Method for diagnosing Parkinson's disease using nasal mucus, composition therefore, and kit comprising the same
11655507 · 2023-05-23
Assignee
- Research & Business Foundation SUNGKYUNKWAN UNIVERSITY (Suwon-si, KR)
- IUCF-HYU (INDUSTRY-UNIVERSITY COOPERATION FOUNDATION HANYANG UNIVERSITY) (Seoul, KR)
Inventors
- Yunjong Lee (Cheongju-si, KR)
- Hyojung Kim (Daegu, KR)
- Seok-Hyun Cho (Seoul, KR)
- Seok-Jae Kang (Gwacheon-si, KR)
- Hee-Tae Kim (Seoul, KR)
Cpc classification
G16B25/10
PHYSICS
G16H50/20
PHYSICS
C12Q2600/166
CHEMISTRY; METALLURGY
C12Q1/6883
CHEMISTRY; METALLURGY
C12Q2600/112
CHEMISTRY; METALLURGY
International classification
Abstract
The present disclosure relates to a method for diagnosing Parkinson's disease in which the method includes measuring the expression level of Parkinson's disease-related genes from a subject's nasal mucus sample, a composition for diagnosing Parkinson's disease, and a kit including the same.
Claims
1. A method for diagnosing Parkinson's disease, the method comprising: obtaining a nasal mucus sample from a patient; measuring expression level of a transcript related to one or more Parkinson's disease-related genes, from cells in the nasal mucus sample and normalizing the measured expression level, wherein the Parkinson's disease-related genes are parkin and AIMP2, and the expression level is measured by using one or more oligonucleotide comprising the nucleotide sequence of at least one of SEQ ID No. 5, 6, 7 or 8; and determining whether said patient has Parkinson's disease, by comparing the normalized expression level with an expression level obtained from normal subjects.
2. The method of claim 1, wherein the measured expression level is normalized based on an expression level of a standard gene, the standard gene comprising at least one of GAPDH, β-actin, or tubulin.
3. The method of claim 1, wherein the expression level of the genes is measured using reverse transcriptase polymerase chain reaction (RT-PCR), competitive RT-PCR, real-time quantitative RT-PCR, quantitative RT-PCR, RNase protection method, Northern blotting or DNA chip technology.
4. The method of claim 1, wherein the comparing of the normalized expression levels is carried out by comparing the normalized expression level of transcript measured in the nasal mucus sample with a predetermined cutoff value.
5. The method of claim 4, wherein said patient is determined to have Parkinson's disease when the normalized expression level of parkin transcript measured in the nasal mucus sample is lower compared to the cutoff value.
6. The method of claim 4, wherein said patient is determined to have Parkinson's disease when the normalized expression level of AIMP2 transcript measured in the nasal mucus sample is higher compared to the cutoff value.
7. A method for diagnosing Parkinson's disease, the method comprising: measuring an expression level of parkin gene and an expression level of AIMP2 gene in a nasal mucus sample of a patient, wherein the measuring of the expression levels comprises detecting a gene transcript, and the expression levels are measured by using one or more oligonucleotide comprising the nucleotide sequence of at least one of SEQ ID No. 5, 6, 7 or 8; and determining whether said patient has Parkinson's disease based on the measured expression level of parkin gene and the measured expression level of AIMP2 gene.
8. The method of claim 7, wherein the gene transcript comprises an RNA.
9. The method of claim 7, further comprising measuring an expression level of one or more standard gene in the nasal mucus sample, and using the expression level of the one or more standard gene with the measured expression level of parkin and AIMP2 genes to determine whether said patient has Parkinson's disease.
10. The method of claim 7, wherein the measuring of the gene expression level of the parkin gene comprises using one or more oligonucleotide comprising the nucleotide sequence of SEQ ID No. 7 or 8.
11. The method of claim 7, wherein the measuring of the gene expression level of the AIMP2 gene comprises using one or more oligonucleotide comprising the nucleotide sequence of SEQ ID No. 5 or 6.
12. The method of claim 7, wherein the determining of whether said patient has Parkinson's disease comprises normalizing the measured expression level of parkin gene based on an expression level of a standard gene.
Description
BRIEF DESCRIPTION OF THE DRAWINGS
(1)
(2)
(3)
(4)
(5)
(6)
(7)
(8)
(9)
DETAILED DESCRIPTION
(10) In the following detailed description, reference is made to the accompanying drawing, which forms a part hereof. The illustrative embodiments described in the detailed description, drawings, and claims are not meant to be limiting. Other embodiments may be utilized, and other changes may be made, without departing from the spirit or scope of the subject matter presented here.
