A GENETICALLY MODIFIED BACILLUS SUBTILIS STRAIN, OPTIMIZED VECTORS, AND USES THEREOF

Abstract

A genetically modified Bacillus subtilis strain has been transformed with an optimized vector, mainly for producing a D-psicose 3-epimerase.

Claims

1. A genetically modified Bacillus subtilis strain wherein the alanine racemase alrA gene is inactivated, and having at least a further gene inactivation chosen among: the inactivation of the sporulation yfqD gene, and/or the inactivation of the erythromycin resistance EmR-comK gene cassette.

2. A genetically modified Bacillus subtilis strain according to claim 1, chosen among: the strain deposited at the National Collection of Microorganisms Cultures on Oct. 18, 2017 under the accession number CNCM I-5251; the strain deposited at the National Collection of Microorganisms Cultures on Oct. 18, 2017 under the accession number CNCM I-5252; and the strain deposited at the National Collection of Microorganisms Cultures on Oct. 18, 2017 under the accession number CNCM I-5253;

3. An isolated nucleic acid molecule comprising a nucleic acid sequence coding for D-psicose 3-epimerase and a sequence comprising or consisting of SEQ ID NO: 1 or of SEQ ID NO: 2.

4. An isolated nucleic acid molecule according to claim 3, wherein the nucleic acid sequence coding for D-psicose 3-epimerase is chosen among the nucleic acid of SEQ ID NO: 3, SEQ ID NO: 4, or the nucleic acid coding for SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12 and SEQ ID NO: 13.

5. A recombinant expression vector comprising a nucleic acid according to claim 3, comprising or consisting of SEQ ID NO: 14, SEQ ID NO: 15 or SEQ ID NO: 16.

6. A recombinant host cell comprising a nucleic acid according to claim 3.

7. A recombinant host cell according to claim 6, wherein the host cell is a genetically modified Bacillus subtilis strain wherein the alanine racemase alrA gene is inactivated, and having at least a further gene inactivation chosen among: the inactivation of the sporulation yfqD gene, and/or the inactivation of the erythromycin resistance EmR-comK gene cassette.

8. A recombinant host cell according to claim 6, wherein the host cell is chosen among: a genetically modified Bacillus subtilis strain deposited at the National Collection of Microorganisms Cultures on Oct. 18, 2017 under the accession number CNCM I-5251 which comprises a nucleic acid comprising or consisting of SEQ ID NO: 14; a genetically modified Bacillus subtilis strain deposited at the National Collection of Microorganisms Cultures on Oct. 18, 2017 under the accession number CNCM I-5251 which comprises a nucleic acid comprising or consisting of SEQ ID NO: 15; a genetically modified Bacillus subtilis strain deposited at the National Collection of Microorganisms Cultures on Oct. 18, 2017 under the accession number CNCM I-5251 which comprises a nucleic acid comprising or consisting of SEQ ID NO: 16; a genetically modified Bacillus subtilis strain deposited at the National Collection of Microorganisms Cultures on Oct. 18, 2017 under the accession number CNCM I-5252 which comprises a nucleic acid comprising or consisting of SEQ ID NO: 14; a genetically modified Bacillus subtilis strain deposited at the National Collection of Microorganisms Cultures on Oct. 18, 2017 under the Number CNCM I-5252 which comprises a nucleic acid comprising or consisting of SEQ ID NO: 15; a genetically modified Bacillus subtilis strain deposited at the National Collection of Microorganisms Cultures on Oct. 18, 2017 under the accession number CNCM I-5252 which comprises a nucleic acid comprising or consisting of SEQ ID NO: 16; a genetically modified Bacillus subtilis strain deposited at the National Collection of Microorganisms Cultures on Oct. 18, 2017 under the accession number CNCM I-5253 which comprises a nucleic acid comprising or consisting of SEQ ID NO: 14; a genetically modified Bacillus subtilis strain deposited at the National Collection of Microorganisms Cultures on Oct. 18, 2017 under the accession number CNCM I-5253 which comprises a nucleic acid comprising or consisting of SEQ ID NO: 15; a genetically modified Bacillus subtilis strain deposited at the National Collection of Microorganisms Cultures on Oct. 18, 2017 under the accession number CNCM I-5253 which comprises a nucleic acid comprising or consisting of SEQ ID NO: 16.

9. A method for producing a D-psicose 3-epimerase, notably by a fermentation process, comprising culturing the recombinant host cell according to claim 6, and optionally recovering the produced D-psicose 3-epimerase from the resulting culture.

10. A method for producing a D-psicose 3-epimerase notably by a fermentation process, comprising culturing the recombinant host cell according to claim 6, and optionally recovering the produced D-psicose 3-epimerase from the resulting culture, comprising the following steps: culturing the recombinant host cell according to claim 6 in a suitable culture medium comprising a sugar concentration of at least 60 g/L, notably 60 g/L; and optionally recovering the produced D-psicose 3-epimerase from the resulting culture.

11. A method for producing a D-psicose 3-epimerase according to claim 9, wherein the recombinant host cell is a genetically modified Bacillus subtilis strain deposited at the National Collection of Microorganisms Cultures on Oct. 18, 2017 under the accession number CNCM I-5253 which comprises a nucleic acid comprising or consisting of SEQ ID NO: 16.

