A NOVEL ORTHOBUNYAVIRUS IN HUMAN ENCEPHALITIS AND ITS DIAGNOSTIC AND THERAPEUTIC APPLICATONS

20230151439 · 2023-05-18

    Inventors

    Cpc classification

    International classification

    Abstract

    The invention relates to methods of diagnosis or detection of Moissiacense virus, a novel orthobunyavirus causing human encephalitis, comprising determining the presence of at least one nucleic acid or protein of said virus or antibodies thereto, in a biological sample. The invention also relates to the various diagnostic agents derived from the viral nucleic acids or proteins, in articular nucleic acid primers and probes, antigens and antibodies, and their use for the diagnosis of Moissiacense virus infection and associated disease, in particular encephalitis. The invention further relates to antigens derived from the viral proteins as vaccine for the prevention of Moissiacense virus infection and associated disease, in particular encephalitis.

    Claims

    1-15. (canceled)

    16. A method of detection of Moissiacense virus nucleic acid in a sample, comprising determining the presence of at least one viral nucleic acid selected from the group consisting of: a first nucleic acid (S segment) comprising a sequence having at least 80% identity with SEQ ID NO: 1 and further including a coding sequence for a Nucleocapsid (N) protein having at least 90% identity with SEQ ID NO: 2, or its complement; a second nucleic acid (M segment) comprising a sequence having at least 80% identity with SEQ ID NO: 3 and further including a coding sequence for a polyprotein M having at least 90% identity with SEQ ID NO: 4; or its complement; and a third nucleic acid (L segment) comprising a sequence having at least 80% identity with SEQ ID NO: 5 and further including a coding sequence for a polymerase (L) protein having at least 90% identity with SEQ ID NO: 6 including at least 90% identity on the core polymerase domain, or its complement.

    17. The method according to claim 16, wherein said Moissiacense virus comprises: a S segment sequence of SEQ ID NO: 1 coding for a nucleocapsid (N) protein of SEQ ID NO: 2, a M segment sequence of SEQ ID NO: 3 coding for a polyprotein M of SEQ ID NO: 4 and a L segment sequence of SEQ ID NO: 5 coding for a polymerase (L) protein of SEQ ID NO: 6, or a S segment sequence of SEQ ID NO: 90 coding for a nucleocapsid (N) protein of SEQ ID NO: 93, a M segment sequence of SEQ ID NO: 91 coding for a polyprotein M of SEQ ID NO: 95, and a L segment sequence of SEQ ID NO: 92 coding for a polymerase (L) protein of SEQ ID NO: 96.

    18. The method according to claim 16, which comprises the detection of at least one specific target sequence of the viral nucleic acid by a process of hybridization with an oligonucleotide probe, amplification with a pair of oligonucleotide primers, sequencing, or a combination thereof.

    19. The method according to claim 16, which comprises the detection of at least one specific target sequence of the viral nucleic acid chosen from the sequences SEQ ID NO: 7, 8, 9; the sequences of at least 15 nucleotides from any one of SEQ ID NO: 7 to 9, and the sequences comprising any one of SEQ ID NO: 7 to 9 and up to 40 consecutive nucleotides of 5′ and/or 3′ flanking sequence from the S, M or L segment sequence.

    20. The method according to claim 16, which comprises the detection of at least one specific target sequence of the viral nucleic acid using oligonucleotide probe or primers selected from the group consisting of: the sequences of 5 to 100 nucleotides, preferably 15 to 60 nucleotides having 80% to 100% identity with any of SEQ ID NO: 1, 3, 5, and 7 to 9, which are specific for Moissiacense virus; and their complement.

    21. The method according to claim 16, which comprises the detection of at least one specific target sequence of the viral nucleic acid using an oligonucleotide probe selected from the group consisting of the sequences SEQ ID NO: 10 to 57 or the pair of oligonucleotide primers is selected from the group consisting of: SEQ ID NO: 10-11, 12-13, 14-15, 16-17, 18-19, 20-21, 22-23, 24-25, 26-27, 28-29, 30-31, 32-33, 34-35, 36-37, 38-39, 40-41, 42-43, 44-45, 46-47, 48-49, 50-51, 52-53, 54-55, and 56-57.

    22. A method of detection of Moissiacense virus antigen or antibody in a sample, comprising: incubating an antigen from Moissiacense virus or antibody thereto with the sample to form a mixture; and detecting antigen-antibody complexes in the mixture.

    23. The method according to claim 22, wherein the antigen from Moissiacense virus comprises an amino acid sequence selected from the group consisting of: a sequence having 90 to 100% with SEQ ID NO: 2 or a fragment thereof; a sequence having 90 to 100% identity with SEQ ID NO: 58 or 60 or a fragment thereof such as an extracellular fragment from the sequence SEQ ID NO: 58.

    24. The method according to claim 22, which comprises an immunoprecipitation, ELISA or immunohistochemistry assay.

    25. The method according to claim 22, wherein the antigen from Moissiacense virus comprises an amino acid sequence chosen from the sequences SEQ ID NO: 61 to 64.

    26. The method according to claim 16, wherein the sample is brain biopsy, cerebral spinal fluid, whole-blood, plasma or serum.

    27. The method according to claim 16, wherein the same biological sample from an individual is subjected to a method of detection of at least another encephalitis virus such as herpesvirus, enterovirus, polyomavirus, astrovirus, measles virus, mumps virus, or arbovirus.

    28. The method according to claim 16, which is for the diagnosis of encephalitis, in particular in humans, specifically for the differential diagnosis of human encephalitis.

    29. The method according to claim 22, wherein the sample is brain biopsy, cerebral spinal fluid, whole-blood, plasma or serum.

    30. The method according to claim 22, wherein the same biological sample from an individual is subjected to a method of detection of at least another encephalitis virus such as herpesvirus, enterovirus, polyomavirus, astrovirus, measles virus, mumps virus, or arbovirus.

    31. The method according to claim 22, which is for the diagnosis of encephalitis, in particular in humans, specifically for the differential diagnosis of human encephalitis.

    32. A kit for the detection of Moissiacense virus nucleic acid, comprising at least one oligonucleotide probe or primer selected from the group consisting of: the sequences of 5 to 100 nucleotides, preferably 15 to 60 nucleotides having 80% to 100% identity with any of SEQ ID NO: 1, 3, 5, and 7 to 9, which are specific for Moissiacense virus; and their complement.

    33. A kit for the detection of Moissiacense virus antigen or antibody, comprising at least an antigen from Moissiacense virus or an antibody thereto, wherein the antigen comprises an amino acid sequence selected from the group consisting of: a sequence having 90 to 100% with SEQ ID NO: 2 or a fragment thereof; a sequence having 90 to 100% identity with SEQ ID NO: 58 or 60 or a fragment thereof such as an extracellular fragment from the sequence SEQ ID NO: 58, preferably chosen from the sequences SEQ ID NO: 61 to 64.

    34. The method of claim 16, which comprises the detection of Moissiacense virus nucleic acid in arthropod vector population for epidemiological survey.

    35. An immunogenic or vaccine pharmaceutical composition comprising, as active substance an antigen from Moissiacense virus comprising an amino acid sequence selected from the group consisting of: a sequence having 90 to 100% with SEQ ID NO: 2 or a fragment thereof; a sequence having 90 to 100% identity with SEQ ID NO: 58 or 60 or a fragment thereof such as an extracellular fragment from the sequence SEQ ID NO: 58 such as the sequences SEQ ID NO: 61 to 64, in association with at least one pharmaceutically acceptable vehicle, adjuvant and/or carrier.

    Description

    FIGURE LEGENDS

    [0102] FIG. 1: Brain MRI of the Two Patients with Umbre Virus Encephalitis

    [0103] a & b: case 1. Axial FLAIR (a) and Diffusion-weighted (b) images, revealing mild hyper intensity of both putamina (thick arrows), and of frontal, insular and posterior cingulate cortices (thin arrows). c to h: case 2. Brain MRI at month 1 (c to e) and month 5 (f to h); c & f: axial T2; d & e; g & h: diffusion-weighted images. c, d, e: normal hippocampi and insular cortices at month 1. f, g, h: bilateral hypersignal (arrows) of the hippocampi and insular cortices, with mild bi-hippocampi atrophy.

    [0104] FIG. 2: Histopathology in Case 1

    [0105] a: Parahippocampal cortex. Haematein-eosin. Microglial cells surrounding a neuron (black arrow), suggesting neuronophagia. b: Dentate nucleus. IBA-1 immunohistochemistry. Diffuse microglial activation and microglial nodule. c: Cerebellum. CD163 immunohistochemistry. Distribution of activated microglia. Enhancement in the dentate nucleus. d: Temporal cortex. Haematein-eosin. Spongiosis. e: Caudate nucleus. CD3 immunohistochemistry. Clusters of T-lymphocytes. f: Frontal cortex. In situ hybridization with a bunyavirus probe. Labeling (red) of the cell body and dendritic shaft of a pyramidal neuron. Scale bars: a & e=50 μm; b & d=100 μm; c=5 mm; f=25 μm.

    [0106] FIG. 3: Histopathology in Case 2

    [0107] a: Right hippocampus. CD163 immunohistochemistry. Distribution of activated microglia. Enhancement of the dentate gyrus and pyramidal sectors of the cornu Ammonis. b: Cerebellum. CD163 immunohistochemistry. Distribution of activated microglia. Enhancement in the dentate nucleus and cerebellar cortex. c: Anterior horn of the spinal cord. Haematein-eosin. Microglial cells surrounding a neuron, suggesting neuronophagia. d: Right hippocampus. Haematein-eosin. Neuronal loss in CA1 (black arrows). e: Roots of the oculomotor nerve. CD163 immunohistochemistry. Infiltration by macrophages. f: Frontal cortex. In situ hybridization with a bunyavirus probe. Labeling (red) of the cell body of a pyramidal neuron. Scale bars: a & b=5 mm; c=50 μm; d=100 μm; e=500 μm; f=25 μm.

    [0108] FIG. 4: Phylogenetic Analysis of Orthobunyaviruses.

    [0109] A) S-segment, B) M-segment, C) L-segment and D) PCR-targeted region on the L-segment. The bootstrap values are given at each branches. Moissiacense virus and the closest relative viral sequences are indicated in red. Serogroups are indicated in black on the right side of each panel. The details of the methods used for the phylogenetic analysis and the list of accession numbers are available in the material and methods section.

    [0110] FIG. 5: RT-PCR assay on the patient's brain sample using primer pairs specific for Moissiacense virus species S, L and M segment sequences.

    [0111] FIG. 6: Comparison of multiplex pan-orthobunyaviruses PCR primers from Lambert A J & Lanciotti R S (J. Clin. Microbiol., 2009, 47, 2398-404) with Moissiacense virus sequence (SEQ ID NO: 74 to 89). Disagreements between the consensus primers and Moissiacense virus sequences are highlighted.

    [0112] FIG. 7: Distribution of raw optical density values (ELISA immunoassay) using the Gc Head domain of Schmallenberg virus and Umbre virus as antigen on a control population (N=300). Black triangle: Schmallenberg positive serum tested undiluted. Small black triangle: Schmallenberg positive serum tested at a 10-fold dilution.

    [0113] FIG. 8: Distribution of raw optical density values (ELISA immunoassay) using the Gc Head domain of Schmallenberg virus and Umbre virus as antigen on a encephalitis group (N=34). Black triangle: Schmallenberg positive serum tested undiluted. Small black triangle: Schmallenberg positive serum tested at a 10-fold dilution.