(11) Hereinafter, embodiments of the present disclosure are described in detail with reference to the accompanying drawings so that those skilled in the art may easily implement the present disclosure. However, the present disclosure may be embodied in many different forms and should not be construed as limited to the embodiments set forth herein. Further, portions unrelated to the description excluded to clearly explain the present disclosure.
(12) Throughout the present specification, when a part “includes” a certain part, it means that one part may further include other parts without excluding other parts unless specifically described otherwise.
(13) The term of indicating the extent “about” or “substantially” used in the present specification is intended to have meanings close to numerical values or ranges specified with an allowable error and intended to prevent accurate or absolute numerical values disclosed for understanding of the present disclosure from being illegally or unfairly used by any unconscionable third party. Further, the term “step of (˜ing)” or “step of” used in the present specification does not mean “step for”.
(14) Throughout the present specification, the term “combination of” included in Markush type description means mixture or combination of one or more components, selected from a group consisting of components described in Markush type and thereby means that the present disclosure includes one or more components selected from the Markush group.
(15) Throughout the present specification, the description of “A and/or B” means “A, B, or A and B.”
(16) Throughout the present specification, the term “diagnosis” means identifying the presence or characteristic of a pathological condition. Among them, the present disclosure is useful for the diagnosis of Parkinson's disease. The present disclosure includes predicting the onset and progression of Parkinson's disease. In particular, an early predictor of Parkinson's disease is very important, and according to the method of the present disclosure, Parkinson's disease-related genes or proteins in nasal mucus which can be easily collected from suspected patients with Parkinson's disease who have olfactory abnormalities may be used as a diagnostic marker for Parkinson's disease. Here, “marker for diagnosis or diagnosis marker” is a substance which can diagnose the disease by distinguishing the cells of Parkinson's disease patients from the cells of the normal people who does not have Parkinson's disease, and can be selected from organic biomolecules such as polypeptides, nucleic acids, lipids, glycolipids, glycoproteins, and sugars (monosaccharides, disaccharides, polysaccharides, etc.) which are increased or decreased in cells of Parkinson's disease patients compared to the cells of normal people.
(17) Throughout the present specification, the term “nucleic acid” is meant to include any DNA or RNA, for example, chromosomes, mitochondria, viruses, and/or bacterial nucleic acids present in tissue samples. It includes one or both strands of a double-stranded nucleic acid molecule and includes any fragment or portion of an intact nucleic acid molecule.
(18) Throughout the present specification, the term “gene” means any nucleic acid sequence or portion thereof that has a functional role in protein coding or transcription or in the regulation of other gene expression. The gene may consist of all nucleic acid encoding a functional protein or only a portion of a nucleic acid encoding or expressing a protein. Nucleic acid sequences may include gene abnormalities in exons, introns, initiation or termination regions, promoter sequences, other regulatory sequences, or unique sequences adjacent to genes.
(19) Throughout the present specification, the term “gene expression” generally refers to a cellular process in which a transcript and further biologically active polypeptide is produced from a DNA sequence and exhibits biological activity in cells. In that sense, the gene expression includes not only transcriptional and translational processes, but also post-transcriptional and post-translational processes that may affect the biological activity of a gene or gene product. The processes include, but are not limited to, RNA synthesis, processing and transport, as well as post-translational modifications of polypeptide synthesis, transport and polypeptide. The present disclosure includes both mRNA expression and protein expression as an aspect of gene expression.
(20) Throughout the present specification, the term “primer” means an oligonucleotide sequence which hybridizes to complementary RNA or DNA-target polynucleotides and functions as a starting point for the stepwise synthesis of polynucleotides from mononucleotides, for example, by the action of nucleotidyltransferases occurred in PCR.
(21) Hereinafter, a composition for diagnosing Parkinson's disease, a kit for diagnosing Parkinson's disease, and a method for providing information for diagnosing Parkinson's disease are described in detail with reference to embodiments, examples, and drawings. However, the present disclosure is not limited to these embodiments, embodiments, and drawings.
(22) A first aspect of the present disclosure relates to a composition for diagnosing Parkinson's disease, in which the composition includes an agent for measuring expression levels of Parkinson's disease-related genes in isolated nasal mucus.