12. A method for producing a D-psicose comprising: (a) culturing the recombinant host cell according to claim 6; (b) recovering the produced D-psicose 3-epimerase from the resulting culture; (c) contacting the D-psicose 3-epimerase obtained in step (b) with D-fructose in conditions suitable for D-psicose 3-epimerase activity; and (d) optionally recovering the produced D-psicose.

13. A method of obtaining a genetically modified Bacillus subtilis strain according to claim 1, comprising mutagenesis or gene transformation of a Bacillus subtilis strain.

14. A method of obtaining a recombinant host cell according to claim 6, comprising the following steps: (a) obtaining a genetically modified Bacillus subtilis strain comprising mutagenesis or gene transformation of a Bacillus subtilis strain; (b) transforming the said genetically modified Bacillus subtilis obtained in step (a) with a vector comprising a nucleic acid molecule comprising a nucleic acid sequence coding for D-psicose 3-epimerase and a sequence comprising or consisting of SEQ ID NO: 1 or of SEQ ID NO: 2.

15. A method of obtaining a recombinant host cell according to claim 14, comprising the following steps: (a) deleting the alanine racemase alrA gene in a Bacillus subtilis; (b) deleting the erythromycin resistance EmR-comK gene cassette in the Bacillus subtilis strain obtained in step (a); (c) deleting the sporulation yfqD gene in the Bacillus subtilis strain obtained in step (b); (d) transforming the Bacillus subtilis obtained in step (c) with a vector comprising or consisting of SEQ ID NO: 16.

16. A recombinant host cell comprising a recombinant expression vector according to claim 5.

Description

FIGURES

[0109] FIG. 1 represents an example of a strategy for the deletion of the alrA structural gene.

[0110] FIG. 2 represents the construction of the plasmid pUB-P43-DPEase-alrA also named vector/plasmid pR1.

[0111] FIG. 3 represents an outline of the vectors/plasmids pR1/pR2/pR3. The sequence region modified with respect to translational efficiency in pR2/pR3 is outlined as a black box.

[0112] FIG. 4 represents a PCR analysis of the beta-galactosidase genomic locus (ganA1/ganA2; wild type product: 2.1Kb). DNA was applied from three independent colonies of BsR, and two collection strain as B. subtilis 1A751 and type 168 strain; M1, gene ruler 100 bp; M2, gene ruler 1 Kb ladder.

[0113] FIG. 5 represents a flow scheme for the cassette EmR-ComK removal using MazF cassette. X indicates on crossing-over event.

[0114] FIG. 6 represents a PCR analysis of the EmR-ComK cassette in BsR clones using gan locus specific primers. 1: BsR original strain, 2-5: Em sensitive clones, M: GeneRuler 1 kb ladder.

[0115] FIG. 7A represents a PCR analysis of D-alanine auxotrophic yqfD (BsR4) mutant candidate clones using specific yqfD region primers.

[0116] FIG. 7B represents a genetic setup of sporulation locus yqfD before and after the deletion and location of analytic primers. 1-5 BsR4. #1-5 (1.7 kb product indicates deletion of yqfD); 6: BsR original strain expected for yqfD wild type); M: GeneRuler 1 kb ladder.

[0117] FIG. 8 represents a phenotype analysis of ΔyqfD (BsR4) on LB+D-alanine supplementation. FIG. 8A represents the BsR4 strain and FIG. 8B represents the BsR strain. For each figure, the left side is before heat treatment, and the right side is after heat treatment.

[0118] FIG. 9 represents the phenotypic screening of BsR5 mutant candidates via loss of D-alanine prototrophy. Clones that have successfully excised the integrated mutagenesis cassette should no longer be able to grow on LB (FIG. 9B) but strictly depend on medium supplemented with D-alanine (FIG. 9A).

[0119] FIG. 10 represents a schematic overview of the strain platform filiation and genetic events applied.

[0120] FIG. 11 represents an overview of the Working Cell Bank preparation

[0121] FIG. 12 represents an overview of the strain cultivation providing the D-psicose 3-epimerase and its stabilization step.

[0122] The following Examples are provided in order to demonstrate and further illustrate certain embodiments and aspects of the present invention and are not to be construed as limiting the scope thereof.

EXAMPLES

Example 1: Construction of a Recombinant Bacillus subtilis Producing a D-Psicose Epimerase from Clostridium cellulolyticum H10

[0123] Within a large part of the bacteria, D-alanine is an important component of the glycan subunits to form the cell wall (peptidoglycan).

[0124] Alanine is usually found as the L-stereoisomer in nature, making the conversion to D-alanine by the cytoplasmic D-alanine racemase (alrA) essential for cell growth.

[0125] Lack of the enzyme leads to rapid cell lysis due to a failure in the initial step of peptidoglycan biosynthesis.

[0126] The entire alrA structural gene (GenBank, no. CAB12271.1) and regulatory signals for its expression were contained within the 1.17 kb DNA fragment (SEQ ID NO: 17).

[0127] 1. Construction of the Bacillus subtilis Host Named BsR

[0128] Fusion of the antibiotic resistance marker cassette with long-flanking homology regions by PCR was done as described by Shevchuk et al. (Nikolai A. Shevchuk et al. Nucleic Acids Research, 2004(32): e19). In brief, it was carried out as follows.

[0129] The lox71-spc-lox66 cassette was amplified from vector p7S6 using P1/P2 primer pair. Two additional primer pairs (P3/P4 and P5/P6) were used to amplify about 900 bp DNA fragments flanking the D-alanine racemase region for deletion at its front and back ends.

