Method and strains for reducing byproduct succinic acid in fermentation process of L-malic acid and use thereof
11655488 · 2023-05-23
Assignee
Inventors
Cpc classification
C12P7/46
CHEMISTRY; METALLURGY
C12Y103/00
CHEMISTRY; METALLURGY
International classification
C12P7/46
CHEMISTRY; METALLURGY
C07K9/00
CHEMISTRY; METALLURGY
C12N9/00
CHEMISTRY; METALLURGY
Abstract
The disclosure discloses an Aspergillus niger engineered strain for reducing byproduct succinic acid in a fermentation process of L-malic acid. The Aspergillus niger engineered strain is an Aspergillus niger engineered strain in which fumaric acid reductase frdA and fumaric acid reductase flavoprotein subunit frdB are simultaneously knocked out. The disclosure provides an frdA and frdB gene double-knockout Aspergillus niger strain, and a method for greatly reducing byproduct succinic acid in a fermentation process of L-malic acid. By the disclosure, the byproduct succinic acid accumulated in a production process of malic acid through fermentation of Aspergillus niger is significantly reduced, a cost in a downstream separation and purification process of malic acid is decreased, and good strains are provided for producing malic acid via industrial fermentation.
Claims
1. A method of constructing an Aspergillus niger engineered strain, wherein the Aspergillus niger engineered strain is capable of reducing the byproduct succinic acid in a fermentation process for making L-malic acid, wherein fumaric acid reductase frdA and fumaric acid reductase flavoprotein subunit frdB are simultaneously knocked out from the Aspergillus niger engineered strain; wherein the method comprises the following steps: (1) respectively amplifying upstream and downstream sequence fragments of a gene frdA through PCR with a wild type Aspergillus niger ATCC1015 genome as a template, and recovering PCR products to respectively obtain target fragments; and cloning the upstream and downstream sequence fragments of the gene frdA into a vector pLH594, so as to construct a fumaric acid reductase frdA knockout vector pLH1067; wherein the downstream sequence of the gene frdA is SEQ NO:3, and the upstream sequence of the gene frdA is SEQ NO: 4; and transferring said vector pLH1067 into Aspergillus niger S489 under the mediation of Agrobacterium, and conducting transformant screening and hygromycin resistance gene recombination to obtain a frdA gene knockout strain K1; and (2) respectively amplifying upstream and downstream sequence fragments of gene frdB through PCR with a wild type Aspergillus niger ATCC1015 strain genome as a template, and recovering PCR products to obtain target sequence fragments; and cloning the upstream and downstream target sequence fragments of the gene frdB into vector pLH594, so as to construct a fumaric acid reductase flavoprotein subunit frdB knockout vector pLH1162; wherein the downstream sequence of the gene frdB is SEQ NO:7, and the upstream sequence of the gene frdB is SEQ NO: 8; and transferring vector pLH1162 into the frdA gene knockout strain K1 under the mediation of Agrobacterium, and conducting transformant screening and hygromycin resistance gene recombination to obtain a frdA gene and frdB gene double-knockout strain K2, that is the Aspergillus niger engineered strain for reducing the byproduct succinic acid accumulation in the fermentation process for making L-malic acid.
2. The method according to claim 1, wherein the amino acid sequence encoded by the fumaric acid reductase gene frdA is SEQ NO:2, the gene sequence of the fumaric acid reductase flavoprotein subunit gene frdB is SEQ NO:5, and the amino acid sequence encoded by the fumaric acid reductase flavoprotein subunit gene frdB is SEQ NO:6.
3. The method according to claim 1, wherein the gene sequence of the fumaric acid reductase gene frdA is SEQ ID NO: 1, and the gene sequence of the fumaric acid reductase flavoprotein subunit gene frdB is SEQ ID NO: 5.
