METHODS AND COMPOSITIONS FOR NONINVASIVE PRENATAL DIAGNOSIS THROUGH TARGETED COVALENT LABELING OF GENOMIC SITES

20230151409 · 2023-05-18

    Inventors

    Cpc classification

    International classification

    Abstract

    This invention relates to a method that covalently modifies unmodified and hydroxymethylated genomic sites in fetal specific genetic material present in maternal blood DNA samples and produce the adjacent genomic regions for detecting fetal aneuploidies and fetal gender using quantitative real time PCR or sequencing. A large panel of differently labeled sites and regions between maternal and fetal genetic material has been identified and they validity for diagnostic purposes of fetal trisomy of chromosome 21 has been demonstrated.

    Claims

    1. (canceled)

    2. (canceled)

    3. (canceled)

    4. (canceled)

    5. (canceled)

    6. (canceled)

    7. (canceled)

    8. (canceled)

    9. (canceled)

    10. (canceled)

    11. (canceled)

    12. A method for prenatal diagnosis of a trisomy 21 and/or fetal gender using a sample of isolated cfDNA, the method comprising: a) enzymatic covalent labeling of nucleic acid molecules of the sample of isolated cfDNA at unmodified CG, uCG, sites with eM.Sssl methyltransferase or hydroxymethylated CG, hmCG, sites with beta-glucosyltransferase and derivatization of said labels with DNA oligonucleotide (ODN); b) measuring the level of the labeled CG-containing regions of the sample of isolated cfDNA at one or more regions of chromosomal DNA from the human genome shown in Tables 4, 5, and 6; c) comparing the measured level of the labeled CG-containing regions of step b) to a standard reference value of at least one region from Table 4, 5, or 6.

    13. The method of claim 12, comprising diagnosing a trisomy based on said comparison of step c), wherein trisomy 21 is diagnosed if the measured level of the labeled CG-containing regions of step b) is (i) higher than the standard reference value from a woman bearing a fetus without trisomy 21; or (ii) lower than the standard reference value from a woman bearing a fetus without trisomy 21; or (iii) comparable to the standard reference value from a woman bearing a fetus with trisomy 21.

    14. The method of claim 12, comprising detecting fetal gender based on said comparison of step c), wherein female gender of a fetus is detected if the measured level of the labeled CG-containing regions of step b) is comparable to the standard reference value from a woman bearing a female fetus, and male gender of a fetus is detected if the measured level of the regions of step b) is comparable to the standard reference value from a woman bearing a male fetus.

    15. The method of claim 12, wherein the levels of the labeled CG-containing regions in the sample of isolated cfDNA are measured by real time quantitative polymerase chain reaction (qPCR).

    16. The method of claim 12, wherein the level of at least one labeled CG from any labeled CG-containing region shown in Tables 4, 5 and 6 is measured by qPCR.

    17. The method of claim 12, further comprising producing nucleic acid molecules from the labeled CG-containing regions using a nucleic acid polymerase which contacts the labeled nucleic acid sequence at or around the site of the labeled uCG or hmCG; wherein polymerization starts from the 3′-end of an oligonucleotide primer non-covalently attached to the ODN of the labeled CG-containing region of the sample of isolated cfDNA; for further amplification of labeled CG-containing regions of the sample of isolated cfDNA, an oligonucleotide primer non-covalently attached to the ODN and yet another oligonucleotide primer that binds to the one strand of an adapter sequence attached to the labeled CG-containing regions through ligation-mediated PCR are used to obtain a sample enriched in unmodified or hydroxymethylated DNA.

    18. The method of claim 12, further comprising producing nucleic acid molecules from the labeled CG-containing regions of the sample of isolated cfDNA using a nucleic acid polymerase which contacts the labeled CG-containing regions at or around the site of labeled uCG or hmCG; wherein polymerization starts from the 3′-end of a primer non-covalently attached to the ODN of the labeled CG-containing regions and partially to genomic nucleotides near the labeled CG sites and another primer binds to genomic region near the labeled CG sites.

    19. The method of claim 17, wherein the levels of the labeled CG-containing regions in the sample of isolated cfDNA are measured by real time quantitative polymerase chain reaction (qPCR) or sequencing.

    20. The method of claim 17, wherein one or more sets of oligonucleotide primers selected from SEQ ID 1-18 are used.

    21. A kit comprising the oligonucleotide primers of claim 20 and an enzyme for uCG and hmC labeling for covalent labeling and enrichment of uCG and hmC sites.

    22. The kit of claim 21, further comprising DNA oligonucleotide (ODN) for derivatization of the labeled uCG and hmC sites.

    23. The kit of claim 21, which further comprises oligonucleotide adaptors and oligonucleotide primers for the ODN-directed and in part by ligation mediated amplification of the labeled regions.

    24. The method of claim 18, wherein the levels of the labeled CG-containing regions in the sample of isolated cfDNA are measured by real time quantitative polymerase chain reaction (qPCR) or sequencing.

    25. The method of claim 18, wherein one or more sets of oligonucleotide primers selected from SEQ ID 1-18 are used.

    26. A kit comprising the oligonucleotide primers of claim 25 and an enzyme for uCG and hmC labeling for covalent labeling and enrichment of uCG and hmC sites.

    27. The kit of claim 26, further comprising DNA oligonucleotide (ODN) for derivatization of the labeled uCG and hmC sites.

    Description

    BRIEF DESCRIPTION OF DRAWINGS

    [0020] FIG. 1 is a diagram of the methodology for identification of Differentially Labeled Regions (DLRs) across chromosome 21 (or chromosomes 13 and 18) comparing the two tissue pairs: chorionic villi tissue DNA of the 1st trimester fetuses and fractionated peripheral blood DNA samples of non-pregnant controls and fractionated peripheral blood DNA samples of non-pregnant female and pregnant female carrying a healthy fetus from the 1st trimester pregnancies. Further strategy for area under curve (AUC) determination for diagnosing T21-affected fetuses is also shown.

    [0021] FIG. 2 shows the difference in (a) uCG and (b) hmCG signal for the exemplary DLRs (tissue-specific u-DLR chr21:33840400-33840500; pregnancy-specific u-DLR chr21:33591700-33591800; tissue-specific hm-DLR chr21:35203200-35203300; pregnancy-specific hm-DLR chr21:43790900-43791000, selected from Tables 4 or 5) identified in chromosome 21 between chorionic villi tissue DNA of the 1st trimester fetuses and fractionated peripheral blood DNA samples of non-pregnant controls; and between fractionated peripheral blood DNA samples of non-pregnant female and pregnant female carrying a healthy fetus from the 1st trimester pregnancies (left panel). For diagnosing purposes of trisomy 21, the signal intensity across the exemplary DLRs is also shown for the samples of pregnant female carrying T21-diagnosed fetuses from the 1st trimester pregnancies (right panel).

    [0022] FIG. 3 shows the difference in (a) uCG and (b) hmCG signal for the exemplary DLRs (u-DLR chr21:43933400-43933500; hm-DLR chr21:36053400-36053500; selected from the Tables 4 or 5) identified in chromosome 21 between fractionated peripheral blood DNA samples of pregnant female carrying a healthy fetus or a T21 diagnosed fetus from the 1st trimester pregnancies.

    [0023] FIG. 4 shows the difference in mean signal of labeled individual CG-DLRs, namely, (a) u-CG-DLRs and (b) hm-CG-DLRs (selected from Table 6) in chromosome 21 for detection of fetal T21 aneuploidy.

    [0024] FIG. 5 shows the difference in mean signal of labeled individual CG-DLRs, namely u-CG-DLRs (selected from Table 6) in chromosome X for fetal gender determination. Samples from pregnant women and fetal CV tissue were labeled either XX or XY according to the gender of a fetus, Female and Male, respectively. Samples from non-pregnant women, NPC, were labeled as None, 00.

    [0025] FIG. 6 shows the relative quantification of individual or a combination of (a) u-CG-DLRs and (b) hm-CG-DLRs of fetal specific DNA regions located on chromosome 21 using real time quantitative PCR for replicated DNA samples of peripheral blood plasma DNA of women pregnant with healthy or T21-diagnosed fetuses. Y-axis indicates the threshold cycle values (C.sub.T) calculated in qPCR for the regions selected from Table 6 whose genome coordinates are shown above the graphs. Notably, numerical values of C.sub.T inversely correlate to the abundance of the DLR region, indicating higher abundance of the region in the blood samples of pregnant female carrying a T21-diagnosed fetus.

    [0026] FIGS. 7a and b show simulation of a PCR-based test for fetal gender determination by measuring DNA methylation differences in (a) chromosome X or (b) chromosome Y, according to the scheme shown in FIG. 8c. DNA of the 1st trimester CV tissue of both genders was mixed with nonpregnant female peripheral blood plasma DNA to the ratio 20/80 or 0/100, respectively, and the difference in the threshold cycle was evaluated by qPCR. ΔC.sub.T indicates the difference in the threshold cycle values between the mixtures using the CV samples of both genders (indicated as XX and XY for female and male genders, respectively). FIG. 7c shows relative quantification of fetal specific DNA regions located on chromosome X for fetal gender determination using qPCR for the replicated DNA samples of untreated, i.e. non-preamplified, pregnant female peripheral blood plasma, according to the scheme shown in FIG. 8c.

    [0027] FIG. 8 is a schematic illustration of the analytical approach for calculation of DLRs using labeling and enrichment of unmodified CG or hydroxymethylated CG sites coupled with analysis by (a) real time quantitative PCR of pre-amplified samples; (b) sequencing of labeled CGs; (c) real time quantitative PCR of non-preamplified DNA samples, of fractionated peripheral blood DNA of pregnant female. ODN—the attached deoxyribonucleotide, A1/A2—the two strands of the ligated to DNA fragments partially complementary adaptors.

    [0028] FIG. 9 shows the difference in (a) uCG and (b) hmCG signal for the exemplary DLRs (selected from Table 7; the genomic coordinates are shown above the graphs) identified for chromosome 13 and chromosome 18 between CV tissue DNA of the 1st trimester fetuses and fractionated peripheral blood DNA samples of non-pregnant controls; and between fractionated peripheral blood DNA samples of non-pregnant female and pregnant female carrying a healthy fetus from the 1st trimester pregnancies.

    [0029] FIG. 10 shows the relative quantification of (a) u-CG-DLRs and (b) hm-CG-DLRs of T21 fetal-specific DNA regions located on chromosome 21 using real time quantitative PCR for an independent group of peripheral blood plasma DNA samples of women pregnant with healthy or T21-diagnosed fetuses. Y-axis indicates the threshold cycle values (C.sub.T) calculated in qPCR for the regions selected from Table 6.

    DESCRIPTION OF EMBODIMENTS

    [0030] In the present embodiment, the method comprises the measurement of the presence or availability of the target CG sites in the template nucleic acid molecules by sequencing of the amplified nucleic acid molecules of the biological sample, such that only the sequence of the targeted CGs and hence the unmodified/hydroxymethylated fraction of CGs is determined. In this embodiment, amplification prior to sequencing is performed through the ODN-directed and ligation-mediated PCR using one primer bound complementary to the ODN or a part of it in the absence of complementarity to the genomic template region, and the second primer bound through non-covalent complementary base pairing to oligonucleotide linkers ligated to both ends of the template nucleic acid molecule. In another aspect of this embodiment, amplification prior to sequencing can be performed by targeted PCR amplification utilizing one primer bound complementary to the ODN or a part of it in the presence (5-7 nucleotides complementarity to the genomic template DNA in the proximity of a CG site) or absence of complementarity to the genomic template DNA, and the second primer bound through non-covalent complementary base pairing to the template DNA in the chromosomal regions shown in Tables 4 or 5 or 6 or 7.

    [0031] In further embodiments, the method comprises the measurement of the presence or availability of the labeled target sites and hence the level of the unmodified or hydroxymethylated template nucleic acid molecules by real time quantitative polymerase chain reaction (qPCR) of the enriched fetal CGs and DNA regions, which have been previously covalently targeted and pre-amplified using attached ODN as described above, utilizing one primer with its 5′ end bound complementary to the chromosomal regions shown in Tables 4-7 in the very close vicinity (its 5′ end binds at or more than 5 nucleotides to a labeled CG site) to the labeled cytosine, and the second primer bound complementary to the template DNA in the selected chromosomal regions shown in Tables 4 or 5 or 6 or 7.

    [0032] In yet another aspect, the method comprises the measurement of the presence or availability of the labeled target sites and hence the level of the unmodified or hydroxymethylated template nucleic acid molecules in a non-preamplified DNA sample by real time quantitative polymerase chain reaction, utilizing one primer that recognizes and binds to the ODN and 5-7 nucleotides adjacent to the target CG site in a template genomic DNA through non-covalent complementary base pairing, and a second primer binds complementary to the template DNA in the selected chromosomal regions shown in Tables 4 or 5 or 6 or 7.

    [0033] In the preferred embodiment of the invention, the plurality of differentially labeled regions (DLRs) preferably is chosen from the lists shown in Tables 4-7. In various embodiments, the levels of the plurality of DLRs are determined for at least one DLR, for example chosen from the lists shown in Tables 4-7. Preferably, the levels of the plurality of DLRs in the labeled DNA sample are determined by real time quantitative polymerase chain reaction (qPCR). As used herein, the term “a plurality of DLRs” is intended to mean one or more DLRs (or CG dinucleotides).

