gene of interest is randomly integrated into the genome of the mammalian cell.
3. The method of Embodiment 1 or 2, wherein the gene of interest comprises a polynucleotide encoding a protein.
4. The method of Embodiment 1, wherein the gene of interest comprises a polynucleotide encoding an antibody or a fragment thereof.
5. The method of Embodiment 4, wherein the gene of interest comprises a polynucleotide encoding an immunoglobulin heavy chain, or a polynucleotide encoding an immunoglobulin light chain, or both.
6. The method of any one of the preceding Embodiments, wherein the first polynucleotide, the second polynucleotide, or the third polynucleotide, or a combination thereof are randomly integrated into genome of the mammalian cell.
7. The method of any one of the preceding Embodiments, wherein the first polynucleotide, the second polynucleotide, or the third polynucleotide, or a combination thereof are integrated using CRISPR.
8. The method of any one of the preceding Embodiments, wherein the first polynucleotide, the second polynucleotide, or the third polynucleotide, or a combination thereof are integrated using a transposase.
9. The method of any one of the preceding Embodiments, wherein the first polynucleotide, the second polynucleotide, or the third polynucleotide, or a combination thereof are integrated using lentiviral integration.
Exemplary Titering Cell Line Embodiments
[0199] 1. A stable mammalian cell line comprising [0200] a first polynucleotide encoding an adeno-associated virus (AAV) large replicase (Rep) protein, wherein the first polynucleotide is operably linked to a promoter; [0201] a second polynucleotide encoding an adenovirus (Ad) E4orf6, wherein the second polynucleotide is operably linked to a promoter; and [0202] a third polynucleotide encoding an Ad DNA binding protein (DBP), wherein the third polynucleotide is operably linked to a promoter.
2. The stable mammalian cell line of Embodiment 1, wherein the first polynucleotide comprises a nucleotide sequence encoding Rep78 or Rep68.
3. The stable mammalian cell line of any one of the preceding Embodiments, wherein the first polynucleotide is operably linked to a destabilizing domain (DD).
4. The stable mammalian cell line of Embodiment 3, wherein the DD comprises a mutant FKBP12 DD.
5. The stable mammalian cell line of any one of the preceding Embodiments, wherein the first polynucleotide is operably linked to polynucleotide encoding a marker.
6. The stable mammalian cell line of any one of the preceding Embodiments, wherein the first polynucleotide is operably linked to an inducible promoter.
7. The stable mammalian cell line of any one of the preceding Embodiments, wherein the first polynucleotide is operably linked to TetOn.
8. The stable mammalian cell line of Embodiment 6 or 7, the stable mammalian cell line further comprising a fourth polynucleotide encoding a regulator, wherein the regulator binds to the inducible promoter.
9. The stable mammalian cell line of Embodiment 8, wherein the fourth polynucleotide encodes a reverse tetracycline transactivator.
10. The stable mammalian cell line of Embodiment 9, wherein the reverse tetracycline transactivator comprises rtTA3.
11. The stable mammalian cell line of any one of Embodiments 8 to 10, wherein the fourth polynucleotide is operably linked to a promoter.
12. The stable mammalian cell line of any one of Embodiments 8 to 11, wherein the fourth polynucleotide further encodes a selectable marker.
13. The stable mammalian cell line of Embodiment 12, wherein the selectable marker comprises Puromycin Resistance (PuroR), Hygromycin B resistance (HygroR), or Blasticidin resistance (BlastR), or a combination thereof.
14. The stable mammalian cell line Embodiment 12 or 13, wherein the fourth polynucleotide comprises a polynucleotide encoding a self-cleaving peptide.
15. The stable mammalian cell line of Embodiment 14, wherein, the self-cleaving peptide comprises T2A.
16. The stable mammalian cell line of any one of the preceding Embodiments, wherein the second polynucleotide and the third polynucleotide are operably linked and, optionally, wherein the second polynucleotide and the third polynucleotide are operably linked to a polynucleotide encoding a self-cleaving peptide.
17. The stable mammalian cell line of Embodiment 16, wherein, the self-cleaving peptide comprises P2A.
18. The stable mammalian cell line of Embodiment 16 or 17, wherein the second polynucleotide and the third polynucleotide are operably linked to the same promoter.
19. The stable mammalian cell line of Embodiment 18, wherein the promoter comprises an inducible promoter.
20. The stable mammalian cell line of Embodiment 18 or 19, wherein the promoter comprises a mifepristone-inducible hybrid promoter comprising Saccharomyces cerevisiae GAL4 upstream activating sequences (UAS) and a TATA box sequence from the adenovirus major late E1b gene.
21. The stable mammalian cell line of Embodiment 19 or 20, the stable mammalian cell line further comprising a fifth polynucleotide encoding a regulator, wherein the regulator binds to the inducible promoter.
22. The stable mammalian cell line of Embodiment 21, wherein the fifth polynucleotide encodes a regulator of the mifepristone-inducible hybrid promoter.
23. The stable mammalian cell line of Embodiment 22, wherein the regulator of the mifepristone-inducible hybrid promoter comprises a DNA binding domain from the yeast GAL4 protein, a truncated ligand binding domain from the human progesterone receptor, and an activation domain from the human NF-kB protein.
24. The stable mammalian cell line of any one of Embodiments 21 to 23, wherein the fifth polynucleotide is operably linked to a promoter.
25. The stable mammalian cell line of any one of the preceding Embodiments, wherein the stable mammalian cell line comprises R2.
Exemplary Methods of Using the Titering Cell Lines
[0203] 1. A method of using the stable mammalian cell line of any one of the Exemplary Titering Cell Line Embodiments.
2. The method of Embodiment 1, the method comprising exposing cells of the stable mammalian cell line to a sample.
3. The method of Embodiment 2, where the sample comprises AAV.
4. The method of any one of the preceding Embodiments, the method comprising exposing the cells to an induction molecule.
4. The method of any one of the preceding Embodiments, the method comprising measuring the number of cells of the stable mammalian cell line infected with AAV.
Exemplary Methods of Making the Titering Cell Lines
[0204] 1. A method comprising stably integrating into a genome of a mammalian cell [0205] a first polynucleotide encoding an adeno-associated virus (AAV) large replicase (Rep) protein, wherein the first polynucleotide is operably linked to a promoter; [0206] a second polynucleotide encoding an adenovirus (Ad) E4orf6, wherein the second polynucleotide is operably linked to a promoter; and [0207] a third polynucleotide encoding an Ad DNA binding protein (DBP), wherein the third polynucleotide is operably linked to a promoter.
2. The method of Embodiment 1, the method further comprising stably integrating into the genome of the mammalian cell [0208] a fourth polynucleotide encoding a regulator.