    EXAMPLES

    [0114] 1. Material and Methods

    [0115] Metatranscriptomics Analysis

    [0116] By using untargeted metatranscriptomics, the inventors aimed at identify RNA sequences from bacteria, fungi, viruses or protozoans without prior hypothesis on the involved pathogen. RNA, rather than DNA, is indicative of living microorganisms. For each patient individually, total RNA was extracted from post-mortem brain using a bead based tissue homogenizer (Bertin) and the Trizol procedure (Thermo Fisher Scientific), followed by RNA purification on RNeasy column including a DNAse treatment (Qiagen). RNA Integrity Number (RIN) ranged between 2.9 and 6.9 after extraction, with 18S and 28S rRNA peaks visible. For each sample, a cDNA (NGS) library was prepared with the SMARTer Stranded Total RNA-Seq Kit—Pico Input Mammalian (Takara Bio, kit v.1 for patient 1 and v.2 for patient 2). The libraries of the 2 patients were made independently. The procedure included a random reverse transcription of total RNA into first strand cDNA, a depletion of human ribosomal cDNA, and a final PCR amplification. The cDNA libraries were sequenced independently for the two patients in 1×150 bp on a NextSeq500 instrument (Illumina), using High Output flow cells generating approximately 35 and 116 million reads. A set of reference human transcripts was used as an internal positive control. The inventors have not sequenced the ante-mortem biopsy of Patient #2. The vast majority of raw reads had quality scores (Q scores) above 20. Raw reads were trimmed to remove low quality bases and sequencing adapters at their ends with AlienTrimmer (Criscuolo et al., A, Genomics, 2013, 102, 500-6; version 0.4.0, options-k 10-m 5-1 50-p 80-c 012-q 20). The reads were then assembled with MegaHit (Li et al., Bioinforma Oxf.Engl., 2015, 31, 1674-6; version 1.1.2, with default options). Unassembled reads were kept as singletons. Resulting sequences were aligned after translation in all the six possible reading frames (3 by DNA strand) against a viral protein reference comprehensive database developed by the inventors (RVDB; Bigot et al., F1000Research, 2019, 8, 530) using the DIAMOND program (Buchfink et al., Nat. Methods, 2015, 12, 59-60). Matches with viral sequences were controlled in NCBI NR protein and NCBI NT databases to identify and eliminate false positive. This led to the identification of 168 sequences (22 contigs and 146 singletons) belonging to the Peribunyaviridae family, covering approximately 55% of the closest reference virus genome represented by Umbre virus. No other viral sequence was identified. A search for bacteria or other non-viral pathogen sequences was performed with Kraken2 (Wood et al., Genome Biol., 2014, 15, R46), Centrifuge (Kim D et al., Genome Res [Internet] 2016 [cited 2018 Nov. 30]; Available from: http://genome.cshlp.org/content/early/2016/11/16/gr.210641.116) and Methaphlan2 (Truong et al., Nat. Methods., 2015, 12, 902-3) leading to no other viral or bacterial hit. Full CDS of the S, L and M segments were obtained by a combination of RT-PCR and RACE analysis. Patient 1: S segment (SEQ ID NO: 1); M segment (SEQ ID NO: 3); L segment SEQ ID NO: 5). Patient 2: S segment (SEQ ID NO: 90); M segment (SEQ ID NO: 91); L segment SEQ ID NO: 92.

    [0117] Phylogenetic Analysis

    [0118] Alignments of amino acids sequences were done with MAFFT v7.388 (Katoh et al., Nucleic Acids Res., 2002, 30, 3059-66; Katoh et al., Mol. Biol. Evol., 2013, 30, 772-80) and manually adjusted when needed. Identity matrices are given in Tables I to IV. RAxML phylogeny with 100 bootstrap replications was performed in Geneious 11.1.5 (Kearse et al., Bioinforma Oxf Engl., 2012, 28, 1647-9) after initial model selection done in MEGA7 (Kumar et al., Mol. Biol. Evol., 2016, 33, 1870-4). Only complete CDS sequences were kept for phylogenetic analysis of the S, M and L segments (FIG. 4A, B, C). The M segment of Koongol virus was removed from the analysis because of the presence of a large deletion (>300 AA) in the NSn and Gc part of the sequence, which most probably reflects a cell culture passaging artifact as demonstrated for Maguari orthobunyavirus (Pollitt et al., Virology, 2006, 348, 224-32). The M segment of Yacabba virus, and the L segments of Little Sussex virus and Salt Ash virus, were not included in the analysis because of partial CDS sequences. No sequence was available for Little Sussex virus M and S segments. Herbert virus (Family: Peribunyaviridae; Genus: Herbevirus) was used as outgroup. Accession numbers: S segment: Aino virus (NC_018460.1), Akabane virus (NC_009896.1), Batai virus (JX846604.1), Bunyamwera virus (NC_001927.1), Cache Valley virus (KC436108.1), Caraparu virus (KF254789.1), Chatanga virus (EU479697.1), Herbert herbevirus (JQ659258.1), Iaco virus (JN572067.1), Ilesha virus (KF234073.1), Koongol virus (KP792667.1), Kowanyama virus (KT820204.1), La Crosse virus (NC_004110.1), Leanyer virus (HM627177.1), Macaua virus (JN572070.1), Madrid virus (NC_034498.1), Murrumbidgee virus (NC_022597.1), Oropouche virus (NC_005777.1), Oya virus (JX983192.1), Salt ash virus (KF234258.1), Sathuperi orthobunyavirus (NC_018462.1), Simbu orthobunyavirus (NC_018477.1), Sororoca virus (JN572073.1), Tahyna virus (HM036217.1), Umbre virus (KP792685.2), Wyeomyia orthobunyavirus (JN572082.1), Yacaaba virus (KT820210.1). M segment: Aino virus (NC_018459.1), Akabane virus (NC_009895.1), Batai virus (JX846605.1), Bunyamwera virus (NC_001926.1), Cache Valley virus (KC436107.1), Caraparu virus (KF254788.1), Chatanga virus (EU621834.1), Herbert herbevirus (JQ659257.1), Iaco virus (JN572066.1), Ilesha virus (KF234074.1), Kowanyama virus (KT820203.1), La Crosse virus (NC_004109.1), Leanyer virus (HM627176.1), Macaua virus (JN572069.1), Madrid virus (KF254780.1), Murrumbidgee virus (NC_022596.1), Oropouche virus (NC_005775.1), Oya virus (JX983193.1), Salt ash virus (KF234257.1), Sathuperi orthobunyavirus (NC_018466.1), Simbu orthobunyavirus (NC_018478.1), Sororoca virus (JN572072.1), Tahyna virus (HM036218.1), Umbre virus (KP792686.1), Wyeomyia orthobunyavirus (JN572081.1). L segment: Aino virus (NC_018465.1), Akabane virus (NC_009894.1), Batai virus (JX846606.1), Bunyamwera virus (NC_001925.1), Cache Valley virus (KC436106.1), Caraparu virus (KF254793.1), Chatanga virus (EU616903.1), Herbert herbevirus (NC_038714.1), Iaco virus (JN572065.1), Ilesha virus (KF234075.1), Koongol virus (KP792669.1), Kowanyama virus (KT820202.1), La Crosse virus (NC_004108.1), Leanyer virus (HM627178.1), Little Sussex virus (KT720483.1), Macaua virus (JN572068.1), Madrid virus (KF254779.1), Murrumbidgee virus (KF234253.1), Oropouche virus (NC_005776.1), Oya virus (JX983194.1), Salt ash virus (KF234256.1), Schmallenberg virus (NC_043583.1), Simbu orthobunyavirus (HE795108.1), Sororoca virus (JN572071.1), Tahyna virus (HM036219.1), Umbre virus strain IG1424 (KP792687.1), Wyeomyia orthobunyavirus (JN572080.1), Yacaaba virus (KT820208.1).

    [0119] Umbre orthobunyavirus strain Moissiacense (Moissiacense virus): S segment (SEQ ID NO: 2); M segment (SEQ ID NO: 4); L segment SEQ ID NO: 6.

    [0120] Umbre orthobunyavirus strain Marna: S segment (SEQ ID NO: 90); M segment (SEQ ID NO: 91); L segment SEQ ID NO: 92.

    [0121] Neuropathology

    [0122] The biopsy sample was left overnight in formalin (10% of the commercial formalin solution containing 4% formaldehyde). After autopsy, fresh brain slices were stored frozen at −80° C. prior to nucleic acid extraction. The whole brains were immersion-fixed in formalin 10%. In case 1, only 9 samples were available. In case 2, a systematic protocol was applied. Samples of cerebral neocortex and hippocampus, basal ganglia, brainstem, cerebellum and spinal cord were analyzed.

    [0123] Immunohistochemistry

    [0124] The samples were paraffin-embedded. Three μm thick sections were obtained and stained with haematein-eosin, Periodic Acid Schiff (PAS) and Luxol Fast Blue. t. Immunochemistry was performed with various primary antibodies in a Ventana Ultra stainer (Roche) with diaminobenzidine as a brown chromogen. Primary antibodies included a rabbit monoclonal anti-CD3 (clone 2GV6, prediluted, Roche), a mouse monoclonal anti-CD163 (clone MRQ-26, prediluted, Roche) and a polyclonal rabbit anti IBA1 (dilution 1/500, Wako), all incubated 32 min at 37° C. Immunohistochemistry was performed independently for the two patients.

    [0125] Western Blot

    [0126] The search for PrPres was performed in the two cases by Western blot according to published protocols (Lasmézas et al., Science, 1997; 275:402-405).

    [0127] In-Situ Hybridization

    [0128] ViewRNA ISH Tissue Assay Kit 2-plex (Thermo Fisher Scientific) was used to detect RNA sequences. According to the manufacturer, the technique has a sensitivity of one single copy and is based on branched DNA technology. ViewRNA Probes have a double Z configuration: one side of the Z is complementary to the target sequence and its other side is complementary to the pre-amplifier DNA sequence. A cocktail of 95 custom bDNA probes was designed to target the 3 genomic segments of Umbre orthobunyavirus strain Moissiacense (Moissiacense virus) (15 probes for segment S, 40 probes for segment M, 40 probes for segment L) and was revealed (as the “probe type 1” of the kit) by a red signal. A mix of control probes targeting human GAPDH, ACTB and PPI transcripts was revealed (as the “probe type 6” of the kit) by a blue signal. To unmask RNA targets, the tissue sections (after deparaffinization by xylene and ethanol) were pretreated by heating at 95° C. during 20 min in PBS 1×, cooling at room temperature (RT) during 5 min, washing 2×1 min in distilled water, washing 1 min in PBS 1×, protease digestion during 10 min at 40° C. in a hybridizer Denaturation & Hybridization System (NB-12-0001, Neobrite), and washing 2×1 minute in PBS at room temperature (RT). Tissue sections were fixed 5 min in formaldehyde 4% at RT, then washed 2×1 min in PBS 1×. Probes diluted in Probe Set Diluant QT (ThermoFisher)—a proprietary aqueous solution containing formamide, detergent, and blocker-were added on the tissue section and were hybridized during 2 hours at 40° C. in the hybridizer. The sections were washed 3×2 min in Wash Buffer. During the amplification step, sections were incubated 25 min at 40° C. in PreAmplifier Mix containing the PreAmplifier DNA type 1 and type 6, washed 3×2 min in Wash Buffer, incubated 15 min at 40° C. in Amplifier Mix containing the Amplifier DNA type 1 and type 6, and washed 3×2 min. In order to produce the blue signals, the section were incubated with 6-AP (an alkaline phosphatase binding the amplifier DNA type 6) during 15 min at 40° C. in the hybridizer, washed 3×3 min in Wash Buffer, incubated with Fast Blue solution during 30 min at RT, and washed 3×3 min in Wash Buffer. The 6-AP was quenched by AP STOP QT during 30 min at RT. In order to produce the red signals, the section were incubated with 1-AP (an alkaline phosphatase binding the amplifier DNA type 1) during 15 min at 40° C. in the hybridizer, washed 3×3 min in Wash Buffer, incubated with Fast Red solution during 45 min at 40° C. in the hybridizer, and washed 1 min in PBS. Haematoxylin was used for counterstaining. In-situ hybridization was performed at different times for the two patients, with Patient #1 having secondarily served as a positive control for Patient #2. The five negative controls used for ISH were other encephalitis cases coming from the larger series of brain samples (see section “Context of the study”) that have been sequenced with a comparable sequencing depth and that were either negative (3/5) or positive for viruses other than Umbre (2/5).

    [0129] Mosquito Capture

    [0130] Approximately 4,000 Culex pipiens female mosquitoes were captured in 2015 in the French Rhone Delta region as described in Eiden et al. 2018 (Eiden M, Gil P, Ziegler U, et al. Infect Genet Evol J Mol Epidemiol Evol Genet Infect Dis 2018; 61:151-4) and 133 pools of approximately 30 individuals were made. Mosquito capture was carried for a 24-hour period once a week between June and September. Captures were carried out in the 6 sites in parallel the same days. The June-September period covers most of the mosquito season in the study region. The population of Culex pipiens is generally rather low before or after this period (usually less than 10 females per catch). In addition, this period was selected because it includes the population peak for Culex pipiens (usually June-July depending on the site) and the peak of prevalence in mosquitoes and clinical cases in vertebrates for Culex-borne arboviruses in the region (i.e. September for West Nile and Usutu viruses, e.g. Eiden et al. 2018, precited). 133 pools of approximately 30 individuals were made. In addition, around 100 Culex pipiens, 30 Culex Sp., 100 Aedes caspius, 50 Aedes detritus, 10 Aedes vexans, 10 Aedes Sp., and 20 Anopheles mosquitoes were captured in 2017 in Camargue and Languedoc (Southern France) and species-specific pools of 5-20 individuals were made. Of the mosquitoes captured in 2017, no positivity was recorded.