[0130] Extensions of 32 nucleotides (nt) that were complementary to the 5′ and 3′ ends of the amplified marker cassette were added to the 5′ end of the reverse and forward primers of the front and back flanking regions, respectively. Finally, the two flanking homology regions and the lox71-spc-lox66 cassette were fused by PCR.

[0131] The PCR product was directly transformed into the B. subtilis host (the PCR product has been recombined with the B. subtilis chromosome due to the two flanking homology fragments).

[0132] Transformants clones were selected on LB agar enriched with both spectinomycin (Spc) (100 μg/mL) and D-alanine (200 μg/mL).

[0133] A positive clone which provides the phenotype [alrA.sup.−; Spc.sup.R] was selected for further modification.

[0134] Then the antibiotic-resistant gene Spc was knocked out by the Cre/Lox system.

[0135] Finally, a Bacillus subtilis host [alrA.sup.−] in which the alanine racemase alrA gene is deleted is obtained (FIG. 1). This Bacillus subtilis is named BsR.

[0136] 2. Construction of the Recombinant Plasmid and the Antibiotic Free B. subtilis DPEase Producer

[0137] The Bacillus subtilis endogenous promotor P43 was amplified from the well-known strain Bacillus subtilis 168 chromosome using the primer pair P7/P8. The D-psicose 3-epimerase gene of Clostridium cellulolyticum H10 (ATCC 35319) (GenBank no CP001348.1) (sequence II) encoding the protein with locus tag YP_002505284 was de novo synthetized by with 1) integration of NdeI and XhoI restriction site at 5′ and 3′terminus (for further gene cloning steps) and 2) a nucleotide substitution T558C to neutralize a NdeI restriction site (SEQ ID NO: 4).

[0138] The P43 promoter and D-psicose 3-epimerase gene were fused as an expression cassette via SOE-PCR (splicing overlap extension PCR) using P7 and P10 primers. Then the PCR-produced p43-DPEase cassette was cloned into pMD-19T vector.

[0139] The pUB110 plasmid was used with its original HpaII promotor in order to improve the expression.

[0140] The plasmid antibiotic resistance gene-free was constructed referring a method called simple cloning (Chun You et al. Appl. Environ. Microbiol. 2012, 78(5): 1593-1595) which is a sequence-independent method without the need for restriction and ligation enzymes.

[0141] The protocol consists of three steps:

[0142] (1) Linear DNA (P43-DPEase expression cassette and the appropriate zone of linear pUB110 vector backbone (the fragment outside Mob gene region)) were separately amplified by PCR with primers P11/P12 and P13/P14 respectively (P11/P12 contain the 40-50 bp overlapping termini of P13/P14).

[0143] (2) The DNA multimers was generated based on these DNA templates (target gene and corresponding vector) by POE-PCR (prolonged overlap extension PCR) without primers and

[0144] (3) the POE-PCR products (pUB-P43-DPEase) were transformed into the Bacillus subtilis competent cells. Hit transformants were recovered on LB agar by adding 50 μg/mL kanamycin. Using the same method, D-alanine racemase gene was inserted replacing the Kanamycin (Km) and Bleomycin (Blm) antibiotic-resistant genes region.

[0145] D-alanine racemase gene and vector backbone were amplified via PCR with the P15/P16 and P17/P18 primers respectively.

[0146] The DNA multimers were transformed within Bacillus subtilis [alrA.sup.−] competent cells, deficient in biosynthesizing D-alanine metabolite.

[0147] Finally, the plasmid pUB-P43-DPEase-alrA (SEQ ID NO: 14) (FIG. 2) was selected on LB agar without adding D-alanine.

[0148] The main advantage of this strategy is to provide direct selection for the plasmid in complex media without antibiotics.

[0149] As the D-alanine racemase involved in the cell wall metabolism, the loss of the activity leads to the cell lysis, preventing the accumulation of a population of cells which have lost the plasmid.

Example 2: Plasmid Optimization for Higher DPEase Expression

[0150] The experimental strategy has aimed at revealing the expression potential and intrinsic limitations of Bacillus subtilis as DPEase expression host (BsR), as obtained above.

[0151] The modifications introduced into the parental plasmid pUB-P43-DPEase-alrA (pR1) target by a translational efficiency (pR2, pR3).

[0152] This means for pR2/pR3, if the gene expression is “on” in a given cell at a given time point, more protein should be expected to be delivered at this moment.

[0153] 1. Plasmid Optimization for the Ribosome Binding Sites (pR2)

[0154] As a template for generation of optimized DPEase expression constructs, the plasmid pUB-P43-DPEase-alrA (or pR1) was isolated from overnight cultivation in standard LB medium and the plasmid free strain was kept for further steps.

[0155] These plasmid preparations served as templates for PCR mediated insertion of variant ribosome binding sites and adjacent regions (FIG. 3). After successful mutagenesis PCR, the new plasmid was introduced back to the B. subtilis alrA deficient plasmid-free strain (BsR).

[0156] Successfully transformed clones were cultivated in standard LB medium and pass throughout a primary activity screening phase (Protocol #1).

[0157] Then, a plasmid DNA was prepared from overnight cultivations for electrophoresis and sequencing verification of the ribosome binding site zone change.

[0158] The upstream sequence identified in the pR2 clone that performs best in conjunction with the downstream DPEase open reading frame is shown below.