    [0034] In a further aspect, the present invention pertains to a kit, comprising the composition of the invention. In other embodiments, the kit further comprises:

    (a) an enzyme capable of covalent derivatization of the cytosine base with an active group, preferentially an azide group;
    (b) a compound comprising the active group (an azide group);
    (c) an ODN attached to the second reactive group, preferably an alkyne group; and
    (d), oligonucleotide primers (e.g., two or more) for assessment of DLR regions through PCR amplification, wherein one primer binds to the ODN or in the close vicinity to the ODN attachment site through non-covalent complementary base pairing and is able to prime a nucleic acid polymerization reaction from the labeled CG and the second primer binds to the genomic regions described in Tables 4-7;
    (e) in another embodiment, the kit can further comprise oligonucleotide linkers for ligation and/or oligonucleotide primers for PCR amplification of the nucleic acid molecules to be analyzed by qPCR or sequencing.

    DETAILED DESCRIPTION OF THE INVENTION

    [0035] The present invention is based, at least in part, on the inventors' identification of a large panel of differentially labeled regions (DLRs) and CGs (CG-DLRs) that exhibit strong labeling in fetal DNA and weak or absence of labeling in maternal DNA. Still further, the invention is based, at least in part, on the inventors' demonstration that hypomethylated/hydroxymethylated fetal DNA can be specifically targeted and enriched through covalent modification of CGs, thereby resulting in a sample enriched for fetal DNA. Still further, the inventors have accurately diagnosed trisomy 21 and fetal gender in a panel of maternal peripheral blood samples using representative examples of the DLRs disclosed herein, thereby demonstrating the effectiveness of the identified DLRs and disclosed methodologies in diagnosing fetal aneuploidy T21 and fetal gender.

    [0036] Various aspects of this disclosure are described in further detail in the following subsections.

    [0037] I. A Method for Non-Invasive Detection of Fetal Aneuploidy T21 and Fetal Gender

    [0038] Accordingly, the invention pertains to a method for prenatal diagnosis of a trisomy 21, and fetal gender using a sample of maternal blood, the method comprising:

    (a) enzymatic labeling of uCG or hmC sites of nucleic acid molecules in a sample of maternal blood with a reactive azide group;
    (b) chemically tethering of an oligodeoxyribonucleotide (ODN) having an alkyne group to the introduced azide groups in a template nucleic acid;
    (c) producing nucleic acid molecules from a template nucleic acid sequence starting at the azide-labeled CG sites through PCR amplification;
    (d) determining the labeling intensity level of unmodified or hydroxymethylated template genomic nucleic acid molecules across the regions or CG sites of chromosomal DNA shown in Tables 4 or 5, or 6 using, preferably qPCR, or sequencing of labeled genomic fraction;
    (e) comparing the experimentally acquired value of the regions of step (d) to a standard reference value for the combination of at least one region, or at least two regions from the list shown in Tables 4-6, wherein the standard reference value is (i) a value for a DNA sample from a woman bearing a fetus without trisomy 21; or (ii) a value for a DNA sample from a woman bearing a fetus with trisomy 21.
    (f) diagnosing a trisomy 21 based on said comparison, wherein trisomy 21 is diagnosed if the experimentally acquired value of the sample is (i) higher than the standard reference value from a woman bearing a fetus without trisomy 21; or (ii) lower than the standard reference value from a woman bearing a fetus without trisomy 21; or (iii) comparable to the standard reference value from a woman bearing a fetus with trisomy 21.

    [0039] A schematic illustration of the analytical approach for evaluation of labeling intensity in DLRs using labeling and enrichment of unmodified or hydroxymethylated CGs is demonstrated in FIG. 8.

    [0040] II. Labeling of Unmodified or Hydroxymethylated CG Sites

    [0041] Methods for the first step of covalent derivatization of genomic DNA sites are known in the art. Covalent labeling of genomic uCG or hmC sites can be performed using an enzyme capable of transfer of a covalent group onto genomic DNA. The enzyme may comprise a methyltransferase or a glucosyltransferase.

    [0042] An enzyme for covalent labeling of uCG sites is preferably the C5 DNA methyltransferase M.Sssl or a modified variant of it, such as M.Sssl variant Q142A/N370A (Kriukiene et al., 2013; Stasevskij et al, 2017) which is adapted to work with synthetic cofactors, such as Ado-6-azide cofactor (Kriukiene et al., 2013; Masevicius et al., 2016).

    [0043] An enzyme for covalent labeling of hmC/hmCG sites is preferably the phage T4 beta-glucosyltransferase (BGT) which is adapted to work with synthetic cofactors, such as UDP-6-azidoglucose (Song et al, 2011).

    [0044] The ODN is preferably from 20 to 90 nucleotides in length, as shown in the exemplary embodiment preferably 39 nt. The ODN contains the reactive group at the second base position from its 5′-end, preferably the alkyne group, which reacts with the azide group which was enzymatically introduced in a template nucleic acid molecule.

    [0045] It should be noted that DNA after covalent labeling becomes enzymatically and chemically altered but preserves base specificity. As used herein, the term “enzymatically altered” is intended to mean reacting the DNA with an enzymatically transferred chemical group that enables the conversion of respective CG sites into the azide-CG sites, giving discrimination of the labeled sites from template CGs. As used herein, the term “chemically altered” is intended to mean enzymatic transformation of template cytosine into the azide-modified cytosine in CG sites. Thus, in the instant method the fetal specific regions are calculated between more intensively and less intensively labeled CG sites in DNA without the need to directly determine methylation or hydroxymethylation levels of template DNA. Furthermore, in the instant method, the DNA of the maternal blood sample is not subjected to sodium bisulfite conversion or any other similar chemical reactions that alter base specificity, such as sodium bisulfite conversion, nor the maternal blood sample is treated with a methylation-sensitive restriction enzyme(s) or through direct or indirect immunoprecipitation to enrich for a portion of maternal blood sample DNA.

    [0046] Alternatively, the ODN-derivatized template DNA can be enriched on solid surfaces using an affinity tag that is introduced in the composition of the ODN. A useful affinity tag preferably is but not restricted to the biotin and can be used in the methods of the present invention. In this aspect, the invention includes an additional step of separating maternal nucleic acid sequences on a solid surface, for example on streptavidin/avidin beads, thereby further enriching for nucleic acid molecules containing labeled CG sites. Other approaches known in the art for physical separation of components can be also used. The captured DNA is to be used for further analysis without detachment or can be detached from beads in mild conditions, such as, for example pure water and heating to 95° C. for 5 min.

    [0047] III. Producing of Template Nucleic Acid Molecules from the Site of Covalent Labeling

    [0048] In the diagnostic method, a nucleic acid polymerase primes polymerization of the template nucleic acid at or around the site of labeling using the 3′-end of an externally added primer which is non-covalently attached to the ODN. Non-covalent bonding preferably involves base pairing interaction between the ODN and the externally added primer. In the preferred embodiments shown in FIGS. 8a and b, the structure of the ODN permits correct positioning of the externally added primer to the template at the site of the ODN attachment; the primer should be complementary to the sequence of the ODN while should not make any complimentary base pairing with the template nucleic acid at its 3′-end. In yet another aspect, shown in FIG. 8c the primer at its 5′-end should be complementary to the sequence of the ODN while its 3′-end should make complementary base pairing with preferably at least 5 nucleotides and not more than 7 nucleotides of the template nucleic acid that are adjacent to the site of the attached ODN.

    [0049] In the diagnostic method, typically after tagging of CGs in the maternal blood sample with the ODN, the tagged CGs and adjacent template nucleic acid are pre-amplified starting from the site of the attachment of the ODN. As used herein, the term “pre-amplified” is intended to mean that additional copies of the DNA are made to thereby increase the number of copies of the DNA, which is typically accomplished using the polymerase chain reaction (PCR).

    [0050] In the preferred embodiment, the experimentally acquired value for the presence or availability of labeled CG that were tagged with the ODN in the maternal blood sample can be acquired by amplification of the DNA molecules starting from the tagged CG sites using the ODN-directed and partially ligation mediated (LM-PCR) polymerase chain reaction. The skilled person will be well aware of suitable methods for ligating adaptor sequences to the DNA fragments. In LM-PCR of the present invention, an adaptor nucleic acid sequences are added onto both ends of each DNA fragments through preferably sticky end or blunt-end ligation, wherein each strand of an adaptor sequences is capable of hybridizing with a primer for PCR, thereby amplifying the DNA fragments to which the linkers have been ligated. In this aspect of the present invention, only one strand of the ligated partially complementary double-stranded adaptor sequence is used to anchor a primer for amplification of the labeled template DNA strand as shown in FIG. 8b. The second primer binds to the ODN sequence through complementary base pairing without contacts to the template DNA. The externally added primer should be at least 10 nucleotides and preferably at least 15 nucleotides in order to allow for a section of a primer to be involved in base pairing with the ODN without the complementary base pairing with the template DNA. This results in amplification of the labeled strands of nucleic acid samples, but not the original DNA fragment to which the adaptor sequences were ligated. In a preferred embodiment, the values of the amplified sequences are determined through real time quantitative polymerase chain reaction using oligonucleotide primers annealing within the regions shown in Tables 4, 5, 6 or 7 in the close vicinity to the labeled CGs as shown in FIG. 8a. Methods of qPCR are well known in the art. Representative, non-limiting conditions for qPCR are given in the Examples.

    [0051] Yet, alternatively, the values of the amplified sequences, or DLRs, are determined through massive parallel sequencing. In this aspect of the embodiments, one strand of the ligated double-stranded adaptor sequence is used to anchor a primer for amplification of the labeled template DNA strand as shown in FIG. 8b. The second primer binds to the ODN sequence through complementary base pairing without contacts to the template DNA. Following PCR amplification, the values of the amplified sequences are determined through sequencing. This is only one exemplification of the presently described strategy for estimation of labeled nucleic acid through sequencing. In yet another aspect, the sub-fraction of the derivatized maternal sample DNA is selectively enriched through targeted PCR amplification prior to sequencing. Such PCR amplification makes use one primer bound complementary to the ODN or a part of it in the presence (5-7 nucleotide complementarity right at the target sites) or absence of complementarity to the template DNA, and the second primer bound through non-covalent complementary base pairing to the template DNA in the chromosomal regions shown in Tables 4-7.

    [0052] In another embodiment of the invention, the experimentally acquired value for the presence or availability of labeled CG is estimated through qPCR, in a maternal blood sample that has not been subjected to adaptor ligation or pre-amplification, as shown in FIG. 8c. In this aspect, one primer to be used in qPCR hybridizes complementarily to the ODN altogether with 5-7 nucleotides of genomic template DNA near the derivatized CG site as described above and the second primer binds within the genomic DNA positions listed in Tables 4-7.

    [0053] IV. Differentially Labeled Regions (DLRs).

    [0054] The diagnostic method of the invention employs a plurality of regions of chromosomal DNA wherein the regions are more intensively labeled in fetal DNA as compared to female peripheral blood samples. In theory, any chromosomic region with the above characteristics can be used in the instant diagnostic method. In particular, methods for identifying such DLRs are described in detail below and in the Examples (see Examples 1 and 2). Moreover, a large panel of DLRs for chromosomes 21, 13 and 18 suitable for use in the diagnostic methods, has now been identified (the strategy for identification of DLRs is shown in FIG. 1).

    [0055] Furthermore, representative examples of a subset of these DLRs (4175 tissue-specific u-DLRs; 163 pregnancy-specific u-DLRs; 8815 tissue-specific hm-DLRs, 679 pregnancy-specific hm-DLRs) have been used to accurately predict trisomy 21, in a method based on analysis of fetal-specific DLRs in chromosome 21 by sequencing of labeled CG sites in a maternal blood sample. We also evaluated labeling differences between maternal blood samples of healthy and T21 positive pregnancies and identified 3,490 u-DLRs and 2,002 hm-DLRs which are shown in Tables 4 and 5, respectively. The effectiveness of the disclosed regions and methodologies for diagnosing fetal aneuploidy T21 has been demonstrated in FIGS. 2 and 3. Such DLRs are shown in the lists of Tables 4 and 5, which provide the selected DLRs for chromosome 21.

    [0056] According to the second exemplary embodiment, DLRs restricted to individual CGs (CG-DLRs) have been identified in chromosomes 21 and X. Representative examples of a subset of these DLRs have been used to accurately predict trisomy 21, in a method based on analysis of fetal-specific hypomethylated or hyper-hydroxymethylated CG-DLRs in chromosome 21 by sequencing of labeled CG sites in a sample of maternal blood. Also, representative examples of a subset of these CG-DLRs have been used to accurately predict fetal gender, in a method based on analysis of fetal-specific CG-DLRs in chromosome X by sequencing of labeled CG sites in a sample of maternal blood. The effectiveness of the disclosed DLRs and methodologies for determination T21 aneuploidy and fetal gender has been demonstrated in FIG. 4 and FIG. 5. The list of DLRs is shown in Table 6.

    [0057] In the third exemplary embodiment, representative examples of a subset of the CG-DLRs have been used to accurately predict trisomy 21 and fetal gender, in a method based on analysis of fetal-specific DLRs in chromosome 21 and chromosome X and/or Y in a sample of maternal blood by qPCR. Thus, the effectiveness of the disclosed regions and methodologies for diagnosing trisomy 21 and fetal gender has been demonstrated in FIG. 6 and FIG. 7.