3. The method of Embodiment 2, wherein the fourth polynucleotide further comprises encoding a selectable marker.
4. The method of any one of the preceding Embodiments, the method further comprising stably integrating into the genome of the mammalian cell [0209] a fifth polynucleotide encoding a regulator.
5. The method of any one of the preceding Embodiments, the method further comprising stably integrating into the genome of the mammalian cell [0210] a sixth polynucleotide encoding a selectable marker.
6. The method of any one of the preceding Embodiments, wherein the first polynucleotide, the second polynucleotide, the third polynucleotide, the fourth polynucleotide, the fifth polynucleotide, or the sixth polynucleotide or a combination thereof, are randomly integrated into the genome of the mammalian cell.
5. The method of any one of the preceding Embodiments, wherein the first polynucleotide, the second polynucleotide, the third polynucleotide, the fourth polynucleotide, the fifth polynucleotide, or the sixth polynucleotide, or a combination thereof are integrated into the genome of the mammalian cell using CRISPR.
6. The method of any one of Embodiments 1 to 5, wherein the first polynucleotide, the second polynucleotide, the third polynucleotide, the fourth polynucleotide, the fifth polynucleotide, or the sixth polynucleotide, or a combination thereof are integrated into the genome of the mammalian cell using a transposase.
7. The method of any one of Embodiments 1 to 5, wherein the first polynucleotide, the second polynucleotide, the third polynucleotide, the fourth polynucleotide, the fifth polynucleotide, or the sixth polynucleotide, or a combination thereof are integrated into the genome of the mammalian cell using a lentivirus.
[0211] The present invention is illustrated by the following examples. It is to be understood that the particular examples, materials, amounts, and procedures are to be interpreted broadly in accordance with the scope and spirit of the invention as set forth herein.
EXAMPLES
Materials and Methods
[0212] All reagents, starting materials, and solvents used in the following examples were purchased from commercial suppliers (such as Sigma Aldrich, St. Louis, Mo.) and were used without further purification unless otherwise indicated.
Cell Culture
[0213] HEK293 cells (Cell Biolabs, Inc., San Diego, Calif.) and derived cells were cultured in Dulbecco's Modified Eagle Medium (DMEM) (GIBCO, Thermo Fisher Scientific, Waltham, Mass.) with 10% Fetal Bovine Serum (FBS) (GIBCO, Thermo Fisher Scientific, Waltham, Mass.) in a 37° C. incubator with 5% CO.sub.2.
Plasmids
[0214] An insert from pAAV-GFP (Cell Biolabs, Inc., San Diego, Calif.) was used for construction of rAAV-GFP constructs. The pHelper plasmid (Cell Biolabs, Inc., San Diego, Calif.) was used for infectious titering and for PCR-based cloning of adenovirus gene products E4orf6 and DBP into transposon integration. The pAAV-RC2 plasmid (Cell Biolabs, Inc., San Diego, Calif.) was used for PCR-based cloning of the capsid gene into transient transfection and transposon integration constructs. The Rep68 and Rep52 coding sequences were custom synthesized (Integrated DNA Technologies, Inc. (IDT), Coralville, Iowa). The inducible systems TetON (pTRE-Tight, Takara Bio, Shiga, Japan), Cumate Switch (System Biosciences, LLC (SBI), Palo Alto, Calif.), and GENESWITCH (Thermo Fisher Scientific, Waltham, Mass.) were used either in their supplied vectors or cloned into lentiviral/transposon vectors.
[0215] Molecular assembly of synthetic gene expression cassettes was done with NEBuilder HiFi DNA Assembly Mix (New England Biolabs, Inc., Ipswich, Mass.) with PCR or restriction fragments of constituent pieces. Final lentiviral destination vectors were based on pLenti, pLOVE or pCDH (System Biosciences, LLC (SBI), Palo Alto, Calif.), and final transposon destination vectors were based on antibiotic-selection variants of pATUM (ATUM, Newark, Calif.).
[0216] Exemplary coding sequences and the sequence of the AAV2 cap gene are provided in Table 1.
CRISPR/Cas9
[0217] The mMESSAGE mMACHINE T7 Ultra kit (Invitrogen, Carlsbad, Calif.) was used to in vitro transcribe eSpCas9 (1.1) mRNA and the MEGAshortscript T7 Transcription kit (Invitrogen, Carlsbad, Calif.) was used to in vitro transcribe AAVS1 sgRNA. The MEGAclear Transcription Clean-Up kit (Invitrogen, Carlsbad, Calif.) was used to purify the resulting RNA. The donor vector was constructed with the rAAV-GFP or rAAV-IgG-dGFP genome flanked by 500 bp AAVS1 homology arms into a BFP/HSVtk dual negative selection vector. HEK293 cells were transfected with Cas9 mRNA, sgRNA, and donor plasmid using Lipofectamine 3000 (Invitrogen, Carlsbad, Calif.) and passaged for two weeks to dilute out transient plasmid copies. Cells were then sorted on a BD FACSAria II sorter with the 100 μm nozzle, and GFP-positive, BFP-negative cells were sorted at one cell per well into a 96-well plate. On day four, 80 μM of Ganciclovir was added to induce HSVtk-mediated killing of off-target clones. Clones were expanded and assayed by junction PCR to confirm correct integration.
Lentiviral Integration
[0218] Recombinant lentiviruses were generated by co-transfecting transfer plasmid, psPAX2, and pMD2.G into HEK293T cells using Lipofectamine 3000 (Invitrogen, Carlsbad, Calif.). Virus-containing supernatant was harvested 54 hours post transfection and filtered. Transduction of HEK293 cells was done at low MOI (MOI<0.5) for low-copy integration.
Transposon Integration
[0219] Transposon vectors were co-transfected into HEK293 cells with Leap-In Transposase (ATUM) using Lipofectamine 3000 (Invitrogen, Carlsbad, Calif.). Selection pressure using the appropriate antibiotics were used for two weeks at the following concentrations: 2 μg/mL puromycin, 10 μg/mL blasticidin, 200 μg/mL Hygromycin.
rAAV Harvest and Infection
[0220] Recombinant AAV was harvested from producer cells by detaching cells using Accutase (BioLegend, San Diego, Calif.) and resuspending cell pellet in Dulbecco's Modified Eagle Medium (DMEM). The cell suspension was frozen and thawed three times by alternating between an ethanol/dry ice bath and a 37° C. water bath. The mixture was treated with benzonase (Sigma-Aldrich, St. Louis, Mo.) for one hour at 37° C. to digest non-encapsidated DNA, then centrifuged and filtered through a 0.45 μm PES filter (CELLTREAT Scientific Products, Pepperell, Mass.) to remove cell debris. These crude AAV preparations were added to target cells for transduction.