Description
DESCRIPTION OF THE DRAWINGS
(1)
(2)
(3)
(4)
(5)
(6)
(7)
(8)
(9)
(10)
(11)
(12)
(13)
(14)
(15)
(16)
DETAILED DESCRIPTION OF PREFERRED EMBODIMENTS
(17) To better understand the disclosure, the disclosure will be further described in detail in combination with embodiments. However, the scope claimed by the disclosure is not limited to the scope represented by embodiments.
(18) Raw materials used in the disclosure, unless otherwise noted, are all conventional commercially available products. The methods used in the disclosure, unless otherwise noted, are all conventional methods in the art. The masses of various substances used in the disclosure are conventional use masses.
(19) An Aspergillus niger engineered strain for reducing byproduct succinic acid in a fermentation process of L-malic acid is an Aspergillus niger engineered strain in which fumaric acid reductase frdA and fumaric acid reductase flavoprotein subunit frdB are simultaneously knocked out.
(20) Preferably, the gene sequence of the fumaric acid reductase gene frdA is SEQ NO:1, the amino acid sequence of the fumaric acid reductase gene frdA is SEQ NO:2, the gene sequence of the fumaric acid reductase flavoprotein subunit gene frdB is SEQ NO:5, and the amino acid sequence of the fumaric acid reductase flavoprotein subunit gene frdB is SEQ NO:6.
(21) Preferably, the fumaric acid reductase gene frdA is NCBI-locus_tag ANI_1_944144, and the fumaric acid reductase flavoprotein subunit gene frdB is NCBI-locus_tag ANI_1_2554024.
(22) A method for constructing the Aspergillus niger engineered strain for reducing byproduct succinic acid in a fermentation process of L-malic acid as described above comprises the following steps:
(23) (1) construction of a fumaric acid reductase gene frdA knockout Aspergillus niger engineered strain
(24) Step 1, constructing a gene frdA knockout vector:
(25) respectively amplifying upstream and downstream sequence fragments of gene frdA through PCR reaction with a wild type Aspergillus niger ATCC1015 genome as a template, recovering PCR products to respectively obtain target fragments; and cloning the upstream and downstream sequence fragments of the gene frdA onto a vector pLH594, so as to construct a fumaric acid reductase frdA knockout vector pLH1067;
(26) wherein the downstream sequence of the frdA gene is SEQ NO:3, the upstream sequence of the frdA gene is SEQ NO: 4;
(27) Step 2, obtaining of an frdA gene knockout strain:
(28) transferring the vector pLH1-67 into an Aspergillus niger S489 (a previously constructed malic acid high-yield strain, as described in Xu, Y., Shan, L., Zhou, Y. et al. Development of a Cre-loxP-based genetic system in Aspergill usniger ATCC1 01 5 and its application to construction of efficient organic acid-producing cell factories. Appl Microbiol Biotechnol 103, 8105-8114 (2019). doi .org/10 .1007/s00253-019-10054-3) under the mediation of Agrobacterium, and conducting transformant screening and hygromycin resistance gene recombination to obtain an frd A gene knockout strain K1;
(29) (2) construction of a fumaric acid reductase gene frdA and fumaric acid reductase flavoprotein subunit gene frdB double-knockout Aspergillus niger engineered strain
(30) Step 1, constructing a gene frdB knockout vector:
(31) respectively amplifying upstream and downstream sequence fragments of gene frdB through PCR reaction with a wild type Aspergillus niger ATCC1015 genome as a template, recovering PCR products to respectively obtain target fragments; and cloning the upstream and downstream sequence fragments of the gene frdB onto a vector pLH594, so as to construct a fumaric acid reductase flavoprotein subunit frdB knockout vector pLH1162;
(32) wherein the downstream sequence of the frdB gene is SEQ NO:7, and the upstream sequence of the frdB gene is SEQ NO: 8;
(33) Step 2, obtaining of an frdA and frdB gene double-knockout strain:
(34) transferring the vector pLH1162 into the frdA gene knockout strain K1 under the mediation of Agrobacterium, and conducting transformant screening and hygromycin resistance gene recombination to obtain an frd A gene and frdB gene dual-knockout strain K2, that is, the Aspergillus niger engineered strain for reducing byproduct succinic acid accumulation in a fermentation process of L-malic acid.