    [0058] In other methods for detecting a fetal aneuploidy, the plurality of DLRs may be on chromosome 13, chromosome 18, to allow for diagnosis of aneuploidies of any of these chromosomes. In theory, any DMR with the above characteristics in a chromosome of interest can be used in the instant diagnostic method. Methods for identifying such DLRs in chromosome 13 and chromosome 18 are described in Example 1 and the effectiveness of the disclosed regions has been demonstrated in FIG. 9. The lists of selected DLRs for chromosomes 13 and 18 are provided in Table 7.

    [0059] As used herein, the term “a plurality of DLRs” is intended to mean one or more regions or DLRs, selected from the list shown in Table 4-7. In various embodiments, the levels of the plurality of DLRs are determined for at least one region. Control regions or control DLRs also can be used in the diagnostic methods of the invention as a reference for evaluation of the labeled signal in the DLR region(s) of interest.

    [0060] In a particularly preferred embodiment, the plurality of DLRs on chromosome 21 comprise one region or a combination of at least two regions, selected from the group shown in Table 6.

    [0061] The invention also pertains to a composition comprising nucleic acid probes that selectively detect DLRs shown in Table 6.

    [0062] The actual nucleotide sequence of any of the DLRs shown in Tables 4-7 is obtainable from the information provided herein together with other information known in the art. More specifically, each of the DLRs shown in Tables 4-7 is defined by a start base position on a particular chromosome, such as, for example “position 10774500” of chromosome 21. Furthermore, primers for targeted detection and/or amplification of a DLR can then be designed, using standard molecular biology methods, based on the nucleotide sequence of the DLR.

    [0063] In another aspect, the invention provides nucleic acid compositions that can be used in the methods and kits of the invention. These nucleic acid compositions are informative for detecting DLRs. As described in detail in Example 3, at least one CG-DLR shown in Table 6 has been selected and identified as being sufficient to accurately diagnose trisomy 21 in a maternal blood sample during pregnancy of a woman bearing a trisomy 21 fetus.

    [0064] V. Determining Levels of DLRs.

    [0065] Labeling levels of the identified DLRs can be measured by sequencing or by qPCR.

    [0066] Labeling levels of a plurality of regions as described above are determined in the unmethylated or hydroxymethylated DNA sample, to thereby obtain a labeling value for the DNA sample. As used herein, the term “the levels of the plurality of DLRs are determined” is intended to mean that the prevalence of the DLRs is determined. The basis for this is that in a fetus with a fetal trisomy 21 there will be a larger amount of the DLRs as a result of the trisomy 21, as compared to a normal fetus. In another aspect, when the T21-specific DLR are being used, the amount of such DLRs can be larger or lesser then the amount in a fetus without a fetal trisomy 21.

    [0067] In a preferred embodiment, the levels of the plurality of DLRs are determined by real time quantitative polymerase chain reaction (qPCR), a technique well-established in the art. The term “the labeling value” is intended to encompass any quantitative representation of the level of DLRs in the sample. For example, the data obtained from qPCR can be used as “the labeling value” or it can be normalized based on various controls and statistical analyses to obtain one or more numerical values that represent the level of each of the plurality of DLRs in the testing DNA sample. The procedure for detection of DLRs by qPCR including primers' sequences, and the cycle conditions used were as described in Example 3.

    [0068] In analysis of labeling intensity of DLRs by sequencing, the level of differential labeling was calculated for non-overlapping 100 bp regions. In more detail, for each window we computed the total log-transformed coverage and the fraction of identified CGs which we then normalized by the total log-transformed coverage and the fraction of identified CGs in reference chromosomes 16 (for uCG signal) and 20 (for hmC signal). For each window a full and null logistic regression models were fitted. Full model included coverage, identified fraction, and, for T21-specific DMRs, fetal sex and fetal fraction, as independent variables. Coverage and identified fraction were excluded from the null model. ANOVA Chi-squared test was used to compare full and null models to obtain p value. In cases where models did not converge fetal sex was removed and p value evaluated again. Model statistics were moderated using empirical Bayes. FDR was used to adjust p values for multiple testing and q<0.05 was used as significance threshold.

    [0069] For each pregnancy-specific or tissue-specific DLR a leave-one-out cross-validation procedure was performed in order to determine its ability to diagnose T21. For each cross-validation cycle Bayesian generalized linear model (Gelman et al. 2008) with normalized coverage and identified CG as independent variables was constructed on the training samples. The model was then applied on the testing sample returning the predicted probability of the sample belonging to the T21 category. After all the cross-validation cycles the prediction probabilities for all samples were taken together. Various thresholds that would determine the discrete sample class from continuous probability measurement may have different effects on predictor's specificity and sensitivity. Therefore, a receiver-operating characteristic curve analysis was performed to estimate the effect of any threshold. The area under receiver-operating characteristic curve (AUC) indicates the overall accuracy of the model. Those DLRs for which the area under the curve was equal to 100% and, therefore, could achieve 100% prediction accuracy, were deemed to be the T21-predictive DLRs.

    [0070] An approach that would combine individual DLRs into a single predictive model is also possible. Such model could be one of but not limited to elastic net, random forest or support vector machine. Model would be evaluated in the same way by assessing receiver-operating characteristic and using cross-validation for parameter tuning. Also, bootstrap could be used instead of cross-validation. Other model accuracy measures could be employed, and data could be transformed in different ways. Interactions of DLRs could be taken into account to build new composite features that would be used for subsequent model training and evaluation.

    [0071] VI. Comparison to a Standardized Reference Value.

    [0072] The labeling value of the fetal DNA (also referred to herein as the “test value”) present in the maternal peripheral blood is compared to a standardized reference value, and the diagnosis of trisomy 21 (or lack of such fetal trisomy 21) is made based on this comparison. Typically, the test value for the fetal DNA sample is compared to a standardized normal reference value for a normal fetus, and diagnosis of fetal trisomy 21 is made when the test value is higher than the standardized normal reference labeling value for a normal fetus. In another aspect, the test value can be lower than the standardized normal reference labeling value for a normal fetus.

    [0073] Alternatively, the test value for the labeled DNA sample can be compared to a standardized reference labeling value for a fetal trisomy 21 fetus, and diagnosis of fetal trisomy 21 can be made when the test value is comparable to the standardized reference labeling value for a fetal trisomy 21 fetus.

    [0074] To establish the standardized normal reference labeling values for a normal fetus, maternal blood samples from the pregnant women carrying a normal fetus are subjected to the same steps of the diagnostic method, namely amplification of the ODN-derivatized CGs and their neighboring genomic sequences to obtain a reference DNA sample, and then determining the labeling value and the levels of at least one region of chromosomal DNA by sequencing or qPCR wherein selected from Tables 4-7.

    [0075] In order to establish the standardized normal reference methylation values for a normal fetus, healthy pregnant women carrying healthy fetuses or healthy non-pregnant women are selected. Pregnant women are of similar gestational age, which is within the appropriate time period of pregnancy for screening fetal chromosomal aneuploidy, typically within the first trimester of pregnancy. Standardized reference labeling values for a T21 fetus can be established using the same approach as described above for establishing the standardized reference values for a healthy fetus, except that the maternal blood samples used to establish the T21-specific reference values are from pregnant women who have been determined to be carrying a fetus with fetal trisomy 21.

    EXAMPLES

    Example 1. Identification of DLRs

    [0076] This example provides the methodology for the preparation of the labeled genomic libraries of the mentioned-above biological samples for genomic mapping of unmodified or hydroxymethylated CGs. Also, this example provides the strategy for DLRs determination and how DLRs for detection of trisomy T21 were preferentially chosen. FIG. 8b shows the application of the sequencing methodology for the identification of DLRs. In this example, DLRs in chromosomes 13 and 18 were also identified.

    [0077] Biological Samples.

    [0078] We performed analysis of three distinct sample types, enabling a characterization of the unmethylated and hydroxymethylated CGs in DNA obtained from plasma of pregnant women; we created single CG resolution uCG and 5hmCG maps of placental chorionic villi (CV) tissue samples from the 1st trimester abortions (CVS; n=6 of uCG and n=3 of 5hmCG); cfDNA samples of female non-pregnant controls (NPC; uCG n=6 and 5hmCG n=7) and cfDNA samples of pregnant women carrying healthy fetuses (uCG n=7 and 5hmCG n=6) or fetuses with the trisomy 21 (uCG n=5 and 5hmCG n=4).

    [0079] Circulating DNA from maternal blood samples was extracted using the MagMax Nucleic Acid Extraction kit (Thermo Fisher Scientific (TS)) or the QIAamp DNA blood Midi Kit (QIAGEN), and DNA from chorionic villi tissue was prepared by phenol extraction.

    [0080] All the maternal peripheral blood DNA samples (1st trimester pregnancies) and chorionic villi samples (1st trimester abortions) were obtained at Tartu University Hospital (Tartu, Estonia) through collaboration with Tartu University (Estonia). Consent forms approved by the Research Ethics Committee of the University of Tartu (ethical permission No. 246/T-21 and 213/T-21) were collected for each of the mother participated.

    [0081] Mapping of Unmodified/Hydroxymethylated CGs in DNA Extracted from Biological Samples.

    [0082] In uTOP-seq, 4-10 ng of cfDNA (or 100 ng of CV tissue DNA, sheared to 200 bp by Covaris sonicator) were labeled with 0.11 ΣM eM.Sssl (Kriukienė et al. 2013) in 10 mM Tris-HCl (pH 7.4), 50 mM NaCl, 0.5 mM EDTA buffer supplemented with 200 μM Ado-6-azide cofactor (Masevicius et al, 2016) for 1 h at 30° C. followed by thermal inactivation at 65° C. for 20 min and Proteinase K treatment (0.2 mg/ml) for 30 min at 55° C. and finally column purified (GeneJET PCR purification kit, (TS)). In hmTOP-seq, 5hmC glycosylation was carried with 5-10 ng of cfDNA supplemented with 50 μM UDP-6-azide-glucose (Jena Bioscience) and 2.5-5 U T4 β-glucosyltransferase (TS) for 1 h 37° C. followed by enzyme inactivation at 65° C. for 20 min and column purification (GeneJET PCR Purification kit (TS)). After ligation of the partially complementary adapters as described previously (Staševskij et al. 2017), covalently labeled DNA was supplemented with 20 μM alkyne-containing DNA oligonucleotide (which was biotinylated for construction of 5hmC maps) (ODN; 5′-T(alkyneT)TTTTGTGTGGTTTGGAGACTGACTACCAGATGTAACA-3′ (or -(biotin)-3′), Base-click) and 8 mM CuBr: 24 mM THPTA mixture (Sigma) in 50% of DMSO, incubated for 20 min at 45° C. and subsequently diluted to <1.5% DMSO before a column purification (GeneJET NGS Cleanup Kit, Protocol A (TS)). DNA recovered after biotinylation step was incubated with 0.1 mg Dynabeads MyOne Cl Streptavidin (TS) in a buffer A (10 mM Tris-HCl (pH 8.5), 1 M NaCl) at room temperature for 3 h on a roller. DNA-bound beads were washed 2× with buffer B (10 mM Tris-HCl (pH 8.5), 3 M NaCl, 0.05% Tween 20); 2× with buffer A (supplemented with 0.05% Tween 20); 1× with 100 mM NaCl and finally resuspended in water and heated for 5 min at 95° C. to recover enriched DNA fraction. Purified DNA after oligonucleotide conjugation (uCG) or biotin-enrichment (5hmC) was subsequently used in a priming reaction with 1 U Pfu DNA polymerase (TS), 0.2 mM dNTP, 0.5 μM complementary priming oligonucleotide (EP; 5′-TGTTACATCTGGTAGTCAGTCTCCAAACCACACAA-3). The reaction mixture was incubated at the following cycling conditions: 95° C. 2 min; 5 cycles at 95° C. 1 min, 65° C. 10 min, 72° C. 10 min. Amplification of a primed DNA library was carried out by adding the above reaction mixture to 100 μl of amplification reaction containing 50 μl of 2× Platinum SuperFi PCR Master Mix (TS) and barcoded fusion PCR primers A(Ad)-EP-barcode-primer (63 nt) and trP1(Ad)-A2-primer (45 nt) at 0.5 μM each. Thermocycler conditions: 94° C. 4 min; 15 cycles (uCG) or 17 cycles (5hmC) at 95° C. 1 min, 60° C. 1 min, 72° C. 1 min. The final libraries were size-selected for −270 bp fragments (MagJET NGS Cleanup and Size Selection Kit, (TS)), and their quality and quantity were tested on 2100 Bioanalyzer (Agilent). Libraries were subjected to Ion Proton (TS) sequencing.

    [0083] Data Analysis.

    [0084] Raw TOP-seq and hmTOP-seq sequencing reads were processed as described in Staševskij et al. (2017) and Gibas et al. (2020, accepted) except for the 3′ sequence ends where adapter sequences were trimmed only if they were identified using cutadapt with maximum allowed error rate 0.1 (Martin 2011). Processed reads were mapped to reference human genome version hg19 and coverage for each CG dinucleotide was computed as the total number of reads starting at or around the CG dinucleotide on either of its strands. We define CG coverage as the total number of reads, c, on any strand starting within absolute distance, d. We retained only reads with d≤3. Only reads aligned to chromosomes 1 to 22, X and Y were used for further analysis. On average, 40% of the raw reads were retained for downstream analysis per sample.