AAV Infectious Titer Assay
[0221] An infectious titer assay was performed by inducing R2 or RM4 replication competent cells overnight and adding rAAV-GFP virus prep at low concentration. Cells were observed by microscopy two days later and the fraction of GFP-positive cells was calculated using quantitative image analysis (ImageJ). Cells were also counted by flow cytometry measurement of GFP or immunostaining of GFP protein. The number of infectious virions was divided by the volume of virus prep added to yield the infectious titer.
Cell Line Induction with Small Molecules
[0222] During cell seeding, small molecule inducers doxycycline hyclate (Sigma-Aldrich, St. Louis, Mo.), mifepristone (Thermo Fisher Scientific, Waltham, Mass.), and cumate (System Biosciences, Palo Alto, Calif.) were added at the appropriate concentrations.
Addition of rAAV Genome Vectors into Packaging Cell Lines
[0223] Plasmid rAAV genome vectors were transiently transfected into packaging cell lines using Lipofectamine 3000 (Invitrogen, Carlsbad, Calif.). Upon transfection, cells were induced and then cultured for four days before harvest. Seed rAAV viruses were used in a similar fashion, but instead of transient transfection with plasmids, packaging cells were infected with rAAV seed virus at an MOI of one.
Quantitative Polymerase Chain Reaction (qPCR) of Packaged Virus Genome Titration
[0224] Viral preps were digested by proteinase K (Fisher BioReagents, Pittsburgh, Pa.) and DNA was purified using the Zymoclean Gel DNA Recovery Kit (Zymo research, Irvine, Calif.). Quantitative PCR was conducted using SYBR™ Select PCR Master Mix (Thermo Fisher Scientific, Waltham, Mass.) on PCR detection system (CFX Connect Real-Time PCR detection system, Bio-Rad Laboratories, Inc., Hercules, Calif.).
Enzyme-Linked Immunosorbent Assay (ELISA) of Assembled AAV2 Capsids
[0225] The AAV2 titration ELISA kit (Progen Biotechnik GmbH, Heidelberg, Germany) was used to determine the concentration of assembled AAV2 capsids in viral preps according to the manufacturer's protocol.
Flow Cytometry Assays
[0226] Cells were detached and analyzed on a BD LSR II flow cytometer for GFP fluorescence. For immunofluorescence detection of GFP expression, detached cells were fixed with 4% paraformaldehyde, permeabilized with 0.2% Triton X-100, incubated with mouse anti-GFP (Sigma G6539), then incubated with goat anti-mouse F(ab′)2 fragment, Alexa Fluor 647 conjugate (Invitrogen A-21237). Then cells were analyzed by flow cytometry (BD LSR II, BD Biosciences, San Jose, Calif.) for Alexa Fluor 647 fluorescence.
Infectious Titer Plate Assay
[0227] The plate assay for infectious titer used quantitative PCR-based detection of replication events. Cells were seeded in a 96-well and induced with 5μg/mL doxycycline and 10 nM mifepristone. Varying dilutions of rAAV2-GFP stock suspension were added to the wells in replicates of ten the following day. After a two-day incubation period, cellular DNA was harvested by QUICKEXTRACT solution (Lucigen Corp., Middleton, Wis.) and quantitative PCR was run using primers against GFP. Wells with cycle numbers three standard deviations below untransduced wells were considered positive. The Spearman-Kärber method was used to determine the 50% tissue culture infective dose, TCID.sub.50.
TABLE-US-00001 TABLE 1 Name Nucleotide Sequence mutant atgggagtgcaggttgaaaccatctccccaggagacgggcgcaccttccccaagcgcggccagacctgtgtggtgcactacaccgg FKBP12 DD gatgcttgaagatggaaagaaagtcgattcctcccgggacagaaacaagccctttaagtttatgctaggcaagcaggaggtgatccga (lower- ggctgggaagaaggggttgcccagatgagtgtgggtcagagagccaaactgactatatctccagattatgcctatggtgccactgggc case)- acccaggcatcatcccaccacatgccactctcgtgttcgatgtggagcttctaaaaccggaaggtgctacgcgtctgcccggatccatg mCherry gtgagcaagggcgaggaggataacatggccatcatcaaggagttcatgcgcttcaaggtgcacatggagggctccgtgaacggcca (lower- cgagttcgagatcgagggcgagggcgagggccgcccctacgagggcacccagaccgccaagctgaaggtgaccaagggtggcc