(35) A method for fermenting L-malic acid by utilizing the Aspergillus niger engineered strain as described above comprises the following steps:
(36) inoculating the Aspergillus niger engineered strain into a PDA culture medium to be cultured for 5 days at 28° C. until conidia are generated, collecting the conidia and inoculating a conidium suspension into a fermentation culture medium, wherein the concentration of the conidia is 1*10.sup.8 conidia/50 ml, and then culturing for 5 days at 28° C. in a constant-temperature shaker at 200 rpm to obtain L-malic acid.
(37) Preferably, components and a formulation method of a malic acid fermentation culture medium are as follows:
(38) the components and a formulation method of a malic acid fermentation culture medium: 100 g/L of glucose, 6 g/L of bacterial peptone, 0.15 g/L of anhydrous potassium dihydrogen phosphate, 0.15 g/L of anhydrous dipotassium hydrogen phosphate, 0.1 g/L of calcium chloride dihydrate, 0.1 g/L of magnesium sulfate heptahydrate, 0.005 g/L of sodium chloride, 0.005 g/L of ferrous sulfate heptahydrate and 0.001 g/L of anhydrous citric acid, a solvent is water, and autoclaving is performed for 20 min at 115° C.
(39) Preferably, the yield of the L-malic acid obtained by the method is 65.59-69.15 g/L which is increased by 7.92% compared with a staring strain, and the yield of succinic acid is 0.91-1.05 g/L which is reduced by 88.73% compared with the starting strain.
(40) Provided is use of the Aspergillus niger engineered strain as described above in production of L-malic acid.
(41) Specifically, relevant preparation and detection are as follows:
(42) Example 1: construction of an frd A gene and frdB gene knockout vector
(43) This example includes the following steps:
(44) (1) construction of a frdA gene knockout vector
(45) To amplify the downstream sequence fragment of the frdA gene, an Aspergillus niger ATCC1015 genome was used as a template to design amplification primers frdA-F-F and frdA-F-R, the downstream sequence fragment of the frdA gene was recovered by PCR amplification, subjected to Xba I and Spe I double digestion and glue recovery and then linked to a vector pLH594 obtained by the same restriction enzyme by virtue of One-Step Clone Kit, the linked product was transformed into E. coli JM109 competent cells and then evenly coated in an LB solid culture medium containing 100 μg/mL kanamycin resistance and inverted overnight at 37° C., and monoclones were picked to be subjected to colony PCR validation and plasmid double-digestion validation (
(46) To amplify the upstream sequence fragment of the frdA gene, an Aspergillus niger genome was used as a template to design amplification primers frdA-R-F and frdA-R-R, the upstream sequence fragment of the frdA gene was recovered by PCR amplification, subjected to Sac I and BamH I double digestion and glue recovery and then linked to a vector pLH1066 obtained by the same restriction enzyme by virtue of One-Step Clone Kit, the linked product was transformed into E. coli JM109 competent cells and then evenly coated in an LB solid culture medium containing 100 μg/mL kanamycin resistance and inverted overnight at 37° C., and monoclones were picked to be subjected to colony PCR validation and plasmid double-digestion validation (
(47) Amplification primers are seen in Table 1, and are identified as SEQ ID Nos: 9-26, respectively.