    [0085] Outlier identification was performed separately for uCG and 5hmC samples. CG coverage matrices were transformed using Hellinger transformation (Legendre and Gallagher, 2001) and then represented in two-dimensional space using non-metric multidimensional scaling (nMDS) with Bray-Curtis similarity index (Bray and Curtis, 1957). Samples that were further than two standard deviations away from the mean of their own sample group (cfDNA of non-pregnant controls, other cfDNA, CV tissue) in either nMDS1 or nMDS2 dimension were deemed outliers and removed from further analysis. There were three outlying samples in uCG and one in 5hmCG dataset.

    [0086] Identification of DLRs in Chromosomes 21, 13 and 18.

    [0087] The strategy for DLR identification is show in FIG. 1. We partitioned the chromosome 21 or 13 or 18 into 100 bp-wide non-overlapping windows. For each window we computed the total log-transformed coverage and the fraction of CGs covered which we then normalized by the total log-transformed coverage and the fraction of identified CGs in reference chromosomes 16 (for uCG) and 20 (for hmC).

    [0088] First, we obtained the pregnancy-specific u-DLRs by comparing NPC samples with cfDNA samples of healthy pregnancies. For each window a full and null logistic regression models were fitted. Full model included coverage, identified fraction, and, for T21-specific DLRs, fetal sex and fetal fraction, as independent variables. Coverage and identified fraction were excluded from the null model. ANOVA Chi-squared test was used to compare full and null models to obtain p value. In cases where models did not converge fetal sex was removed and p value evaluated again. Model statistics were moderated using empirical Bayes adjustment. FDR was used to adjust p values for multiple testing and q<0.05 was used as significance threshold.

    [0089] Next, we used the same strategy to obtain tissue-specific u-DLRs (FDR q<0.05; logistic regression) by comparing NPC and CV tissue samples. The same analytic approach was used separately for uCG and hmCG data. In case of hm-DLRs, nominal p value threshold was used when analysis did not yield any FDR significant DLRs.

    [0090] Further, for each hypomodified pregnancy-specific and tissue-specific u-DLR or hyper-hydroxymethylated pregnancy-specific and tissue-specific hm-DLR in chromosome 21 a leave-one-out cross-validation procedure was performed in order to determine its ability to diagnose T21. For each cross-validation cycle Bayesian generalized linear model (Gelman et al. 2008) with normalized coverage and identified CG as independent variables was constructed on the training samples. The model was then applied on the testing sample returning the predicted probability of the sample belonging to the T21 category. After all the cross-validation cycles the prediction probabilities for all samples were taken together. Various thresholds that would determine the discrete sample class from continuous probability measurement may have different effects on predictor's specificity and sensitivity. Therefore, a receiver-operating characteristic curve analysis was performed to estimate the effect of any threshold. The area under receiver-operating characteristic curve indicates the overall accuracy of the model. Those DLRs for which area under the curve was equal to 100% and, therefore, could achieve 100% prediction accuracy, were deemed to be T21-predictive DLRs (FIG. 1).

    [0091] Using the strategy for DLR determination in chromosome 21, we obtained 2,761 pregnancy-specific u-DLRs (FDR q<0.05) and 16,555 fetal tissue-specific u-DLRs (FDR q<0.05; logistic regression). For hm-DLR identification, we used nominal p<0.05 threshold and identified 4,930 pregnancy-specific hm-DLRs and 15,986 tissue-specific hm-DLRs.

    [0092] An in-depth investigation of the identified DLRs between non-pregnant female peripheral blood and placental DNA samples or non-pregnant and pregnant female cfDNA samples, has led to the selection of a list of DLRs located on chromosome 21 for diagnosing trisomy 21. The selection criteria of the regions were based firstly on the labeling intensity status of the regions in maternal blood samples and CV DNA samples, or on the labeling intensity status of the regions in the non-pregnant and pregnant female maternal blood samples. More specifically, the selected regions should demonstrate a high labeling intensity status in CV tissue DNA and a low labeling intensity or absence of labeling in peripheral blood samples of NPCs, or should show a high labeling intensity status in pregnant female blood samples and a low labeling intensity or absence of labeling in NPCs. Using leave-one-out cross-validation as described above we discovered 4175 tissue-specific u-DLRs; 163 pregnancy-specific u-DLRs; 8815 tissue-specific hm-DLRs, 679 pregnancy-specific hm-DLRs in chromosome 21 that classified the samples according to fetal karyotype with 100% accuracy (the selected DLRs are shown in Tables 4 and 5, for the uCG and hmCG signal, respectively) (FIG. 2).

    [0093] Furthermore, considering global epigenetic changes in Down syndrome affected fetuses (Jin et al. 2013), we also employed an alternative approach to identify the trisomy 21-specific DLRs. We evaluated modification differences between cfDNA samples of healthy and T21-diagnosed pregnancies and identified differentially modified DLRs. A logistic regression model was fitted to each 100 bp window with the CG-coverage and CG-fraction as independent variables and karyotype as the response variable, as above. In addition, we adjusted for possible confounding effects of fetal fraction and fetal gender which could not be accounted for in the previous analyses. With such approach, we identified 3,490 u-DLRs and 2,002 hm-DLRs (FDR q<0.05; logistic regression). The selected T21-specific DLRs that discriminate most the sample groups of healthy and T21-diagnosed pregnancies are shown in Tables 4 and 5, for uCG and hmCG signal, respectively) (FIG. 3).

    [0094] Using the same strategy for DLR identification shown in FIG. 1 we also identified DLRs in chromosomes 13 and 18. For chromosome 13, we obtained 1,394 pregnancy-specific u-DLRs (FDR q<0.05) and 25,091 fetal tissue-specific u-DLRs (FDR q<0.05; logistic regression) and using nominal p<0.05 threshold 4,255 pregnancy-specific hm-DLRs and 22,526 tissue-specific hm-DLRs. For chromosome 18, we obtained 1,321 pregnancy-specific u-DLRs (FDR q<0.05), 22,121 fetal tissue-specific u-DLRs (FDR q<0.05; logistic regression) and 3,626 pregnancy-specific hm-DLRs and 20,780 tissue-specific hm-DLRs. The lists of the selected DLRs across chromosomes 13 and 18 are shown in Table 7 (FIG. 9).

    [0095] The total number of fetal specific hypomethylated and hyper-hydroxymethylated tissue- and pregnancy-specific DLRs identified across chromosomes 21, 13 and 18 is summarized in Table 1.

    TABLE-US-00001 TABLE 1 Numbers of pregnancy- and tissue-specific DLRs identified across chromosomes 21, 13 and 18. No. of No. of No. of hyper- No. of hyper- hypo- hypo- hydroxy- hydroxy- methylated methylated methylated methylated tissue- pregnancy- tissue- pregnancy- specific specific specific specific Chromosome u-DLRs u-DLRs hm-DLRs hm-DLRs Chr21 4175 163 8815 679 Chr13 25091 1394 22526 4255 Chr18 22121 1321 20780 3626

    Example 2. Identification of Individual Labeled CGs for Detection of Trisomy 21 and Fetal Sex

    [0096] This example provides the strategy for determination of individual labeled CGs (CG-DLRs) following analysis of the samples described in Example 1 that can be used for detection of fetal trisomy T21.

    [0097] An investigation of labeling intensities of uCGs and hmCGs in peripheral blood samples of women that were confirmed to be carrying a fetus with trisomy 21 against labeling intensities of uCGs and hmCGs in the three types of control samples, i.e. placental CV tissue DNA, peripheral blood samples of non-pregnant women and peripheral blood samples of women pregnant with healthy fetuses, has led to the selection of individual CG-DLRs located on chromosome 21 for detection of fetal T21. The selection criteria of the CG-DLRs were based firstly on a labeling intensity status of CGs in blood samples of women pregnant with T21-diagnosed fetuses. More specifically, the selected CG-DLRs should demonstrate a high labeling intensity status in blood samples of women pregnant with T21-diagnosed fetuses and a low labeling intensity or absence of labeling in the three other sample types: CV tissue DNA, peripheral blood samples of NPC and pregnant female carrying a healthy fetus.

    [0098] The CGs with non-zero coverage and non-zero variance were used. The read coverage was log transformed. CGs from chromosome 21 were used for detection of T21 markers. Samples from non-pregnant female and pregnant with healthy fetuses women and CV tissue samples were marked as control, whereas only the female samples with T21 positive fetuses were marked as cases. A linear regression model was fitted for every CG, and resulting model fits were moderated using empirical Bayes adjustment. The CGs with FDR q value less than 0.05 and log fold change more than 1.2 were taken as significant. The list of the selected T21 CG-DLRs is shown in Table 6 (FIG. 4).

    [0099] Identification of CG-DLRs for Determination of Fetal Sex.

    [0100] Similarly, CGs from chromosome X (and Y) were analyzed for identification of CG-DLRs for fetal gender determination. A no intercept linear regression model was fitted for each CG and a contrast fit was used to determine differences between male and female samples. Resulting model fits were moderated using empirical Bayes adjustment. The CGs with FDR q value less than 0.05 and log fold change more than 1 were taken as significant. The list of the selected gender CG-DLRs is shown in Table 6 (FIG. 5).

    Example 3. Evaluation of CG-DLRs by qPCR

    [0101] In this example, individual CGs or CG-DLRs identified according to the methodology described in Examples 1 and 2 were used for their validation by qPCR. A flowchart diagram of the methodology is shown in FIGS. 8a and c. Several experiments were carried out to analyze and validate the identified DLRs or individual CGs. These experiments include an evaluation of the variability and reproducibility of the labeling intensity among different individuals and among technical replicates.

    [0102] Detection of Fetal Trisomy T21 by qPCR.

    [0103] The difference in labeling intensity at specific CG-DLRs, shown in Table 6, was tested in blood samples of pregnant female carrying healthy or T21-diagnosed fetuses (FIG. 6). Briefly, DNA of maternal blood sample was treated as described in Example 1. Then, 0.5 ng of the final amplified DNA were used for measurement of the labeling intensity of u-CG-DLRs and hm-CG-DLRs by qPCR with a Rotor-Gene 0 real-time PCR system (Qiagen) using Maxima SybrGreen/ROX qPCR Master Mix (TS). 0.3 mM of each primer pair used in each reaction, wherein one of the primers binds complementarily to a genomic region in close proximity to the CG site (its 5′ end anneals more than 5 nucleotides to the CG being analyzed), and another primer binds in a vicinity of the CG to allow PCR amplification of the region (or selected DLR) to occur. The amplification conditions were set as: 95° C. for 10 min, 40 cycles 95° C. for 15 s, 60° C. for 60 s.

    [0104] In this embodiment, the plurality of CG-DLRs on chromosome 21 comprises one region or a combination of at least two regions, selected from Table 6. The invention also pertains to a composition comprising nucleic acid probes that selectively detect the regions shown in Table 6, preferably, the pair/set of oligonucleotide primers are selected from Table 2.

    TABLE-US-00002 TABLE 2 [First position of the genomic coordinates of the selected u-CG-DLRs and hm-CG-DLR on chromosome 21 and nucleotide sequences of the primers for determination of fetal trisomy T21 by qPCR.] PCR u-CG-DLR product, coordinate length Primer sequence Chr21: 29732020-1, Seq ID 1: 29732020 109 bp 5′CAACTCCCTACAG CCCCTTG Seq ID 2: 5′AAATTGCATGATT CCCCTGACA Chr21: 29732020-2, Seq ID 3: 29732020 67 bp 5′ATGACTGGCTTATTTC ACTTAGCATC Seq ID 4: 5′AGTCCTGCTATATGCA ACACCTT Chr21: 33462648, Seq ID 5: 33462648 97 bp 5′GGTATTTACAAAAGT CTGCACCTTAGTC Seq ID 6: 5′CTGCCAACTTCACCC AGAGT Chr21: 34672959, Seq ID 7: 34672959 73 bp 5′TAGAAATCTTTAGGA GGTGGTGAATG Seq ID 8: 5′CATGGTGGAAGAGAT GGGC PCR hm-CG-DLR product, coordinate length Primer sequence Chr21: 30341466, Seq ID 9: 30341466 101 bp 5′GCAGAGGTTGCAG TGAGCTG Seq ID 10: 5′GTCTGGATGCAAAA ATCCCTTT Chr21: 46964859, Seq ID 11: 46964859 88 bp 5′GCTGTCCCTGTGGT TAAGGTC Seq ID 12: 5′GCCACCACAACAGC ACCA Chr21: 44084933, Seq ID 13: 44084933 89 bp 5′CCCCATCACCAACT TCACTC Seq ID 14: 5′GAAACTGAGTCTC TCGCAAGG

    [0105] Detection of Fetal Gender by qPCR.

    [0106] In another embodiment of the invention, the experimentally acquired value for the presence or availability of labeled CGs is estimated through qPCR, in a total untreated, i.e. non-ligated to adaptors and non-preamplified, maternal blood sample as shown in FIG. 8c, for fetal gender determination. Notably, analysis of the selected CG-DLRs in chromosome X is sufficient for detection of fetal gender. This is only one exemplification of the strategy; the similar strategy may be used for determination of fetal trisomy.