case, ccctgcccttcgcctgggacatcctgtcccctcagttcatgtacggctccaaggcctacgtgaagcaccccgccgacatccccgacta underlined)- cttgaagctgtccttccccgagggcttcaagtgggagcgcgtgatgaacttcgaggacggcggcgtggtgaccgtgacccaggactc Rep68 ctccctgcaggacggcgagttcatctacaaggtgaagctgcgcggcaccaacttcccctccgacggccccgtaatgcagaagaaga (upper-case) ccatgggctgggaggcctcctccgagcggatgtaccccgaggacggcgccctgaagggcgagatcaagcagaggctgaagctga fusion aggacggcggccactacgacgctgaggtcaagaccacctacaaggccaagaagcccgtgcagctgcccggcgcctacaacgtca protein acatcaagttggacatcacctcccacaacgaggactacaccatcgtggaacagtacgaacgcgccgagggccgccactccaccggc coding ggcatggacgagctgtacaagATGCCGGGGTTTTACGAGATTGTGATTAAGGTCCCCAGCGA sequence CCTTGACGAGCATCTGCCCGGCATTTCTGACAGCTTTGTGAACTGGGTGGCCGAG (SEQ ID AAGGAATGGGAGTTGCCGCCAGATTCTGACATGGATCTGAATCTGATTGAGCAG NO: 3) GCACCCCTGACCGTGGCCGAGAAGCTGCAGCGCGACTTTCTGACGGAATGGCGC CGTGTGAGTAAGGCCCCGGAGGCCCTTTTCTTTGTGCAATTTGAGAAGGGAGAGA GCTACTTCCACATGCACGTGCTCGTGGAAACCACCGGGGTGAAATCCATGGTTTT GGGACGTTTCCTGAGTCAGATTCGCGAAAAACTGATTCAGAGAATTTACCGCGGG ATCGAGCCGACTTTGCCAAACTGGTTCGCGGTCACAAAGACCAGAAATGGCGCC GGAGGCGGGAACAAGGTGGTGGATGAGTGCTACATCCCCAATTACTTGCTCCCC AAAACCCAGCCTGAGCTCCAGTGGGCGTGGACTAATATGGAACAGTATTTAAGC GCCTGTTTGAATCTCACGGAGCGTAAACGGTTGGTGGCGCAGCATCTGACGCACG TGTCGCAGACGCAGGAGCAGAACAAAGAGAATCAGAATCCCAATTCTGATGCGC CGGTGATCAGATCAAAAACTTCAGCCAGGTACGGGGAGCTGGTCGGGTGGCTCG TGGACAAGGGGATTACCTCGGAGAAGCAGTGGATCCAGGAGGACCAGGCCTCAT ACATCTCCTTCAATGCGGCCTCCAACTCGCGGTCCCAAATCAAGGCTGCCTTGGA CAATGCGGGAAAGATTATGAGCCTGACTAAAACCGCCCCCGACTACCTGGTGGG CCAGCAGCCCGTGGAGGACATTTCCAGCAATCGGATTTATAAAATTTTGGAACTA AACGGGTACGATCCCCAATATGCGGCTTCCGTCTTTCTGGGATGGGCCACGAAAA AGTTCGGCAAGAGGAACACCATCTGGCTGTTTGGGCCTGCAACTACCGGCAAGA CCAACATCGCGGAGGCCATAGCCCACACTGTGCCCTTCTACGGGTGCGTAAACTG GACCAATGAGAACTTTCCCTTCAACGACTGTGTCGACAAGATGGTGATCTGGTGG GAGGAGGGGAAGATGACCGCCAAGGTCGTGGAGTCGGCCAAAGCCATTCTCGGA GGAAGCAAGGTGCGCGTGGACCAGAAATGCAAGTCCTCGGCCCAGATAGACCCG ACTCCCGTGATCGTCACCTCCAACACCAACATGTGCGCCGTGATTGACGGGAACT CAACGACCTTCGAACACCAGCAGCCGTTGCAAGACCGGATGTTCAAATTTGAACT CACCCGCCGTCTGGATCATGACTTTGGGAAGGTCACCAAGCAGGAAGTCAAAGA CTTTTTCCGGTGGGCAAAGGATCACGTGGTTGAGGTGGAGCATGAATTCTACGTC AAAAAGGGTGGAGCCAAGAAAAGACCCGCCCCCAGTGACGCAGATATAAGTGA GCCCAAACGGGTGCGCGAGTCAGTTGCGCAGCCATCGACGTCAGACGCGGAAGC TTCGATCAACTACGCAGACAGATTGGCTCGAGGACACTCTCTCTGA Adenovirus atgactacgtccggcgttccatttggcatgacactacgaccaacacgatctcggttgtctcggcgcactccgtacagtagggatcgcct E4orf6 acctccttttgagacagagacccgcgctaccatactggaggatcatccgctgctgcccgaatgtaacactttgacaatgcacaacgtga (lower- gttacgtgcgaggtcttccctgcagtgtgggatttacgctgattcaggaatgggttgttccctgggatatggttctgacgcgggaggag case)- cttgtaatcctgaggaagtgtatgcacgtgtgcctgtgttgtgccaacattgatatcatgacgagcatgatgatccatggttacgagtc P2A (upper- ctgggctctccactgtcattgttccagtcccggttccctgcagtgcatagccggcgggcaggttttggccagctggtttaggatggtgg case)- tggatggcgccatgtttaatcagaggtttatatggtaccgggaggtggtgaattacaacatgccaaaagaggtaatgtttatgtccagc DBP (lower- gtgtttatgaggggtcgccacttaatctacctgcgcttgtggtatgatggccacgtgggttctgtggtccccgccatgagctttggata case, cagcgccttgcactgtgggattttgaacaatattgtggtgctgtgctgcagttactgtgctgatttaagtgagatcagggtgcgctgct underlined) gtgcccggaggacaaggcgtctcatgctgcgggcggtgcgaatcatcgctgaggagaccactgccatgttgtattcctgcaggacggag coding cggcggcggcagcagtttattcgcgcgctgctgcagcaccaccgccctatcctgatgcacgattatgactctacccccatgGGAAGCGG sequence AGCTACTAACTTCAGCCTGCTGAAGCAGGCTGGAGACGTGGAGGAGAACCCTGGAC (SEQ ID NO: CTatggccagtcgggaagaggagcagcgcgaaaccacccccgagcgcggacgcggtgcggcgcgacgtccaccaaccatgga 4) ggacgtgtcgtccccgtcgccgtcgccgccgcctccccgcgcgcccccaaaaaagcggctgaggcggcgtctcgagtccgaggac gaagaagactcgtcacaagatgcgctggtgccgcgcacacccagcccgcggccatcgacctcgacggcggatttggccattgcgtc caaaaagaaaaagaagcgcccctctcccaagcccgagcgcccgccatccccagaggtgatcgtggacagcgaggaagaaagaga agatgtggcgctacaaatggtgggtttcagcaacccaccggtgctaatcaagcacggcaagggaggtaagcgcacggtgcggcgg ctgaatgaagacgacccagtggcgcggggtatgcggacgcaagaggaaaaggaagagtccagtgaagcggaaagtgaaagcac ggtgataaacccgctgagcctgccgatcgtgtctgcgtgggagaagggcatggaggctgcgcgcgcgttgatggacaagtaccacg tggataacgatctaaaggcaaacttcaagctactgcctgaccaagtggaagctctggcggccgtatgcaagacctggctaaacgagg