DETECTION SYSTEM OF INTERACTION BETWEEN KNOWN MOLECULES AND PROTEINS BASED ON COVALENT CONNECTION AND IDENTIFICATION OR VERIFICATION METHOD THEREOF
20230280353 · 2023-09-07
Assignee
Inventors
- Shengce TAO (Shanghai, CN)
- Hewei JIANG (Shanghai, CN)
- Yunxiao ZHENG (Shanghai, CN)
- Hong Chen (Shanghai, CN)
- Xuening WANG (Shanghai, CN)
Cpc classification
G01N33/6842
PHYSICS
G01N33/6845
PHYSICS
International classification
Abstract
A detection system for the interaction between known molecules and proteins based on covalent connection and an identification or verification method thereof are disclosed. The detection system comprises: a) streptavidin-short peptide tetramer; b) PafA enzyme; and c) Biotin-modified known molecules. After a known molecule interacts with a protein, streptavidin-short peptide tetramer can efficiently capture interacting proteins of known molecules under mild conditions. Then, under the catalysis of PafA enzyme, the interaction between short peptides and known molecules is made into protein covalent binding, so that the non-covalent binding between known molecules and proteins is converted into covalent binding between streptavidin and protein, and then analysis, separation and identification are carried out. This method can capture weak interaction and instantaneous interaction on the basis of keeping the natural structure of known molecules, which can be used to verify and discover known molecules and interacting proteins.
Claims
1. A system for detecting interactions between known molecules and proteins based on covalent linkages, comprising the following molecules: a) a streptavidin-short peptide tetramer; b) a PafA enzyme; and c) biotin-modified known molecules.
2. The system for detecting the interactions between the known molecules and the proteins based on the covalent linkages according to claim 1, wherein a short peptide in the streptavidin-short peptide tetramer is a peptide chain containing 12-100 amino acids.
3. The system for detecting the interactions between the known molecules and the proteins based on the covalent linkages according to claim 2, wherein the short peptide comprises a Pup molecule or a mutant molecule of the Pup molecule, and a glutamine at an end of the Pup molecule is mutated into a glutamic acid, and wherein a sequence of which the Pup molecule is as shown in SEQ ID NO: 1; and the mutation molecule of the Pup molecule is a Pup molecule with one or more mutations, and a sequence of the mutation molecule of the Pup molecule is shown by any sequence of SEQ ID NO: 2, SEQ ID NO: 3, and SEQ ID NO: 4.
4. The system for detecting the interactions between the known molecules and the proteins based on the covalent linkages according to claim 1, wherein characterized in that seven lysine mutations on a surface of the PafA enzyme are arginines, and mutation sites are K162R, K202R, K320R, K361R, K423R, K435R, and K446R.
5. The system for detecting the interactions between the known molecules and the proteins based on the covalent linkages according to claim 1, wherein the biotin-modified known molecules comprise any one or more of proteins, a DNA, an RNA, and small molecules.
6. The system for detecting the interactions between the known molecules and the proteins based on the covalent linkages according to claim 5, wherein the proteins comprise at least one of a protein, a peptide, a modified peptide, an antibody, and a lectin; the RNA comprises at least one of a messenger RNA, a ribosome RNA, a long chain non-coding RNA, and a non-coding small RNA; the DNA comprises at least one of a double-stranded DNA and a closed circular DNA; and the small molecules comprise at least one of bioactive oligonucleotides, amino acids, vitamins, secondary metabolites of animal and plant microorganisms, and chemically synthesized small molecules in organisms.
7. A method for identifying interactions between known molecules and proteins by the system according to claim 1, comprising the steps of: A. fully mixing the biotin-modified known molecules and a sample to be tested and incubating at 25° C.-35° C. for 0 h-1 h to obtain a first mixture; B. adding a streptavidin-short peptide tetramer to the first mixture, thoroughly mixing, and incubating at 25° C. to 35° C. for 0 h-1 h to obtain a second mixture; C. adding a PafA enzyme to the second mixture, thoroughly mixing, and incubating at 25° C.-35° C. for 1 min-6 h to obtain a third mixture; D. adding a biotin-labeled affinity medium to the third mixture to isolate a streptavidin-short peptide and proteins connected by the streptavidin-short peptide; and E. conducting a mass spectrometry identification.
8. The method for identifying the interactions between the known molecules and the proteins according to claim 7, wherein the sample to be tested comprises at least one of a protein, a living cell or tissue, a membrane protein, a cell lysate, and a tissue lysate.
9. A method for verifying an interaction between a known molecule and a protein by the system according to claim 1, comprising the steps of: S1. mixing the known molecule to be verified with the protein to be verified, and incubating at 25° C. to 35° C. for 0 h-1 h to obtain a first mixture; S2. adding a streptavidin-short peptide tetramer to the first mixture, thoroughly mixing, and incubating at 25° C. to 35° C. for 0 h-1 h to obtain a second mixture; S3. adding a PafA enzyme to the second mixture, thoroughly mixing, and incubating at 25° C.-35° C. for 1 min-6 h; and S4. conducting a western blot analysis to detect the interaction between the known molecule to be verified and the protein to be verified.
10. The method for verifying the interaction between the known molecule and the protein by the system according to claim 9, wherein the known molecule to be verified is a known molecule modified by a biotin and comprises any one or more of a protein, a DNA, a RNA, and small molecules; the protein comprises at least one of a protein, a polypeptide, a modified peptide, an antibody, and a lectin; the RNA comprises at least one of a messenger RNA, a ribosome RNA, a long chain non-coding RNA, and a non-coding small RNA; the DNA comprises at least one of a double-stranded DNA and a closed circular DNA; and the small molecules comprise at least one of bioactive oligonucleotides, amino acids, vitamins, secondary metabolites of animal and plant microorganisms, and chemically synthesized small molecules in organisms.
Description
BRIEF DESCRIPTION OF THE DRAWINGS
[0052] Other features, objects, and advantages of the present invention will become more apparent by reading the detailed description of non-limiting embodiments with reference to the following drawings:
[0053]
[0054]
[0055]
[0056]
[0057]
[0058]
[0059]
[0060]
[0061]
[0062]
[0063]
[0064]
[0065]
[0066]
[0067]
[0068]
[0069]
[0070]
[0071]
[0072]
[0073]
[0074] Wherein, “SPIDER” shown in each drawing represents the abbreviation of the detection system of the present invention.