    [0107] Firstly, the difference in the abundance of DLR regions starting at specific CGs shown in Table 6 was tested in the 1st trimester CV tissue DNA of both genders and non-pregnant female blood sample DNA. Then, we mixed CV tissue DNA and non-pregnant female peripheral blood plasma DNA to the ratios 20/80 and 0/100 of the CV and plasma DNA, respectively. 10 ng of each sample mixture were labeled and derivatized with the ODN as described above. Next, 1.5 ng of each sample was analyzed in replicates by qPCR. The coordinates of the u-CG-DLRs on chromosomes X and Y and primers for qPCR are shown in Table 3.

    TABLE-US-00003 TABLE 2=3 [First position of the genomic coordinates of the selected u-CG-DLRs on chromosomes X and Y and nucleotide sequences of the primers for determination of fetal gender by qPCR.] PCR u-CG-DLR product coordinate length Primer sequence ChrX: 160 bp Seq ID 15: 5′-CCTCTCTATGGGCAGT 138802516 CGGTGATTGACCTGCTTCCTGTGTTGAGC Seq ID 16: 5′-TGTTACATCTGGTAGT CAGTCTCCAAACCACACAAAAAAGTGGAG ChrY: 123 bp Seq ID 17: 5′-GTAGAAAAAAGTAGA 14774154 AACAGCAAGGGGAAG Seq ID 18:5-TGTTACATCTGGTAGTC AGTCTCCAAACCACACAAAAAAGCCCCT

    [0108] In more detail, DNA of each sample were labeled with eM.Sssl MTase in the presence of 200 μM Ado-6-azide cofactor for 1 hour at 30° C. as described in Example 1 followed by column purification (Oligo Clean&Concentrator-5, Zymo Research). Then, DNA eluted in 8 ul of Elution Buffer was supplemented with 20 uM alkyne DNA oligonucleotide (ODN, 5′-T(alkyneU)TTTTGTGTGGTTTGGAGACTGACTACCAGATGTAACA), the mixture of 8 mM CuBr and 24 mM of THPTA (Sigma) in 50% of DMSO, incubated for 20 min at 45° C. and subsequently diluted to <1.5% DMSO before purification through the GeneJET NGS Cleanup kit (TS). 1.5 ng of the purified DNA were used for measurement of the labeling intensity of uCGs by qPCR with a Rotor-GeneQ real-time PCR system (Qiagen) using Maxima SybrGreen/ROX qPCR Master Mix (TS). 0.3 mM of each primer pair was used in each reaction, wherein one of the primers binds complementarily to the ODN and to 5 nucleotides of the template genomic DNA adjacent to the derivatized CG site, and another primer binds in a vicinity of the CG to allow PCR amplification of the region (or selected DLR) to occur. The amplification program was set as: 95° C. for 10 min, 40 cycles 95° C. for 15 s, 65° C. for 30 s, 72° C. for 30 s (FIG. 7a,b,c).

    Example 4. qPCR-Based Noninvasive Diagnostics of Trisomy 21

    [0109] This example describes the independent validation of non-invasive testing for fetal trisomy 21. For this purpose, we have performed qPCR-based analysis of a small group of samples which have not been used in the previous Examples for identification of validation of DLRs. The group consists of 3 maternal peripheral blood samples from women bearing a normal fetus and 2 maternal peripheral blood samples from women bearing a trisomy 21-affected fetus.

    [0110] These maternal peripheral blood samples were obtained at a gestational age of between 12-13 weeks at Tartu University Hospital (Tartu, Estonia) through collaboration with Tartu University (Estonia). Consent forms approved by the Research Ethics Committee of the University of Tartu (ethical permission No. 246/T-21 and 213/T-21) were collected for each of the mother participated.

    [0111] The fetal specific approach used herein is illustrated schematically in FIG. 8a, wherein the ability to discriminate normal from trisomy 21 cases is achieved by comparing the values obtained from normal and trisomy 21 cases using T21-specific differentially modified CG dinucleotides, or CG-DLRs, located on chromosome 21. A fetus with trisomy 21 has a differentially modified genome in relation to normal genome and an extra copy of chromosome 21, and thus the increased abundance of a fetal specific region compared to a normal fetus. Therefore, the amount of T21-specific fetal region will increase more in fetuses with trisomy 21 compared to normal cases.

    [0112] An in-depth investigation of our previously identified DLRs, described in Examples 1 and 2, has led to selection of DLRs located on chromosome 21. A group of selected DLRs has been used for identification of fetal trisomy 21 by qPCR (Example 3). These DLRs demonstrate a hypomethylated or hyper-hydroxymethylated, and thus more labeled, status in peripheral blood DNA of pregnant women carrying a T21-diagnosed fetus and a hypermethylated or hypo-hydroxymethylated, and thus less labeled, status in CV tissue DNA and peripheral blood DNA of pregnant women carrying a normal fetus and in peripheral blood DNA of non-pregnant women in order to achieve the enrichment of fetal T21-specific CG-labeled regions. These selected CG-DLRs shown in Table 2 were used for analysis of the samples by qPCR.

    [0113] The procedure of sample processing and qPCR cycle conditions used were as described in Examples 1 and 3. Briefly, 5-10 ng of maternal cfDNA was covalently derivatized with the ODN and the adaptors were ligated to the ends of DNA fragments. The labeled CG regions were enriched through the ODN-mediated polymerization of the adjacent genomic regions and such regions were subsequently amplified using the primers complementary to the ODN and one strand of the adaptors. Then, the amounts of u-CG-DLRs and hm-CG-DLRs was calculated by qPCR as shown in Example 3 using a combination of CG-DLRs and qPCR primers listed in Table 2.

    [0114] Comparing the obtained test values of the samples with known karyotype (the T21-diagnosed samples show lower test values than normal cases), all T21-diagnosed samples were confirmed as having trisomy 21, indicating 100% specificity and 100% sensitivity of the approach (FIG. 10).

    APPENDICES

    [0115]

    TABLE-US-00004 TABLE 4 [The coordinate is shown for the first base pair of 100 bp u-DLRs in chromosome 21] Pregnancy-specific u-DLRs 10774500 26212900 35812700 38891600 43228800 45323700 46743900 47331000 11025700 26835100 35819500 38946900 43470300 45330400 46751000 47331900 15169700 28041300 35879100 38969700 43519400 45355100 46808700 47362600 15770300 28074300 36073900 39202100 43708100 45392900 46812700 47390300 16130900 28759100 36089600 39507100 43714600 45400400 46837800 47419000 16577200 28942700 36220800 39544400 43728400 45597600 46847100 47451100 17308600 29288000 36437300 39690100 43782100 45734900 46934400 47479200 17333200 31008200 36478700 39891300 43864600 45748300 46946300 47498400 18086100 32374100 36701300 41001100 43864800 45753500 46973100 47502800 18676300 32639100 36917100 41292800 43876000 45790600 46995500 47536100 18940600 32915800 37085900 42099000 44061700 45842200 46997700 47542700 20437200 33522600 37192500 42127100 44113000 46036100 46999800 47549500 20608700 33533900 37218700 42212900 44191100 46182600 47057200 47559700 21354200 33591700 37352800 42424900 44196200 46312000 47181700 48047900 21670800 33954100 37493000 42595400 44208900 46359300 47211600 48079600 22564300 34369300 37527800 42694800 44346000 46396600 47212000 9901200 24387600 34406400 37970500 42732500 44474700 46415700 47213500 24474800 34483300 38066600 42746400 44511200 46418600 47245100 25233800 34851100 38092400 42928900 44754300 46545400 47273200 25693500 35365900 38104700 42936000 45065800 46720900 47287600 26152100 35531600 38385400 43112600 45156300 46738900 47315300 Tissue-specific u-DLRs. Only 1000 selected DLRs are shown 10027900 15984000 17333200 18351000 19378400 20630400 21741100 22819200 10395200 15993500 17333300 18356700 19379400 20633700 21743700 22820400 10527800 16003800 17344200 18361400 19382400 20655700 21745700 22830600 10551600 16009000 17364800 18387200 19390200 20668400 21746900 22842800 10603000 16010900 17377300 18389400 19391100 20685000 21755000 22848600 10713200 16015300 17382300 18399000 19392100 20698000 21765500 22866100 10757400 16016600 17384200 18418800 19392900 20701500 21771800 22880300 10762300 16025200 17389700 18426600 19397200 20706300 21775600 22896500 10762500 16033800 17392100 18433700 19400200 20715200 21775700 22925400 10807400 16039700 17396700 18444200 19406900 20719900 21802300 22926000 10812800 16046800 17400700 18449500 19415500 20748600 21809600 22926600 10821600 16051800 17405400 18461000 19427200 20749700 21814100 22936200 10824800 16056200 17405500 18483000 19427900 20759800 21826100 22947400 10826000 16058300 17422500 18492200 19429700 20763100 21831900 22970300 10836600 16065200 17423000 18497900 19432000 20780900 21832100 22975500 10851100 16065400 17423200 18519100 19443000 20790400 21838500 22981800 10851700 16066400 17434500 18527800 19443800 20806100 21840500 22984400 10862500 16076200 17440300 18535800 19486900 20808400 21850900 23000600 10868300 16087900 17443100 18550100 19495300 20814400 21851100 23009700 10889500 16099900 17456000 18570400 19495400 20825700 21851800 23012900 10898800 16104500 17461800 18587100 19496300 20834300 21852800 23032500 10990600 16105700 17464000 18603400 19501800 20867700 21852900 23058900 11021600 16120400 17464100 18611400 19506400 20869900 21856600 23061100 11025700 16127400 17466600 18618800 19508200 20876400 21883000 23061600 11034800 16130900 17466800 18619900 19514500 20876600 21888700 23094800 11048000 16141200 17467500 18622300 19523800 20889300 21891500 23095300 11096200 16151900 17481900 18634200 19526200 20893200 21892000 23101600 11100600 16159500 17505400 18637600 19526700 20898100 21893600 23126800 11106600 16163900 17506600 18643800 19530700 20900800 21900500 23129400 11127600 16176600 17517700 18668800 19531400 20903700 21928500 23185500 11153500 16182300 17519700 18676300 19552600 20912300 21935000 23191700 11161300 16218500 17528400 18677300 19562100 20920500 21938500 23196100 11180200 16229300 17532700 18678900 19569200 20930800 21940100 23235500 14344600 16259600 17561300 18685400 19569800 20941500 21950400 23236400 14361600 16260700 17561800 18699800 19591300 20944400 21965200 23240500 14372500 16288000 17573800 18707300 19596200 20956500 21978100 23275900 14383200 16291200 17582800 18707600 19603500 20967800 21988500 23276000 14390500 16307500 17584600 18715900 19613900 21013800 22001400 23290600 14395600 16396400 17586100 18716200 19615600 21024900 22018800 23296900 14411800 16443400 17595800 18720000 19616500 21050300 22031600 23303600 14431400 16452000 17619000 18740600 19619500 21074500 22043300 23326200 14699500 16458600 17620100 18741900 19635700 21081100 22060800 23328300 14805600 16461400 17621100 18748500 19643700 21091600 22062000 23328700 14828200 16518900 17627600 18778900 19649100 21101600 22080100 23338700 14897900 16520800 17633400 18783100 19649900 21104100 22086700 23341100 14900100 16528100 17635100 18788000 19657900 21104300 22105900 23345000 14944200 16553000 17637900 18797600 19688500 21108700 22106200 23354800 14950900 16556500 17643000 18798400 19708400 21110400 22115900 23356100 15036300 16558500 17663200 18800100 19719700 21136800 22133500 23360300 15054200 16565200 17666500 18819100 19727600 21140800 22134300 23365200 15078000 16569700 17670500 18821500 19731400 21143400 22134400 23372200 15083000 16582300 17683800 18831800 19738100 21149400 22138200 23382900 15087900 16604700 17698700 18834000 19743000 21151800 22144800 23389900 15141900 16606800 17703300 18836800 19756000 21158900 22145200 23401700 15194400 16614900 17707500 18839500 19757000 21160100 22159500 23403000 15255400 16628500 17709400 18848600 19759100 21167300 22161000 23404600 15323900 16629000 17710800 18857500 19763800 21172800 22171200 23405000 15356300 16633000 17752400 18880600 19786900 21174500 22173800 23405200 15372700 16643000 17758800 18900200 19794500 21183100 22174700 23407500 15398100 16644600 17759500 18907500 19795600 21186600 22218100 23426000 15412500 16654100 17784400 18909300 19824300 21189400 22224000 23456500 15434900 16685000 17788300 18910100 19824700 21189800 22234100 23467900 15435600 16686400 17813400 18914600 19825200 21192600 22243700 23490200 15445400 16694900 17827300 18918900 19831700 21223200 22255400 23492700 15451600 16707300 17828200 18921800 19837300 21224300 22264200 23502200 15528500 16732500 17832300 18942200 19849300 21226200 22265000 23507500 15546200 16744000 17838700 18943400 19858300 21233900 22270700 23510800 15576100 16756800 17856200 18951300 19859200 21238500 22278500 23534900 15589600 16777100 17864500 18955000 19865900 21239300 22280600 23576400 15607200 16786100 17864900 18956800 19867200 21273800 22281500 23582100 15608600 16798600 17875800 18998400 19890600 21282600 22281800 23611500 15609000 16859000 17877800 18999200 19891100 21283300 22294100 23657500 15615500 16860400 17885300 19000900 19903500 21301000 22312200 23659400 15620000 16863700 17896400 19010800 19911700 21304400 22313200 23667100 15629000 16872300 17898500 19023900 19912700 21310100 22319300 23672700 15629700 16875900 17914500 19026000 19940300 21316200 22323700 23696400 15630300 16885500 17916200 19030300 19952500 21326500 22325600 23718600 15633600 16892300 17935900 19041100 19979900 21333300 22331400 23779300 15639900 16894100 17939600 19044700 19985200 21354100 22333100 23793400 15641300 16904300 17961100 19047700 20009000 21354200 22337300 23803600 15646800 16922200 17976600 19049500 20015100 21365300 22337800 23808300 15650300 16932600 17982200 19053900 20024300 21366400 22347600 23826100 15665500 16934400 17985200 19054300 20120500 21381000 22347900 23831100 15670200 16936900 17997200 19063100 20120600 21388800 22351600 23833100 15673600 16942700 18009700 19082400 20128100 21400400 22356700 23833700 15676400 16943100 18023100 19095100 20131000 21404000 22371200 23833900 15686900 16963300 18032400 19098100 20131500 21415000 22378400 23835900 15687000 16964400 18038700 19100300 20149600 21416100 22381400 23840200 15703200 16967500 18040100 19108000 20180700 21416900 22383100 23853500 15709200 16969300 18049300 19110700 20200400 21433900 22385800 23859400 15709900 16979600 18054800 19114200 20208800 21436900 22392900 23871200 15713500 16996400 18077000 19117100 20227000 21454900 22402900 23876400 15715700 16997200 18086100 19117200 20239300 21460100 22423000 23877000 15717600 17008700 18097800 19117800 20239400 21467700 22456400 23880000 15724200 17012700 18102600 19117900 20260500 21475300 22459000 23890200 15741400 17017800 18109800 19119800 20268300 21476300 22462200 23890500 15757600 17025900 18118400 19132800 20286400 21482800 22477300 23891200 15760000 17030000 18127000 19147700 20289300 21490300 22478300 23901600 15770300 17062200 18145400 19203900 20295300 21493900 22482400 23917700 15782400 17063900 18154600 19205400 20320600 21496200 22495500 23918900 15791300 17064700 18157800 19205800 20322700 21496700 22498300 23923900 15806500 17074500 18163100 19205900 20326300 21499100 22519200 23931300 15807300 17079000 18168000 19206700 20337600 21501000 22534100 23934300 15810000 17086600 18169800 19218500 20349500 21501100 22547500 23941700 15811800 17090900 18172800 19219800 20353400 21509600 22562200 23950900 15820300 17094100 18179000 19221900 20356400 21516800 22582000 23951200 15833000 17101300 18187900 19222000 20362800 21522400 22606900 23952600 15834600 17103200 18196800 19223900 20364900 21533000 22607100 23959700 15838300 17111700 18200900 19248800 20394300 21548500 22615800 23972500 15839100 17116600 18217200 19251000 20395900 21567700 22631300 23981400 15845600 17133800 18221600 19252500 20429600 21594700 22646300 23983100 15853600 17154600 18223800 19256700 20436900 21616500 22687500 23992300 15866100 17160400 18233400 19274300 20453600 21636700 22690100 23999500 15876600 17207100 18251500 19288100 20462000 21636900 22697000 24018400 15882100 17218700 18252100 19288200 20476500 21637100 22701400 24018800 15899800 17276800 18259400 19296000 20500600 21643600 22744100 24025300 15909400 17278400 18267400 19302000 20506900 21670800 22745700 24057800 15928100 17279200 18274100 19305800 20519200 21672100 22754900 24061000 15936100 17285600 18301200 19317400 20536400 21678300 22762300 24074500 15941400 17292700 18310100 19328300 20548000 21678700 22769500 24084900 15947900 17296700 18315000 19334800 20566900 21679300 22773000 24089300 15955700 17300600 18317500 19335700 20581300 21691700 22790800 24105100 15970000 17303600 18322500 19346600 20591500 21714200 22809100 24113400 15972100 17315700 18325500 19354400 20608700 21719300 22809300 24114000 15982800 17320300 18334900 19375100 20614800 21739500 22818500 24139100 The selected T21-specific u-DLRs 15078000 20843100 24937300 31821900 34672900 42770000 47588600 38660800 15413700 21451400 25752700 32258800 34690700 43291800 9875200 41842500 15486300 21739100 25887700 32294400 34872200 43644200 18679500 45355100 15490100 21771600 26081000 32526200 35234300 43933400 22295500 45734900 15680600 22449400 28463100 32748600 36191800 44303300 22450800 45770300 16547900 22459500 29713600 32900300 36193500 44303600 26152100 45946100 17461600 22530700 29732000 33572800 37070300 45151100 31408200 46316400 18123400 22715800 29879100 33831600 38032500 45597700 32639100 48079600 18499700 22908900 31306700 33875700 39652400 45708400 33533900 19286900 22921700 31357700 33919200 40405900 46009400 33591700 20037100 23004300 31489300 34092400 41285400 46780500 33840400 20042500 23380000 31568000 34460800 42378900 47329500 36220800