    [0131] RT-PCR

    [0132] RT-PCRs were done on the exact same tissue RNA extracts that were used for sequencing. Reverse transcription reactions were performed using the SuperScript IV First-Strand Synthesis System (Thermo Fischer Scientific). Quantitative PCR were done in SYBR Green format with 45 cycles of amplification. Human beta-actin was included in the RT-PCR experiments as a positive control of the cDNA. No Template Control (NTC) wells, validating the absence of cDNA or DNA contaminant into the PCR mix, were also added to the experiment. Positive amplicons after 45 cycles were purified on gel and serial-dilutions were made to generate standard curves. Primer pairs used for detection of Moissiacense virus were: L segment AGAATTGGTTATCCCAGATGAGGT (forward; SEQ ID NO: 14) and GCCATAAATTGAAAATGGTTCTCCA (reverse; SEQ ID NO: 15); M segment ACAGGRCAAATAGCACTAAAGGT (forward; SEQ ID NO: 12) and CCTTCRTCTCTCACTTTGCAG (reverse; SEQ ID NO: 13); S segment AAACGCAGAACTGGGTAGCA (forward; SEQ ID NO: 10) and GAGTTAGCTCATCGTCCGCA (reverse; SEQ ID NO: 11). The primer pair used for detection of the Koongol virus L segment was GACCCAATACTGTAAACAG (forward; SEQ ID NO: 69) and CGTCAGAATGCACCATTG (reverse; SEQ ID NO: 70). PCR performed after omitting the reverse transcription step for samples C2, F2, G2 and C9 were negative, supporting the detection of viral RNA rather than endogenous viral DNA in mosquitoes.

    [0133] CSF Analysis

    [0134] RNA extracts from 193 CSFs collected in patients (attending both University hospitals of Montpellier and Nimes, two towns close to the Camargue region) presenting with a meningitis or meningo-encephalitis during the course of a regional arbovirus surveillance program during the peak mosquito activity period from 1.sup.st May to 31 Nov. 2016 and 2017 were tested by RT-PCR using primers specific for the S segment of Moissiacense virus (Umbre virus). These 193 CSFs have not been analyzed with the serological assay due to insufficient quantity remaining after RT-PCR.

    [0135] Serology

    [0136] Recombinant Protein Preparation

    [0137] Expression of the Gc Head Domain in Eukaryotic System

    [0138] The Gc head domains of Umbre orthobunyavirus strain Moissiacense (residues G477-D730 of the polyprotein precursor; SEQ ID NO: 64) and Schmallenberg virus (residues Q465-1702 of the polyprotein precursor (GenBank accession number: CCF55030.1) carrying a C-terminal Strep-tag (GGWSHPQFEK; SEQ ID NO: 97) were produced in recombinant Drosophila S2 cells (Gibco) grown at 28° C. in HyClone SFM4Insect medium with L-glutamine (GE Healthcare) supplemented with 25 U/mL penicillin/streptomycin (Gibco). For this purpose, a codon-optimized synthetic gene fragment (Invitrogen) was cloned into the pMT expression vector (Invitrogen) downstream of a BiP secretion signal. The expression plasmid was co-transfected with the selection plasmid pCoPURO (Iwaki et al., BioTechniques 2003; 35:482-484, 486) at a mass ratio of 20:1 using the Effectene transfection reagent (Qiagen) according to the manufacturer's instructions. A polyclonal stable S2 cell line was established by selection with 7.5 μg/mL puromycin (Invivogen), which was added to the medium starting 40 h after transfection. The culture was expanded to 1 L of 10.sup.7 cells/mL in Erlenmeyer flasks shaking at 100 rpm and at 28° C. Recombinant protein expression was then induced with 500 μM CuSO.sub.4. The cell supernatant was harvested 1 week after induction, concentrated to 50 mL on a 10 kDa MWCO PES membrane (Sartorius), pH-adjusted with 0.1M Tris-Cl pH 8.0, cleared from biotin with 15 μg/mL avidin, cleared from precipitate by centrifugation at 4000×g for 15 min at 8° C., and was used for affinity purification on a 5 mL Strep-Tactin Superflow he column (iba Life Science). The protein was further purified by gel permeation chromatography on a HiLoad Superdex 200 μg column (GE Healthcare) in 20 mM Tris-Cl pH 8.0, 150 mM NaCl. Aliquots were flash-frozen on liquid nitrogen and stored at −80° C.

    [0139] Expression of then Protein in Prokaryotic System

    [0140] The N protein (SEQ ID NO: 2) was expressed from a codon-optimized synthetic gene in E. coli BL21 with N-terminal Strep- and His-tags. The protein was sequentially purified on a HisTrap column (GE Healthcare), a StrepTactin column (iba) and a Superdex S200 column (GE Healthcare). Peak fractions in 20 mM Tris-Cl pH 8, 150 mM NaCl were frozen.

    [0141] Serum Samples

    [0142] Three hundred serum samples randomly collected from patients attending the Montpellier University hospital as part of a collection for seroepidemiological investigation through the Arbosud project (Montpellier University MUSE project) were screened. Additional 34 serum samples from patients with diagnosis of meningitis or meningo-encephalitis were also tested (Institutional review board 2019-IRB-MPT-05-06).

    [0143] ELISA Serological Assay

    [0144] Two enzyme linked immuno assays were set up with two recombinant antigens, corresponding to the head domain of the Gc protein for respectively the Umbre virus Moissiacence strain and the Schmallenberg virus used as a negative control. Reactivity of every serum samples was concomitantly tested against each antigen in 96 wells plates. Plates were coated overnight at 4° C. with 1004, of 2 μg/mL of the respective antigens. Plates were subsequently washed 3 times with PBS-tween 0.1% and further blocked with PBS-tween 0.01% plus 2% of bovine serum albumin during 2 hours at room temperature. Plates were washed 3 times before 100 μL of a one hundred dilution of serum samples in blocking solution was added. Serum samples were incubated 3 hours at room temperature. Horseradish peroxidase secondary antibody diluted in blocking solution was added after 3 washes and incubated one hour at 37° C., under agitation. TMB substrate was added and plates remained in dark at room temperature for 20 min before reaction was further stopped with H.sub.2SO.sub.4. The 450 nm optical densities were recorded for each sample. Samples giving the highest values were alternatively tested through a commercial pan-species ELISA Schmallenberg virus assay that displays the N protein as targeted antigen, following the manufacturer recommendations (ID Screen Schmallenberg virus indirect Multi-species, IDvet, France).

    [0145] LIPS Serological Assay

    [0146] The search for antibodies against Umbre virus are carried out on sera using a Luciferase Immuno-Precipitation System (LIPS) assay as described (Temmam et al., Front Microbiol., 2019, 10, 2315, doi.org/10.3389/fmicb.2019.02315) using the full Gc protein (SEQ ID NO: 60) or the Gc extracellular domain (SEQ ID NO: 61) or the N-terminal Alpha helix (SEQ ID NO: 62) or the N protein (SEQ ID NO: 2). Viral antigens are produced in HEK-293F cells transfected with plasmids expressing the gene for Nanoluc fused to the C-terminus of the viral protein. Recombinant proteins are harvested from the supernatant or cell lysate without any purification step, and incubated with 10 μL of animal serum. The immune complexes are precipitated with protein A/G-coated beads, washed, and the luciferase activity is monitored for example on a Centro XS.sup.3 LB 960 luminometer (Berthold Technologies, France). The positivity threshold can be defined as the mean of 10 negative controls (without serum)+five standard deviations.

    [0147] Serological Survey

    [0148] The Gc head domain of Schmallenberg virus, an orthobunyavirus of ruminants belonging to the Simbu serogroup, served as a negative control. It was not possible to use the sera of the two Umbre patients as a positive control because of their immunoglobulin deficiency. A positive control was used for the Schmallenberg virus antigen and was tested undiluted and at a 10-fold dilution. Three hundred sera from control patients (the control group) and 34 sera from encephalitis cases (the encephalitis group) were screened. In the control group (N=300), optical densities ranged from 0 to 4 for both antigens (FIG. 7). Because no human cases of Schmallenberg virus infection have been reported (Ducomble et al., Emerg Infect Dis, 2012, 18:1333-1335; Reusken et al., Emerg Infect Dis 2012; 18:1746-1754.) the inventors verified and confirmed the absence of detectable antibodies against the immunodominant nucleocapsid N protein of Schmallenberg virus for samples with the highest densities, using a reference veterinary kit which included a positive control (ID Screen Schmallenberg virus indirect Multi-species, IDvet, France). Since the Gc head domains of Schmallenberg virus and Umbre virus were designed in an orthologous manner and produced under strictly identical conditions, the inventors concluded that optical densities values up to 4 corresponded to background noise. In the encephalitis group (N=34), all optical values were inferior to 3 (FIG. 8). The observed statistical differences were therefore attributed to random background noise and it was concluded that no specific antibody response was recorded.

    2. Case Report

    Context of the Study

    [0149] The two cases presented in this study were selected from a larger series of sixty brain samples collected either from autopsy or biopsy, with brain inflammation, in which the inventors performed a molecular screening for the presence of pathogens. Over a period of 2 years, seventeen of these samples were analyzed by high-throughput sequencing with a metatranscriptomics approach. Patient #2 had undergone a brain biopsy followed 10 days later by a diagnostic autopsy. Patient #1 had been included in the National Creutzfeldt-Jakob disease (CJD) surveillance network, coordinated by the neuropathology department of Pitié-Salpêtrière. This network collects the postmortem samples from all cases in France with a diagnosis of “possible” or “likely” CJD, according to the World Health Organization criteria (WHO Recommended surveillance standards WHO/CDS/CSR/99.2). The aim of this network is not only to confirm CJD but also to identify differential diagnoses in cases of rapidly progressive neurological diseases. In a large series of 1572 cases autopsied between 1992 and 2009, the inventors found that 30% of the collected cases were not prion diseases (Peckeu L et al., Euro Surveill Bull Eur Sur Mal Transm Eur Commun Dis Bull, 2017; 22).

    Case 1

    [0150] A 21-year-old man was was admitted to the neurology department of Toulouse Hospital in October 2013 for swallowing impairment and fluctuation of consciousness. He was living in Moissac, in the south-west of France. He had developed behavioral changes suggestive of depression after a party during which he could have used cocaine and cannabis. His psychiatrist had prescribed selective serotonin reuptake inhibitors. The clinical state had not improved. He was then referred to the psychiatry department at Toulouse University Hospital. His past condition included Bruton's agammaglobulinemia (Omim #300755), an X-linked immunodeficiency characterized by the absence of circulating B cells and low to undetectable levels of all immunoglobulin isotypes in the serum. He was treated since early childhood by repeated infusion of intravenous immunoglobulins together with an anti-infectious prophylaxis by valaciclovir and sulfamethoxazole/trimethoprim. He also suffered from Crohn's disease, which was treated with mesalazine and azathioprine.

    [0151] The patient was anorectic and had lost 10 kg during the last weeks. He was afebrile. The diagnosis of catatonia was considered. He did not respond to antidepressants, benzodiazepines and neuroleptics at high doses. Upon admission in the Neurology department, brain MRI, with FLAIR (FLuid-Attenuated Inversion Recovery) sequence and diffusion-weighted imaging, showed a diffuse hypersignal in the insular, posterior cingulate and occipital cortices, and in the caudate nucleus and putamen, bilaterally (FIG. 1, a & b). FDG PET/CT scan showed a diffuse cortical hypofixation, more severe in the left hemisphere and no hypermetabolism outside the brain. Blood cell count showed a decreased number of lymphocytes (500 G/L). There was no anti-thyroglobulin and anti-thyroperoxidase antibody in the serum. Serological tests for Borrelia burgdorferi, Treponema pallidum, polyomavirus, HIV, and hepatitis B, C, and E viruses were negative—a negativity that was difficult to interpret in a patient with agammaglobulinemia. The concentration of serum C-reactive protein was increased (150 mg/L; normal value below 6 mg/L). The blood levels of aspartate aminotransferase, and alanine aminotransferase were increased two folds.

    [0152] Total proteins concentration, glucose level, and cell count were normal in the cerebrospinal fluid (CSF). No oligoclonal bands were detected. CSF PCRs for enteroviruses, herpesviruses, and Tropheryma whipplei were negative. The search for Ri/La/Hu, VGCC, NMDA receptor, GABA, ANNA-1, ANNA-2, gangliosides, AQP4, and MOG antibodies was negative. The CSF was positive for the 14-3-3 protein.

    [0153] The patient died two months and a half after the first symptoms. The rapid course of the disease, the cortical and striatal hyperintensity at MRI, the positivity of 14-3-3 protein in the CSF, and a history of repeated treatment with blood products had raised the diagnostic hypothesis of Creutzfeldt-Jakob disease, either iatrogenic or variant. The diagnosis of encephalitis, by contrast, was thought implausible: the patient had been afebrile during the whole course of the disease and the CSF cell count was normal. The autopsy was limited to the brain. The brain samples were referred to the national neuropathology network for the surveillance of Creutzfeldt-Jakob disease.