[0159] Nucleotide sequence of the 5′ untranslated region upstream of the DPEase in pR1 (1) and pR2 (2). The ATG codon of the DPEase gene is shown underlined and the RBS modified region is in italic bold in Table 1 below.

TABLE-US-00002 TABLE 1 Nucleotide sequences of the 5′ untranslated region upstream of the DPEase in pR1 (1) and pR2 (2) pR1 1- AGCGGTACCATTATAGGT ATG AAACATGGTATATACTACGCATATTGG (SEQ ID NO: 38) pR2 2- AGCGGTACCATTATAGGT ATG AAACATGGTATATACTACGCATATTGG (SEQ ID NO: 39)

[0160] Plasmid pR2 of SEQ ID NO: 15 contains an optimized sequence of SEQ ID NO: 1 or SEQ ID NO: 39.

[0161] Protocol #1: Enzymatic Detection of DPEase Activity

[0162] The analysis of DPEase screening samples was performed by applying a Fructose/Glucose Assay Kit from Megazymes (K-FRUGL).

[0163] Initial evaluation revealed that psicose does not give rise to any signal, thus, DPEase activities can be measured by following the reduction of fructose contents in the reactions. Briefly, samples were diluted 1:1000 freshly prior to the reaction.

[0164] Calibration glucose/fructose standards as well as a fructose/PBS mix were always included. Sugars could be detected in a linear range of 0-100 mg/L.

[0165] 100 μL sample were transferred to an assay-plate (96 well MTP, flat-bottom). 90 μL reaction mix 1+2 (10 μL each of Solution 1&2, +70 μL milliQ (mQ) water) was added and allowed to incubate at RT for a few minutes.

[0166] 20 μL reaction mix 3 (2 μL Solution 3+18 μL mQ water) was added and after 5 min the OD340 was read out as “blank” 20 μL reaction mix 4 (2 μL Solution 4+18 μL mQ water) was added and after 5 min the OD340 was read out as residual fructose.

[0167] The residual fructose was calculated with the help of the calibration standards, and the converted psicose estimated in comparison to the untreated fructose sample.

[0168] 2. Establishment of Vector with Customized Translation Initiation (pR3)

[0169] The previous pR2 variant depicted in FIG. 3 served as parental plasmid for further optimization of the translation initiation region (spacer).

[0170] To this end, the proximal 4 nucleotides upstream of the DPEase open reading frame were randomized via PCR mutagenesis.

[0171] The resulting plasmids variants were introduced back to the B. subtilis alrA deficient plasmid-free strain (BsR) and cultivated onto standard LB agar plates.

[0172] In order to cover all possible 4 nucleotide combinations, a mutant bank of above 2000 clones was randomly picked and cultivated in 96-Deep well plates (DWP and assessed for DPEase expression in the primary activity screening phase (Protocol #1).

[0173] The best clone harboring the pR3 plasmid has been sequenced. (below)

[0174] Nucleotide sequences of the 5′ untranslated region upstream of the DPEase in pR1 (1) and pR2 (2) and pR3 (3) are shown in Table 2 below. The ATG codon of the DPEase gene is shown underlined and the RBS modified region is in italic bold and the translation initiation region boxed.

TABLE-US-00003 TABLE 2 Nucleotide sequences of the 5′ untranslated region upstream of the DPEase in pR1 (1) and pR2 (2) pR1 1- AGCGGTACCATTATAGGT ATG AAACATGGTATATACTACGCATATTGG (SEQ ID NO: 38) pR2 2- AGCGGTACCATTATAGGT ATG GAAACATGTATATACTACGCATATTGG (SEQ ID NO: 39) pR3 3- AGCGGTACCATTATAGG ATG AAACATGGTATATACTACGCATATTGG (SEQ ID NO: 40)

[0175] Plasmid pR3 of SEQ ID NO: 16 contains an optimized sequence of SEQ ID NO: 2 or SEQ ID NO: 40.

[0176] 3. Expression Screening and Enzyme Assay

[0177] A second activity screening phase has been done for more representative DPEase production. For the re-assessment, a selection of best performing clones was chosen for cultivation with larger volume.

[0178] Thus, the strain BsR strain previously transformed with pR1 and pR2 and pR3 plasmids were cultivated in shake flasks (Table 3).

[0179] Samples were taken at final point (16 h) and cells were collected by centrifugation at 6000 g for 15 minutes and the supernatant was discarded.

[0180] The cells pellets harboring C. cellulolyticum DPEase prepared by freeze-drying were vacuum freeze-dried, grinded and directly used as an enzyme powder.

[0181] Next, DPEase activity for each enzyme powders produced was done (following the method given below).

TABLE-US-00004 TABLE 3 Media composition used for the DPEase production from plating to production cultivations in shakeflasks at 37° C. at 200 rpm. 1.sup.st Seed 2.sup.nd Seed Media comp.(g/L) Plate culture culture Production Trypton from milk casein 10 10 10 (Biokar) Yeast Extract  5  5  5 15   (BactoYE Difco, BD) NaCl [7647-14-5] 10 10 10 8   Dextrose (Roquette Freres) 15   Na.sub.2HPO.sub.4, 12H.sub.2O 1   [10039-32-4] MgSO.sub.4, 7H.sub.2O 1   [10034-99-8] MnSO.sub.4, H.sub.2O [10034-96-5]  0.008 Antifoam (EROL18) 0.3 pH adjustment no no no (NaOH 4M) 7.4* *pH is adjusted before heat sterilization. The effective cultivation initial pH is roughly 6.75
Incubation time were overnight for the plate, 16 h for the first seed culture, up to Abs.sub.600nm for second seed culture and 16 h for the production.