    TABLE-US-00005 TABLE 5 [The coordinate is shown for the first base pair of 100 bp hm-DLRs in chromosome 21] Pregnancy-specific hm-DLRs 15078000 30594600 35231100 38321300 42695100 44301100 45492400 46747600 15442500 30642600 35246100 38335200 42738300 44326600 45494400 46748200 15496700 30658000 35272400 38441400 42746900 44329100 45498400 46748800 15970900 30669700 35293400 38443100 42760300 44334600 45542100 46769800 16119600 30675000 35344900 38454300 42824800 44347000 45560600 46776900 16193000 30708600 35349600 38541100 42851600 44350500 45568800 46777600 16213800 30719600 35444700 38566700 42860000 44354200 45571400 46780700 16214600 30755900 35500600 38567300 42860500 44361200 45572100 46784600 16240400 31030700 35516100 38579100 42874000 44366300 45614500 46790700 16311800 31223600 35560500 38634900 43030200 44381700 45621700 46799200 16326500 32471400 35587700 38636200 43050800 44383700 45630000 46869900 16389000 32510000 35616700 38662600 43092100 44387300 45632500 46870200 16395200 32575500 35712600 38676800 43115200 44387900 45637600 46886600 16396200 32581400 35718200 38732000 43135400 44442400 45658000 46902700 16407900 32678200 35755000 38750600 43154800 44448300 45659300 46911600 16488800 32711300 35761500 38766900 43171100 44461800 45663300 46914600 16511900 32725600 35879600 38767300 43172900 44467700 45675100 46924300 16572400 32831900 35884200 38822100 43175500 44475900 45704700 46925400 16572800 32840800 35886800 38832800 43175800 44491400 45705900 46931500 16582800 32898600 35893700 38888500 43179100 44508400 45724700 46932100 16591800 32915200 35894400 38890600 43228700 44573600 45743000 46932200 16643600 32915700 35922100 38920900 43228800 44591600 45747000 46932700 16682300 32934700 35940800 38942100 43239800 44594100 45751700 46934200 16684400 32986500 35963200 38964000 43241000 44595900 45773900 46945700 16706000 32999300 36072400 39104900 43242000 44614600 45796000 46950400 16763200 33005100 36076400 39343900 43245800 44626800 45825100 46959000 16828600 33012700 36079700 39461200 43256600 44704800 45826500 46959800 16884200 33019200 36081500 39490900 43293000 44732600 45843300 46971900 16888000 33026800 36108600 39594800 43314600 44762100 45880200 46973300 17036800 33057900 36157900 39598900 43319100 44782500 45883300 46977800 17086600 33085600 36164200 39632900 43319500 44784900 45898800 46980800 17099100 33671200 36165000 39706900 43344400 44802600 45928000 47051900 17099800 33723100 36198900 39755900 43351200 44814600 45956000 47124500 17117000 33725000 36202900 39761300 43376500 44817100 46034900 47188800 17193500 33763500 36208100 39851400 43384100 44837100 46055600 47239300 17550000 33792500 36242900 39948700 43394500 44870700 46063700 47251700 17561300 33805800 36243000 39970500 43412800 44871500 46068700 47288700 17578000 33823700 36244900 39984000 43443300 44872300 46142700 47290300 17592700 33857800 36246600 40119400 43446200 44876300 46154200 47333300 17666600 33881100 36288500 40123900 43456200 44883100 46182800 47403100 17734100 33901800 36329200 40134200 43499900 44883700 46214100 47418400 18846300 33948600 36331900 40166900 43506100 44900600 46235600 47422300 18857600 33957500 36345600 40176200 43567000 44916900 46253400 47423800 18883100 33966100 36389700 40244600 43571300 44924000 46270000 47457000 19052700 34062900 36444900 40277900 43577500 44928000 46271300 47515500 19066500 34069100 36595800 40285300 43603000 44928800 46272800 47520800 19069400 34075400 36656600 40293700 43621300 44935600 46284800 47530400 19071700 34185900 36693800 40293800 43679800 45039800 46286600 47538400 19106400 34338600 36829500 40310600 43681500 45040100 46307200 47541800 19118800 34402600 36840000 40349000 43786800 45064600 46308100 47542400 19150100 34405900 36944400 40352500 43790900 45067700 46319500 47545100 19173600 34409600 37015500 40356600 43801700 45092200 46320800 47552700 19176300 34447800 37033700 40357800 43813600 45105500 46326500 47556200 19228600 34477900 37038600 40358000 43817900 45109700 46328000 47574100 21311300 34517400 37169900 40372800 43844600 45116700 46349100 47577700 21626600 34556200 37277600 40394400 43846300 45129900 46371800 47608400 22421400 34618500 37334100 40395100 43846800 45131700 46379600 47617600 23735900 34623200 37436800 40453300 43869600 45147000 46396500 47624100 25184700 34625700 37456000 40466200 43872000 45153200 46398100 47630200 25711300 34638000 37459800 40466900 43893300 45182000 46401200 47631900 27006500 34643100 37537100 40479000 43896600 45190800 46403700 47632900 27157900 34717700 37542300 40479900 43898300 45191200 46407900 47676300 27190500 34722900 37554900 40542000 43915300 45228200 46412700 47686900 27287800 34728000 37559100 40568900 43943900 45229000 46442000 47700500 27332200 34753100 37609600 40637700 43977800 45232900 46449800 47715600 27397400 34754700 37627900 40730800 43988800 45234200 46451400 47764000 27424500 34756700 37639400 40741800 44003400 45242100 46455200 47766000 27434400 34774100 37646900 40763200 44004600 45244300 46455400 47780500 27445300 34790400 37658400 40773600 44006200 45246200 46461600 47786500 27449100 34790500 37674700 40815500 44033500 45253700 46473600 47793600 27452300 34811500 37750300 40841700 44037100 45271700 46480500 47805500 27489500 34814600 37758700 40881500 44053600 45286500 46491900 47861300 27559600 34848800 37772200 41010600 44064900 45298300 46560000 47939900 27895000 34911100 37791900 41086000 44075700 45298700 46566300 47946100 27938500 34923100 37795000 41130500 44115900 45299700 46568900 47976300 28256200 35023200 37819200 41132500 44117300 45325300 46640200 47980600 28307900 35047800 37978700 41919500 44144600 45338100 46643200 47983300 28515800 35058800 38028500 42036400 44152000 45343000 46677400 47985500 29484500 35065700 38060900 42419200 44173600 45364400 46677800 47985700 30006300 35142600 38100300 42442800 44182200 45373900 46683700 48024400 30241900 35169600 38140400 42543300 44255200 45396700 46685300 48041700 30436300 35201900 38153300 42546300 44281900 45431100 46699900 48048700 30494600 35203700 38192600 42551900 44282200 45446700 46700100 48054400 30535200 35217300 38215600 42595400 44282300 45448900 46715700 48070800 30536400 35227600 38282500 42625000 44300500 45470500 46728100 Tissue-specific hm-DLRs. Only 1000 selected DLRs are shown 10421900 16261100 16954300 17764700 18920700 23068700 27303600 27558300 10589700 16261600 16956100 17764900 18921000 23227200 27303900 27558700 10596500 16262900 16956500 17766800 18923400 23236000 27304800 27559900 10596600 16274900 16962500 17767800 18926900 23291400 27306000 27562900 10598400 16283000 16975500 17773300 18931000 23456600 27307500 27566800 10598900 16284300 16976200 17785700 18943000 23492500 27307800 27569500 10715400 16289300 16976400 17796400 18952700 23492900 27307900 27570000 10736200 16291100 16989000 17799200 18956300 23510900 27308200 27577000 10843800 16291200 16989500 17813700 18956800 23518700 27316600 27580900 10913500 16299300 16990900 17886800 18968000 23525700 27324600 27581400 10924600 16299800 16991500 17898600 18970500 23528800 27326100 27585800 10955200 16311900 16992000 17905500 18971800 23552200 27327900 27593300 10987700 16325200 16997600 17905800 18973800 23560200 27330800 27600300 10992800 16326500 17001900 17906900 18975600 23562800 27335500 27602200 11012100 16329200 17009300 17909300 18977100 23573000 27335700 27604900 11028500 16329400 17017900 17922600 18977300 23573400 27337100 27605000 11094600 16332100 17034600 17924100 18982100 23616700 27338200 27605300 11098900 16334600 17036800 17928200 18987300 23629800 27340000 27607200 11112100 16347100 17040700 17928300 19005000 23656900 27340500 27609200 11122000 16357400 17041300 17928400 19010300 23659900 27341200 27609700 11130500 16366000 17041400 17928900 19020100 23667300 27342900 27610200 11131500 16373300 17041700 17931600 19023400 23682600 27343100 27617500 11132500 16373500 17045000 17934400 19028400 23701700 27343200 27620800 11139800 16373700 17045100 17936200 19031000 23724200 27351000 27621100 11144000 16374700 17046400 17936400 19033300 23732400 27352700 27625200 11144200 16380800 17049500 17941100 19033700 23732500 27354700 27626300 11145700 16382700 17050200 17943400 19033900 23732700 27360300 27631000 11170400 16383100 17065200 17944100 19034800 23735900 27360700 27637700 14384400 16388400 17080100 17945100 19035000 23768500 27362800 27656300 14804300 16391900 17080600 17945800 19041900 23811300 27363900 27656400 14816400 16396200 17084900 17945900 19042100 23833900 27369600 27658700 15056300 16396800 17085500 17947600 19045100 23918100 27371100 27659000 15067900 16399900 17089800 17956700 19045800 23947700 27372700 27691600 15068200 16400700 17094100 17958000 19046600 23950600 27373700 27693400 15077900 16401600 17099100 17958400 19048800 24744100 27375500 27697600 15166800 16401700 17099300 17961700 19052000 24825100 27375800 27718300 15227100 16407000 17116900 17965900 19052600 24974800 27376700 27744600 15228900 16407900 17117000 17971500 19063900 25255800 27377900 27760700 15261500 16423400 17121500 17978700 19070600 25258400 27381200 27763400 15261700 16423900 17123000 17979900 19071100 25301000 27382900 27763500 15262000 16425600 17127100 18023400 19077100 25304000 27383300 27765300 15297900 16426600 17142200 18029900 19098900 25370100 27384900 27765800 15300600 16428100 17145100 18040100 19100300 25580300 27387100 27766600 15309200 16429800 17147400 18042800 19101100 25871200 27388300 27766800 15357200 16433200 17153200 18049200 19102500 26100000 27389600 27769700 15375900 16434800 17154000 18078000 19104300 26219400 27397000 27770900 15380100 16434900 17156500 18078200 19104400 26335300 27397400 27773000 15381100 16435500 17157700 18085600 19108200 26656500 27399800 27775500 15383400 16435600 17166300 18141500 19108800 26833400 27407900 27776200 15383800 16438600 17172100 18144200 19116400 26929000 27410800 27776400 15384000 16444100 17174000 18147500 19116800 26930500 27411200 27776700 15384700 16444300 17176800 18215200 19117200 26932600 27411900 27777100 15386000 16451600 17178500 18443200 19117800 26934200 27414400 27778500 15386300 16467200 17180200 18699900 19119800 26935800 27417100 27779300 15404000 16469800 17182400 18762800 19128600 26940700 27417600 27780400 15407300 16478900 17182500 18763400 19131400 26942300 27424500 27783600 15412600 16479500 17187400 18766800 19136100 26945900 27428100 27783800 15431700 16491000 17188500 18772200 19150100 26948800 27428400 27784100 15434600 16494700 17193500 18782400 19151900 26961400 27430700 27796700 15435600 16504800 17193700 18782600 19162200 26971700 27431100 27799400 15436100 16505800 17197300 18788400 19166300 26973100 27431200 27812100 15436700 16506400 17206900 18793000 19167200 26978700 27434300 27817200 15436900 16506500 17207100 18793300 19167300 26980800 27440500 27818000 15442600 16507400 17210000 18807500 19173600 26986400 27440700 27818500 15442700 16510800 17211500 18808900 19174700 26986600 27443300 27822300 15443000 16511000 17212800 18809700 19175600 26997800 27443400 27823900 15443100 16521700 17213100 18809900 19177800 26998000 27445200 27825700 15444800 16522600 17218600 18810300 19188900 26998200 27446900 27827800 15447000 16536900 17221000 18812500 19196300 27003800 27448400 27831100 15448400 16547800 17222100 18813900 19196900 27020000 27449100 27835300 15451300 16551900 17226200 18816600 19202000 27038000 27449300 27838000 15452900 16560600 17232500 18817500 19213400 27050200 27450800 27840200 15453000 16569600 17236600 18817600 19228600 27054700 27452300 27840900 15455900 16572400 17247200 18818700 19278100 27055500 27459000 27843400 15456600 16574500 17247400 18820500 19280100 27072600 27463900 27846500 15457200 16577000 17261000 18821800 19294600 27072900 27465900 27855900 15458000 16581900 17268600 18822500 19311000 27090600 27467700 27857900 15464500 16585300 17277600 18822900 19318500 27094500 27468400 27867400 15464700 16591800 17279700 18823100 19345900 27098000 27468500 27868200 15465300 16592400 17280700 18824500 19514500 27098200 27469200 27874100 15468700 16592500 17300600 18826000 19764200 27098400 27470200 27874900 15471100 16600400 17305200 18827900 20037300 27102000 27471200 27875500 15473800 16611500 17305400 18828300 20173200 27109900 27476700 27877200 15474300 16615800 17333200 18829500 20216000 27122500 27477300 27887800 15474400 16615900 17341500 18829800 20250500 27127200 27479800 27889100 15477900 16620100 17350300 18831300 20270100 27127300 27481500 27903600 15491600 16625100 17352300 18834100 20508400 27135600 27485300 27923600 15491800 16627700 17353900 18834500 20649200 27140300 27489700 27942700 15552200 16633100 17354100 18834600 20966100 27157500 27490800 27945000 15647300 16647900 17356000 18835600 21390900 27161300 27491000 27958500 15650300 16663300 17357600 18842600 21540500 27173500 27493200 27960200 15705500 16664500 17362400 18843000 21546100 27184800 27495100 27960300 15731300 16670800 17363500 18848200 21594000 27185000 27497800 27963700 15734600 16672300 17371300 18849100 22347600 27185100 27498300 28021600 15743100 16673600 17376500 18853800 22367200 27190500 27500200 28026000 15748000 16677500 17377500 18854600 22369700 27192700 27502400 28027800 15748600 16688000 17422500 18858800 22370000 27194600 27503000 28031600 15758400 16710100 17433700 18861900 22370200 27200700 27503200 28041800 15765100 16717600 17442900 18862400 22381400 27207100 27504200 28047900 15807300 16729800 17443400 18864000 22386400 27207500 27505400 28049900 15811600 16732800 17457400 18865600 22396900 27208700 27508300 28051800 15851300 16769900 17485500 18866400 22397500 27213300 27509100 28056300 15854600 16799800 17485700 18867100 22399400 27214200 27509200 28074300 15869800 16815100 17489400 18867400 22413800 27217000 27510800 28075700 15983000 16816700 17496000 18868000 22421500 27218200 27511400 28080900 16007100 16818200 17505000 18868600 22429800 27232100 27511500 28081500 16016200 16828600 17541600 18870800 22440800 27243600 27518500 28081900 16105700 16842900 17542100 18872900 22452600 27247400 27518800 28093200 16197300 16854200 17544000 18873100 22461200 27252100 27519700 28094900 16202200 16855700 17552100 18876400 22493100 27256300 27522300 28095900 16213600 16859000 17552200 18878800 22514900 27258500 27522600 28100300 16213800 16866200 17565400 18879100 22537800 27260300 27524100 28104200 16213900 16867200 17568100 18880800 22537900 27261700 27524400 28105700 16214600 16872200 17568500 18883100 22555600 27275300 27527500 28105800 16215100 16872400 17612000 18891400 22564300 27276400 27528200 28106000 16222100 16893900 17636600 18894500 22572100 27277200 27529400 28106900 16240400 16894500 17651900 18894600 22573400 27278600 27529900 28107200 16241200 16914400 17653200 18894900 22591200 27281000 27534800 28107900 16248200 16915700 17659500 18895500 22619600 27281400 27537800 28108900 16248900 16916300 17675200 18901000 22620800 27281900 27537900 28109400 16249300 16932100 17675400 18902800 22631200 27282500 27538800 28109800 16251500 16936900 17690400 18904100 22640300 27298500 27544700 28110400 16253600 16940600 17728700 18908700 22651800 27298600 27551800 28112300 16255000 16948100 17741300 18912400 22728200 27300300 27552500 28114800 16260700 16952900 17763100 18913800 22737400 27303000 27553700 28114900 The selected T21-specific hm-DLRs 27300500 35948700 39631800 43336700 45754400 48054800 40036100 45715400 27447600 36053400 39790900 43722500 46170300 15496700 40305700 45747100 30341400 36175700 39841200 43763200 46261400 15841200 40411000 45884900 30692000 36185500 40204700 43896900 46387900 16481500 42682100 46235600 32936900 36215200 40303500 44427300 46551600 20885400 43256500 46463000 32942700 36381000 40340900 44511200 46984700 34790500 43319100 46851000 33019400 37847300 40704800 44615300 47183600 35616700 43418800 46932200 33801400 38262700 40717600 44906600 47707300 35894400 43932600 47983300 34419100 38327400 40973900 44916000 47844900 35913900 44775800 35203200 38434500 42694700 45546000 47897800 35936600 45244300 35937700 39484900 43127700 45753000 47947900 35948600 45331400