DETAILED DESCRIPTION OF THE EMBODIMENTS
[0075] The present invention is described in detail below in connection with specific embodiments. The following embodiments will facilitate a further understanding of the invention by those skilled in the art but do not limit the invention in any form. It should be noted that several modifications and modifications may be made to those of ordinary skill in the art without departing from the concept of the invention. All these belong to the protection scope of the present invention.
[0076] The principle of the invention is described as follows:
[0077] 1. The schematic diagram of protein interaction is shown in
[0078] 2. The schematic diagram for verifying protein interaction is shown in
[0079] 3. The schematic diagram of the interaction between RNA and protein is shown in
[0080] 4. The schematic diagram for verifying the interaction between RNA and protein is shown in
[0081] 5. The schematic diagram of the interaction between DNA and protein is shown in
[0082] 6. The schematic diagram for verifying the interaction between DNA and protein is shown in
[0083] 7. The schematic diagram of the interaction between small molecules and proteins is shown in
[0084] 8. The schematic diagram for verifying the interaction between small molecules and proteins is shown in
[0085] In the following embodiments, the adopted E. coli BL31 (DE3) strain was purchased from TransGen Biotech Co., Ltd., HEK293T cells were purchased from the Cell Bank of Chinese Academy of Sciences. The vector pET28a, pTrc99a and pET32a are commonly used plasmids in laboratory. Biotin agarose beads were purchased from Sigma-Aldrich Company. Nickel column was purchased from Zhongke Senhui Microsphere Technology (Suzhou) Co., Ltd., Annealing Buffer (5×) was purchased from Biyuntian Biotechnology Co., Ltd., biotinylated C-di-GMP was purchased from biolog Company, biotinylated lenalidomide small molecule was presented by Dong Jiajia, Shanghai Institute of Organic Chemistry, Chinese Academy of Sciences, and biotinylated Rapamycin was presented by Dang Yongjun, School of Basic Medicine, Fudan University.
Embodiment 1: Reactivity Verification of PafA and Pup (E)
[0086] 1. Obtain GFP-Pup (E) and Pup (E)-GFP Proteins
[0087] Pup (E) refers to the mutation of glutamine (Q) at the C terminal of wild-type Pup molecule (sequence as shown in SEQ NO. 1) to
[0088] Glutamic acid (E). Pup (E) was fused and expressed at the N-terminal and C-terminal of GFP protein, respectively. GFP-Pup (E) and Pup (E)-GFP were constructed on pET28a and transformed into E. coli BL21 (DE3) strain, respectively, without a 6×His tag attached to the terminal of Pup (E). GFP-Pup (E) and Pup (E)-GFP proteins were purified by nickel column after IPTG was added in 1 L of bacteria medium when OD.sub.600 was about 0.6 and induced overnight at 18° C.
[0089] 2. Obtain PafA Enzyme
[0090] The wild-type PafA sequence is shown in SEQ NO. 6. PafA was linked to the pTrc99a vector and transformed into E. coli BL21 (DE3) strain, in which the C-terminal of PafA was linked to a 6×His tag. PafA enzyme was obtained by adding IPTG at 18° C. overnight when OD600 was about 0.6 and purified by nickel column.
[0091] 3. Verify the Reactivity of PafA and Pup (E)
[0092] 10 μL enzyme activity reaction system was prepared. The protein concentration ratio was as follows: GFP-Pup (E) or Pup (E)-GFP (10 μM), PafA (0.5 μM), ATP (5 mM). The insufficient volume was filled with reaction buffer (50 mM Tris, PH 7.5, 100 mM NaCl, 20 mM MgCl.sub.2, 10% (v/v) glycerol), and the reaction was carried out at 30° C. for 6h. SDS-PAGE and Coomassie Brilliant Blue staining were used. As shown in
Embodiment 2 Modification and Activity Verification of Streptavidin-Pup
[0093] 1. Obtain the Modified Streptavidin-Pup Tetramer Protein
[0094] To avoid streptavidin-Pup self-linking (Pup sequence is shown in SEQ ID NO: 1), the surface of streptavidin protein and lysine of Pup molecule are mutated into arginine, and the mutated streptavidin-Pup tetramer (SA.sub.m-Pup.sup.E) amino acid sequence (SEQ ID NO: 5) is shown in
[0095] 2. Biotin Binding Activity of SA.sub.m-Pup.sup.E was Detected as Shown in
[0096] The SA.sub.m-Pup.sup.E protein and wild-type streptavidin (SA) purified in step 1 were mixed with biotin (A600078) and incubated at room temperature for 1 hour, and then detected by SDS-PAGE. As can be seen in
[0097] 3. The Stability of the Binding of SA.sub.m-Pup.sup.E to Biotin Agarose Beads was Examined, as Shown in
[0098] The SA-Pup purified from Step 1 was added into Buffer R (50 mM Tris, PH 7.5, 100 mM NaCl, 20 mM MgCl.sub.2, 10% (v/v) glycerol) and high salt buffers (50 mM Tris-HCl, PH 8.0, 8 M urea, 15 mM DTT, 1 mM EDTA, PH 8.0) containing 8 M urea, respectively. After mixing, the supernatant was absorbed, and then biotin agarose beads were added to rotate and incubate at room temperature for 1 hour, and then the supernatant was absorbed. The supernatant was detected by SDS-PAGE. As shown in
[0099] The embodiment also provides a modified streptavidin-Pup tetramer protein, which is prepared by the method of step 1, with the only difference that the corresponding streptavidin-Pup tetramer proteins SA.sub.m-Pup.sup.E-1 and SA.sub.m-Pup.sup.E-2 are prepared by adopting the mutant molecular sequence of Pup as shown in SEQ ID NO: 3 or SEQ ID NO: 4.