[0182] Method: DPEase Enzyme Assay Description

[0183] The DPEase activity was measured via determining the quantity of D-psicose produced using a whole-cell reaction.

[0184] One milliliter of the reaction mixture contained D-fructose (80 g/L) in 50 mM Tris-HCl, pH7.5, and 200 μL of enzyme solution; the cells were dissolved in tris-HCL.

[0185] The reaction was incubated at 60° C. for exactly 10 minutes and ended by boiling at 100° C. for exactly 10 minutes. The generated D-psicose in the mixture was detected via a Waters Alliance HPLC, fitted with aminex HPX-87Ca.sup.2+ column (from Biorad) with dimensions 250×4 mm, #125-0094 and a refractive index detector (waters 410).

[0186] The column was eluted with pure water at a flow rate of 0.3 ml/min at 85° C. One unit of DPEase activity was defined as the amount of enzyme that catalyzed the production of 1 μmol of D-psicose per minute.

[0187] 4. DPEase Performance Results

[0188] The best DPEase enzyme performances are gathered into the following Table

TABLE-US-00005 TABLE 4 Results of strain BsR transformed with the plasmid pR1, pR2 or pR3 DPEase enzyme act. (U/mL) n BsR-pR1 10.57 5 BsR-pR2 26.85 10 BsR-pR3 38.85 20 n means the number of assays performed.

[0189] Initial strain (BsR), which is D-alanine racemase deficient, harboring the constructed pUB-P43-DPEase-alrA vector (pR1) showed a DPEase enzyme activity of about 10.57.

[0190] The two steps plasmid optimizations showed higher DPEase activity with about 26.85 U/mL and 38.85 U/mL for RBS region change (pR2) and translation initiation spacer optimization (pR3), respectively. Plasmid pR3 is the most promising plasmid.

Example 3: Bacillus subtilis BsR Improvement for DPEase Enzyme Expression Enhancement

[0191] In parallel to the plasmid optimization, the strain itself, BsR, was optimized, especially for the regulatory and safety purposes.

[0192] Antibiotics sensitivity of the BsR showed the strain was able to grow when erythromycin was added at 5 μg/mL. This observation clearly indicates that the strain was erythromycin resistant (Em.sup.R). This resistance has to be removed. Bacillus genus bacteria are known to produce a dedicated, very resistant and non-reproductive structure to enter in a state of dormancy: the endospores.

[0193] Bacterial endospores keeps all material the cell needs to recover a living cell when favorable conditions will appear.

[0194] The endospores are the perfect dissemination factor for the strain and is a serious risk for environmental and health contamination. For industrial uses of an endospore forming BsR, it is important to abort the endospore forming pathway.

[0195] 1. Removal of the EmR-comK Cassette: Generation of BsR3

[0196] Aiming to develop an enzyme producer strain by molecular biology tools, the Bacillus subtilis BsR was tested for the applicability of different antibiotics (tetracycline, erythromycin and kanamycin) and sugars (xylose and mannitol) likely used as inducers of gene expression on some plasmids.

[0197] Surprisingly, BsR was able to cultivate on erythromycin even at a concentration that is applied for high copy plasmids (5 μg/mL) selection pressure and the strain showed a clear delayed cultivation on xylose, compare to Bacillus subtilis (wild-type).

[0198] As the B. subtilis beta-galactosidase gene lacA (also named ganA) can serve as integration site for heterologous expression cassettes and/or as a reporter gene to test promotor induction efficiencies, its functionality was tested on X-gal agar plate.

[0199] X-gal (5-bromo-4-chloro-3-indolyl-beta-D-galactopyranoside(C.sub.14H.sub.15BrClNO.sub.6)) which is an analog of lactose sensitives to beta-galactosidase (the enzyme cleaves the beta-glycosidic bond in D-lactose) is cleaved and galactose and 5-bromo-4-chloro-3-hydroxyindole are released.

[0200] The latter spontaneously dimerizes and is oxidized into 5,5′-dibromo-4,4′-dichloro-indigo (insoluble blue color).

[0201] Indeed, native lacA gene by growing the cells on agar containing the chromogenic substrate X-gal should have blue colored colonies, indicating the lacA gene is active. For BsR strain, no blue colonies were seen onto X-gal plate.

[0202] Thus, lacA PCR analysis was done compared to a B. subtilis strains (wild-type).

[0203] If wild type lacA gene is present, a 2.1 kb product should be provided. PCR analysis clearly showed a larger amplification band of about 5 kb indicating the lacA locus contained an insert in (FIG. 4).

[0204] This amplified fragment was amplified and blasted to reveal the existence of a cassette containing the EmR gene and a comK gene controlled by the xylose-inducible promoter PxylA.

[0205] To remove the EmR-comK cassette (PCR fragment of 6.2 kb), an Escherichia coli toxin gene MazF as a counter-selectable marker was used.

[0206] The MazF gene was placed under the control of an isopropyl-O-d-thiogalactopyranoside (IPTG)-inducible expression system and associated with the alrA gene to form the MazF cassette, which was flanked by three targeting sequences.