    Case 2

    [0154] A 58-year-old woman was referred to the emergency department of Paris Pitié-Salpêtrière Hospital in October 2018 for anorexia and psychomotor slowing, without fever. She had been followed in the immunology department (Saint Louis Hospital, Paris) for a complex immunologic disorder. The diagnosis of a cutaneous follicular lymphoma had been made 17 years earlier. She had been treated with radiotherapy, surgery and chemotherapy (rituximab-cyclophosphamide-vincristin-prednisone, then rituximab-cyclophosphamide). She had been in complete remission for 9 years. She had developed a humoral immune deficiency characterized by low IgG and undetectable IgM levels in the absence of circulating B cells. She had recurrent bacterial infections for which she had received polyvalent immunoglobulins. She was also suffering from vitiligo and lichen planus. She had been followed for more than 10 years for a severe autoimmune hepatitis requiring immunosuppressive treatment with sirolimus and leading to cirrhosis, for which transplantation was being considered. At admission in the intensive care unit, psychomotor slowing was marked. There were no focal neurological signs. CSF was clear and contained 10 white blood cells/mm.sup.3 (N<5), with CD20 negative lymphocytes at various stages of activation and some macrophages. CSF glucose was normal (3.53 mmole/L). The protein level was increased (0.67 g/L, N<0.40). MRI was normal (FIG. 1, c-e). Three months later, the patient was apathetic. The CSF contained 34 white blood cells/mm3 and 4,200 red blood cells/mm3. CSF protein level was 0.47 g/L. Interferon alpha was increased in the CSF (6 kUI/L, N<2), normal in the serum (2 kUI/L). The search for autoantibodies (including NMDAr, Yo, RI, Hu, amphiphysine, CV2, Sox1, GAD, Ma1, Ma2) was negative. CSF PCRs for viruses (EBV, CMV, HSV1 and 2, VZV, HHV6, HHV8, adenovirus, enterovirus, polyomavirus) were all negative. She received intravenous immunoglobulins in the hypothesis of dysimmune encephalitis. Four months later, her neurologic condition worsened. She had lost her balance, had fallen several times and was mute. She was transferred to the neurology department at Pitié-Salpêtrière Hospital. She lived in Paris area (Val-de-Marne). Her relatives indicated that she had traveled extensively, visiting China, Japan, Australia, Spain, Israel and Italy in previous years. They also reported that a few weeks before the onset of the symptoms, she had sojourned in Camargue, south of France, and went on a 10-day Mediterranean cruise. Despite treatment with amoxicillin and aciclovir, she progressed to akinetic mutism within three months. Hyperintensity in the hippocampus, the temporal pole and the insula were observed bilaterally and progressed to atrophy (FIG. 1, f-h). The spinal MRI was normal. Repeated EEG showed slow waves, with pseudo-periodic patterns, similar to those observed in Creutzfeldt-Jakob disease. She became comatose, despite Ig replacement therapy, high dose steroids pulses, and plasma exchange in the hypothesis of autoimmune encephalitis. It was decided to perform a biopsy of the right frontal middle gyms in the absence of focal lesion visible at MM. Nine days after the biopsy, the patient developed acute hepatic failure due to portal venous thrombosis. She died after an evolution of five months and a half. The diagnosis of encephalitis was suspected but its cause remained undetermined. An autopsy was performed.

    3. Results

    Neuropathology

    [0155] Case 1

    [0156] The brain weighed 1200 g. Its external aspect was unremarkable. Microscopic examination showed severe neuronal loss and spongiosis in the cerebral cortex and in the striatum in both hemispheres (FIG. 2, d); the number of Purkinje cells was also severely reduced. The gliosis was marked, made of fibrillar astrocytes with abundant eosinophilic cytoplasm. Microglia-IBA1, CD163 and CD68 positive-were diffusely activated (FIG. 2, a-c). Numerous microglial nodules were observed, in particular in the pyramidal layer of the hippocampus and in the dentate nucleus of the cerebellum (FIG. 2, a & b). The nodules sometimes contained a neuron (neuronophagia) (FIG. 2, a). A few T lymphocytes, CD3 and CD8 positive, were diffusely distributed around the vessels and in the parenchyma (FIG. 2, e). CD20 and CD4 immunohistochemistry was negative (FIG. 2, d & e). No viral inclusion was observed. Luxol Fast Blue staining did not show significant demyelination. PrP 12F10 immunohistochemistry was negative as well as the PrPres Western blot.

    [0157] Case 2 Biopsy

    [0158] The biopsy sample consisted of 1 cm.sup.3 of cerebral cortex comprising leptomeninges, gray and white matter. Microscopic examination showed marked astrogliosis and severe microglial activation, confirmed by CD163 immunochemistry. Some perivascular cuffs were observed, made of CD3 positive, small T-lymphocytes, 80% of them being CD4- and 20%, CD8-positive. There was no granuloma nor multinucleated giant cell.

    [0159] Case 2 Autopsy

    [0160] The brain weighed 1055 g. Gross examination showed thinning and softening of the temporal poles, and atrophy of the caudate nucleus and cerebral peduncles, bilaterally. An inflammatory infiltrate of low abundance, made of small CD3 positive T lymphocytes, was observed in the leptomeninges and around the veins in the caudate nucleus and mesencephalon. The arterial walls were not altered; there was no evidence for vasculitis. Severe neuronal loss, astrogliosis, and diffuse microglial activation were observed in the neocortex, hippocampus, striatum and cerebellum on both sides (FIG. 3, a & b). There was a severe loss of pyramidal neurons in CA1 to CA4 sectors (FIG. 3, d). Neurons were replaced by reactive astrocytes with enlarged cytoplasms. The numerical density of the granule neurons of the dentate gyrus was decreased. CD163 immunohistochemistry showed massive microglial activation in the pyramidal sectors of the hippocampus and in the dentate gyrus (FIG. 3, a). In the cerebellum (FIG. 3, b), neuronal loss and microglial activation were severe in the dentate nucleus, as well as in the granular and Purkinje cell layers. The loss of Purkinje cells was complete, underlined by the hypertrophy of Bergmann glia. The neuronal loss was severe in the substantia nigra, locus cœruleus and pontine nuclei. Numerous macrophages were observed in the root of the oculomotor nerve in which axonal and myelin loss was severe (FIG. 3, e). Nodules of neuronophagia were found in the medulla oblongata and in the anterior horns of the spinal cord (FIG. 3, c). The spinal roots were spared.

    [0161] Identification, Characterization and Quantification of Umbre Virus Sequences from Patients Sample

    [0162] Post-mortem, metatranscriptomics identified viral sequences related to Umbre virus in the brain of patient 1 and in the brain and spinal cord of patient 2. Full coding sequence of the S, L and M segments were obtained by a combination of RT-PCR and Rapid Amplification of cDNA Ends (RACE). Patient 1: SEQ ID NO: 5 (L segment), SEQ ID NO: 3 (M segment) and SEQ ID NO: 1 (S segment). Patient 1: SEQ ID NO: 92 (L segment), SEQ ID NO: 91 (M segment) and SEQ ID NO: 90 (S segment). This novel virus, named Moissiacense virus in reference to the French region where patient 1 was living, is a member of a currently unnamed Glade or serogroup (FIG. 4A, B, C), and is closely related to Umbre virus strain IG1424, isolated in India. 97.6% amino acid sequence identity (AA Id) and 88% nucleotide sequence identity (nt Id) for L segment; 94.3% AA Id and 86% nt Id for M segment; 97.5% AA Id and 92% nt Id for S segment) and to a lesser extend to Koongol virus (70.5%-AA Id and 68% nt Id for L segment; 55.0% AA Id and 66% nt Id for S segment; no data for M segment) (Tables I to III).

    [0163] The viral sequences found in the two patients were closely related to Umbre virus strain IG1424, isolated in India (97.6%-97.9% amino-acids identity for the L segment), and to a lesser extent to Koongol virus, isolated in Australia (70.5%-71.0% AA Id for L segment) (FIG. 4C; Tables III and IV). According to the species demarcation criteria of the International Committee on Taxonomy of Viruses (ICTV) for orthobunyaviruses (International Committee on Taxonomy of Viruses (ICTV). Available at: https://talk.ictvonline.org/ictv-reports/ictv_9th_report/), the virus strain IG1424 and the two viral strains identified from the two patients belong to the same species and represent different strains of Umbre virus. The inventors therefore gave the names Umbre orthobunyavirus strain Moissiacense (Patient 1) and Umbre orthobunyavirus strain Mama (Patient 2), in reference to the French regions where the patients lived (Moissac and Val-de-Marne, respectively). Moissiacense virus and Mama virus also appears to be very closely related to Little Sussex virus (100.0% AA Id for the 96 AA PCR amplicon on L segment) (Table IV).

    [0164] PCR primer pairs were designed for the specific detection of Moissiacense virus, Umbre virus and Little Sussex virus (Moissiacense virus species-specific primers): SEQ ID NO: 10-11 (S segment); SEQ ID NO: 12-13 (M segment): SEQ ID NO: 14-15 (L segment). Umbre virus S, L and M segments were detected by RT-PCR on the patient's brain sample using the Moissiacense virus species-specific primers (FIG. 5). C. pipiens samples containing related virus sequences were negative by PCR with the Moissiacense virus species-specific primer. These results demonstrate the specificity of the designed PCR primers for Moissiacense virus species (Moissiacense virus, Umbre virus and Little Sussex virus). Determination of viral titer in the patient's brain sample by RT-qPCR indicated approximately 10.sup.6 to 10.sup.8 genome copies/gram of tissue for both patients. Patient 2 also tested positive, albeit less strongly, in the liver and lymph nodes with viral genome copies ranging from 10.sup.4 to 10.sup.6 per gram of tissue.

    [0165] No CSF from patient 1 was available. Three CSF samples from patient 2, collected less than three months before death, were tested by RT-PCR for the three segments of Moissiacense virus species (Umbre virus) and were negative. In addition, 193 CSFs from meningo-encephalitis cases collected in Montpellier and Nimes, two southern cities close to the Camargue region were tested by RT-PCR, for the Moissiacense virus species (Umbre virus) S segment. None was positive.

    [0166] Umbre Virus Infects Brain Neurons

    [0167] In the absence of commercially available antibody specific to the Moissiacense group of viruses, in-situ hybridization probes were designed to detect the S, M and L segments of Moissiacense virus. In situ hybridization (ISH) was performed on tissue sections from samples of frontal cortex, in which microglial activation was severe. Probes homologous to the S, M and L segments of Umbre virus were positive in the cell body and the apical neurite of pyramidal neurons (FIG. 2, f and FIG. 3, f), while glial cells, macrophages or lymphocytes were negative. Positive neurons were scattered in case 1 but numerous in case 2. Viral sequences were not found in five biopsy and autopsy samples of control cases with encephalitis of other documented causes. These data indicate that Umbre virus infects and replicates in cortical neurons.

    [0168] Detection and Prevalence of Viral Sequences Related to Umbre Virus in Culex pipiens Captured in France

    [0169] Umbre virus has never been described in Europe. Since this virus is borne by mosquitoes (Dandawate et al., Indian J Med Res, 1969; 57:1420-1426) the inventors attempted to determine if it could be detected in mosquitoes captured in Camargue between 2015 and 2017 (see Material and Methods). Camargue is located between the Mediterranean Sea and the two arms of the Rhone delta. It is a touristic area, in the South of France, inhabited by many species of insects and notoriously by mosquitoes. Patient 2 stayed in Camargue during the weeks preceding the onset of her disease. Patient 1 was living 200 km west of the Rhone delta and had never travelled outside continental France.

    [0170] All 133 pools of Culex pipiens mosquitoes captured in 2015 in Camargue were negative for PCRs targeting the S, M and L segments of Moissiacense virus. However, 4 out of the 133 pools were positive for Koongol L-segment by RT-PCR (samples C2, C9, F2 and G2). PCR performed after omitting the reverse transcription step was negative, supporting the detection of viral RNA rather than endogenous viral DNA. Sanger sequence analysis of the viral amplicons from mosquitoes confirmed the proximity between Koongol virus (82.1-83.2% AA Id), Little Sussex, Umbre and Moissiacense viruses (75.8-76.8% AA Id) (FIG. 4D and Table IV). Of the mosquitoes captured in 2017, none were positive, which might reflect the lower number of mosquitoes tested. Based on the number of positive pools and the size of the pools from the 2015 captures, the prevalence of Koongol-like sequences in Culex pipiens was estimated by statistical prediction models to be approximately 0.1% (variances ranging from 10.sup.−7 to 10.sup.−3 depending on the model used), assuming either unknown or perfect sensitivity and specificity values of the PCR (Cowling et al., Prev. Vet. Med., 1999, 39, 211-25).

    [0171] Serological Survey

    [0172] Three hundred sera from control patients and 34 sera from encephalitis cases from the South of France including the Camargue region were screened with an ELISA test that the inventors developed to detect Umbre virus antibodies (FIGS. 7-8). No serum gave a positive result.

    4. Discussion

    [0173] Inaccurate diagnosis of encephalitis is a main issue as immunosuppressive treatments can be deleterious in case of viral infection. Metatranscriptomics identified sequences of Umbre virus in brain samples from two immunocompromised patients with clinical and pathological signs of encephalitis. In the two cases, behavioral symptoms preceded neurological signs caused by involvement of the basal ganglia (extrapyramidal syndrome) and of the brainstem (swallowing difficulties). There was no fever. The CSF was normal or with a mild hypercytosis. Pathologically, microglial activation, perivascular cuffing by mononucleated cells including T-lymphocytes, neuronal loss and neuronophagia ascertained the diagnosis of encephalitis. The relative scarcity of lymphocytes, contrasting with the abundance of microglial activation, and the frequency of neuronophagia were noticeable in the two cases. The changes predominated in the grey matter (cerebral cortex, striatum, cerebellar cortex and dentate nucleus). At least in case 2, there was a severe involvement of the brainstem and spinal cord. Although never isolated previously in cases of human or animal encephalitis, Umbre virus may be taken as causal in the two reported cases because of the high number of recovered genomes (around 10.sup.8 genome copies/gram) and the demonstration that Umbre virus infected the neurons of the two patients as seen by in situ hybridization, a key feature of arboviruses responsible for encephalitis (Salimi et al., Neurother J Am Soc Exp Neurother, 2016, 13:514-534.) In addition, no other pathogen was found.