Embodiment 3 Modification and Activity Verification of PafA Enzyme
[0100] 1. Obtain the Modified PafA Enzyme, and the Sequence (SEQ ID NO: 7) Shown in
[0101] In order to avoid self-linking of PafA (sequence as shown in SEQ ID NO: 6), seven lysine sites on its surface were mutated into arginine, and the mutation sites were K162R, K202R, K320R, K361R, K423R, K435R and K446R. PafA (named PafA7.sub.KR) with seven point mutations constructed by QuikChange 0 site-directed mutagenesis kit (Agilent Company) was connected to pTrc99a vector and transformed into E. coli BL21 (DE3) strain, in which PafA7.sub.KR C terminal was connected with a 6×His tag. PafA7.sub.KR enzyme was obtained by adding IPTG, inducing overnight at 18° C. when OD600 was about 0.6, and purifying by nickel column.
[0102] 2. Detect the Pupification Activity of PafA7.sub.KR Enzyme on its Pup Modification, as Shown in
[0103] PafA7.sub.KR enzyme was incubated with SA.sub.m-Pup.sup.E or Pup.sup.E at 30° C. for 4 h, and its Pupping degree was detected by WB. As shown in
[0104] 3. Detect the Ability of PafA7.sub.KR to the Pup Modification of Substrate, as Shown in
[0105] PafA7.sub.KR was incubated with Pup and PanB at 30° C. for 6h and detected by SDS-PAGE. As shown in
Embodiment 4 Verification of the Interaction Between CheAs Protein and CheZ Protein
[0106] 1. Obtain Biotin Modified Protein CheZ.
[0107] The CheZ sequence with Avi tag was constructed onto pET32a vector, and BirA enzyme with biotin labeling function was constructed onto pET28a vector, and the two plasmids were co-transformed into E. coli BL21 (DE3) strain. The biotin-modified protein CheZ was obtained by incubating 1 L bacteria solution, OD600≈0.6, adding IPTG, inducing overnight at 18° C., and purifying by nickel column.
[0108] 2. Obtain the Protein CheAs to be Verified
[0109] CheAs wild type and mutant (L126A, L123A) sequences were linked with 6×His and Flag tags to obtain CheAs-Flag-His sequences, in which 6×His tags were used for protein purification and Flag tags were used for Western blot detection. The CheAs-Flag-His sequence was constructed on pET28a vector and transformed into E. coli BL21 (DE3) strain. When OD600 was 0.6, IPTG was added, induced at 37° C. for 3h, and CheAs protein was purified by nickel column.
[0110] 3. Verify the Interaction Between CheZ Protein at Different Concentrations and Wild-Type CheAs Protein, as Shown in
[0111] Biotinylated protein CheZ was mixed with wild-type protein CheAs (0.2 μM) and SA.sub.m-Pup.sup.E. The concentration gradients of biotinylated protein CheZ are set to 0, 0.1 μM, 0.2 μM and 0.4 μM. PafA7.sub.KR (10 mM) and ATP (5 mM) were added into the system, and then incubated at 30° C. for 6h. Flag antibody was used for Western blot analysis. If there is no interaction between protein CheAs and protein CheZ, CheAs bands (truncated type, about 19 kDa) were detected; If there is interaction between the two proteins, the complex bands of CheAs and SA.sub.m-Pup.sup.E monomer were detected. As shown in
[0112] 4. Verify the Interaction Between CheZ Protein and Different Mutant CheAs Protein, as Shown in
[0113] The biotinylated protein CheZ (0.4 μM) was well mixed with the protein CheAs (0.2 μM) and SA.sub.m-Pup.sup.E. CheAs include wild type (WT) and mutant type (L126A, L123A). PafA7.sub.KR (10 mM) and ATP (5 mM) were added into the system, mixed well and incubated at 30° C. for 6h. Flag antibody was used for Western blot analysis. As shown in
[0114] 5. Identify the CheAs Protein-Formed Complex by Mass Spectrometry, as Shown in
[0115] LC-MS/MS detection of the CheAs protein-formed complex showed that the C-terminal of SA.sub.m-Pup.sup.E was linked to multiple CheAs sites, including K146 site, as shown in
[0116] This example also verified that the streptavidin-Pup tetramer protein prepared using the Pup (E) of example 1 (the preparation method is the same as that of example 2, except that Pup.sup.E is replaced by Pup (E)) was used to verify the interaction between CheAs protein and CheZ protein, and the results were similar to those of
[0117] This example also verified that SA.sub.m-Pup.sup.E-1 and SA.sub.m-Pup.sup.E-2 as described in Example 2 were used to verify the interaction between CheAs protein and CheZ protein, and the results were similar to those of
Embodiment 5 Detection of Interacting Proteins of CobB
[0118] 1. The principle of using this method to detect CobB interacting proteins is shown in
[0119] When biotinylated CobB protein binds to SA.sub.m-Pup.sup.E, PafA7.sub.KR exerts proximity labeling activity to covalently link the C-terminal of SA.sub.m-Pup.sup.E to the interacting protein of CobB when the protein in cell lysate interacts with CobB.
[0120] 2. The Flow of Detecting CobB Interacting Proteins Using this Method is Shown in
[0121] Firstly, the biotinylated CobB protein was constructed and reacted with SA.sub.m-Pup.sup.E, PafA7.sub.KR enzyme and E. coli SLIAC (Lys/Arg relabeled) cell lysate (experimental group). In the control group, SLIAC relabeled cell lysate was replaced by E. coli common cell lysate. SA.sub.m-Pup.sup.E and its covalently linked capture protein were enriched by biotin agarose beads. The capture protein was identified by mass spectrometry and the non-specific binding was removed.
[0122] The Specific Steps are as Follows:
[0123] 2.1 Biotin-modified CobB protein was obtained. The CobB sequence with Avi tag was constructed into pET32a vector, and BirA with biotin labeling function was constructed into pET28a vector, and both vectors were transformed into E. coli BL21 (DE3) strain at the same time. The biotin-modified CobB protein was purified by nickel column after IPTG was added when OD600 was about 0.6 and induced overnight at 18° C.
[0124] 2.2 Preparation of Cell Lysate Samples
[0125] E. coli cells and SLIAC (Lys/Arg re-labeled) cells were cultured and lysed by high pressure disruption to obtain cell lysate.