    TABLE-US-00006 TABLE 6 Selected u-CG-DLRs and hm-CG-DLRs for fetal T21 and fetal gender determination DLR type Position Detection of fetal T21 aneuploidy uCG chr21 29732020 Detection of fetal T21 aneuploidy uCG chr21 33462648 Detection of fetal T21 aneuploidy uCG chr21 34672959 Detection of fetal T21 aneuploidy uCG chr21 36193512 Detection of fetal T21 aneuploidy uCG chr21 40801830 Detection of fetal T21 aneuploidy uCG chr21 44303692 Detection of fetal T21 aneuploidy uCG chr21 44741616 Detection of fetal T21 aneuploidy uCG chr21 45798427 Detection of fetal T21 aneuploidy hmCG chr21 30341466 Detection of fetal T21 aneuploidy hmCG chr21 35898716 Detection of fetal T21 aneuploidy hmCG chr21 38327475 Detection of fetal T21 aneuploidy hmCG chr21 40074274 Detection of fetal T21 aneuploidy hmCG chr21 40135661 Detection of fetal T21 aneuploidy hmCG chr21 44084933 Detection of fetal T21 aneuploidy hmCG chr21 45546038 Detection of fetal T21 aneuploidy hmCG chr21 46964859 Fetal gender determination uCG chrX 22425661 Fetal gender determination uCG chrX 50774868 Fetal gender determination uCG chrX 23776534 Fetal gender determination uCG chrX 9624546 Fetal gender determination uCG chrX 9389347 Fetal gender determination uCG chrX 62584036 Fetal gender determination uCG chrX 138802442 Fetal gender determination uCG chrY 14774154