    [0174] The work is original because it deals with the damaged brain tissue obtained from a brain biopsy or autopsy and analyzed by confirmed neuropathologists and the analysis is done without a priori, by methods of very deep sequencing (High Troughput sequencing or NGS), followed by a comparison of the sequences with viral and general nucleotide and protein data bases. The originality of the work is strengthened by the fact that PCR consensus assays targeting a broad range of orthobunyaviruses (Lambert A J, Lanciotti R S, J. Clin. Microbiol., 2009, 47, 2398-404) would have missed Moissiacense virus due to sequence variation (FIG. 6).

    [0175] Within the genus Orthobunyavirus, Umbre virus, Little Sussex virus and Koongol virus belong to the Koongol group of viruses, a group that is yet to be classified by the ICTV but that is distinct from other Orthobunyavirus groups such as the California encephalitis, Bunyamwera, Simbu and Wyeomyia groups. Within the order Bunyavirales, members of the California serogroup (genus Orthobunyavirus, family Peribunyaviridae) and the Rift Valley Fever virus (genus Phlebovirus, family Phenuiviridae) can be responsible for human encephalitis. Regarding viruses related to the Koongol group, however, their pathogenic potential remains unknown.

    [0176] Based on the species demarcation criteria of the International Committee on Taxonomy of Viruses (ICTV) for orthobunyaviruses, Moissiacense virus, Umbre virus and Little Sussex virus would belong to the same species (>90% identical AA identity; ICTV report, 30 Nov. 2018 (available from https://talk.ictvonline.org/ictv-reports/ictv_9th_report/), Previously, Umbre, Little Sussex and Koongol viruses have been identified in Culex sp. in India, Australia and New Guinea (Dandawate et al., Indian J. Med. Res., 1969, 57, 1420-6; Doherty et al., Aust. J. Exp. Biol. Med. Sci., 1979, 57, 509-20; Doherty et al., Aust. J. Exp. Biol. Med. Sci., 1963, 41, 17-39; Karabatsos, edited by N. International catalogue of arboviruses, including certain other viruses of vertebrates [Internet]. 3rd ed. San Antonio, Tex.: American Society of Tropical Medicine and Hygiene for The Subcommittee on Information Exchange of the American Committee on Arthropod-borne Viruses; 1985. Available from: https://catalysy.library.jhu.edu/catalog/bib_66192).

    [0177] Umbre virus (genus Orthobunyavirus, family Peribunyaviridae) was first identified in Culex sp. mosquitoes in India in the 1950s and was catalogued as an arthropod borne (arbo-) virus after successful disease transmission experiments in mice (Dandawate et al., Indian J Med Res 1969; 57:1420-1426). In the 1970s, related viruses named Little Sussex and Koongol were identified in Culex sp. in Queensland, Australia (Doherty et al., Aust J Exp Biol Med Sci 1979; 57:509-520; Doherty et al., Aust J Exp Biol Med Sci 1963; 41:17-39.). The pathogenic potential, in human, of viruses related to the Umbre/Koongol group, however, remained uncertain despite that they are classified by the Center for Disease Control and Prevention (CDC) as ‘Probable Arbovirus’. Serological surveys based on hemagglutination assay have suggested that members of the Umbre/Koongol group could infect several mammals, but this has not been confirmed with a more specific technique such as seroneutralization (Shchetinin et al., Viruses, 2015; 7:5987-6008). Only recently, a partially characterized orthobunyavirus closely related to Umbre virus, causing severe kidney disease in broiler chickens, has been reported in Malaysia (Palya et al., Emerg Infect Dis., 2019; 25:1110-1117). The inventors now report the first human cases leading to brain infection with a virus from the Umbre/Koongol group.

    [0178] In this study, the origin of the two Umbre virus strains could not be elucidated. No Umbre virus could be traced by RT-PCR in pools of mosquitoes isolated in Camargue. Sequences from Koongol virus could however be identified in a small number of mosquitoes, indicating the presence of still unidentified orthobunyaviruses, close to Umbre virus, in the south of France. The inventors concluded that the two patients were possibly infected by mosquito bites—a finding that should stimulate more comprehensive epidemiological studies of the virome of mosquitoes in this area.

    [0179] Diagnosis of orthobunyavirus encephalitis is based on antibody testing (Miller A et al., Hosp. Pediatr., 2012, 2, 235-242). The inventors have tested the prevalence of antibodies binding the Gc head domain protein of Umbre virus in a first series of control (N=300) and encephalitis (N=34) cases but did not find any positive case. It is noteworthy that, because of the hypo- or agammaglobulinemia status of the two patients, the absence of human serum that can serve as a positive control complicated the methodology. The observations of the inventors nevertheless suggest that the prevalence of infection in the general population is low or that the virus is unable to infect most individuals with a normal immune system. The actual risk of disease transmission in immunocompromised individuals may be different and remains unknown. Immune deficit—and particularly the deficit in neutralizing antibodies (Hellert et al., Nat Commun 2019; 10:879)—may have played a crucial role in the development of the encephalitis in a way that remains to be investigated.

    [0180] As for other major arboviruses, like JEV, Umbre virus seems to be hardly detectable in the CSF after the onset of the disease (Dubot-Pérès et al., Lancet Infect. Dis., 2015, 15, 1376-7; Touch et al., Trop. Med. Int. Health TM IH, 2009, 14, 1365-73). (three CSFs from P2 tested negative, and none of the 193 CSFs taken from suspected cases of meningo-encephalitis in two southern cities close to the Camargue region tested positive). Similarly, negative PCR-testing of the CSF was also recorded for Cache Valley virus, another orthobunyavirus identified recently in the brain of an immunodeficient patient (Wilson et al., Ann. Neurol., 2017, 82, 105-14). This suggests that in immunodeficient patients, especially patients without circulating B cells, persistent neurological symptoms should evoke a viral encephalitis that only a brain biopsy can confirm at an early stage.

    [0181] In conclusion, the convergence of virological and epidemiological data shows that the inventors have identified Umbre virus as a new neurotropic arbovirus in Europe, belonging to the orthobunyaviruses. Another close species was identified in Culex pipiens mosquitoes from the same region. Thus, members of the Moissiacense group or species of viruses (i.e. Umbre virus strains), should be added to targeted tests in routine diagnosis of brain tissue from encephalitis cases with unidentified etiology, in particular in a context of immune suppression. The negativity of the CSF in such cases raises the question of brain biopsy at an early stage in the management of encephalitis of unknown etiology.

    TABLE-US-00001 TABLE I Amino acids identity matrix on the S segment (see accession numbers in Phylogenetic analysis) Aino Simbu Akabane Schmallenberg Oropouche Oya Leanyer Batai Bunyamwera Ilesha virus orthobunyavirus virus virus virus virus virus virus virus virus Aino virus 83.3 82.9 79.9 69.2 65.0 54.7 42.8 41.5 41.5 Simbu orthobunyavirus 83.3 81.6 80.3 72.2 64.5 51.3 41.5 41.1 40.7 Akabane virus 82.9 81.6 79.9 68.4 62.4 53.4 39.8 39.4 39.4 Schmallenberg virus 79.9 80.3 79.9 70.1 62.0 52.5 40.7 40.3 39.8 Oropouche virus 69.2 72.2 68.4 70.1 74.4 52.1 43.6 41.9 42.3 Oya virus 65.0 64.5 62.4 62.0 74.4 50.8 39.8 38.1 38.6 Leanyer virus 54.7 51.3 53.4 52.5 52.1 50.8 42.4 40.8 41.2 Batai virus 42.8 41.5 39.8 40.7 43.6 39.8 42.4 90.6 88.5 Bunyamwera virus 41.5 41.1 39.4 40.3 41.9 38.1 40.8 90.6 94.4 Ilesha virus 41.5 40.7 39.4 39.8 42.3 38.6 41.2 88.5 94.4 Cache Valley virus 41.1 41.9 41.1 40.3 42.3 40.3 42.0 90.2 90.6 90.6 Iaco virus 44.9 43.2 43.2 44.1 41.5 39.0 41.6 63.2 65.4 66.7 Sororoca virus 43.6 42.8 42.8 43.2 40.6 39.0 37.8 65.0 66.7 65.4 Wyeomyia 42.8 42.4 43.6 43.6 40.6 41.5 40.8 60.7 63.2 64.1 orthobunyavirus Macaua virus 39.4 39.8 39.8 41.1 39.3 39.0 38.2 62.4 62.4 61.5 Chatanga virus 44.3 43.5 43.9 44.3 43.2 42.2 42.7 44.9 44.5 45.3 Tahyna virus 43.9 43.5 44.3 43.9 43.2 42.6 43.1 44.1 44.5 45.3 La Crosse virus 44.3 42.6 43.5 43.9 41.9 43.0 42.7 44.9 43.2 44.9 Kowanyama virus 40.7 39.8 41.1 40.3 38.3 39.8 43.3 43.8 41.7 42.1 Yacaaba virus 37.0 36.2 38.3 37.9 36.4 39.5 39.9 44.2 43.8 44.6 Caraparu virus 39.7 40.1 38.8 40.1 41.5 38.0 42.0 41.2 43.3 42.0 Madrid virus 39.7 40.1 40.5 41.4 41.1 38.8 41.6 41.2 41.6 40.3 Murrumbidgee virus 40.2 40.2 39.7 39.3 38.1 38.1 38.8 37.7 36.8 37.7 Salt ash virus 37.5 37.9 37.9 36.7 38.3 35.0 37.3 37.1 35.8 36.7 Koongol virus 31.9 32.8 31.5 33.2 31.9 33.6 33.5 33.3 32.1 32.1 Umbre orthobunyavirus 35.3 36.6 32.8 34.9 34.0 33.2 34.7 34.5 35.3 35.3 strain Marna (Case #2) Umbre orthobunyavirus 35.3 36.1 32.8 34.9 34.0 33.2 34.7 34.9 35.7 35.7 strain Moissiacense (Case #1) Umbre virus strain 36.1 37.4 33.6 35.3 34.5 33.6 34.3 34.9 35.7 35.7 IG1424 Herbert virus 19.7 19.7 19.3 18.5 19.8 18.5 20.3 20.4 20.4 20.0 Cache Valley Iaco Sororoca Wyeomyia Macaua Chatanga Tahyna La Crosse Kowanyama Yacaaba virus virus virus orthobunyavirus virus virus virus virus virus virus Aino virus 41.1 44.9 43.6 42.8 39.4 44.3 43.9 44.3 40.7 37.0 Simbu orthobunyavirus 41.9 43.2 42.8 42.4 39.8 43.5 43.5 42.6 39.8 36.2 Akabane virus 41.1 43.2 42.8 43.6 39.8 43.9 44.3 43.5 41.1 38.3 Schmallenberg virus 40.3 44.1 43.2 43.6 41.1 44.3 43.9 43.9 40.3 37.9 Oropouche virus 42.3 41.5 40.6 40.6 39.3 43.2 43.2 41.9 38.3 36.4 Oya virus 40.3 39.0 39.0 41.5 39.0 42.2 42.6 43.0 39.8 39.5 Leanyer virus 42.0 41.6 37.8 40.8 38.2 42.7 43.1 42.7 43.3 39.9 Batai virus 90.2 63.2 65.0 60.7 62.4 44.9 44.1 44.9 43.8 44.2 Bunyamwera virus 90.6 65.4 66.7 63.2 62.4 44.5 44.5 43.2 41.7 43.8 Ilesha virus 90.6 66.7 65.4 64.1 61.5 45.3 45.3 44.9 42.1 44.6 Cache Valley virus 65.0 65.0 63.7 62.8 43.6 43.6 43.6 42.1 43.0 Iaco virus 65.0 77.4 75.6 72.2 47.5 47.0 47.9 44.3 46.3 Sororoca virus 65.0 77.4 73.9 68.8 42.8 43.2 43.6 42.6 42.1 Wyeomyia 63.7 75.6 73.9 74.8 47.9 46.6 47.5 44.3 41.7 orthobunyavirus Macaua virus 62.8 72.2 68.8 74.8 44.9 44.5 44.1 43.0 42.6 Chatanga virus 43.6 47.5 42.8 47.9 44.9 90.7 89.4 54.4 50.0 Tahyna virus 43.6 47.0 43.2 46.6 44.5 90.7 86.0 54.4 50.4 La Crosse virus 43.6 47.9 43.6 47.5 44.1 89.4 86.0 54.0 50.0 Kowanyama virus 42.1 44.3 42.6 44.3 43.0 54.4 54.4 54.0 62.8 Yacaaba virus 43.0 46.3 42.1 41.7 42.6 50.0 50.4 50.0 62.8 Caraparu virus 41.6 41.6 39.1 40.3 38.7 44.8 44.8 42.3 42.9 42.6 Madrid virus 40.8 39.9 37.8 39.1 40.3 44.8 44.8 42.3 43.7 43.4 Murrumbidgee virus 37.2 37.2 35.1 38.5 38.1 41.3 40.8 41.3 43.9 39.2 Salt ash virus 35.8 38.3 37.5 38.8 37.1 45.6 43.2 43.2 43.8 38.2 Koongol virus 33.8 33.8 34.2 33.3 31.6 40.8 41.2 39.9 39.7 36.6 Umbre orthobunyavirus 36.1 38.7 38.2 39.5 37.0 38.7 38.2 38.7 36.1 35.2 strain Marna (Case #2) Umbre orthobunyavirus 36.6 38.2 38.2 39.5 37.0 38.2 37.8 38.2 35.7 34.8 strain Moissiacense (Case #1) Umbre virus strain 36.6 39.1 38.7 39.9 37.4 39.5 39.1 39.5 36.1 35.2 IG1424 Herbert virus 19.6 21.6 20.4 19.6 19.6 19.4 19.8 19.4 20.4 16.0 Umbre Umbre orthobunya- orthobunya- Umbre virus strain virus strain virus Caraparu Madrid Murrumbidgee Salt ash Koongol Marna Moissiacense strain Herbert virus virus virus virus virus (Case #2) (Case #1) IG1424 virus Aino virus 39.7 39.7 40.2 37.5 31.9 35.3 35.3 36.1 19.7 Simbu orthobunyavirus 40.1 40.1 40.2 37.9 32.8 36.6 36.1 37.4 19.7 Akabane virus 38.8 40.5 39.7 37.9 31.5 32.8 32.8 33.6 19.3 Schmallenberg virus 40.1 41.4 39.3 36.7 33.2 34.9 34.9 35.3 18.5 Oropouche virus 41.5 41.1 38.1 38.3 31.9 34.0 34.0 34.5 19.8 Oya virus 38.0 38.8 38.1 35.0 33.6 33.2 33.2 33.6 18.5 Leanyer virus 42.0 41.6 38.8 37.3 33.5 34.7 34.7 34.3 20.3 Batai virus 41.2 41.2 37.7 37.1 33.3 34.5 34.9 34.9 20.4 Bunyamwera virus 43.3 41.6 36.8 35.8 32.1 35.3 35.7 35.7 20.4 Ilesha virus 42.0 40.3 37.7 36.7 32.1 35.3 35.7 35.7 20.0 Cache Valley virus 41.6 40.8 37.2 35.8 33.8 36.1 36.6 36.6 19.6 Iaco virus 41.6 39.9 37.2 38.3 33.8 38.7 38.2 39.1 21.6 Sororoca virus 39.1 37.8 35.1 37.5 34.2 38.2 38.2 38.7 20.4 Wyeomyia 40.3 39.1 38.5 38.8 33.3 39.5 39.5 39.9 19.6 orthobunyavirus Macaua virus 38.7 40.3 38.1 37.1 31.6 37.0 37.0 37.4 19.6 Chatanga virus 44.8 44.8 41.3 45.6 40.8 38.7 38.2 39.5 19.4 Tahyna virus 44.8 44.8 40.8 43.2 41.2 38.2 37.8 39.1 19.8 La Crosse virus 42.3 42.3 41.3 43.2 39.9 38.7 38.2 39.5 19.4 Kowanyama virus 42.9 43.7 43.9 43.8 39.7 36.1 35.7 36.1 20.4 Yacaaba virus 42.6 43.4 39.2 38.2 36.6 35.2 34.8 35.2 16.0 Caraparu virus 94.1 34.0 36.8 36.3 40.2 40.2 40.2 18.3 Madrid virus 94.1 34.9 37.2 36.3 38.1 38.1 38.1 18.7 Murrumbidgee virus 34.0 34.9 67.8 34.3 31.3 30.8 32.1 17.4 Salt ash virus 36.8 37.2 67.8 32.1 30.3 30.3 31.1 18.3 Koongol virus 36.3 36.3 34.3 32.1 55.0 55.0 54.6 16.0 Umbre orthobunyavirus 40.2 38.1 31.3 30.3 55.0 98.7 97.9 15.4 strain Marna (Case #2) Umbre orthobunyavirus 40.2 38.1 30.8 30.3 55.0 98.7 97.5 15.4 strain Moissiacense (Case #1) Umbre virus strain 40.2 38.1 32.1 31.1 54.6 97.9 97.5 15.8 IG1424 Herbert virus 18.3 18.7 17.4 18.3 16.0 15.4 15.4 15.8