[0126] 2.3 Capture and Detection of Protein Interactions
[0127] The following reaction system was prepared: 1 μM biotinylated CobB protein, 5 μM SA.sub.m-Pup.sup.E, 0.5 μM PafA7.sub.KR enzyme, 5 mM ATP, 5 mg of E. coli cell lysate or SILAC cell lysate were added, and buffer (50 mM Tris 8.0, 0.5 M NaCl, 20 mM MgCl.sub.2, 10% (v/v) Glycerol, 10 mM imidazole) was lysed to 5 ml. The system was incubated at 30° C. for 6h, and biotin agarose beads were added for incubation overnight at 4° C. Wash buffer 1 (8M urea, 50 mM Tris 8.0, 200 mM NaCl, 0.2% SDS), Wash Buffer 2 (8M urea, 50 mM Tris 8.0, 200 mM NaCl, 2% SDS), Wash buffer 3 (8M urea, 50 mM Tris 8.0, 200 mM NaCl), Wash buffer 4 (50 mM Tris 8.0, 0.5 mM EDTA, 1 mM DTT), Wash buffer 5 (50 mM NH4HCO.sub.3) were incubated at room temperature for 5 min and centrifuged at 1500 rpm for 4 min. The biotin agarose beads were transferred to a 1.5 mL centrifuge tube, centrifuged in a horizontal centrifuge with 1 mL Wash buffer 5, 1500 rpm for 4 min and washed repeatedly with Wash buffer 5 to obtain the reaction product. Trypsin was lysed and identified by mass spectrometry.
[0128] 3. Result Analysis
[0129] Comparing the CobB interacting proteins obtained by this method with the existing studies, the results are as shown in
[0130] 4. Interacting Protein Validation
[0131] The interacting proteins found were purified and the interaction with CobB was verified. The results of purified proteins are shown in
[0132] CobB has the activity of deacetylase. CobB was co-incubated with VacB and DksA proteins, and the acetylation level of protein was detected by Western blot analysis of acetylation antibody. As shown in
Embodiment 6 Detection of Cell Surface Receptor of PD-1 Protein
[0133] 1. The principle of using this method to detect PD-1 protein cell surface receptor is shown in
[0134] Biotinylated PD-1 protein binds to SA.sub.m-Pup.sup.E. When PD-1 interacts with cell surface receptor, PafA7.sub.KR exerts proximity labeling activity to covalently link the C terminal of SA.sub.m-Pup.sup.E to the receptor.
[0135] 2. The Flow of Detecting the Cell Surface Receptor of PD-1 Protein Using this Method is Shown in
[0136] Firstly, purified PD-1 protein was constructed and reacted with HEK293T living cells in Petri dish. SA.sub.m-Pup.sup.E and its covalently linked capture protein were enriched by biotin agarose beads, and the capture protein was identified by mass spectrometry.
[0137] The specific steps are as follows:
[0138] 2.1 Construction of PD-1 sequence with Avi tag on N-terminal onto pET32a vector, construction of BirA with biotin-labeled function onto pET28a vector, co-transformation of the two plasmids into E. coli BL21 (DE3) strain. When OD600 was 0.6, IPTG was added and induced overnight at 18° C. The PD-1 protein modified by biotin was purified by nickel column.
[0139] 2.2 Preparation of HEK293T Cells
[0140] The PD-L1 plasmid was transfected into HEK293T cells with Lipofectamine 2000 (ThermoFisher 118668) and cultured for 48 h.
[0141] 2.3 Capture of Cell Surface Receptors
[0142] The following reaction system was prepared: 1 μM biotinylated PD-1 protein, 5 μM SA.sub.m-Pup.sup.E, 0.5 μM PafA7.sub.KR enzyme, 5 mM ATP. HEK293T cells overexpressing PD-L1 were added to react in a plate, incubated at 30° C. for 6h, and incubated overnight at 4° C. with biotin agarose beads. Wash buffer 1 (8M urea, 50 mM Tris 8.0, 200 mM NaCl, 0.2% SDS), Wash Buffer 2 (8M urea, 50 mM Tris 8.0, 200 mM NaCl, 2% SDS), Wash buffer 3 (8M urea, 50 mM Tris 8.0, 200 mM NaCl), Wash buffer 4 (50 mM Tris 8.0, 0.5 mM EDTA, 1 mM DTT), Wash buffer 5 (50 mM NH4HCO3) were incubated at room temperature for 5 min and centrifuged at 1500 rpm for 4 min. The biotin agarose beads were transferred to a 1.5 mL centrifuge tube, centrifuged in a horizontal centrifuge with 1 mL Wash buffer 5, 1500 rpm for 4 min and washed repeatedly with Wash buffer 5 to obtain the reaction product. Trypsin was lysed and identified by mass spectrometry.
[0143] 3. Verification of Interaction Between PD-1 and PD-L1
[0144] The invention is used to verify the interaction between PD-1 and PD-L1. If there is interaction, PafA7.sub.KR enzyme covalently connects the C terminal of SA.sub.m-Pup.sup.E to PD-L1. As shown in
Embodiment 7 Detection of Interacting Proteins of SARS-CoV-2 Proteins
[0145] 1. The flow of using this method to detect the interaction protein of some SARS-CoV-2 proteins is shown in
[0146] Biotin modified SARS-CoV-2 protein was obtained. SARS-CoV-2 protein sequence with Avi tag was constructed into pET32a vector, and BirA with biotin labeling function was constructed into pET28a vector, and 2 plasmids were co-transformed into E. coli BL21 (DE3) strain. The biotin-modified SARS-CoV-2 protein was purified by nickel column after IPTG was added when OD600 was about 0.6 and induced overnight at 18° C.
[0147] 2. Preparation of Samples to be Tested
[0148] HEK293T normal cells and SLIAC (Lys/Arg relabeled) cells were cultured and lysed with Thermo Fisher 78501 M-PER® Mammalian Protein Extraction to obtain cell lysates.
[0149] 3. Capture and Detection of Protein-Protein Interactions
[0150] The reaction system was prepared as follows: 1 μM biotinylated bait protein, 5 μM SA.sub.m-Pup.sup.E, 0.5 μM PafA, 5 mM ATP, 5 mg HEK293T cell lysate or SILAC cell lysate was added, and the volume was supplemented to 5 ml with M-PER lysate. The system was incubated at 30° C. for 6h, and biotin agarose beads were added for incubation overnight at 4° C. Wash buffer 1 (8M urea, 50 mM Tris 8.0, 200 mM NaCl, 0.2% SDS), Wash Buffer 2 (8M urea, 50 mM Tris 8.0, 200 mM NaCl, 2% SDS), Wash buffer 3 (8M urea, 50 mM Tris 8.0, 200 mM NaCl), Wash buffer 4 (50 mM Tris 8.0, 0.5 mM EDTA, 1 mM DTT), Wash buffer 5 (50 mM NH.sub.4HCO.sub.3) were incubated at room temperature for 5 min and centrifuged at 1500 rpm for 4 min. The biotin agarose beads were transferred to a 1.5 mL centrifuge tube, centrifuged in a horizontal centrifuge with 1 mL Wash buffer 5, 1500 rpm for 4 min and washed repeatedly with Wash buffer 5 to obtain the reaction product. Trypsin was lysed and identified by mass spectrometry.