[0207] A double-crossover event between delivery vector and the chromosome integrated the MazF cassette in front of the targeted EmR-comK cassette, and yielded an IPTG-sensitive strain with D-alanine racemase. Another single-crossover event between the two ganA sequences led to the excision of the MazF cassette (FIG. 5).

[0208] Then clones were evaluated regarding the desired phenotypes of successful mutants a) no growth with erythromycin selection and b) no growth on medium lacking D-alanine.

[0209] The latter clones were successfully checked via PCR analysis for the desired EmR-comK cassette removal genotype with a 2.3 kB amplified fragment (FIG. 6).

[0210] Theses erythromycin sensitive (Em.sup.S) and D-alanine auxotrophic clones were subsequently transformed with the DPEase expression plasmid pR3.

[0211] The resulting clones were able to growth on LB with no external D-alanine supplementation.

[0212] 2. Spore Inactivation: Generation of BsR4 and BsR5

[0213] Previously to generate the BsR5 strain version which is erythromycin sensitive and sporulation deficient (double mutant Em.sup.S Spo.sup.−), the impact of the endospore inactivation was evaluated with the strain BsR (containing EmR-comK cassette) leading to the single mutant named BsR4, Em.sup.R spo.sup.− genotyped.

[0214] The strategy to disrupt the sporulation metabolic cascade was to delete the yqfD essential gene, which acts during the stage IV (one of the later phase on sporulation process) of the endospore maturation, in order to abort the sporulation.

[0215] a—Generation of the Single Mutant Strain, BsR4

[0216] Establishment of a D-alanine racemase selectable mutagenesis cassette for deletion of the sporulation gene yqfD was generated and introduced into BsR devoid of the DPEase harbored plasmid.

[0217] The alrA cassette was done as the one used for the EmR-ComK cassette removal, with specific sequence for ydfD gene deletion.

[0218] Transformants were successfully selected by their capability to grow on medium with no D-alanine in.

[0219] These candidates were applied for IPTG induced counter selection that leads to clones devoid of the mutagenesis cassette as well as the yqfD sporulation gene (ΔyqfD).

[0220] The single mutants were identified by their D-alanine auxotrophy and by PCR analysis of the yqfD locus (FIG. 7).

[0221] In order to evaluate the sporulation phenotype of BsR4 strain, the mutant clones were cultivated in LB+D-alanine medium for overnight growth.

[0222] Cultures were then spotted on sporulation agar plates (supplemented with D-alanine) to form large colonies.

[0223] The sporulation plates were incubated at 37° C. for 3 days and evaluated by microscopy. The BsR original strain had produced phase-bright spores, while the ΔyqfD mutant clones did not produce any phase bright spores indicating the sporulation defect (spores produced by mutants were dark instead of bright which indicates that they are unable to proceed to maturation).

[0224] To check that the mutant clones were not able to produce any mature (so viable) endospores, an overnight cultivation in LB+D-alanine was performed at 37° C. The day after, 2×0.5 mL were sterile sampled into sterile tubes.

[0225] The first tube was directly spotted on a LB+D-alanine medium when the second was incubated at 80° C. for 30 minutes.

[0226] Heat treatment aims to kill vegetative cells, and only mature endospores can survive.

[0227] After the heat treatment, the broth was spotted onto the previous described plate (directly next to the previous unheattreated spots).

[0228] The plate was then incubated overnight at 37° C. for growth. As expected, only BsR wild type clone survived the heat treatment.

[0229] Only cellular debris was visible for the spots after heat treatment for BsR4 clone (FIG. 8).

[0230] b—Generation of the Double Mutant Strain BsR5

[0231] The mutagenesis cassette targeting the sporulation locus yqfD that has already been successfully applied to generate the single mutant strain, BsR4, was introduced into the erythromycin sensitive strain, BsR3.

[0232] After successful genomic integration, mutant screening was initiated for the identification of clones that had excised the mutagenesis cassette from the genome, leading to clean deletion of yqfD gene.

[0233] As performed for BsR4 strain, the clones were selected for their inability to produce mature endospores. After an overnight cultivation, samples were spotted before and after the heat treatment onto LB+D-alanine plates then incubated for another night at 37° C.

[0234] The hit candidates that did not grow after heat treatment were picked and spotted to LB medium plate for their loss of D-alanine prototrophy and incubate overnight at 37° C.

[0235] The hits candidates were those which showed growth (FIG. 9).

[0236] Finally, an industrial strain platform, BsR5, was obtained as a double mutant erythromycin sensitive and sporulation negative for respect environmental and safety regulations (FIG. 10)

[0237] 3. DPEase Enzyme Production Performance Results

[0238] All the strains obtained (BsR3, BsR4 and BsR5) were transformed with hit plasmid pR3. They were cultivated regarding the following protocol (FIGS. 11 and 12):

Working Cell Bank Construction:

[0239] Working cell bank refers to a −80° C. frozen stock, in Nalgene® vials of 2 mL.