(48) TABLE-US-00001 TABLE 1 Primer sequence SEQ ID Primer NOs name Primer sequence (5’-3’) 9 frdA-F-F CCCAGAATTCAATTCGAGCTCCAGGTGACGTGGGAAGGATC 10 frdA-F-R ATTATACGAAGTTATGGATCCGAGGGAAGGGAGACAAGGATG 11 frdA-R-F GCTATACGAAGTTATTCTAGAGCCTAGAGCTGTAAAAACCCC G 12 frdA-R-R TGCCTGCAGGGGCCCACTAGTACTTCTGCCTCTCCCTCGAC 13 frdB-F-F GCTCCGTAACACCCAGAATTCGTGCACCTTTCACCGTCCTG 14 frdB-F-R CGAAGTTATGGATCCGAGCTCGTTACCTCCTGCCCATTCCTCC 15 frdB-R-F GCTATACGAAGTTATTCTAGAGACCACACTGGGACGTGG 16 frdB-R-R TGCCTGCAGGGGCCCACTAGTAGACTACAACCGTGCCTGC 17 P1 CACGGCATGCTAATTGGTG 18 P2 GATCAACTCACGTCCACCG 19 P3 GCGATGCCACAGAAGGTATG 20 P4 TCGGGCCTTGCAAAGAATG 21 P5 CCAGGATGTGTTGGCGACG 22 P6 TGGACGGTGCGCATTGCC 23 P7 GAACCCGCGCATGCGCGC 24 P8 GACATAGTATATTATTCCTGC 25 P641 CAATATCAGTTAACGTCGAC 26 P642 GGAACCAGTTAACGTCGAAT a Underline sequence represents restriction enzyme sites
(49) The gene sequence of the gene frdA is SEQ NO:1, with a length of 2496 bp; the amino acid sequence of the gene frdA is SEQ NO:2, with 629 amino acids; the functional domain of a protein is shown in
(50) The downstream sequence of the frdA gene is SEQ NO:3, with a length of 1245 bp;
(51) The upstream sequence of the frdA gene is SEQ NO:4, with a length of 1285 bp;
(52) The LB solid culture medium containing kanamycin resistance comprises the following components: 10 g/L of tryptone, 5 g/L of yeast extract, 10 g/L of sodium chloride and 15 g/L of agar powder. Sterilization was performed for 20 min at 121° C. Kanamycin was added when sterilizing and cooling to about 50° C. until a final concentration was 100 μg/mL.
(53) (2) Construction of an frdB gene knockout vector
(54) To amplify the downstream sequence fragment of a frdB gene, an Aspergillus niger ATCC1015 genome was used as a template to design amplification primers frdB-F-F and frdB-F-R, the downstream sequence fragment of the frdB gene was recovered by PCR amplification, subjected to Xba I and Spe I double digestion and glue recovery and then linked to a vector pLH594 obtained by the same restriction enzyme by virtue of One-Step Clone Kit, the linked product was transformed into E. coli JM109 competent cells and then evenly coated in an LB solid culture medium containing 100 μg/mL kanamycin resistance and inverted overnight at 37° C., and monoclones were picked to be subjected to colony PCR validation and plasmid double-digestion validation (
(55) To amplify the upstream sequence fragment of the frdB gene, an Aspergillus niger genome was used as a template to design amplification primers frdB-R-F and frdB-R-R, the upstream sequence fragment of the frdB gene was recovered by PCR amplification, subjected to EcoR I and Sac I double digestion and glue recovery and then linked to a vector pLH1161 obtained by the same restriction enzyme by virtue of One-Step Clone Kit, the linked product was converted into E. coli JM109 competent cells and then evenly coated in an LB solid culture medium containing 100 μg/mL kanamycin resistance and inverted overnight at 37° C., and monoclones were picked to be subjected to colony PCR validation and plasmid double-digestion validation (
(56) Amplification primers are seen in Table 1.
(57) The gene sequence of the gene frdB is SEQ NO:5, with a length of 1569 bp; the amino acid sequence of the the gene frdB is SEQ NO:6, with 522 amino acids; the functional domain of a protein is shown in
(58) The downstream sequence of the frdB gene is SEQ NO:7, with a length of 881 bp;
(59) The upstream sequence of the frdB gene is SEQ NO:8, with a length of 1463 bp.