[0151] 4. Result Reading
[0152] Comparing the SARS-CoV-2 protein interacting proteins obtained by this method with the existing methods, the results are as shown in
[0153] 5. Interacting Protein Validation
[0154] The purified biotinylated ORF9b was co-incubated with SA.sub.m-Pup.sup.E, cell lysate overexpressing TOM70, PafA and ATP, and the bands of covalent linkage between TOM70 and SA.sub.m-Pup.sup.E monomer were detected, which indicated protein-protein interaction. As shown in
Embodiment 8 Identification of Interacting Proteins of Biotinylated m6A RNA
[0155] 1. Obtain Biotin-Modified RNA.
[0156] The 5′-terminal biotin-modified m6A RNA (biotinylated m6A RNA) was synthesized by Nanjing Kingsley Company, and the RNA sequence was CGUCUCGGCUCGGCUGCU (SEQ ID NO: 8).
[0157] 2. Prepare Samples to be Tested
[0158] HEK293T normal cells and SLIAC (Lys/Arg relabeled) cells were cultured and lysed with Thermo Fisher 78501 M-PER® Mammalian Protein Extraction to obtain cell lysates.
[0159] 3. Capture and Detection of m6A RNA Interacting Proteins
[0160] The reaction system was prepared as follows: 1 μM biotinylated m6A RNA, 5 μM SA.sub.m-Pup.sup.E, 0.5 μM PafA7.sub.KR enzyme, 5 mM ATP, 5 mg HEK293T cell lysate or SILAC cell lysate were added, and buffer (50 mM Tris 8.0, 0.5 M NaCl, 20 mM MgCl.sub.2, 10% (v/v) Glycerol, 10 mM imidazole) was lysed to 5 ml. The system was incubated at 30° C. for 6h, and biotin agarose beads were added for incubation overnight at 4° C. Wash buffer 1 (8M urea, 50 mM Tris 8.0, 200 mM NaCl, 0.2% SDS), Wash Buffer 2 (8M urea, 50 mM Tris 8.0, 200 mM NaCl, 2% SDS), Wash buffer 3 (8M urea, 50 mM Tris 8.0, 200 mM NaCl), Wash buffer 4 (50 mM Tris 8.0, 0.5 mM EDTA, 1 mM DTT), Wash buffer 5 (50 mM NH.sub.4HCO.sub.3) were incubated at room temperature for 5 min and centrifuged at 1500 rpm for 4 min. The biotin agarose beads were transferred to a 1.5 mL centrifuge tube, centrifuged in a horizontal centrifuge with 1 mL Wash buffer 5, 1500 rpm for 4 min and washed repeatedly with Wash buffer 5 to obtain the reaction product. Trypsin was lysed and identified by mass spectrometry. Three credible m6A binding proteins, YTDHF1, YTDHF2 and YTDHF3, were obtained by mass spectrometry.
Embodiment 9: Verification of Interaction Between Biotinylated m6A RNA and YTDHF1, YTDHF2, YTDHF3 Proteins
[0161] 1. Obtain Biotin-Modified m6A RNA
[0162] The 5′-terminal biotin-modified m6A RNA (biotinylated m6A RNA) was synthesized by Nanjing Kingsley Company, and the RNA sequence was CGUCUCGGCUCGGCUGCU (SEQ ID NO: 8). The cell lysates overexpressing YTDHF1, YTDHF2 and YTDHF3 proteins were obtained.
[0163] 2. Prepare Samples to be Verified
[0164] The sequences of YTDHF1, YTDHF2 and YTDHF3 were linked with GFP tags, which were used for Western blot detection. The sequences of YTDHF1-GFP, YTDHF2-GFP and YTDHF3-GFP were constructed on pCDNA3.1 vector and transfected into HEK293T cells with Lipofectamine 2000 (ThermoFisher 118668). After 48h of culture, the lysates overexpressing YTDHF1, YTDHF2 and YTDHF3 were extracted.
[0165] 3. Verify the Interaction of Biotinylated m6A RNA with YTDHF1, YTDHF2, YTDHF3 Proteins, as Shown in
[0166] The cells overexpressing YTDHF1, YTDHF2 and YTDHF3 were mixed with biotinylated m6A RNA (0.5 μM) and SA.sub.m-Pup.sup.E, then PafA7.sub.KR (10 mM) and ATP (5 mM) were added into the system, then incubated at 30° C. for 4-6h. Immunoblot analysis of GFP antibody was used. If the protein YTDHF1, YTDHF2, YTDHF3 interacted with biotinylated m6A RNA, the protein-SA.sub.m-Pup.sup.E complex bands (>120 kDa) could be detected; If the proteins YTDHF1, YTDHF2, YTDHF3 did not interact with biotinylated m6A RNA, only YTDHF1, YTDHF2, YTDHF3 bands (about 100 kDa) could be detected. As shown in
[0167] This example also verified that the streptavidin-Pup tetramer protein prepared using the Pup (E) of example 1 (the preparation method is the same as that of example 2, except that Pup.sup.E is replaced by Pup (E)) was used to verify the interaction of biotinylated m6A RNA with YTDHF1, YTDHF2, YTDHF3 proteins, and the results were similar to those of
[0168] This example also verified that SA.sub.m-Pup.sup.E-1 and SA.sub.m-Pup.sup.E-2 described in Example 2 were used to verify the interaction between biotinylated m6A RNA and YTDHF1, YTDHF2 and YTDHF3 proteins, and the results were similar to those of
Embodiment 10 Identification of Interacting Proteins of Biotinylated DNA
[0169] In this example, four segments of biotinylated DNA are used, and the interacting proteins are identified after mixing them. The target sequences of the four segments of biotinylated DNA are CGGCAGATGCATAAAGGTG (SEQ ID NO: 9), CACCTTTTTTATGCATCTGCCG (SEQ ID NO: 10), CCTTTTTTATGCAAAT (SEQ ID NO: 11) and ATATGCAAATT (SEQ ID NO: 12).