[0240] The process contains a petri dish cultivation on LB medium (trypton 10 g/L, Yeast extract 5 g/L, NaCl 5 g/L, pH 7.5 adjusted with 10 N soda) at 37° C. for 16 h. A cellular suspension is prepared within a 5 or 10 mL of liquid LB+0.1 mM manganese (MnCl.sub.2, 4H.sub.2O [13446-34-9]) medium to obtain a 10 O.D..sub.600nm preparation. A 500 mL shake flask with 2 lateral baffles containing 50 mL liquid LB+0.1 mM manganese is sterilized at 121° C. for 21 minutes. The latter medium is inoculated to 0.1 O.D..sub.600nm with the freshly interim suspension. The cultivation is incubated at 37° C. and 250 rpm (orbital=5 cm) and the growth is monitored with hourly O.D..sub.600nm measurements. The procedure move one step ahead when the cultivation reaches O.D..sub.600nm MAX/2. Then, the exact volume of the final culture is measured and the same volume of cryoprotectant (30% v/v) Glycerol [56-81-5]) is slowly added and mixed until good homogenization. The latter suspension is then aliquoted at 1.8 mL into 2 mL vials. The vials freshly filled up are rapidly stored into a −80° C. freezer and designed as a Working Cell Bank for further uses.

Strain Cultivation for DPEase Enzyme Production

[0241] As a seed culture, a 300 mL shake flask unbaffled was filled up with 30 mL LB medium supplemented with manganese and then heat sterilized at 121° C. for 20 minutes. 1.8 mL of a working cell bank tube was used for inoculation. The cultivation was incubated 4 h at 37° C. and 250 rpm (orbital=5 cm).

[0242] As a production cultivation, a 0.9 mL of the previous seed culture was used to inoculate a sterile 300 mL shake flask with 3 lateral baffles and 50 mL modified LB-ROQ medium (Dextrose monohydrate 15 g/L, Yeast extract 15/L, NaCl [7647-14-5] 8 g/L, K.sub.2HPO.sub.4 [7758-11-4] 7 g/L, KH.sub.2PO.sub.4 [7778-77-0] 1.3 g/L, MgSO.sub.4. 7H.sub.2O [10034-99-8] 50 mg/L, MnSO.sub.4. H.sub.2O [10034-96-5] 0.4 mg/L and MnCl.sub.2. 4H.sub.2O [13446-34-9] 19 mg/L. pH should be close to neutral. The culture was incubated at 37° C. and 250 rpm (orbital 5 cm) for 16 h. The DPEase enzyme assessment was done as detailed into example 2.

[0243] The best DPEase enzyme performances are gathered into the Table 5 below indicating the average value of the performance and the number of trials performed:

TABLE-US-00006 TABLE 5 Results of the strain BsR3 transformed with the plasmid pR3, the strain BsR4 transformed with the plasmid pR3 or the strain BsR5 transformed with the plasmid pR3 n means the number of assays performed. Average value DPEase enzyme act. (U/mL) n BsR3-pR3 39.25 2 BsR4-pR3 44.31 2 BsR5-pR3 52.06 11

[0244] The successive DPEase enzyme productions with the different constructed strain platforms, BsR3 (single mutant Em.sup.S), BsR4 (single mutant ΔyqfD) and BsR5 (double mutant Em.sup.S, ΔyqfD) when transformed with the plasmid pR3 (puB-P43-DPEase-alrA vector) leaded to progressively improved the performance.

[0245] Intermediate single mutation strains (BsR3 and BsR4) were assessed for the DPEase production to follow the impact of the genetic modifications. For these two strains, the performance was not affected.

[0246] The final strain, BsR5 transformed with the plasmid pR3, which is environmentally and safety optimized, leads to the better expression of the enzyme DPEase.

[0247] The strain might save resources expressing DPEase instead of produces erythromycin resistance tools and endospore full maturation processing machinery.

Example 4: Optimization of the Fermentation Medium for DPEase Enzyme Expression Enhancement

Material & Methods

[0248] The strain used in the strain BsR5 transformed with the plasmid pR3.

1.1 Production of Biomass

[0249] The production of biomass begins with a preculture step. Glucose (15 g/L), yeast extract (15 g/L) and NaCl (15 g/L) are dissolved in demineralized water (QS 1 L). pH is not adjusted. The medium is placed in a baffled Erlenmeyer (2000 mL), then the erlenmeyers are autoclaved 20 minutes at 121° C., then inoculated in sterile conditions with 1 cryotube, then incubated at 37° C., during 4 hours, at 110 RPM.

[0250] The precultures are carried out in 2 L erlenmeyers containing 0.5 L of medium. The erlenmeyers are incubated for 3 h at 37° C. and 110 RPM so as to obtain an optical density of between 0.5 and 1 or a DCW (dry cell weight) of between 0.07 and 0.18 g/L.

[0251] The production step consists of a “batch” type fermentation which is carried out with a complex medium based on glucose, yeast extract and salts. The management of the pO2 is special since the medium is micro-aerated: the OUR (oxygen consumption) is maintained around 7 mmol/l/h. To do this, the agitation and the aeration are weak and fixed (200 RPM and 9 L/min), which causes a zero pO2 during the ¾ of the production. During the fermentation, there is no addition of medium (fed). A regulation of pH 6 is set up with ammonia 20% (w/w).

1.2 Biomass Preparation—Grinding

[0252] Biomass is collected when glucose is completely consumed. At this point the enzymatic activity is maximal. The biomass is then centrifuged (10000 g/5 min) and washed with a 50 mM PBS buffer pH8. The cells are then broken in a ball mill (30 min/2 g beads/1 g washed must). The mixture obtained is filtered through a 0.45 μm filter in order to remove the debris. The solution obtained is stable for 7 days at 4° C.