(23) The present disclosure's composition is to diagnose Parkinson's disease using nasal mucus, which is easily collectable compared with the cerebrospinal fluid commonly used to diagnose Parkinson's disease. Nasal mucus is collected from the nasal cavity in patients with Parkinson's disease, and by measuring the expression levels of Parkinson's disease-related genes from the nasal mucus, Parkinson's disease can be diagnosed early with high accuracy.
(24) For example, the nasal mucus may be obtained from a nasal wash solution, but may not be limited thereto. For example, the nasal wash may be performed using saline or water (distilled water), but may not be limited thereto.
(25) Measurement of expression levels of Parkinson's disease-related genes in the isolated nasal mucus may be to isolate the cells in the nasal mucus and to measure the expression levels of the gene in the cells, but may not be limited thereto.
(26) According to an embodiment of the present disclosure, the Parkinson's disease-related gene may be selected from the group consisting of α-synuclein (SNCA), parkin, ZNF746 (PARIS), RNF146 c-Abl and AIMP2, but may not be limited thereto. The genes that are expressed differently in nasal mucus in Parkinson's patients compared to those in normal people can be used without limitation.
(27) According to an embodiment of the present disclosure, the agent for measuring the expression level may include a nucleic acid primer that binds to a nucleic acid sequence of Parkinson's disease-related gene or its corresponding sequence or an antibody or aptamer that specifically binds to a peptide or protein expressed by the Parkinson's disease gene, but may not be limited thereto. Any method of quantifying gene expression levels, which is commonly performed in the technical field to which the present disclosure belongs may be used without limitation.
(28) A second aspect of the present disclosure relates to a kit for diagnosing Parkinson's disease, in which the kit includes the composition according to the first aspect of the present disclosure.
(29) When the kit of the present disclosure is applied to a PCR amplification process, the kit may optionally contain reagents necessary for PCR amplification, such as buffers, DNA polymerases (e.g., thermally stable DNA polymerases obtained from Thermus aquaticus (Taq), Thermus thermophilus (Tth), Thermus filiformis, Thermis flavus, Thermococcus literalis or Pyrococcus furiosus (Pfu)), DNA polymerase cofactors and dNTPs.
(30) When the kit of the present disclosure is applied to an immunoassay, the kit may optionally include a secondary antibody and a substrate of the label. Furthermore, the kit according to the present disclosure may be manufactured in the multiple separate packaging or compartments containing the reagent components as described above.
(31) A third aspect of the present disclosure relates to a method for providing information on diagnosing Parkinson's disease, in which the method includes separating nasal mucus from a suspected patient of Parkinson's disease, measuring expression level of a Parkinson's disease-related gene and its transcript, or a peptide or a protein expressed therefrom, from the cells in the nasal mucus and normalizing the measured results to expression of standard genes, and comparing the normalized expression level with the normalized expression level measured for normal subjects.
(32) According to an embodiment of the present disclosure, the Parkinson's disease-related gene may be selected from the group consisting of α-synuclein (SNCA), parkin, ZNF746 (PARIS), RNF146, c-Abl and AIMP2, but may not be limited thereto.
(33) According to an embodiment of the present disclosure, the standard gene may be a housekeeping gene, preferably GAPDH, β-actin, or tubulin. However, genes may be used without limitation as long as the genes exhibit constant expression among individuals regardless of the presence of Parkinson's disease.
(34) According to an embodiment of the present disclosure, the expression level of the gene may be measured using reverse transcriptase polymerase (RT-PCR), competitive RT-PCR, real-time quantitative RT-PCR, quantitative RT-PCR, RNase protection method, Northern blotting or DNA chip technology and may be measured using sequencing qualitative, quantitative analysis or NGS, but may not be limited thereto.
(35) According to an embodiment of the present disclosure, the expression level of the protein or peptide may be measured using Western blot, enzyme linked immunosorbent assay (ELISA), immunoprecipitation assay, complement fixation assay, fluorescence activated cell sorter (FACS) or a protein chip, but may not be limited thereto.
(36) According to an embodiment of the present disclosure, the comparison of normalized expression levels may be carried out by comparing with a predetermined cutoff value, but may not be limited thereto. In this case, the cutoff value may be determined according to a ROC curve, which is a curve drawn with sensitivity and 1-specificity of the measured value. That is, after normalizing gene expression levels in nasal mucus of Parkinson's patients and nasal mucus of normal persons, the cutoff values are predetermined from the ROC curve results using the same. Then, the normalized value of the gene expression level in the nasal mucus of the individual to be diagnosed is compared with the predetermined cutoff value to provide information for the diagnosis of Parkinson's disease, but may not be limited thereto.