(60) The comparison results of similarities between frdA and frdB protein sequences are shown in
(61) Example 2: obtaining of an Aspergillus niger gene knockout strain
(62) This example is achieved through the following steps:
(63) (1) construction of a frdA gene knockout strain K1
(64) The vector pLH1067 was electroporated into agrobacterium, then this agrobacterium and an Aspergillus niger host strain S489 were co-cultured in an IM culture medium for agrobacterium-mediated transformation, the culture product was evenly coated in a CM culture medium after culturing for 2.5 days to be cultured until transformants were grown, and then the transformants were transferred to different culture mediums to be screened. The phenotypes of the transformants on different culture mediums should have resistance to hygromycin and sensitivity to glufosinate-ammonium. Such the transformants were subjected to genome validation and validation primers were designed (Table 1). Amplification results satisfy that the amplification of left and right homology arms is negative (
(65) The transformation method of the gene knockout is an agrobacterium-mediated method.
(66) The electrotransformation conditions of the agrobacterium-mediated method are as follows: Capacitnce: 25 uF, Voltage: 2 .5 kV, Resistance: 200 Ω, Pulse: 5 msec.
(67) The agrobacterium strain is an AGL-1 strain.
(68) A method for formulating the IM culture medium comprises: water was added into 15 g of agar so that a 905.7 mL volume was reached, sterilization was performed at 121° C. for 20 min, 0.8 mL of sterile K buffer, 20 mL of MN buffer, 1 mL of 1% CaCl.sub.2.Math.2H.sub.2O, 10 mL of 0.01% FeSO.sub.4, 5 mL of IM Trace elements, 2 .5 mL of 20% NH.sub.4NO.sub.3, 10 mL of 50% glycerol, 40 mL of 1M MES and 5 mL of 20% glucose which were prepared in advance were added, kanamycin was added when the temperature was reduced to about 50° C. so that a final concentration was 100 μg/mL, acetosyringone was added so that the final concentration was 200 μM.
(69) A method for formulating the CM culture medium comprises: water was added into 20 g of agar so that a 897 mL volume was reached, sterilization was performed at 121° C. for 20 min, 20 mL of aseptic ASP+N, 20 mL of 50% glucose, 2 mL of 1M MgSO.sub.4, 1 mL of CM Trace elements, 10 mL of 10% casein hydrolyzate and 50 mL of 10% yeast extract which were prepared in advance were added, hygromycin was added when the temperature was reduced to about 50° C. so that the final concentration was 250 μg/mL, streptomycin was added so that the final concentration was 100 μg/mL, cefotaxime sodium was added so that the final concentration was 100 μg/mL, and ampicillin was added so that the final concentration was 100 μg/mL.
(70) The validation primer sequences are seen in Table 1.
(71) The induction and recombination method of the resistance marker comprises: spores of about 400 frdA gene knockout clones were evenly coated onto an MM culture medium containing 30 μg/mL tetracycline, cultured at 28° C. until monoclones were grown, and 100 monoclones were randomly picked and transferred to a PDA culture medium to be cultivated at 28° C. for 24 h, and then the clones were transferred to a PDA medium containing hygromycin for 24 h at 28° C. one by one, and finally the phenotypes were observed to screen the transformants induced and recombined by resistance markers, that is, the transformants which can be normally grown in the PDA culture medium but cannot be normally grown in the PDA culture medium containing hygromycin were successfully induced and recombined transformants.
(72) A method for formulating the PDA culture medium comprises: 200 g of peeled potatoes were accurately weighed and cut into about 1 cm.sup.3 of small pieces, distilled water was added, the resulting mixture was boiled for 30 min under the condition of continuous stirring and filtered with double-layer gauze, filtrate was collected, 20 g of glucose was stirred until it was completely dissolved, the volume was adjusted to 1 L with distilled water, the resulting mixture was packaged into a jar, 1.5% agar was added, and the jar was autoclaved at 121° C. for 20 min.