1.3 Measurement of Activity

[0253] Enzymatic analysis is carried out under the following conditions: 800 pi of substrate (fructose 400 g/L in 50 mM PBS pH 8) are preincubated at 55° C. for 5 minutes. The necessary amount of enzymatic solution is added to start the reaction. The whole is incubated for 10 min at 55°. The reaction is then stopped by a passage during 10 minutes at 100° C. The measurement of the psicose produced is carried out by HPLC (Ca2+ column at 65° C., H.sub.2O at 0.3 ml/min and refractometric detection) by measurement of the % area of psicose. The activity is expressed in μmol of psicose formed per ml of enzyme and per minute of reaction (U/ml).

[0254] Several fermentation medium were tested, and their compositions are detailed in Table 6 below.

TABLE-US-00007 TABLE 6 Fermentation medium tested Time until complete Oxygen OUR glucose partial DPEase Glucose Yeast (NH.sub.4).sub.2SO.sub.4 KH.sub.2PO.sub.4 MgSO.sub.4 MnSO.sub.4 maximal consumption pressure activity Reference (g/L) (g/L) (g/L) (g/L) (g/L) (mg/L) (mmol/h/L) (h) (PO.sub.2) (U/mL) F2 160808 15 15 1 1 1 8 8 8 No 34.0 regulation F1 160811 15 15 1 1 1 8 8 9 No 40.0 regulation F2 160811 15 15 1 1 1 8 8 9 No 41.9 regulation F1 160817 30 30 2 2 2 16 7 16 No 41.8 regulation F2 160817 30 15 1 1 1 8 7 16 No 58.8 regulation F1 160823 15 15 1 1 1 8 3 16 No 28.2 regulation F2 160823 15 15 1 1 1 8 3 13 No 14.2 regulation F1 160906 45 15 1 1 1 8 8 23 No 91.9 regulation F2 160906 30 15 1 1 1 8 8 17 No 71.8 regulation F1 160919 Fed 15 1 1 1 8 8 23 No 121.2 regulation F2 160919 60 15 1 1 1 8 8 28 No 139.9 regulation F1 160926 Fed 15 1 1 1 8 8 27 No 143.4 regulation F2 160926 45 15 1 1 1 8 8 22 No 128.0 regulation F1 161003 45 15 1 1 8 8 20 No 127.7 regulation F2 161005 45 15 1 1 1 8 8 21 No 134.1 regulation F1 161011 45 15 1 1 1 8 9 21 No 133.8 regulation F2 161011 100  15 1 1 1 8 8 71 No 156.6 regulation F1 161026 60 15 1 1 1 8 80 15 Regulated 71.7 5% F2 161026 60 15 1 1 1 8 20 17 No 134.7 regulation F1 161107 Fed 15 1 1 1 8 8 32 No 143.0 regulation F2 161107 60 15 1 1 1 8 7 32 No 133.5 regulation F1 161122 Fed 15 1 1 1 8 25 29 No 166.7 regulation F2 161122 60 15 1 1 1 8 3 60 No 129.3 regulation F2 170117 Fed 15 1 1 1 8 15 35 No 125.6 regulation F1 170124 Fed 15 1 1 1 8 60 24 Regulated 41.2 5%

[0255] Thus, a fermentation medium comprising 60 g/L (medium called “F2 160919”) leads to a DPEase activity of about 139.9 U/mL whereas a fermentation medium comprising 15 g/L (medium called “F1 160811”) leads to a DPEase activity of about 40.0 U/mL.

[0256] These results prove the interest of using a fermentation medium comprising at least 60 g/L of sugar, notably glucose.

Example 5: Comparison of Several Mutated Nucleotide Sequences of 5′UTR

[0257] Mutations have been brought in the nucleotide sequences of the 5′ untranslated region upstream of the ATG codon of the DPEase gene.

[0258] Results of the DPEase activity, tested according to the Standard Of Procedure (SOP), is detailed in Table 7 below.

TABLE-US-00008 TABLE 7 DPEase activity of several variants nt upstream of clone # start codon U/ml U/ml U/ml original AGAGAGGAATGTACAC 13.92 13.92 12.49 (SEQ ID NO: 41) I7 GAAAGGAGGATTCGAA 58.44 58.44 62.87 (SEQ ID NO: 42) I9 GAAAGGAGGATTATGG 77.4 77.4 81.51 (SEQ ID NO: 43) I11 GAAAGGAGGATTGTCG 21.81 21.81 22.29 (SEQ ID NO: 44) II2 GAAAGGAGGATTTAGT 55.72 55.72 57.39 (SEQ ID NO: 45) II3 GAAAGGAGGATTGAGG 55.91 55.91 55.67 (SEQ ID NO: 46) II6 AGAAAGGAGGATTAAA 73.25 73.25 75.43 (SEQ ID NO: 47) II7 GAAAGGAGGATTTCGT 75.45 75.45 80.24 (SEQ ID NO: 48) II8 GAAAGGAGGATTTTTG 49.79 49.79 51.95 (SEQ ID NO: 49)

[0259] Clones 116 and 117 provides the best DPEase activity after analysis according to SOP. However, assays under optimal fermentation conditions (see example 4) showed that mutations of the 17 clone lead to the best DPEase activity.

[0260] Thus, mutations of the 17 clone are the mutations present in the plasmid pR3.