[0170] 1. Obtain Biotin-Modified DNA
[0171] Nanjingjinsirui Science & Technology Biology Corp. synthesized the above four 5′-end biotin modified DNA target sequences and their corresponding four complementary sequences, DNA target sequence (DNA oligo A) and its corresponding complementary sequence (DNA oligo B) were prepared into 5004 with ultrapure water, respectively, and the following reaction systems were set up: Nuclease-Free Water 40 μL, Annealing Buffer (5×) 20 μL, DNA oligo A (50 μM) 20 μL, DNA oligo B (50 μM) 20 μL. After the above systems were mixed evenly, they were placed in PCR to perform annealing reaction: 95° C. for 2 min, and dropped 0.1° C. every 8 seconds to 25° C., and then double-stranded target DNA (i.e. biotinylated DNA) was obtained.
[0172] 2. Obtain the Sample to be Tested
[0173] Mouse cells were cultured and lysed using Thermo Fisher 78501 M-PER® Mammalian Protein Extraction to obtain cell lysate.
[0174] 3. Capture and Detection of Biotinylated DNA Interacting Proteins
[0175] The following reaction system was prepared: 1 μM mixed biotinylated DNA, 5 μM SA.sub.m-Pup.sup.E, 0.504 PafA7.sub.KR enzyme, 5 mM ATP, 5 mg HEK293T cell lysate or SILAC cell lysate, and 5 ml buffer (50 mM Tris 8.0, 0.5 M NaCl, 20 mM MgCl.sub.2, 10% (v/v) Glycerol, 10 mM imidazole). The system was incubated at 30° C. for 6h, and biotin agarose beads were added for incubation overnight at 4° C. Wash buffer 1 (8M urea, 50 mM Tris 8.0, 200 mM NaCl, 0.2% SDS), Wash buffer 2 (8M urea, 50 mM Tris 8.0, 200 mM NaCl, 2% SDS), Wash buffer 3 (8M urea, 50 mM Tris 8.0, 200 mM NaCl), Wash buffer 4 (50 mM Tris 8.0, 0.5 mM EDTA, 1 mM DTT) and Wash buffer 5 (50 mM NH.sub.4HCO.sub.3) were incubated at room temperature for 5 min, and centrifuged at 1500 rpm for 4 min to remove supernatant. The biotin agarose beads were transferred to a 1.5 mL centrifuge tube, centrifuged in a horizontal centrifuge with 1 mL Wash buffer 5, 1500 rpm for 4 min and washed repeatedly with Wash buffer 5 to obtain the reaction product. Trypsin was lysed and identified by mass spectrometry. According to the results of mass spectrometry, several credible biotin DNA binding proteins were obtained, such as Sox2, HNRNPAB, Sub1, Arid 3a, etc.
Embodiment 11 Verification of Interaction Between Biotinylated DNA and EthR Protein
[0176] 1. Obtain Biotin-Modified DNA
[0177] Nanjingjinsirui Science & Technology Biology Corp. synthesized the 5′-terminal biotin modified DNA target sequence and its complementary sequence. The DNA target sequence is: CATGGATCCACCGTAATGTCGAGGCCGTCAACGAGATGTCGACACTATCGACACGT AGTAAGCTGCCAGATGAGACAAA (SEQ ID NO: 13). DNA target sequence (DNA oligo A) and its corresponding complementary sequence (DNA oligo B) were prepared into 50 μM with ultrapure water, respectively, and the following reaction systems were set up: Nuclease-Free Water 40 μL, Annealing Buffer (5×) 20 μL, DNA oligo A (50 μM) 20 μL, DNA oligo B (50 μM) 20 μL. After the above systems were mixed evenly, they were placed in PCR to perform annealing reaction: 95° C. for 2 min, and dropped 0.1° C. every 8 seconds to 25° C., and then double-stranded target DNA (i.e. biotinylated DNA) was obtained.
[0178] 2. Obtain DNA Binding Protein EthR
[0179] EthR-Flag-His sequence was obtained by linking 6×His and Flag tags to the sequence encoding EthR protein, in which 6×His tags were used for protein purification and Flag tags were used for Western blot detection. EthR-Flag-His sequence was constructed on pET28a vector and transformed into E. coli BL21 (DE3) strain. When OD600≈0.6, IPTG was added into 1 L bacterial solution cultured, and induced overnight at 18° C. EthR protein was purified by nickel column.
[0180] 3. Verify the Interaction Between Biotinylated DNA and EthR, as Shown in
[0181] In order to verify that interaction between specifically capture biotinylated DNA and EthR protein, Using different types of DNA molecules to react with EthR protein, The biotinylated DNA molecule is used as the experimental group, poly dIdC molecule can reduce the non-specific binding between DNA and protein, high concentration of DNA molecules without biotin modification and with the same sequence are used to compete for binding to low concentration of biotinylated DNA, and mutated biotinylated DNA (sequence: CATGGATCCACCGCTATCAACGTAATGCCGTCAACAAGATAAGCCCCCTATCGACAC GTAGTAAGCTGCCAGATGACAAAGCCID, SEQ ID NO: 14) is used to verify the specificity of DNA sequence. Biotinylated DNA (1 μM), a mixture of biotinylated DNA (1 μM) and poly dI dC, a mixture of biotinylated DNA (1 μM) and identical DNA without biotin modification (10 μM), and mutated biotinylated DNA (1 μM) were added to several systems. Different types of EthR-binding DNA fragments were mixed with EthR protein (0.2 μM) and SA.sub.m-Pup.sup.E. PafA7.sub.KR (10 mM) and ATP (5 mM) were added into the system, and incubated at 30° C. for 4-6h. Flag antibody was used for Western blot analysis. If the protein EthR interacted with DNA, the complex band (about 50 kDa) between EthR and SA.sub.m-Pup.sup.E monomer was detected; If there was no interaction between the protein EthR and DNA, an EthR band (about 32 kDa) was detected. As shown in
Embodiment 12 Verification of Specificity of DNA-RutR Interaction
[0182] 1. Obtain Biotin-Modified DNA
[0183] Nanjingjinsirui Science & Technology Biology Corp. synthesized the 5′-end biotin modified DNA target sequence and its complementary sequence. 2 DNA target sequences are TTGACCACATGGACCAAACAGTCTG (SEQ ID NO: 15, corresponding to the DNA sequence of biotin-D1 or D1) and TTGACCACATAGACCGACTGGTCTA (SEQ ID NO: 16, corresponding to the DNA sequence of biotin-D2 or D2). DNA target sequence (DNA oligo A) and its corresponding complementary sequence (DNA oligo B) were prepared into 50 μM with ultrapure water, respectively, and the following reaction systems were set up: Nuclease-Free Water 40 μL, Annealing Buffer (5×) 20 μL, DNA oligo A (50 μM) 20 μL, DNA oligo B (50 μM) 20 μL. After the above systems were mixed evenly, they were placed in PCR to perform annealing reaction: 95° C. for 2 min, and dropped 0.1° C. every 8 seconds to 25° C., and then double-stranded target DNA (i.e. biotinylated DNA) was obtained.