(37) In the method for providing information on diagnosing Parkinson's disease according to the present disclosure, the measurement result of Parkinson's disease-related gene expression level (normalized expression level) may be compared with that of normal group or the predetermined cutoff value to diagnose Parkinson's disease.
(38) According to an embodiment of the present disclosure, the presence of Parkinson's disease may be determined when the normalized expression level of Parkin is lower compared to the cutoff value.
(39) According to an embodiment of the present disclosure, the presence of Parkinson's disease may be determined when the normalized expression level of AIMP2 is higher compared to the cutoff value.
(40) The present disclosure relates to a new early diagnosis of Parkinson's disease. The present disclosure first suggests that Parkinson's disease can be diagnosed by analyzing transcripts from nasal mucus. Further, the present disclosure suggests that Parkinson's disease-related genes Parkin and AIMP2 may be efficiently utilized for Parkinson's disease-specific biomarkers.
(41) Hereinafter, the present disclosure is described in more detail with reference to the following examples, but the following examples are for illustrative purposes only and are not intended to limit the scope of the present disclosure.
EXAMPLES
(42) 1. Subject Selection and Evaluation
(43) In order to evaluate the expression of markers for Parkinson's disease and multiple system atrophy (MSA) in nasal mucus, 30 patients with Parkinson's disease, 10 patients with MSA, and 13 normal patients were selected. All patients were diagnosed with Parkinson's disease according to the United kingdom brain bank diagnostic criteria (UKBBDC), and MSA patients were diagnosed according to the criteria set forth in Gilman, S. et al. Second consensus statement on the diagnosis of multiple system atrophy, Neurology 71, 670-.676. The following table 1 shows information about the test subject.
(44) TABLE-US-00001 TABLE 1 Control PD MSA p value N 13 30 10 Male:female 7:6 15:15 7:3 0.544 Age(years) 64.7 ± 8.9 70.7 ± 9.4 67.9 ± 2.2 0.093 H&Y 2.5 ± 0.2 UPDRS 28.2 ± 3.0
(45) 2. Whole Transcript Purification and cDNA Synthesis in Nasal Mucus Cells
(46) After the sterile normal saline solution was introduced into normal or patient nasal cavity twice (puff; total of 10 μl), nasal fluid was collected through suction collector. Thereafter, the nasal fluid was transferred to a laboratory bench, and crust and debris were removed with a cell strainer (100 μm, SPL, Pocheon, Gyeonggi-do, South Korea). Then, the nasal fluid was centrifuged at 6000 rpm for 5 minutes, and the cell pellet was resuspended in 1 ml of Trizol. The result was stored and used at −80° C.
(47) Confirmation experiments were first conducted to determine whether detectable levels of transcripts could be purified from nasal mucus cells (
(48) 3. Quantification of Target Gene by RTO PCR
(49) The cDNA library was synthesized for nasal mucus in normal and Parkinson's patients, and then a pair of primers which is specific for Parkinson's disease-related genes (α-synuclein, c-Abl, RNF146, AIMP2, Parkin and ZNF746 (PARIS)) were designed to perform RTQ PCR. Information on the primers used is shown in Table 2 and Sequence Listing. The fluorescence of SYBR green was measured at each amplification step. Peaks were identified for the amplicons of the target gene in the melt curve stage to confirm the selectivity of the PCR products.