agcaccgcgggttgcagctgaccttcaccagcaacaagacctttgtgacgatgatggggcgattcctgcaggcgtacctgcagtcgttt gcagaggtaacctacaagcaccacgagcccacgggctgcgcgttgtggctgcaccgctgcgctgagatcgaaggcgagcttaagtg tctacacgggagcattatgataaataaggagcacgtgattgaaatggatgtgacgagcgaaaacgggcagcgcgcgctgaaggagc agtctagcaaggccaagatcgtgaagaaccggtggggccgaaatgtggtgcagatctccaacaccgacgcaaggtgctgcgtgcat gacgcggcctgtccggccaatcagttttccggcaagtcttgcggcatgttcttctctgaaggcgcaaaggctcaggtggcttttaagcag atcaaggctttcatgcaggcgctgtatcctaacgcccagaccgggcacggtcaccttctgatgccactacggtgcgagtgcaactcaa agcctgggcatgcaccctttttgggaaggcagctaccaaagttgactccgttcgccctgagcaacgcggaggacctggacgcggatc tgatctccgacaagagcgtgctggccagcgtgcaccacccggcgctgatagtgttccagtgctgcaaccctgtgtatcgcaactcgcg cgcgcagggcggaggccccaactgcgacttcaagatatcggcgcccgacctgctaaacgcgttggtgatggtgcgcagcctgtgga gtgaaaacttcaccgagctgccgcggatggttgtgcctgagtttaagtggagcactaaacaccagtatcgcaacgtgtccctgccagtg gcgcatagcgatgcgcggcagaacccctttgatttttaa AAV2 cap CATCGACGTCAGACGCGGAAGCTTCGATCAACTACGCAGACAGGTACCAAAACA gene AATGTTCTCGTCACGTGGGCATGAATCTGATGCTGTTTCCCTGCAGACAATGCGA (SEQ ID NO: GAGAATGAATCAGAATTCAAATATCTGCTTCACTCACGGACAGAAAGACTGTTTA 5) GAGTGCTTTCCCGTGTCAGAATCTCAACCCGTTTCTGTCGTCAAAAAGGCGTATC AGAAACTGTGCTACATTCATCATATCATGGGAAAGGTGCCAGACGCTTGCACTGC CTGCGATCTGGTCAATGTGGATTTGGATGACTGCATCTTTGAACAATAAATGATT TAAATCAGGTATGGCTGCCGATGGTTATCTTCCAGATTGGCTCGAGGACACTCTC TCTGAAGGAATAAGACAGTGGTGGAAGCTCAAACCTGGCCCACCACCACCAAAG CCCGCAGAGCGGCATAAGGACGACAGCAGGGGTCTTGTGCTTCCTGGGTACAAG TACCTCGGACCCTTCAACGGACTCGACAAGGGAGAGCCGGTCAACGAGGCAGAC GCCGCGGCCCTCGAGCACGACAAAGCCTACGACCGGCAGCTCGACAGCGGAGAC AACCCGTACCTCAAGTACAACCACGCCGACGCGGAGTTTCAGGAGCGCCTTAAA GAAGATACGTCTTTTGGGGGCAACCTCGGACGAGCAGTCTTCCAGGCGAAAAAG AGGGTTCTTGAACCTCTGGGCCTGGTTGAGGAACCTGTTAAGACGGCTCCGGGAA AAAAGAGGCCGGTAGAGCACTCTCCTGTGGAGCCAGACTCCTCCTCGGGAACCG GAAAGGCGGGCCAGCAGCCTGCAAGAAAAAGATTGAATTTTGGTCAGACTGGAG ACGCAGACTCAGTACCTGACCCCCAGCCTCTCGGACAGCCACCAGCAGCCCCCTC TGGTCTGGGAACTAATACGATGGCTACAGGCAGTGGCGCACCAATGGCAGACAA TAACGAGGGCGCCGACGGAGTGGGTAATTCCTCGGGAAATTGGCATTGCGATTC CACATGGATGGGCGACAGAGTCATCACCACCAGCACCCGAACCTGGGCCCTGCC CACCTACAACAACCACCTCTACAAACAAATTTCCAGCCAATCAGGAGCCTCGAAC GACAATCACTACTTTGGCTACAGCACCCCTTGGGGGTATTTTGACTTCAACAGAT TCCACTGCCACTTTTCACCACGTGACTGGCAAAGACTCATCAACAACAACTGGGG ATTCCGACCCAAGAGACTCAACTTCAAGCTCTTTAACATTCAAGTCAAAGAGGTC ACGCAGAATGACGGTACGACGACGATTGCCAATAACCTTACCAGCACGGTTCAG GTGTTTACTGACTCGGAGTACCAGCTCCCGTACGTCCTCGGCTCGGCGCATCAAG GATGCCTCCCGCCGTTCCCAGCAGACGTCTTCATGGTGCCACAGTATGGATACCT CACCCTGAACAACGGGAGTCAGGCAGTAGGACGCTCTTCATTTTACTGCCTGGAG TACTTTCCTTCTCAGATGCTGCGTACCGGAAACAACTTTACCTTCAGCTACACTTT TGAGGACGTTCCTTTCCACAGCAGCTACGCTCACAGCCAGAGTCTGGACCGTCTC ATGAATCCTCTCATCGACCAGTACCTGTATTACTTGAGCAGAACAAACACTCCAA GTGGAACCACCACGCAGTCAAGGCTTCAGTTTTCTCAGGCCGGAGCGAGTGACAT TCGGGACCAGTCTAGGAACTGGCTTCCTGGACCCTGTTACCGCCAGCAGCGAGTA TCAAAGACATCTGCGGATAACAACAACAGTGAATACTCGTGGACTGGAGCTACC AAGTACCACCTCAATGGCAGAGACTCTCTGGTGAATCCGGGCCCGGCCATGGCA AGCCACAAGGACGATGAAGAAAAGTTTTTTCCTCAGAGCGGGGTTCTCATCTTTG GGAAGCAAGGCTCAGAGAAAACAAATGTGGACATTGAAAAGGTCATGATTACAG ACGAAGAGGAAATCAGGACAACCAATCCCGTGGCTACGGAGCAGTATGGTTCTG TATCTACCAACCTCCAGAGAGGCAACAGACAAGCAGCTACCGCAGATGTCAACA CACAAGGCGTTCTTCCAGGCATGGTCTGGCAGGACAGAGATGTGTACCTTCAGGG GCCCATCTGGGCAAAGATTCCACACACGGACGGACATTTTCACCCCTCTCCCCTC ATGGGTGGATTCGGACTTAAACACCCTCCTCCACAGATTCTCATCAAGAACACCC CGGTACCTGCGAATCCTTCGACCACCTTCAGTGCGGCAAAGTTTGCTTCCTTCATC ACACAGTACTCCACGGGACAGGTCAGCGTGGAGATCGAGTGGGAGCTGCAGAAG GAAAACAGCAAACGCTGGAATCCCGAAATTCAGTACACTTCCAACTACAACAAG TCTGTTAATGTGGACTTTACTGTGGACACTAATGGCGTGTATTCAGAGCCTCGCC CCATTGGCACCAGATACCTGACTCGTAATCTGTGA AAV2 Rep52 ATGGAGCTGGTCGGGTGGCTCGTGGACAAGGGGATTACCTCGGAGAAGCAGTGG coding ATCCAGGAGGACCAGGCCTCATACATCTCCTTCAATGCGGCCTCCAACTCGCGGT sequence CCCAAATCAAGGCTGCCTTGGACAATGCGGGAAAGATTATGAGCCTGACTAAAA (SEQ ID CCGCCCCCGACTACCTGGTGGGCCAGCAGCCCGTGGAGGACATTTCCAGCAATCG NO: 6) GATTTATAAAATTTTGGAACTAAACGGGTACGATCCCCAATATGCGGCTTCCGTC TTTCTGGGATGGGCCACGAAAAAGTTCGGCAAGAGGAACACCATCTGGCTGTTTG