    TABLE-US-00002 TABLE II Amino acids identity matrix on the M segment (see accession numbers in Phylogenetic analysis) Aino Schmallenberg Simbu Oropouche Oya Leanyer Akabane Batai Bunyamwera Cache Valley virus virus orthobunyavirus virus virus virus virus virus virus virus Aino virus 57.2 51.7 36.7 37.2 32.1 35.0 32.1 32.0 32.2 Schmallenberg virus 57.2 51.4 35.1 36.7 31.4 35.6 30.7 31.5 31.9 Simbu orthobunyavirus 51.7 51.4 37.0 37.2 33.0 36.8 31.5 32.6 32.2 Oropouche virus 36.7 35.1 37.0 51.0 35.7 32.4 31.8 32.9 33.2 Oya virus 37.2 36.7 37.2 51.0 36.3 34.1 32.7 33.5 32.9 Leanyer virus 32.1 31.4 33.0 35.7 36.3 31.0 31.3 31.1 31.4 Akabane virus 35.0 35.6 36.8 32.4 34.1 31.0 28.9 29.1 29.1 Batai virus 32.1 30.7 31.5 31.8 32.7 31.3 28.9 78.6 64.4 Bunyamwera virus 32.0 31.5 32.6 32.9 33.5 31.1 29.1 78.6 64.0 Cache Valley virus 32.2 31.9 32.2 33.2 32.9 31.4 29.1 64.4 64.0 Ilesha virus 32.9 31.7 31.8 32.5 33.0 30.5 28.6 64.7 63.4 69.3 Iaco virus 30.9 30.4 30.5 31.9 33.5 30.7 28.2 51.5 51.2 51.1 Sororoca virus 30.8 30.3 30.0 31.8 33.1 31.0 29.1 51.0 51.4 50.0 Macaua virus 31.5 30.3 30.8 32.4 33.5 30.9 29.1 52.4 51.2 52.5 Wyeomyia 31.9 30.3 31.3 32.3 33.2 30.2 28.9 51.4 50.8 51.1 orthobunyavirus Chatanga virus 30.8 31.5 30.3 31.2 32.2 29.7 28.1 42.2 41.6 43.0 La Crosse virus 30.8 31.5 30.6 31.1 31.7 30.1 28.7 42.2 42.3 42.4 Tahyna virus 30.6 31.6 30.3 30.6 31.9 30.1 27.5 42.4 41.8 42.7 Kowanyama virus 29.2 29.9 28.6 32.9 32.0 28.8 28.5 37.9 37.4 38.2 Umbre orthobunyavirus 29.7 29.4 29.8 30.6 29.3 28.0 27.8 38.5 37.8 38.3 strain Marna (Case #2) Umbre orthobunyavirus 30.0 29.1 29.7 30.7 29.5 28.1 27.4 38.8 37.9 38.6 strain Moissiacense (Case #1) Umbre virus strain 29.4 28.7 30.1 30.6 29.6 27.8 27.3 38.6 38.0 38.6 IG1424 Caraparu virus 29.6 28.8 28.8 30.5 32.5 29.0 28.7 33.4 33.3 34.1 Madrid virus 29.5 29.0 29.4 30.7 33.2 29.1 27.9 34.3 34.0 34.1 Murrumbidgee virus 29.1 27.7 28.2 27.8 28.7 27.4 27.9 31.2 31.5 32.8 Salt ash virus 30.3 28.1 30.1 29.7 30.4 29.9 28.7 33.3 33.2 33.9 Herbert virus 11.3 12.2 12.4 11.9 10.7 11.0 12.4 9.7 10.2 10.4 Ilesha Iaco Sororoca Macaua Wyeomyia Chatanga La Crosse Tahyna Kowanyama virus virus virus virus orthobunyavirus virus virus virus virus Aino virus 32.9 30.9 30.8 31.5 31.9 30.8 30.8 30.6 29.2 Schmallenberg virus 31.7 30.4 30.3 30.3 30.3 31.5 31.5 31.6 29.9 Simbu orthobunyavirus 31.8 30.5 30.0 30.8 31.3 30.3 30.6 30.3 28.6 Oropouche virus 32.5 31.9 31.8 32.4 32.3 31.2 31.1 30.6 32.9 Oya virus 33.0 33.5 33.1 33.5 33.2 32.2 31.7 31.9 32.0 Leanyer virus 30.5 30.7 31.0 30.9 30.2 29.7 30.1 30.1 28.8 Akabane virus 28.6 28.2 29.1 29.1 28.9 28.1 28.7 27.5 28.5 Batai virus 64.7 51.5 51.0 52.4 51.4 42.2 42.2 42.4 37.9 Bunyamwera virus 63.4 51.2 51.4 51.2 50.8 41.6 42.3 41.8 37.4 Cache Valley virus 69.3 51.1 50.0 52.5 51.1 43.0 42.4 42.7 38.2 Ilesha virus 51.4 50.5 51.2 50.2 42.0 42.1 42.2 38.4 Iaco virus 51.4 79.7 71.2 70.4 41.5 42.4 42.3 37.5 Sororoca virus 50.5 79.7 70.1 69.8 42.5 42.9 42.8 37.4 Macaua virus 51.2 71.2 70.1 85.9 41.8 41.6 41.9 36.3 Wyeomyia 50.2 70.4 69.8 85.9 40.7 40.7 41.6 36.9 orthobunyavirus Chatanga virus 42.0 41.5 42.5 41.8 40.7 88.1 81.9 39.6 La Crosse virus 42.1 42.4 42.9 41.6 40.7 88.1 79.5 39.9 Tahyna virus 42.2 42.3 42.8 41.9 41.6 81.9 79.5 39.9 Kowanyama virus 38.4 37.5 37.4 36.3 36.9 39.6 39.9 39.9 Umbre orthobunyavirus 37.0 36.9 37.2 35.9 35.4 40.6 39.9 39.7 36.4 strain Marna (Case #2) Umbre orthobunyavirus 37.1 36.7 37.0 35.7 35.2 40.9 39.9 39.9 36.0 strain Moissiacense (Case #1) Umbre virus strain 36.9 37.2 37.1 35.5 35.3 40.2 39.9 39.7 36.4 IG1424 Caraparu virus 32.5 31.8 32.1 32.5 32.0 32.6 33.0 32.5 31.8 Madrid virus 32.5 32.9 33.4 33.8 32.8 32.8 33.1 33.3 32.2 Murrumbidgee virus 32.4 31.6 32.8 31.6 32.0 31.3 32.4 31.8 31.4 Salt ash virus 32.9 32.6 33.1 32.6 32.1 33.4 33.3 33.2 34.3 Herbert virus 10.7 10.2 9.9 10.2 10.1 10.8 11.0 10.7 10.2 Umbre Umbre orthobunya- orthobunya- Umbre virus strain virus strain virus Marna Moissiacense strain Caraparu Madrid Murrumbidgee Salt ash Herbert (Case #2) (Case #1) IG1424 virus virus virus virus virus Aino virus 29.7 30.0 29.4 29.6 29.5 29.1 30.3 11.3 Schmallenberg virus 29.4 29.1 28.7 28.8 29.0 27.7 28.1 12.2 Simbu orthobunyavirus 29.8 29.7 30.1 28.8 29.4 28.2 30.1 12.4 Oropouche virus 30.6 30.7 30.6 30.5 30.7 27.8 29.7 11.9 Oya virus 29.3 29.5 29.6 32.5 33.2 28.7 30.4 10.7 Leanyer virus 28.0 28.1 27.8 29.0 29.1 27.4 29.9 11.0 Akabane virus 27.8 27.4 27.3 28.7 27.9 27.9 28.7 12.4 Batai virus 38.5 38.8 38.6 33.4 34.3 31.2 33.3 9.7 Bunyamwera virus 37.8 37.9 38.0 33.3 34.0 31.5 33.2 10.2 Cache Valley virus 38.3 38.6 38.6 34.1 34.1 32.8 33.9 10.4 Ilesha virus 37.0 37.1 36.9 32.5 32.5 32.4 32.9 10.7 Iaco virus 36.9 36.7 37.2 31.8 32.9 31.6 32.6 10.2 Sororoca virus 37.2 37.0 37.1 32.1 33.4 32.8 33.1 9.9 Macaua virus 35.9 35.7 35.5 32.5 33.8 31.6 32.6 10.2 Wyeomyia 35.4 35.2 35.3 32.0 32.8 32.0 32.1 10.1 orthobunyavirus Chatanga virus 40.6 40.9 40.2 32.6 32.8 31.3 33.4 10.8 La Crosse virus 39.9 39.9 39.9 33.0 33.1 32.4 33.3 11.0 Tahyna virus 39.7 39.9 39.7 32.5 33.3 31.8 33.2 10.7 Kowanyama virus 36.4 36.0 36.4 31.8 32.2 31.4 34.3 10.2 Umbre orthobunyavirus 96.1 94.5 32.2 32.4 29.4 31.2 11.0 strain Marna (Case #2) Umbre orthobunyavirus 96.1 94.3 31.9 32.5 29.7 31.2 11.1 strain Moissiacense (Case #1) Umbre virus strain 94.5 94.3 32.1 32.0 29.5 30.9 10.9 IG1424 Caraparu virus 32.2 31.9 32.1 82.1 30.7 31.8 11.0 Madrid virus 32.4 32.5 32.0 82.1 29.9 31.4 11.0 Murrumbidgee virus 29.4 29.7 29.5 30.7 29.9 48.8 11.0 Salt ash virus 31.2 31.2 30.9 31.8 31.4 48.8 11.6 Herbert virus 11.0 11.1 10.9 11.0 11.0 11.0 11.6