[0184] 2. Obtain DNA Binding Protein RutR
[0185] RutR-Flag-His sequence was obtained by linking 6×His and Flag tags to the sequence encoding RutR protein, in which 6×His tags were used for protein purification and Flag tags were used for Western blot detection. The RutR-Flag-His sequence was constructed on pET28a vector and transformed into E. coli BL21 (DE3) strain. The RutR protein was obtained by adding IPTG at 18° C. overnight when OD600 was about 0.6 and purified by nickel column.
[0186] 3. Verify the Interaction Between Biotinylated DNA and RutR, as Shown in
[0187] In order to verify that the invention can specifically capture the interaction between biotinylated DNA and RutR protein, different types of DNA molecules are used to react with RutR protein: biotinylated DNA (biotin-D1, biotin-D2), DNA without biotin modification and consistent sequence (D1, D2), irrelevant sequence D3 (the sequence of D3 is CAACCATGAGTCATAC, SEQ ID NO: 17) and biotin labeled D3 (biotin-D3); biotin-D1 (1 μM), biotin-D1 (1 μM) and D1 (10 μM), biotin-D2 (1 μM), biotin-D2 (1 μM) and D2 (10 μM), biotin-D3 (1 μM), biotin-D3 (1 μM) and D3 (10 μM) were added to different reaction systems (as shown in
Example 13 Verification of Interaction Between Biotinylated DNA and GCN4
[0188] 1. Obtain Biotin-Modified DNA
[0189] Nanjingjinsirui Science & Technology Biology Corp. synthesized the 5′-terminal biotin modified DNA target sequence and its complementary sequence, and the DNA target sequence was CAACCCATGAGTCATAC (SEQ ID NO: 17). DNA target sequence (DNA oligo A) and its corresponding complementary sequence (DNA oligo B) were prepared into 50 μM with ultrapure water, respectively, and the following reaction systems were set up: Nuclease-Free Water 40 μL, Annealing Buffer (5×) 20 μL, DNA oligo A (50 μM) 20 μL, DNA oligo B (50 μM) 20 μL. After the above systems were mixed evenly, they were placed in PCR to perform annealing reaction: 95° C. for 2 min, and dropped 0.1° C. every 8 seconds to 25° C., and then double-stranded target DNA (i.e. biotinylated DNA) was obtained.
[0190] 2. Obtain DNA Binding Protein GCN4
[0191] GCN4-Flag-His sequence was obtained by linking 6×His and Flag tags to the sequence encoding GCN4 protein, in which 6×His tags were used for protein purification and Flag tags were used for Western blot detection. The GCN4-Flag-His sequence was constructed on pET28a vector and transformed into E. coli BL21 (DE3) strain. When OD600 was 0.6, IPTG was added and induced overnight at 18° C., and GCN4 protein was purified by nickel column.
[0192] 3. Verify the Interaction Between Biotinylated DNA and GCN4, as Shown in
[0193] The biotinylated DNA molecule (104) was fully mixed with GCN4 protein (0.2 μM) and SA.sub.m-Pup.sup.E, and a high concentration of DNA (10 μM) without biotin modification and with consistent sequence was added to the other system to verify that SPIDER technology specifically captured the interaction between biotinylated DNA and GCN4 protein. PafA7.sub.KR (10 mM) and ATP (5 mM) were added into the system, and then incubated at 30° C. for 4-6 h. Flag antibody was used for Western blot analysis. If the protein GCN4 interacted with DNA, the complex band (about 40 kDa) between GCN4 and SA.sub.m-Pup.sup.E monomer was detected; If there was no interaction between GCN4 and DNA, GCN4 bands (about 20 kDa) were detected. As shown in
Embodiment 14 Identification of Interacting Proteins of Lenalidomide Small Molecule
[0194] 1. Obtain Biotin Modified Lenalidomide (Lenalidomide) Small Molecule
[0195] Biotin modified lenalidomide molecule was presented by Dong Jiajia, a teacher from Shanghai Institute of Organic Chemistry, Chinese Academy of Sciences. lenalidomide is a conventional small molecule with a size of 259.261 Da.
[0196] 2. Obtain the Sample to be Tested
[0197] HEK293T cells were cultured and lysed with Thermo Fisher 78501 M-PER® Mammalian Protein Extraction to obtain cell lysate.