GGCCTGCAACTACCGGCAAGACCAACATCGCGGAGGCCATAGCCCACACTGTGC CCTTCTACGGGTGCGTAAACTGGACCAATGAGAACTTTCCCTTCAACGACTGTGT CGACAAGATGGTGATCTGGTGGGAGGAGGGGAAGATGACCGCCAAGGTCGTGGA GTCGGCCAAAGCCATTCTCGGAGGAAGCAAGGTGCGCGTGGACCAGAAATGCAA GTCCTCGGCCCAGATAGACCCGACTCCCGTGATCGTCACCTCCAACACCAACATG TGCGCCGTGATTGACGGGAACTCAACGACCTTCGAACACCAGCAGCCGTTGCAA GACCGGATGTTCAAATTTGAACTCACCCGCCGTCTGGATCATGACTTTGGGAAGG TCACCAAGCAGGAAGTCAAAGACTTTTTCCGGTGGGCAAAGGATCACGTGGTTG AGGTGGAGCATGAATTCTACGTCAAAAAGGGTGGAGCCAAGAAAAGACCCGCCC CCAGTGACGCAGATATAAGTGAGCCCAAACGGGTGCGCGAGTCAGTTGCGCAGC CATCGACGTCAGACGCGGAAGCTTCGATCAACTACGCAGACAGGTACCAAAACA AATGTTCTCGTCACGTGGGCATGAATCTGATGCTGTTTCCCTGCAGACAATGCGA GAGAATGAATCAGAATTCAAATATCTGCTTCACTCACGGACAGAAAGACTGTTTA GAGTGCTTTCCCGTGTCAGAATCTCAACCCGTTTCTGTCGTCAAAAAGGCGTATC AGAAACTGTGCTACATTCATCATATCATGGGAAAGGTGCCAGACGCTTGCACTGC CTGCGATCTGGTCAATGTGGATTTGGATGACTGCATCTTTGAACAA Cas9 coding ATGGACTATAAGGACCACGACGGAGACTACAAGGATCATGATATTGATTACAAA sequence GACGATGACGATAAGATGGCCCCAAAGAAGAAGCGGAAGGTCGGTATCCACGG (SEQ ID AGTCCCAGCAGCCGACAAGAAGTACAGCATCGGCCTGGACATCGGCACCAACTC NO: 7) TGTGGGCTGGGCCGTGATCACCGACGAGTACAAGGTGCCCAGCAAGAAATTCAA GGTGCTGGGCAACACCGACCGGCACAGCATCAAGAAGAACCTGATCGGAGCCCT GCTGTTCGACAGCGGCGAAACAGCCGAGGCCACCCGGCTGAAGAGAACCGCCAG AAGAAGATACACCAGACGGAAGAACCGGATCTGCTATCTGCAAGAGATCTTCAG CAACGAGATGGCCAAGGTGGACGACAGCTTCTTCCACAGACTGGAAGAGTCCTT CCTGGTGGAAGAGGATAAGAAGCACGAGCGGCACCCCATCTTCGGCAACATCGT GGACGAGGTGGCCTACCACGAGAAGTACCCCACCATCTACCACCTGAGAAAGAA ACTGGTGGACAGCACCGACAAGGCCGACCTGCGGCTGATCTATCTGGCCCTGGCC CACATGATCAAGTTCCGGGGCCACTTCCTGATCGAGGGCGACCTGAACCCCGACA ACAGCGACGTGGACAAGCTGTTCATCCAGCTGGTGCAGACCTACAACCAGCTGTT CGAGGAAAACCCCATCAACGCCAGCGGCGTGGACGCCAAGGCCATCCTGTCTGC CAGACTGAGCAAGAGCAGACGGCTGGAAAATCTGATCGCCCAGCTGCCCGGCGA GAAGAAGAATGGCCTGTTCGGAAACCTGATTGCCCTGAGCCTGGGCCTGACCCCC AACTTCAAGAGCAACTTCGACCTGGCCGAGGATGCCAAACTGCAGCTGAGCAAG GACACCTACGACGACGACCTGGACAACCTGCTGGCCCAGATCGGCGACCAGTAC GCCGACCTGTTTCTGGCCGCCAAGAACCTGTCCGACGCCATCCTGCTGAGCGACA TCCTGAGAGTGAACACCGAGATCACCAAGGCCCCCCTGAGCGCCTCTATGATCAA GAGATACGACGAGCACCACCAGGACCTGACCCTGCTGAAAGCTCTCGTGCGGCA GCAGCTGCCTGAGAAGTACAAAGAGATTTTCTTCGACCAGAGCAAGAACGGCTA CGCCGGCTACATTGACGGCGGAGCCAGCCAGGAAGAGTTCTACAAGTTCATCAA GCCCATCCTGGAAAAGATGGACGGCACCGAGGAACTGCTCGTGAAGCTGAACAG AGAGGACCTGCTGCGGAAGCAGCGGACCTTCGACAACGGCAGCATCCCCCACCA GATCCACCTGGGAGAGCTGCACGCCATTCTGCGGCGGCAGGAAGATTTTTACCCA TTCCTGAAGGACAACCGGGAAAAGATCGAGAAGATCCTGACCTTCCGCATCCCCT ACTACGTGGGCCCTCTGGCCAGGGGAAACAGCAGATTCGCCTGGATGACCAGAA AGAGCGAGGAAACCATCACCCCCTGGAACTTCGAGGAAGTGGTGGACAAGGGCG CTTCCGCCCAGAGCTTCATCGAGCGGATGACCAACTTCGATAAGAACCTGCCCAA CGAGAAGGTGCTGCCCAAGCACAGCCTGCTGTACGAGTACTTCACCGTGTATAAC GAGCTGACCAAAGTGAAATACGTGACCGAGGGAATGAGAAAGCCCGCCTTCCTG AGCGGCGAGCAGAAAAAGGCCATCGTGGACCTGCTGTTCAAGACCAACCGGAAA GTGACCGTGAAGCAGCTGAAAGAGGACTACTTCAAGAAAATCGAGTGCTTCGAC TCCGTGGAAATCTCCGGCGTGGAAGATCGGTTCAACGCCTCCCTGGGCACATACC ACGATCTGCTGAAAATTATCAAGGACAAGGACTTCCTGGACAATGAGGAAAACG AGGACATTCTGGAAGATATCGTGCTGACCCTGACACTGTTTGAGGACAGAGAGA TGATCGAGGAACGGCTGAAAACCTATGCCCACCTGTTCGACGACAAAGTGATGA AGCAGCTGAAGCGGCGGAGATACACCGGCTGGGGCAGGCTGAGCCGGAAGCTG ATCAACGGCATCCGGGACAAGCAGTCCGGCAAGACAATCCTGGATTTCCTGAAG TCCGACGGCTTCGCCAACAGAAACTTCATGCAGCTGATCCACGACGACAGCCTGA CCTTTAAAGAGGACATCCAGAAAGCCCAGGTGTCCGGCCAGGGCGATAGCCTGC ACGAGCACATTGCCAATCTGGCCGGCAGCCCCGCCATTAAGAAGGGCATCCTGC AGACAGTGAAGGTGGTGGACGAGCTCGTGAAAGTGATGGGCCGGCACAAGCCCG AGAACATCGTGATCGAAATGGCCAGAGAGAACCAGACCACCCAGAAGGGACAG AAGAACAGCCGCGAGAGAATGAAGCGGATCGAAGAGGGCATCAAAGAGCTGGG CAGCCAGATCCTGAAAGAACACCCCGTGGAAAACACCCAGCTGCAGAACGAGAA GCTGTACCTGTACTACCTGCAGAATGGGCGGGATATGTACGTGGACCAGGAACT GGACATCAACCGGCTGTCCGACTACGATGTGGACCATATCGTGCCTCAGAGCTTT CTGGCGGACGACTCCATCGACAACAAGGTGCTGACCAGAAGCGACAAGAACCGG GGCAAGAGCGACAACGTGCCCTCCGAAGAGGTCGTGAAGAAGATGAAGAACTAC TGGCGGCAGCTGCTGAACGCCAAGCTGATTACCCAGAGAAAGTTCGACAATCTG ACCAAGGCCGAGAGAGGCGGCCTGAGCGAACTGGATAAGGCCGGCTTCATCAAG AGACAGCTGGTGGAAACCCGGCAGATCACAAAGCACGTGGCACAGATCCTGGAC TCCCGGATGAACACTAAGTACGACGAGAATGACAAGCTGATCCGGGAAGTGAAA GTGATCACCCTGAAGTCCAAGCTGGTGTCCGATTTCCGGAAGGATTTCCAGTTTT