    TABLE-US-00003 TABLE III Amino acids identity matrix on the L segment (see accession numbers in Phylogenetic analysis) Aino Akabane Schmallenberg Simbu Oropouche Oya Leanyer Caraparu Madrid Batai virus virus virus orthobunyavirus virus virus virus virus virus virus Aino virus 68.0 68.8 71.1 58.7 57.9 55.3 49.6 49.7 48.3 Akabane virus 68.0 70.9 70.1 58.4 57.5 54.3 50.6 50.6 48.8 Schmallenberg virus 68.8 70.9 70.0 57.6 56.8 54.5 49.4 49.5 48.1 Simbu orthobunyavirus 71.1 70.1 70.0 58.3 57.6 55.0 49.7 49.2 48.4 Oropouche virus 58.7 58.4 57.6 58.3 66.2 58.8 52.6 52.7 50.2 Oya virus 57.9 57.5 56.8 57.6 66.2 58.0 52.8 52.4 48.6 Leanyer virus 55.3 54.3 54.5 55.0 58.8 58.0 50.7 50.8 49.0 Caraparu virus 49.6 50.6 49.4 49.7 52.6 52.8 50.7 94.4 50.6 Madrid virus 49.7 50.6 49.5 49.2 52.7 52.4 50.8 94.4 50.3 Batai virus 48.3 48.8 48.1 48.4 50.2 48.6 49.0 50.6 50.3 Bunyamwera virus 48.8 49.4 48.8 48.4 49.9 48.5 48.4 51.4 51.4 82.8 Ilesha virus 47.7 49.3 47.9 48.3 49.9 48.6 48.1 50.5 50.7 81.9 Cache Valley virus 48.6 49.3 48.5 48.7 49.8 48.2 48.2 51.2 51.2 80.6 Iaco virus 49.0 49.5 48.5 48.4 49.9 49.3 49.2 51.0 51.2 67.2 Sororoca virus 48.1 49.1 48.0 47.1 49.1 48.3 48.2 50.2 50.4 65.5 Macaua virus 48.5 49.1 48.1 48.9 49.0 48.9 49.2 51.1 51.3 66.7 Wyeomyia 47.8 49.0 48.0 47.6 48.7 48.8 48.8 50.4 50.6 66.6 orthobunyavirus Chatanga virus 49.4 49.8 49.8 48.8 51.4 50.5 50.4 50.7 50.7 54.4 La Crosse virus 49.2 50.5 50.1 49.3 51.5 50.6 50.6 50.9 51.2 55.0 Tahyna virus 49.4 49.9 50.2 48.9 51.1 50.5 50.3 50.8 50.8 54.0 Kowanyama virus 47.8 49.8 49.3 48.4 49.8 49.5 49.3 49.2 49.1 52.1 Yacaaba virus 49.4 50.9 49.3 49.5 50.4 50.1 48.4 50.6 50.6 51.6 Koongol virus 45.3 45.1 44.7 44.6 46.5 46.4 46.2 46.2 46.3 47.6 Umbre orthobunyavirus 44.1 44.3 44.6 44.5 45.8 45.9 45.0 46.5 46.6 48.3 strain Marna (Case #2) Umbre orthobunyavirus 44.2 44.4 44.7 44.6 45.7 45.9 45.1 46.5 46.6 48.4 strain Moissiacense (Case #1) Umbre virus strain 44.0 44.1 44.7 44.5 45.9 45.9 44.8 46.4 46.5 48.0 IG1424 Murrumbidgee virus 45.5 45.3 45.6 45.5 46.1 45.2 46.8 47.3 46.9 48.8 Herbert virus 24.5 24.1 24.6 24.5 25.0 23.6 24.1 25.0 25.0 25.3 Bunyamwera Ilesha Cache Valley Iaco Sororoca Macaua Wyeomyia Chatanga La Crosse Tahyna virus virus virus virus virus virus orthobunyavirus virus virus virus Aino virus 48.8 47.7 48.6 49.0 48.1 48.5 47.8 49.4 49.2 49.4 Akabane virus 49.4 49.3 49.3 49.5 49.1 49.1 49.0 49.8 50.5 49.9 Schmallenberg virus 48.8 47.9 48.5 48.5 48.0 48.1 48.0 49.8 50.1 50.2 Simbu orthobunyavirus 48.4 48.3 48.7 48.4 47.1 48.9 47.6 48.8 49.3 48.9 Oropouche virus 49.9 49.9 49.8 49.9 49.1 49.0 48.7 51.4 51.5 51.1 Oya virus 48.5 48.6 48.2 49.3 48.3 48.9 48.8 50.5 50.6 50.5 Leanyer virus 48.4 48.1 48.2 49.2 48.2 49.2 48.8 50.4 50.6 50.3 Caraparu virus 51.4 50.5 51.2 51.0 50.2 51.1 50.4 50.7 50.9 50.8 Madrid virus 51.4 50.7 51.2 51.2 50.4 51.3 50.6 50.7 51.2 50.8 Batai virus 82.8 81.9 80.6 67.2 65.5 66.7 66.6 54.4 55.0 54.0 Bunyamwera virus 91.6 82.1 67.9 65.8 67.4 67.0 55.4 55.9 55.0 Ilesha virus 91.6 81.1 67.6 65.3 67.2 66.9 54.4 55.0 54.3 Cache Valley virus 82.1 81.1 67.7 66.1 66.3 67.2 54.5 55.4 54.6 Iaco virus 67.9 67.6 67.7 86.1 80.2 80.0 54.1 54.3 54.0 Sororoca virus 65.8 65.3 66.1 86.1 78.3 77.6 53.6 53.6 53.2 Macaua virus 67.4 67.2 66.3 80.2 78.3 84.9 55.1 55.4 54.5 Wyeomyia 67.0 66.9 67.2 80.0 77.6 84.9 54.7 55.1 54.5 orthobunyavirus Chatanga virus 55.4 54.4 54.5 54.1 53.6 55.1 54.7 93.7 89.7 La Crosse virus 55.9 55.0 55.4 54.3 53.6 55.4 55.1 93.7 89.5 Tahyna virus 55.0 54.3 54.6 54.0 53.2 54.5 54.5 89.7 89.5 Kowanyama virus 52.7 52.5 52.4 51.2 50.9 50.9 51.0 57.1 57.8 57.9 Yacaaba virus 52.0 52.0 51.8 51.9 52.0 52.0 51.6 56.4 57.0 56.6 Koongol virus 47.1 47.2 47.8 48.6 48.6 49.4 49.2 51.4 51.6 51.8 Umbre orthobunyavirus 47.7 47.4 47.9 47.9 47.5 48.2 48.2 52.3 52.0 51.4 strain Marna (Case #2) Umbre orthobunyavirus 47.6 47.3 47.9 48.0 47.6 48.3 48.2 52.2 51.9 51.4 strain Moissiacense (Case #1) Umbre virus strain 47.4 47.1 47.5 47.8 47.6 48.2 48.0 52.1 51.8 51.5 IG1424 Murrumbidgee virus 48.4 48.5 48.5 48.7 47.9 48.8 48.1 49.6 49.7 49.9 Herbert virus 24.9 24.5 25.1 24.9 24.0 24.6 24.8 25.0 25.0 24.7 Umbre Umbre orthobunya- orthobunya- Umbre virus strain virus strain virus Kowanyama Yacaaba Koongol Marna Moissiacense strain Murrumbidgee Herbert virus virus virus (Case #2) (Case #1) IG1424 virus virus Aino virus 47.8 49.4 45.3 44.1 44.2 44.0 45.5 24.5 Akabane virus 49.8 50.9 45.1 44.3 44.4 44.1 45.3 24.1 Schmallenberg virus 49.3 49.3 44.7 44.6 44.7 44.7 45.6 24.6 Simbu orthobunyavirus 48.4 49.5 44.6 44.5 44.6 44.5 45.5 24.5 Oropouche virus 49.8 50.4 46.5 45.8 45.7 45.9 46.1 25.0 Oya virus 49.5 50.1 46.4 45.9 45.9 45.9 45.2 23.6 Leanyer virus 49.3 48.4 46.2 45.0 45.1 44.8 46.8 24.1 Caraparu virus 49.2 50.6 46.2 46.5 46.5 46.4 47.3 25.0 Madrid virus 49.1 50.6 46.3 46.6 46.6 46.5 46.9 25.0 Batai virus 52.1 51.6 47.6 48.3 48.4 48.0 48.8 25.3 Bunyamwera virus 52.7 52.0 47.1 47.7 47.6 47.4 48.4 24.9 Ilesha virus 52.5 52.0 47.2 47.4 47.3 47.1 48.5 24.5 Cache Valley virus 52.4 51.8 47.8 47.9 47.9 47.5 48.5 25.1 Iaco virus 51.2 51.9 48.6 47.9 48.0 47.8 48.7 24.9 Sororoca virus 50.9 52.0 48.6 47.5 47.6 47.6 47.9 24.0 Macaua virus 50.9 52.0 49.4 48.2 48.3 48.2 48.8 24.6 Wyeomyia 51.0 51.6 49.2 48.2 48.2 48.0 48.1 24.8 orthobunyavirus Chatanga virus 57.1 56.4 51.4 52.3 52.2 52.1 49.6 25.0 La Crosse virus 57.8 57.0 51.6 52.0 51.9 51.8 49.7 25.0 Tahyna virus 57.9 56.6 51.8 51.4 51.4 51.5 49.9 24.7 Kowanyama virus 65.9 47.8 47.4 47.4 47.6 48.1 25.0 Yacaaba virus 65.9 49.2 48.8 48.9 48.9 46.9 25.6 Koongol virus 47.8 49.2 71.0 70.5 70.8 44.8 24.7 Umbre orthobunyavirus 47.4 48.8 71.0 98.8 97.9 45.3 24.4 strain Marna (Case #2) Umbre orthobunyavirus 47.4 48.9 70.5 98.8 97.6 45.2 24.5 strain Moissiacense (Case #1) Umbre virus strain 47.6 48.9 70.8 97.9 97.6 45.2 24.3 IG1424 Murrumbidgee virus 48.1 46.9 44.8 45.3 45.2 45.2 24.0 Herbert virus 25.0 25.6 24.7 24.4 24.5 24.3 24.0