(50) TABLE-US-00002 TABLE 2 Direction Gene of Primer Sequence 1 c-Abl Forward CATCACGCCAGTCAACAGTCT (SEQ ID NO: 1) Reverse GTACACCCTCCCTTCGTATCT (SEQ ID NO: 2) 2 α-synuclein Forward AAGAGGGTGTTCTCTATGTAG GC (SEQ ID NO: 3) Reverse GCTCCTCCAACATTTGTCACT T (SEQ ID NO: 4) 3 AIMP2 Forward AGGTAAAGCCCTATCACGGG (SEQ ID NO: 5) Reverse ACAGGTTAGACTCTTCCTGCA (SEQ ID NO: 6) 4 arkin Forward CAGCAGTATGGTGCAGCGGA (SEQ ID NO: 7) Reverse TCAAATACGGCACTGCACTC (SEQ ID NO: 8) 5 PARIS Forward GCTGGAATTTCCGGTGTAAAC C (SEQ ID NO: 9) Reverse GGGGTCCAAGATGGCCTCT (SEQ ID NO: 10) 6 RNF146 Forward ATTCCCGAGGATTTCCTTGAC A (SEQ ID NO: 11) Reverse GCTCATCGTACTGCCACCA (SEQ ID NO: 12) 7 OMP Forward TACCGCCTCAACTTCACCCA (SEQ ID NO: 13) Reverse CCTCCTTGCGCCAGAAGATG (SEQ ID NO: 14) 8 GAPDH Forward AAACCCATCACCATCTTCCAG (SEQ ID NO: 15) Reverse AGGGGCCATCCACAGTCTTCT (SEQ ID NO: 16)
(51) Because the amplicons of the PCR products for the nasal mucus cDNA library of the normal group and Parkinson's patients had one main peak for the target genes, it was confirmed that the PCR for the nasal mucus library was successfully performed.
(52) The quantitative value of each genome in the nasal mucus of the normal group (CTRL) and Parkinson's patient (IPD) was normalized to the quantitative value of GAPDH used as internal loading control to identify the relative amounts of target genes in each group.
(53) Parkin and AIMP2 are known genes that are linked to Parkinson's disease pathology. Parkin is an E3 ligase enzyme that mediates ubiquitination labeling of substrate proteins and degradation by proteasomes. Mutations of this gene are known to cause the recessive inheritance of Parkinson's disease by inhibiting Parkin's enzymatic activity. It has also been reported that Parkin's mutations as well as reduction of nitrosylation, phosphorylation, and solubility are involved in sporadic Parkinson's disease pathology. There has been no previous report on the reduced association of Parkinson's disease with Parkin transcripts in nasal wash solution. AIMP2 is a toxic protein regulated by Parkin and is present at low levels in normal conditions. However, AIMP2 has been reported by Parkinson's midbrain tissue autopsy that quantitative accumulation occurs in the case of Parkin's mutation or enzyme activity decrease. In particular, animal experiments have shown that accumulation of AIMP2 plays an important pathology in causing major lesions in Parkinson's disease including the death of dopamine neurons. Similarly, there has been no reported on changes in AIMP2 transcripts and disease linkages in nasal wash solution in Parkinson's disease patients. Therefore, the present disclosure first confirmed that the decrease of Parkin transcripts and the increase of AIMP2 transcripts in nasal mucus could be used as early diagnostic markers as risk factors for the development of Parkinson's disease.
(54) 4. ROC Curve Analysis for Parkin and AIPM2
(55) In particular, as shown in
(56) 5. Analysis of Parkin and AIMP2 Transcript Expression Levels and their Association with H&Y and UPDRS
(57) The expression level of Parkin or AIMP2 in nasal mucus was examined in 14 Parkinson patients in the H&Y 1-2.5 stage, 15 Parkinson patients in the H&Y 3-5 stage, and 13 normal patients. As a result, as shown in
(58) Further, the association between the UPDRS score and the level of transcript expression of Parkin or AIMP2 was examined. As shown in
(59) 6. Identification of Parkin and AIMP2 Transcript Expression Levels and their Association with MSA
(60) The expression levels of Parkin and AIMP2 transcripts were confirmed with samples of 10 MSA patients and samples of normal people.
(61) The results are shown in
(62) As shown in
(63) The above description of the present disclosure is for illustrative purposes, and it will be understood that a person of ordinary skill in the technical field to which the present disclosure belongs may readily transform into another specific form without changing the technical spirit or essential characteristics of the present disclosure. Therefore, it should be understood that the examples described above are exemplary in all respects and not limiting. For example, each component described as a single type may be implemented in a distributed manner, and similarly, components described as distributed may be implemented in a combined form.
(64) It should be interpreted that the scope of the present disclosure is indicated by the following claims rather than the above description, and all changes or modifications derived from the meaning and scope of the claims and their equivalents are included in the scope of the present disclosure.
(65) From the foregoing, it will be appreciated that various embodiments of the present disclosure have been described herein for purposes of illustration, and that various modifications may be made without departing from the scope and spirit of the present disclosure. Accordingly, the various embodiments disclosed herein are not intended to be limiting, with the true scope and spirit being indicated by the following claims.