ACAAAGTGCGCGAGATCAACAACTACCACCACGCCCACGACGCCTACCTGAACG CCGTCGTGGGAACCGCCCTGATCAAAAAGTACCCTGCGCTGGAAAGCGAGTTCG TGTACGGCGACTACAAGGTGTACGACGTGCGGAAGATGATCGCCAAGAGCGAGC AGGAAATCGGCAAGGCTACCGCCAAGTACTTCTTCTACAGCAACATCATGAACTT TTTCAAGACCGAGATTACCCTGGCCAACGGCGAGATCCGGAAGGCGCCTCTGATC GAGACAAACGGCGAAACCGGGGAGATCGTGTGGGATAAGGGCCGGGATTTTGCC ACCGTGCGGAAAGTGCTGAGCATGCCCCAAGTGAATATCGTGAAAAAGACCGAG GTGCAGACAGGCGGCTTCAGCAAAGAGTCTATCCTGCCCAAGAGGAACAGCGAT AAGCTGATCGCCAGAAAGAAGGACTGGGACCCTAAGAAGTACGGCGGCTTCGAC AGCCCCACCGTGGCCTATTCTGTGCTGGTGGTGGCCAAAGTGGAAAAGGGCAAG TCCAAGAAACTGAAGAGTGTGAAAGAGCTGCTGGGGATCACCATCATGGAAAGA AGCAGCTTCGAGAAGAATCCCATCGACTTTCTGGAAGCCAAGGGCTACAAAGAA GTGAAAAAGGACCTGATCATCAAGCTGCCTAAGTACTCCCTGTTCGAGCTGGAAA ACGGCCGGAAGAGAATGCTGGCCTCTGCCGGCGAACTGCAGAAGGGAAACGAAC TGGCCCTGCCCTCCAAATATGTGAACTTCCTGTACCTGGCCAGCCACTATGAGAA GCTGAAGGGCTCCCCCGAGGATAATGAGCAGAAACAGCTGTTTGTGGAACAGCA CAAGCACTACCTGGACGAGATCATCGAGCAGATCAGCGAGTTCTCCAAGAGAGT GATCCTGGCCGACGCTAATCTGGACAAAGTGCTGTCCGCCTACAACAAGCACCG GGATAAGCCCATCAGAGAGCAGGCCGAGAATATCATCCACCTGTTTACCCTGACC AATCTGGGAGCCCCTGCCGCCTTCAAGTACTTTGACACCACCATCGACCGGAAGA GGTACACCAGCACCAAAGAGGTGCTGGACGCCACCCTGATCCACCAGAGCATCA CCGGCCTGTACGAGACACGGATCGACCTGTCTCAGCTGGGAGGCGACAAAAGGC CGGCGGCCACGAAAAAGGCCGGCCAGGCAAAAAAGAAAAAGTAA AAVS1 sgRNA ggggccactagggacaggatgttttagagctagaaatagcaagttaaaataaggctagtccgttatcaacttgaaaaagtggcaccga sequence gtcggtgctttt (SEQ ID NO: 8)
Example 1A
[0228] This Example describes the construction of a stable cell line with an integrated rAAV genome; helper and replication genes can replicate the genome.
[0229] HEK293 cell lines were constructed by integrating into the genome three sets of DNA sequence encoding for functional genes: (1) the rAAV genome encoding GFP, (2) the cumate-inducible destabilized mCherry-Rep68 fusion protein and (3) doxycycline-inducible adenovirus helper proteins (
[0230] GR1-5 includes G— GFP genome (plus ITR); and R— replication functions (helper and rep68); was part of the generation 1 (lenti) designs, and was clone 5.
Example 1B
[0231] This Example shows cells with integrated rAAV genome, helper and replication genes (see Example 1A) produce infectious virus upon provision of a capsid gene.
[0232] The capability of GR1-5 to produce infectious rAAV upon provision of cap proteins was demonstrated by transfection of packaging plasmids (
[0233] On day 5, the cells were harvested by accutase treatment, freeze-thawed three times to release the virus from the cells, and treated with benzonase to digest non-encapsidated DNA. The filtered preparation was then added to HEK293 cells transfected with pHelper (
Example 2A
[0234] This Example describes the construction of a stable cell line with integrated rAAV genome, helper, replication, and encapsidation genes produce infectious virus.
[0235] A different set of gene vectors than those used in Example 1 were employed to further demonstrate that cells engineered to integrated rAAV, replication enzymes and helper functions under non-viral promoter control can generate infectious virus. Three vectors for transposase mediated insertion, the rAAV-GFP genome, a replication module, and a packaging module, were integrated into HEK293 cells (
[0236] Cells with all three vectors integrated into the genome were selected by resistance to all three antibiotics (puromycin, hygromycin and blasticidin). A resulting cell pool, GR2C3, was used to produce rAAV. Cells were induced with doxycycline, mifepristone, and cumate for four days. The cells were harvested by accutase treatment, freeze-thawed three times to release the virus from the cells and treated with benzonase to digest non-encapsidated DNA. The viral prep was then used to transduce mifepristone- and doxycycline-induced R2 titering cells (described in
[0237] GR2C3 cells include G—GFP genome (plus ITR); R—replication functions (helper and rep68) in a generation 2 design; and C—packaging functions (cap and rep52) in a generation 3 design.