(73) (2) Construction of a frdB gene knockout strain K2
(74) The vector pLH1162 was electroporated into agrobacterium, and then this agrobacterium and frdA gene knockout strain K1 were co-cultured on an IM medium for agrobacterium-mediated transformation, the culture product was evenly coated in a CM culture medium after culturing for 2.5 days to be cultured until transformants were grown, and then the transformants were transferred to different culture mediums to be screened. The phenotypes of the transformants on different culture mediums should have resistance to hygromycin and sensitivity to glufosinate-ammonium. Such the transformants were subjected to genome validation and validation primers were designed (Table 1). Amplification results satisfy that the amplification of the left and right homology arms is negative (
(75) Example 3: use of an engineered strain in production of L-malic acid via fermentation
(76) A method for producing malic acid by utilizing Aspergillus niger frdA gene and frdB gene knockout strains K1 and K2 constructed in the disclosure in a shaker via fermentation specifically comprises the following steps:
(77) First, the obtained engineered strains K1 and K2 were inoculated into a PDA culture medium and subjected to inverted culture in a 28° C. incubator for 5 days until enough conidia were generated;
(78) then, the conidia of strains K1 and K2 were collected and inoculated into a malic acid fermentation culture medium, wherein the final concentration of the conidia was 1*10.sup.8 conidia/mL, and the shaker was placed under the conditions of 28° C. and at 200 rpm for 5 days of culture.
(79) The malic acid fermentation culture medium comprises the compositions: 100 g/L of glucose, 6 g/L of bacterial peptone, 0.15 g/L of anhydrous potassium dihydrogen phosphate, 0.15 g/L of anhydrous dipotassium hydrogen phosphate, 0.1 g/L of calcium chloride dihydrate, 0.1 g/L of magnesium sulfate heptahydrate, 0.005 g/L of sodium chloride, 0.005 g/L of ferrous sulfate heptahydrate and 0.001 g/L of anhydrous citric acid. Autoclaving was performed for 20 min at 115° C.
(80) Finally, the fermentation product was collected to prepare a test sample, and the content of the main organic acid in the sample was determined by HPLC. The results showed that the main organic acid was malic acid, the content of the byproduct succinic acid of the frdA gene knockout engineered strain K1 was reduced to 43.07% of a starting strain, while the content of the byproduct succinic acid of the frd A and frdB gene double-knockout strain K2 was reduced by 88.74% compared with that of the starting strain. The results are shown in
(81) A method for preparing the detection sample comprises: 2 mL of evenly vibrated fermentation broth was sucked, an equal volume of 2 M HCl was added, the above materials fully reacted, the reaction product was centrifuged to take supernatant, the supernatant was diluted by 50 folds, and the diluted supernatant was filtered via a 0.22 μm filter membrane and then stored in a liquid vial for future HPLC analysis.
(82) A method for detecting an organic acid via HPLC comprises: Agilent high performance liquid chromatograph UV detector, AminexHPX-87H chromatographic column (300 mm*7.8 mm), 5 mM H.sub.2SO.sub.4 mobile phase, 0.6 mL/min flow rate, the column temperature was 65° C., the detection wavelength was 210 nm, and the injection volume was 20 μL.
(83) According to research results of the disclosure, the byproduct succinic acid accumulated in the production process of malic acid through fermentation of Aspergillus niger is significantly reduced, the cost in the process of downstream separation and purification malic acid was reduced, and good strains are provided for industrialized production of malic acid via fermentation.
(84) Although the embodiments of the disclosure have been disclosed for illustrative purposes, those skilled in the art will appreciate that various substitutions, changes and modifications are possible without departing from the spirit and scope of the disclosure and the appended claims, and therefore the scope of the disclosure is not limited to the contents disclosed in the embodiments.