[0198] 3. Capture and Detection of Biotinylated Lenalidomide Interacting Protein
[0199] The reaction system was prepared as follows: 1 μM mixed biotinylated lenalidomide, 5 μM SA.sub.m-Pup.sup.E, 0.5 μM PafA7.sub.KR enzyme, 5 mM ATP, 5 mg of HEK293T cell lysate or SILAC cell lysate was added, and buffer (50 mM Tris 8.0, 0.5 M NaCl, 20 mM MgCl2, 10% (v/v) Glycerol, 10 mM imidazole) was completed to 5 ml. The system was incubated at 30° C. for 6h, and biotin agarose beads were added for incubation overnight at 4° C. Wash buffer 1 (8M urea, 50 mM Tris 8.0, 200 mM NaCl, 0.2% SDS), Wash buffer 2 (8M urea, 50 mM Tris 8.0, 200 mM NaCl, 2% SDS), Wash buffer 3 (8M urea, 50 mM Tris 8.0, 200 mM NaCl), Wash buffer 4 (50 mM Tris 8.0, 0.5 mM EDTA, 1 mM DTT) and Wash buffer 5 (50 mM NH4HCO3) were incubated at room temperature for 5 min, and centrifuged at 1500 rpm for 4 min to remove supernatant. The biotin agarose beads were transferred to a 1.5 mL centrifuge tube, centrifuged in a horizontal centrifuge with 1 mL Wash buffer 5, 1500 rpm for 4 min and washed repeatedly with Wash buffer 5 to obtain the reaction product. Trypsin was lysed and identified by mass spectrometry. According to the results of mass spectrometry, several credible biotin lenalidomide binding proteins were obtained, such as PRDX2, ADD3, TRIM25, PSMEL PHB, WDR18, HK2 and so on.
Embodiment 15 Verification of the Interaction Between c-Di-GMP Small Molecule and ETHR Protein
[0200] 1. Obtain Biotin Modified c-Di-GMP
[0201] Biotin-modified c-di-GMP was purchased from Biolog Company under item number B098-005 and molecular size 1172 Da.
[0202] 2. Obtain the Protein to be Verified
[0203] ETHR-Flag-His sequence was obtained by linking the sequence encoding ETHR protein with 6×His tag and Flag tag respectively, in which 6×His tag was used for protein purification and Flag tag was used for Western blot detection. The ETHR-Flag-His sequence was constructed on pET28a vector and transformed into E. coli BL21 (DE3) strain. When OD600 was 0.6, IPTG was added and induced overnight at 18° C. ETHR protein was purified by nickel column.
[0204] 3. Verify the Interaction of c-Di-GMP Small Molecules with ETHR Protein at Different Concentrations, as Shown in
[0205] The biotinylated small molecule c-di-GMP (Biotin-c-di-GMP) was mixed with ETHR protein and SA.sub.m-Pup.sup.E. The concentration gradients of biotinylated small molecule c-di-GMP are 0, 0.5 μM and 2 μM. PafA 7.sub.KR (1 μM) and ATP (10 mM) were added to each concentration system, and then incubated at 30° C. for 4-6 h. Flag antibody was used for Western blot analysis. If the decoy molecule c-di-GMP did not interact with the protein ETHR, only the ETHR protein band (about 32 KDa) was detected; If the small molecule c-di-GMP interacted with the protein, the complex band of ETHR and SA.sub.m-Pup.sup.E monomer (about 50 KDa) was detected. As shown in
Embodiment 16: Verification of Interaction Between c-Di-GMP Small Molecule and CSP Series Short Peptides
[0206] 1. Obtain Biotin Modified c-Di-GMP
[0207] Biotin-modified c-di-GMP was purchased from Biolog Company under item number B098-005.
[0208] 2. Obtain the Protein to be Verified
[0209] The N-terminal sequences encoding CSP1, CSP2 and CSP3 were all labeled with Flag tags and constructed on PET32a vector, which was fused with thioredoxin for expression. The recombinant vector was transformed into E. coli BL21 (DE3) strain. The CSP1, CSP2 and CSP3 proteins were obtained by adding IPTG and inducing at 37° C. for 4h when OD600 was about 0.6 in 1 L of bacteria medium. The CSP1, CSP2 and CSP3 proteins were purified by nickel column.
[0210] CSP series peptide sequences were:
TABLE-US-00001 (SEQ ID NO: 18) CSP1: GGSGDRRRFNSADYKGPRRRKAD (SEQ ID NO: 19) CSP2: GGSGDRRFNSADYKGPRRRKAD (SEQ ID NO: 20) CSP3: GGSGDRRRFNSADYKAPRRRKAD
[0211] 3. Verify the Interaction Between c-Di-GMP Small Molecules and CSP Series Proteins, as Shown in
[0212] The biotinylated small molecule c-di-GMP (2 μM) was mixed with CSP series proteins (5 μM) and SA.sub.m-Pup.sup.E and incubated at 30° C. for 20 min. After that, PafA7.sub.KR (1 μM) and ATP (10 mM) were added into the system and incubated at 30° C. for 6 h. Flag antibody was used for Western blot analysis. Compared with c-di-GMP without biotinylation, the CSP series protein bands in the experimental group migrated significantly. The results showed that the system was connected with the whole system by biotinylated c-di-GMP.
Embodiment 17: Verification of the Interaction Between Rapamycin Small Molecule and FKBP12 Protein
[0213] 1. Obtain Biotin Modified Rapamycin
[0214] Biotin modified Rapamycin was presented by Dang Yongjun, a teacher from School of Basic Medicine, Fudan University. It is a conventional known small molecule with a molecular size of 914.19 Da.
[0215] 2. Obtain the Protein to be Verified
[0216] FKBP12-V5-His sequence was obtained by linking 6×His and V5 tags to the sequence encoding FKBP12 protein respectively, in which 6×His tag was used for protein purification and V5 tag was used for Western blot detection. The FKBP12-V5-His sequence was constructed on pET28a vector and transformed into E. coli BL21 (DE3) strain. FKBP12 protein was obtained by adding IPTG at 18° C. overnight when OD600 was about 0.6 and purified by nickel column.
[0217] The biotinylated small molecule Rapamycin (2 μM), FKBP12 protein (5 μM) and SA.sub.m-Pup.sup.E were mixed well and incubated at 30° C. for 20 min, then PafA7.sub.KR (1 μM) and ATP (10 mM) were added into the system, mixed well and incubated at 30° C. for 6 h. Flag antibody was used for Western blot analysis. Compared with Rapamycin without biotinylation in the system, the FKBP12 protein bands in the experimental group migrated significantly. It shows that the system started working after connecting with the whole system through biotinylated Rapamycin, as shown in
[0218] There are many specific application ways of the invention, and the above is only a preferred embodiment of the invention. It should be noted that the above embodiments are only intended to illustrate the present invention and are not intended to limit the scope of protection of the present invention. To one of ordinary skill in the art, several modifications may be made without departing from the principles of the present invention, which should also be considered as the scope of protection of the present invention.