Example 2B
[0238] This Example describes the construction of stable cell lines with helper, replication, and encapsidation genes that produce infectious virus. A different packaging module vector than the one used in Example 2A was employed to modify capsid protein expression. In this instance the native intron of the capsid gene was omitted and the start codon of the first ORF, VP1, was modified from ATG to ACG, resulting in an inefficient translational start codon. The resulting cap variant was called VP123. Three vectors for transposase-mediated insertion, the rAAV-GFP genome, a replication module, and a packaging module, were integrated into HEK293 cells (
[0239] The effect of inducer concentration on rAAV yield was further illustrated using GRP3. As doxycycline concentration increased, Rep68 transcript levels increased as expected. This resulted in an increase in infectious rAAV yield as measured by using RM4 cells (
[0240] Three different combinations of inducer concentrations were tested on GRP3 cells to demonstrate the capability of the inducible production system in shifting full-to-empty particle ratio. Mifepristone induction level was fixed throughout, while doxycycline and cumate levels were varied at two levels each. With high doxycycline concentration and high cumate concentration (10D/2.5M/90C), capsid particle titer was high, but many were empty, shown by a low full capsid content. With high doxycycline concentration and low cumate concentration (10D/2.5M/10C), capsid particle titer was lower, yet the fraction of full capsids was much higher. Finally, with low doxycycline concentration and high cumate concentration (0.5D/2.5M/90C), capsid particle titer was very high but full capsid content was very low. This demonstrated that using GRP3 one can manipulate the inducer concentrations to modulate the full particle content which is an important quality attribute for rAAV vectors.
[0241] G denotes cells that include GFP-AAV genome integrated into the cell genome; R denotes cells that have the replication module integrated; P denotes the integration of packaging module into cell genome; GRP has all three: genome, replication, and packaging modules.
Example 2C
[0242] This Example describes the construction of stable AAV packaging cell lines with replication, helper and encapsidation genes which produce infectious virus upon provision of a rAAV genome. The cell line can be used to produce different rAAVs by supplying different AAV genomes. The replication module and packaging module gene vectors used in Example 2B were used, while the rAAV-GFP genome was omitted. The two vectors were integrated into HEK293 cells using transposase-mediated insertion (
[0243] Cells with both vectors integrated into the genome were selected by resistance to two antibiotics (hygromycin and blasticidin). A resulting cell pool, called RP, was further used for the single cell cloning to acquire cell clones. Two resulting cell clones, RP6 and RP7, were further used to produce rAAV. Cells were transiently transfected with rAAV genome vector and induced with doxycycline, mifepristone, and cumate for four days and the resulting viruses were harvested. The viral prep was then used to transduce mifepristone-induced and doxycycline-induced RM4 titering cells (described in
[0244] R denotes cells that have the replication module integrated into cell genome; P denotes the integration of packaging module into cell genome; RP denotes cells that have both replication and package modules.
Example 3
[0245] The capability of the cells of Example 1 to replicate the genome of rAAV and express a cargo protein was further harnessed to manipulate the copy number of the cargo gene and increase cargo protein expression. In this Example, cells bearing the latent rAAV genome encoding the product protein were grown in culture to expand their population. At the onset of the production phase, rAAV genome replication was induced to achieve a higher copy number to increase the production of the product protein. Since no viral packaging element is present in the cell, no virus is produced.
[0246] The rAAV genome encoding human immunoglobulin G light chain and heavy chain and destabilized GFP (
[0247] IR1-10 includes I—IgG genome (plus ITR); R—replication functions (helper and rep68); and was part of the generation 1 (lenti) designs, and was clone 10.
Example 4A
[0248] This Example describes the construction of an assay cell line that does not require co-infection with a helper virus to quantify the infectious titer of rAAV that is replication defective. The assay cell line has in its engineered genome the helper gene from adenovirus that facilitates second-strand synthesis, as well as AAV and adenovirus genes that enable incoming rAAV to replicate; yet, it lacks the capsid proteins to form and release virus particles. As shown in
[0249] The R2 pool was infected with a sample of rAAV (rAAV-GFP) with GFP as its payload and induced with mifepristone and doxycycline. R2 cells identically infected but uninduced was included as a negative control. HEK293 cells transfected with a minimal adenovirus plasmid, pHelper, which contains the adenovirus helper genes E2A and E4 was used as another control that approximates adenovirus co-infection for second-strand synthesis but not the adenovirus functions of endosomal release.
[0250] As shown in
Example 4B
[0251] This example describes a clonal cell line derived from the pool in Example 4A. The clone, called RM4, was isolated by limiting dilution of the pool followed by clonal expansion. Upon induction to express Rep68 and helper proteins, RM4 cells were able to support the replication of exogenously transduced rAAV genome and express the cargo GFP protein. This was evident by strong GFP expression in RM4 cells transduced with rAAV2-GFP particles (
[0252] RM4 cells were transduced with rAAV2-GFP in an infectious titer assay that was benchmarked against the traditional rAAV titration method of Ad co-infection. Flow cytometry density plots showed both RM4 cells and HEK293 cells with Ad-coinfection gave a similar fraction of GFP-positive cells (
[0253] In clinical applications, the payload gene will not be a reporter but a therapeutic protein. Immunostaining of the cargo protein can be used to detect the expression of the cargo protein and hence the transduction of rAAV. Immunostaining of the GFP protein with a mouse anti-GFP antibody and an Alexa Fluor 647-tagged anti-mouse antibody was performed for the RM4 infectious titer assay and benchmarked against the Ad co-infection method. Flow cytometry density plots revealed that the RM4 based assay and Ad-coinfection method gave a similar fraction of immunostain-positive (Alexa Fluor 647-positive) cells (
[0254] Next, the flow cytometry-based infectious titer assay was compared with a qPCR-based TCID.sub.50 assay using RM4 cells. Rows of ten wells of induced R1V14 cells were transduced with dilutions of rAAV2-GFP such that, at a limiting dilution, wells would probabilistically receive one (or more) infectious virus particles, or none at all. Replicated genomes were detected using qPCR, and the positive wells detected were shown as a plate-view map (
[0255] The rAAV virus stock used in the assays described above was of serotype 2. HEK293 cells, from which RM4 were derived, express surface receptors for other AAV serotypes including serotypes 6 and 8 which are commonly used in gene therapy studies. RM4 cells were used to determine the infectious titer of rAAV-GFP of serotypes 6 and 8 (
[0256] The complete disclosure of all patents, patent applications, and publications, and electronically available material cited herein are incorporated by reference. In the event that any inconsistency exists between the disclosure of the present application and the disclosure(s) of any document incorporated herein by reference, the disclosure of the present application shall govern. The foregoing detailed description and examples have been given for clarity of understanding only. No unnecessary limitations are to be understood therefrom. The invention is not limited to the exact details shown and described, for variations obvious to one skilled in the art will be included within the invention defined by the claims.