    TABLE-US-00004 TABLE IV Amino acids identity matrix on PCR-targeted region on the L segment (See accession numbers in phylogenetic analysis) Simbu ortho- Cache Aino Akabane Schmallenberg bunya- Oropouche Oya Leanyer Batai Bunyamwera Ilesha Valley Iaco virus virus virus virus virus virus virus virus virus virus virus virus Aino virus 75.8 81.1 76.8 69.5 64.2 66.3 67.4 68.4 66.3 62.1 62.1 Akabane virus 75.8 81.1 73.7 67.4 66.3 62.1 63.2 63.2 63.2 61.1 58.9 Schmallenberg virus 81.1 81.1 78.9 71.6 68.4 73.7 64.2 66.3 63.2 63.2 60.0 Simbu orthobunyavirus 76.8 73.7 78.9 70.5 68.4 66.3 64.2 66.3 66.3 62.1 57.9 Oropouche virus 69.5 67.4 71.6 70.5 71.6 68.4 61.1 61.1 62.1 62.1 57.9 Oya virus 64.2 66.3 68.4 68.4 71.6 65.3 64.2 57.9 60.0 58.9 57.9 Leanyer virus 66.3 62.1 73.7 66.3 68.4 65.3 63.2 63.2 64.2 63.2 63.2 Batai virus 67.4 63.2 64.2 64.2 61.1 64.2 63.2 80.0 83.2 82.1 71.6 Bunyamwera virus 68.4 63.2 66.3 66.3 61.1 57.9 63.2 80.0 92.6 82.1 68.4 Ilesha virus 66.3 63.2 63.2 66.3 62.1 60.0 64.2 83.2 92.6 85.3 67.4 Cache Valley virus 62.1 61.1 63.2 62.1 62.1 58.9 63.2 82.1 82.1 85.3 66.3 Iaco virus 62.1 58.9 60.0 57.9 57.9 57.9 63.2 71.6 68.4 67.4 66.3 Sororoca virus 62.1 58.9 61.1 55.8 57.9 57.9 61.1 69.5 68.4 67.4 66.3 89.5 Macaua virus 58.9 55.8 58.9 61.1 58.9 54.7 65.3 64.2 72.6 71.6 66.3 84.2 Wyeomyia 61.1 61.1 62.1 58.9 56.8 61.1 66.3 68.4 70.5 68.4 70.5 82.1 orthobunyavirus Chatanga virus 65.3 60.0 68.4 65.3 66.3 61.1 67.4 70.5 70.5 69.5 71.6 62.1 La Crosse virus 65.3 64.2 68.4 64.2 68.4 60.0 67.4 68.4 71.6 71.6 70.5 62.1 Tahyna virus 65.3 62.1 68.4 64.2 68.4 61.1 66.3 69.5 71.6 70.5 72.6 64.2 Culex pipiens 52.6 57.9 57.9 55.8 57.9 55.8 50.5 57.9 51.6 53.7 52.6 57.9 France (C2) Culex pipiens 52.6 57.9 57.9 55.8 57.9 55.8 50.5 57.9 51.6 53.7 52.6 57.9 France (F2) Culex pipiens 52.6 57.9 57.9 55.8 57.9 55.8 50.5 57.9 51.6 53.7 52.6 57.9 France (G2) Culex pipiens 51.6 56.8 56.8 55.8 56.8 54.7 50.5 56.8 51.6 53.7 52.6 56.8 France (C9) Koongol virus 54.7 62.1 58.9 52.6 57.9 57.9 52.6 63.2 54.7 56.8 56.8 58.9 Little Sussex virus 61.1 61.1 64.2 62.1 57.9 57.9 52.6 62.1 57.9 58.9 55.8 56.8 Umbre virus strain 61.1 61.1 64.2 62.1 57.9 57.9 52.6 62.1 57.9 58.9 55.8 56.8 IG1424 Umbre orthobunyavirus 61.1 61.1 64.2 62.1 57.9 57.9 52.6 62.1 57.9 58.9 55.8 56.8 strain Marna (Case #2) Umbre orthobunyavirus 61.1 61.1 64.2 62.1 57.9 57.9 52.6 62.1 57.9 58.9 55.8 56.8 strain Moissiacense (Case #1) Kowanyama virus 67.4 64.2 72.6 67.4 71.6 61.1 67.4 66.3 66.3 64.2 65.3 61.1 Yacaaba virus 69.5 68.4 74.7 72.6 70.5 64.2 64.2 61.1 63.2 61.1 61.1 62.1 Caraparu virus 61.1 62.1 67.4 62.1 61.1 63.2 66.3 61.1 60.0 61.1 62.1 56.8 Madrid virus 62.1 62.1 67.4 64.2 62.1 62.1 66.3 60.0 61.1 62.1 61.1 55.8 Murrumbidgee virus 51.6 50.5 53.7 53.7 47.4 49.5 50.5 56.8 51.6 52.6 50.5 52.6 Salt ash virus 58.9 54.7 53.7 55.8 51.6 52.6 50.5 53.7 54.7 54.7 52.6 55.8 Herbert virus 45.8 47.9 51.0 47.9 44.8 43.8 41.7 44.8 44.8 46.9 42.7 40.6 Wyeomyia Culex Culex Culex Culex ortho- pipiens pipiens pipiens pipiens Sororoca Macaua bunya- Chatanga La Crosse Tahyna France France France France Koongol virus virus virus virus virus virus (C2) (F2) (G2) (C9) virus Aino virus 62.1 58.9 61.1 65.3 65.3 65.3 52.6 52.6 52.6 51.6 54.7 Akabane virus 58.9 55.8 61.1 60.0 64.2 62.1 57.9 57.9 57.9 56.8 62.1 Schmallenberg virus 61.1 58.9 62.1 68.4 68.4 68.4 57.9 57.9 57.9 56.8 58.9 Simbu orthobunyavirus 55.8 61.1 58.9 65.3 64.2 64.2 55.8 55.8 55.8 55.8 52.6 Oropouche virus 57.9 58.9 56.8 66.3 68.4 68.4 57.9 57.9 57.9 56.8 57.9 Oya virus 57.9 54.7 61.1 61.1 60.0 61.1 55.8 55.8 55.8 54.7 57.9 Leanyer virus 61.1 65.3 66.3 67.4 67.4 66.3 50.5 50.5 50.5 50.5 52.6 Batai virus 69.5 64.2 68.4 70.5 68.4 69.5 57.9 57.9 57.9 56.8 63.2 Bunyamwera virus 68.4 72.6 70.5 70.5 71.6 71.6 51.6 51.6 51.6 51.6 54.7 Ilesha virus 67.4 71.6 68.4 69.5 71.6 70.5 53.7 53.7 53.7 53.7 56.8 Cache Valley virus 66.3 66.3 70.5 71.6 70.5 72.6 52.6 52.6 52.6 52.6 56.8 Iaco virus 89.5 84.2 82.1 62.1 62.1 64.2 57.9 57.9 57.9 56.8 58.9 Sororoca virus 80.0 80.0 64.2 64.2 66.3 54.7 54.7 54.7 53.7 62.1 Macaua virus 80.0 85.3 63.2 64.2 65.3 52.6 52.6 52.6 52.6 53.7 Wyeomyia 80.0 85.3 67.4 66.3 69.5 55.8 55.8 55.8 54.7 56.8 orthobunyavirus Chatanga virus 64.2 63.2 67.4 92.6 93.7 57.9 57.9 57.9 56.8 58.9 La Crosse virus 64.2 64.2 66.3 92.6 92.6 58.9 58.9 58.9 57.9 61.1 Tahyna virus 66.3 65.3 69.5 93.7 92.6 58.9 58.9 58.9 57.9 58.9 Culex pipiens 54.7 52.6 55.8 57.9 58.9 58.9 100.0 100.0 98.9 83.2 France (C2) Culex pipiens 54.7 52.6 55.8 57.9 58.9 58.9 100.0 100.0 98.9 83.2 France (F2) Culex pipiens 54.7 52.6 55.8 57.9 58.9 58.9 100.0 100.0 98.9 83.2 France (G2) Culex pipiens 53.7 52.6 54.7 56.8 57.9 57.9 98.9 98.9 98.9 82.1 France (C9) Koongol virus 62.1 53.7 56.8 58.9 61.1 58.9 83.2 83.2 83.2 82.1 Little Sussex virus 55.8 55.8 60.0 60.0 60.0 60.0 76.8 76.8 76.8 75.8 77.9 Umbre virus strain 55.8 55.8 60.0 60.0 60.0 60.0 76.8 76.8 76.8 75.8 77.9 IG1424 Umbre orthobunyavirus 55.8 55.8 60.0 60.0 60.0 60.0 76.8 76.8 76.8 75.8 77.9 strain Marna (Case #2) Umbre orthobunyavirus 55.8 55.8 60.0 60.0 60.0 60.0 76.8 76.8 76.8 75.8 77.9 strain Moissiacense (Case #1) Kowanyama virus 62.1 62.1 62.1 73.7 74.7 74.7 60.0 60.0 60.0 58.9 61.1 Yacaaba virus 63.2 65.3 65.3 67.4 69.5 70.5 57.9 57.9 57.9 56.8 57.9 Caraparu virus 55.8 61.1 62.1 63.2 63.2 64.2 51.6 51.6 51.6 51.6 53.7 Madrid virus 54.7 62.1 61.1 62.1 64.2 63.2 52.6 52.6 52.6 52.6 54.7 Murrumbidgee virus 51.6 51.6 48.4 52.6 53.7 53.7 54.7 54.7 54.7 54.7 53.7 Salt ash virus 56.8 52.6 50.5 54.7 56.8 56.8 53.7 53.7 53.7 52.6 56.8 Herbert virus 40.6 39.6 39.6 44.8 44.8 45.8 43.8 43.8 43.8 43.8 40.6 Umbre Umbre Umbre orthobunya- orthobunya- Little virus virus strain virus strain Murrum- Salt Sussex strain Marna Moissiacense Kowanyama Yacaaba Caraparu Madrid bidgee ash Herbert virus IG1424 (Case #2) (Case #1) virus virus virus virus virus virus virus Aino virus 61.1 61.1 61.1 61.1 67.4 69.5 61.1 62.1 51.6 58.9 45.8 Akabane virus 61.1 61.1 61.1 61.1 64.2 68.4 62.1 62.1 50.5 54.7 47.9 Schmallenberg virus 64.2 64.2 64.2 64.2 72.6 74.7 67.4 67.4 53.7 53.7 51.0 Simbu orthobunyavirus 62.1 62.1 62.1 62.1 67.4 72.6 62.1 64.2 53.7 55.8 47.9 Oropouche virus 57.9 57.9 57.9 57.9 71.6 70.5 61.1 62.1 47.4 51.6 44.8 Oya virus 57.9 57.9 57.9 57.9 61.1 64.2 63.2 62.1 49.5 52.6 43.8 Leanyer virus 52.6 52.6 52.6 52.6 67.4 64.2 66.3 66.3 50.5 50.5 41.7 Batai virus 62.1 62.1 62.1 62.1 66.3 61.1 61.1 60.0 56.8 53.7 44.8 Bunyamwera virus 57.9 57.9 57.9 57.9 66.3 63.2 60.0 61.1 51.6 54.7 44.8 Ilesha virus 58.9 58.9 58.9 58.9 64.2 61.1 61.1 62.1 52.6 54.7 46.9 Cache Valley virus 55.8 55.8 55.8 55.8 65.3 61.1 62.1 61.1 50.5 52.6 42.7 Iaco virus 56.8 56.8 56.8 56.8 61.1 62.1 56.8 55.8 52.6 55.8 40.6 Sororoca virus 55.8 55.8 55.8 55.8 62.1 63.2 55.8 54.7 51.6 56.8 40.6 Macaua virus 55.8 55.8 55.8 55.8 62.1 65.3 61.1 62.1 51.6 52.6 39.6 Wyeomyia 60.0 60.0 60.0 60.0 62.1 65.3 62.1 61.1 48.4 50.5 39.6 orthobunyavirus Chatanga virus 60.0 60.0 60.0 60.0 73.7 67.4 63.2 62.1 52.6 54.7 44.8 La Crosse virus 60.0 60.0 60.0 60.0 74.7 69.5 63.2 64.2 53.7 56.8 44.8 Tahyna virus 60.0 60.0 60.0 60.0 74.7 70.5 64.2 63.2 53.7 56.8 45.8 Culex pipiens 76.8 76.8 76.8 76.8 60.0 57.9 51.6 52.6 54.7 53.7 43.8 France (C2) Culex pipiens 76.8 76.8 76.8 76.8 60.0 57.9 51.6 52.6 54.7 53.7 43.8 France (F2) Culex pipiens 76.8 76.8 76.8 76.8 60.0 57.9 51.6 52.6 54.7 53.7 43.8 France (G2) Culex pipiens 75.8 75.8 75.8 75.8 58.9 56.8 51.6 52.6 54.7 52.6 43.8 France (C9) Koongol virus 77.9 77.9 77.9 77.9 61.1 57.9 53.7 54.7 53.7 56.8 40.6 Little Sussex virus 100.0 100.0 100.0 60.0 56.8 55.8 56.8 54.7 54.7 40.6 Umbre virus strain 100.0 100.0 100.0 60.0 56.8 55.8 56.8 54.7 54.7 40.6 IG1424 Umbre orthobunyavirus 100.0 100.0 100.0 60.0 56.8 55.8 56.8 54.7 54.7 40.6 strain Marna (Case #2) Umbre orthobunyavirus 100.0 100.0 100.0 60.0 56.8 55.8 56.8 54.7 54.7 40.6 strain Moissiacense (Case #1) Kowanyama virus 60.0 60.0 60.0 60.0 72.6 65.3 66.3 52.6 55.8 47.9 Yacaaba virus 56.8 56.8 56.8 56.8 72.6 62.1 62.1 55.8 54.7 46.9 Caraparu virus 55.8 55.8 55.8 55.8 65.3 62.1 97.9 50.5 53.7 43.8 Madrid virus 56.8 56.8 56.8 56.8 66.3 62.1 97.9 50.5 53.7 43.8 Murrumbidgee virus 54.7 54.7 54.7 54.7 52.6 55.8 50.5 50.5 61.3 37.5 Salt ash virus 54.7 54.7 54.7 54.7 55.8 54.7 53.7 53.7 61.3 43.8 Herbert virus 40.6 40.6 40.6 40.6 47.9 46.9 43.8 43.8 37.5 43.8