    TABLE-US-00007 TABLE 7 [The list of selected DLRs in chromosome 13 and 18. The coordinate is shown for the first base pair of 100 bp u-DLRs and hm-DLRs] Pregnancy-specific chr13 u-DLRs 100008100 101482600 104426200 108936500 110709500 112672700 113632800 113742100 100038800 101710500 104949900 109038400 110846700 112681700 113649800 113761500 100066600 101742200 105608400 109386000 111057200 112690800 113653700 114185600 100315300 101779900 106272200 109429500 111090000 113103000 113673300 114187400 100392100 101961000 106323700 109819300 111773200 113138200 113684400 114203600 100479400 102346200 106590100 109944500 111852400 113279700 113694800 114215200 100529300 102578800 106662300 109949500 111997000 113416500 113697000 114441300 100570600 102811900 107601600 110174500 112101500 113420400 113698300 114458800 100575700 102906700 108033300 110178400 112226000 113532000 113707900 114471100 100596500 103155900 108233300 110193200 112288900 113544500 113709900 101100600 103702300 108310100 110254600 112293800 113551300 113715800 101185900 103951500 108413600 110481200 112623000 113551800 113731600 101313000 104351000 108869700 110653400 112664300 113556700 113739100 Pregnancy-specific chr18 u-DLRs 10164100 11127100 1225900 13326200 14966900 21431200 23230100 28368600 10230000 11280000 12431600 13421100 14970000 21579300 23449800 29048800 10248300 11283300 12561500 13431900 18700600 21587400 24037600 29144400 10263100 11378600 12565400 13432000 19028000 21668700 24125900 29926800 10272700 11378800 12723100 13497800 1911400 21709600 24318400 30488500 10433300 11532400 12741900 13511300 19222900 21972200 24360100 30722200 10563500 11750800 13135100 13517000 19273800 22278700 24421300 31581500 10706400 11759500 13226200 13527500 19294100 22307200 24459600 31941500 10723700 11802400 13246300 13625400 19898200 22733400 24709600 32154300 10842000 11817700 13247600 13627100 19991500 22783900 24873100 1091900 11847900 13254200 13645500 20008200 22800300 25465700 10936900 12035600 13270000 13647500 20815500 23006400 25734400 11101200 12234800 13278200 14162800 20895400 23092300 28207100 Tissue-specific chr13 u-DLRs 111000000 100286200 100395800 100591400 101203000 101763500 102608900 103229800 100057600 100291500 100406500 100596700 101212600 101820800 102732300 103236500 100066900 100315300 100442900 100656600 101288800 101825400 102775200 103354900 100078400 100318100 100446000 100689500 101314300 101885900 102852000 103365800 100080400 100328100 100456000 100704300 101334100 101931900 102901900 103400700 100097800 100341200 100463200 100932000 101391500 101996400 102906700 103427900 100110300 100344400 100479400 100989300 101404700 102271000 102979800 103430200 100122700 100358700 100541600 101034400 101425600 102293100 103044900 103539000 100140900 100375400 100557000 101045700 101593600 102397600 103045200 103547600 100142900 100375800 100559900 101097200 101593900 102498800 103094700 100152100 100377300 100563200 101160600 101596900 102548800 103174600 100172600 100387200 100565000 101194500 101605400 102558900 103202900 100271900 100395500 100570600 101199900 101742200 102573800 103207500 Tissue-specific chr18 u-DLRs 10004000 10218000 10366100 10472500 10723700 10825100 10890600 11037100 10007600 10218900 10369400 10472800 10724200 10828600 10902200 11049800 10010500 10220300 10372500 1047300 10730800 10834900 10925700 11054500 10013200 10230100 10373000 10500900 10731400 10838000 10936900 11058000 10029700 10231800 10381300 10571200 10734700 10838800 10971200 11063500 10030300 10263000 10398500 10582400 10737400 10844200 10986100 11068000 10035100 10272700 10403400 10592900 10745300 10844600 10990400 11071000 10052400 10287000 10404600 10682200 10755600 10845500 10993600 11074000 10068500 10300900 10408400 10682500 10774400 10847900 10994000 11099500 10100200 10301900 10410400 10703600 10775500 10864900 11009700 10120900 10332200 10423100 10708300 10776700 10873300 11012000 10153400 10343100 10433300 10717300 10785400 10878300 11021400 10164600 10346600 10450400 10721900 10806500 10888800 11027200 Pregnancy-specific chr13 hm-DLRs 100305000 107282100 114215200 28102000 43394700 46000500 50682600 92422900 100776700 110322500 20563600 28571600 44470900 47112300 50238200 99310800 107214300 111140600 21527500 28936500 45023500 Pregnancy-specific chr18 hm-DLRs 24079700 3473100 56528700 72186200 9478700 3172300 35234800 61869500 73934900 Tissue-specific chr13 hm-DLRs 111000000 100756100 101237300 101687300 101833600 102068100 102116200 103304300 100015300 100765100 101242700 101701700 101837400 102076800 102168800 103304500 100033700 100828300 101255600 101702000 101898100 102078200 102183900 103344400 100078000 100931800 101263700 101710300 101956100 102082400 102204700 103349700 100084900 100980400 101281000 101734400 101960500 102102200 102206000 103358800 100085400 100982800 101286200 101751100 101961200 102105900 102228800 103362900 100126100 101075300 101305600 101751500 101990200 102106400 102238000 103408800 100136900 101094300 101320900 101764100 101991600 102106800 102344000 103481700 100138400 101098400 101365300 101777000 101992300 102108000 102407700 105737500 100211300 101122000 101399900 101794700 102007400 102108700 102553800 100231000 101182400 101451600 101796000 102052700 102109100 102580000 100243900 101199800 101525100 101799300 102060500 102109800 103259500 100589400 101202400 101533600 101831100 102060600 102112500 103265400 Tissue-specific chr18 hm-DLRs 10018900 10207900 10935800 11956100 12326400 12659400 12855600 13622800 10020300 10373100 11208700 11971200 12367700 12660600 12871700 1379600 10030100 10377900 11274300 12027100 12375000 12734300 12908700 1399600 10034200 10547100 11571800 12027200 12389700 12738100 12908900 14090000 10045400 10560700 11690300 12231400 12443300 12738600 1296400 14975600 10046100 10710600 11807300 12251400 12463100 12738700 12969400 15021300 10052400 107600 11829700 12254300 12467300 12748100 12972900 18573300 10055600 10796000 11857200 12254900 12476900 12775300 12995300 18637700 10073000 10798100 11900 12255500 12521400 12782800 12996400 18710400 10093500 10799200 11912400 12282900 12547600 12788800 13137700 10121200 10923400 11921600 12289600 12565700 12839200 1331300 10169200 10927300 11947700 12301800 12641500 12849500 13608200 10190600 10929600 11952800 12324700 12646700 12850200 13611300

    NON PATENT LITERATURE

    [0116] NPL1: Akolekar R, Beta J, Picciarelli G, Ogilvie C, D'Antonio F. Procedure-related risk of miscarriage following amniocentesis and chorionic villus sampling: a systematic review and meta-analysis. Ultrasound Obstet Gynecol. 2015 January; 45(1):16-26. doi: 10.1002/uog.14636. [0117] NPL2: Chan K C, Zhang J, Hui A B, Wong N, Lau T K, Leung T N, Lo K W, Huang D W, Lo Y M. Size distributions of maternal and fetal DNA in maternal plasma. Clin Chem. 2004 January; 50(1):88-92. [0118] NPL3: Chim S S, Jin S, Lee T Y, Lun F M, Lee W S, Chan L Y, Jin Y, Yang N, Tong Y K, Leung T Y, Lau T K, Ding C, Chiu R W, Lo Y M. Systematic search for placental DNA-methylation markers on chromosome 21: toward a maternal plasma-based epigenetic test for fetal trisomy 21. Clin Chem. 2008 March; 54(3):500-11. [0119] NPL3: Chim S S, Tong Y K, Chiu R W, Lau T K, Leung T N, Chan L Y, Oudejans C B, Ding C, Lo Y M. Detection of the placental epigenetic signature of the maspin gene in maternal plasma. Proc Natl Acad Sci USA. 2005 Oct. 11; 102(41):14753-8. [0120] NPL4: Chiu R W, Chan K C, Gao Y, Lau V Y, Zheng W, Leung T Y, Foo C H, Xie B, Tsui N B, Lun F M, Zee B C, Lau T K, Cantor C R, Lo Y M. Noninvasive prenatal diagnosis of fetal chromosomal aneuploidy by massively parallel genomic sequencing of DNA in maternal plasma. Version 2. Proc Natl Acad Sci USA. 2008 Dec. 23; 105(51):20458-63. [0121] NPL5: Daniels G, Finning K, Martin P, Summers J. Fetal blood group genotyping: present and future. Ann N Y Acad Sci. 2006 September; 1075:88-95. [0122] NPL6: Fan H C, Blumenfeld Y J, Chitkara U, Hudgins L, Quake S R. Analysis of the size distributions of fetal and maternal cell-free DNA by paired-end sequencing. Clin Chem. 2010 August; 56(8):1279-86. [0123] NPL7: Gibas P, Narmontė M, Staševskij Z, Gordevičius J, Klimašauskas S, Kriukienė E. Precise genomic mapping of 5-hydroxymethylcytosine via covalent tether-directed sequencing. PLoS Biol. 2020 accepted [0124] NPL8: Jensen T J, Kim S K, Zhu Z, Chin C, Gebhard C, Lu T, Deciu C, van den Boom D, Ehrich M. Whole genome bisulfite sequencing of cell-free DNA and its cellular contributors uncovers placenta hypomethylated domains. Genome Biol. 2015 Apr. 15; 16(1):78. [0125] NPL9: Keravnou A, Ioannides M, Tsangaras K, Loizides C, Hadjidaniel M D, Papageorgiou E A, Kyriakou S, Antoniou P, Mina P, Achilleos A, Neofytou M, Kypri E, Sismani C, Koumbaris G, Patsalis P C. Whole-genome fetal and maternal DNA methylation analysis using MeDIP-NGS for the identification of differentially methylated regions. Genet Res (Camb). 2016 Nov. 11; 98:e15. [0126] NPL10: Kriukienė E, Labrie V, Khare T, Urbanavičiūtė G, Lapinaitė A, Koncevičius K, Li D, Wang T, Pai S, Ptak C, Gordevičius J, Wang S C, Petronis A, Klimašauskas S. DNA unmethylome profiling by covalent capture of CpG sites. Nat Commun. 2013; 4:2190. [0127] NPL11: Li Y, Zimmermann B, Rusterholz C, Kang A, Holzgreve W, Hahn S. Size separation of circulatory DNA in maternal plasma permits ready detection of fetal DNA polymorphisms. Clin Chem 2004; 50: 1002-11. [0128] NPL12: Lo Y M, Chan K C, Sun H, Chen E Z, Jiang P, Lun F M, Zheng Y W, Leung T Y, Lau T K, Cantor C R, Chiu R W. Maternal plasma DNA sequencing reveals the genome-wide genetic and mutational profile of the fetus. Sci Transl Med. 2010 Dec. 8; 2(61):61ra91. [0129] NPL13: Lo Y M, Chiu R W. Prenatal diagnosis: progress through plasma nucleic acids. Nat Rev Genet. 2007 January; 8(1):71-7. [0130] NPL14: Lo Y M, Corbetta N, Chamberlain P F, Rai V, Sargent I L, Redman C W, Wainscoat J S. Presence of fetal DNA in maternal plasma and serum. Lancet 1997; 350:485-487. [0131] NPL15: Lo Y M, Hjelm N M, Fidler C, Sargent I L, Murphy M F, Chamberlain P F, Poon P M, Redman C W, Wainscoat J S. Prenatal diagnosis of fetal RhD status by molecular analysis of maternal plasma. N Engl J Med. 1998 Dec. 10; 339(24):1734-8. [0132] NPL16: Lun F M, Chiu R W, Sun K, Leung T Y, Jiang P, Chan K C, Sun H, Lo Y M. Noninvasive prenatal methylomic analysis by genomewide bisulfite sequencing of maternal plasma DNA. Clin Chem. 2013 November; 59(11):1583-94. [0133] NPL17: Masevičius V, Nainytė M, Klimašauskas S. Synthesis of S-Adenosyl-L-Methionine Analogs with Extended Transferable Groups for Methyltransferase-Directed Labeling of DNA and RNA. Curr Protoc Nucleic Acid Chem. 2016 Mar. 1; 64:1.36.1-1.36.13. [0134] NPL18: Old R W, Crea F, Puszyk W, Hulten M A. Candidate epigenetic biomarkers for non-invasive prenatal diagnosis of Down syndrome. Reprod Biomed Online. 2007 August; 15(2):227-35. [0135] NPL19: Papageorgiou E A, Fiegler H, Rakyan V, Beck S, Hulten M, Lamnissou K, Carter N P, Patsalis P C. Sites of differential DNA methylation between placenta and peripheral blood: molecular markers for noninvasive prenatal diagnosis of aneuploidies. Am J Pathol. 2009 May; 174(5):1609-18. [0136] NPL20: Parker S E, Mai C T, Canfield M A, Rickard R, Wang Y, Meyer R E, Anderson P, Mason C A, Collins J S, Kirby R S, Correa A; National Birth Defects Prevention Network. Updated National Birth Prevalence estimates for selected birth defects in the United States, 2004-2006. Birth Defects Res A Clin Mol Teratol. 2010 December; 88(12):1008-16. [0137] NPL21: Song C X, Szulwach K E, Fu Y, Dai Q, Yi C, Li X, Li Y, Chen C H, Zhang W, Jian X, Wang J, Zhang L, Looney T J, Zhang B, Godley L A, Hicks L M, Lahn B T, Jin P, He C. Selective chemical labeling reveals the genome-wide distribution of 5-hydroxymethylcytosine. Nat Biotechnol. 2011 January; 29(1):68-72. [0138] NPL22: Staševskij Z, Gibas P, Gordevičius J, Kriukienė E, Klimašauskas S. Tethered Oligonucleotide-Primed Sequencing, TOP-Seq: A High-Resolution Economical Approach for DNA Epigenome Profiling. Mol Cell. 2017 Feb. 2; 65(3):554-564.e6. [0139] NPL23: Tong Y K, Jin S, Chiu R W, Ding C, Chan K C, Leung T Y, Yu L, Lau T K, Lo Y M. Noninvasive prenatal detection of trisomy 21 by an epigenetic-genetic chromosome-dosage approach. Clin Chem. 2010 January; 56(1):90-8. [0140] NPL24: Tsaliki E, Papageorgiou E A, Spyrou C, Koumbaris G, Kypri E, Kyriakou S, Sotiriou C, Touvana E, Keravnou A, Karagrigoriou A, Lamnissou K, Velissariou V, Patsalis P C. MeDIP real-time qPCR of maternal peripheral blood reliably identifies trisomy 21. Prenat Diagn. 2012 October; 32(10):996-1001. [0141] NPL25: Weber M, Davies J J, Wittig D, Oakeley E J, Haase M, Lam W L, Schübeler D. Chromosome-wide and promoter-specific analyses identify sites of differential DNA methylation in normal and transformed human cells. Nat Genet. 2005 August; 37(8):853-62. [0142] NPL26: Zimmermann B, Holzgreve W, Wenzel F, Hahn S. Novel real-time quantitative PCR test for trisomy 21. Clin Chem. 2002 February; 48(2):362-3.