METHOD FOR CONTROLLING OBESITY BY REGULATING ACTIVITY OF TREK1

Abstract

The present invention relates to obesity control by regulating the expression level of TREK1.

Claims

1. A method for preventing or treating obesity, comprising: enhancing the activity of TREK1.

2. The method of claim 1, wherein the enhancement of TREK1 comprises treating TREK1 activator.

3. The method of claim 1, wherein the enhancement of TREK1 is achieved by: 1) increasing the intracellular copy number of a polynucleotide encoding TREK1; 2) modifying the expression regulatory region of a gene encoding TREK1 with a sequence having a strong activity; 3) modifying the nucleotide sequence encoding the 5′-UTR or 3′-UTR of the gene transcript encoding TREK1; 4) modifying the amino acid sequence or the polynucleotide sequence encoding the same such that the activity of TREK1 is enhanced; 5) regulating the transcription or translation such that the activity of TREK1 is enhanced; 6) introducing a foreign polypeptide exhibiting the activity of TREK1 or a foreign polynucleotide encoding the polypeptide; 7) codon optimization of the polynucleotide encoding TREK1; 8) post-translational modification such that the activity of TREK1 is enhanced; or 9) a combination of two or more selected from above 1) to 8).

4. The method of claim 1, wherein the enhancement of the TREK1 activity is achieved by increasing TREK1 activity in adipocytes.

5. The method of claim 2, wherein the TREK1 activator is selected from riluzole, lithium, gabapentin, valproate, carbamazepine, ML67, ML67-33, ML335, ML402, arachidonic acid, chloroform, halothane, isoflurane, diethyl ether, fenamate, flufenamic acid, BL-1249, RNE28, GI-530159, PUFA, and derivatives thereof.

6. The method of claim 2, wherein the TREK1 activator is a vector containing cDNA

7. A method for preparing an obese animal model, comprising weakening TREK1 activity.

8. The method of claim 7, wherein the weakening is achieved by: 1) deleting a part or all of the gene encoding TREK1; 2) modifying the expression regulatory region such that the expression of the gene encoding TREK1 is decreased; 3) modifying the amino acid sequence constituting the protein or the polynucleotide encoding the same such that the activity of TREK1 is removed or weakened; 4) post-translational modification such that the activity of TREK1 is removed or weakened; 5) modifying the nucleotide sequence encoding the 5′-UTR or 3′-UTR of the gene transcript encoding the protein such that the activity of TREK1 is removed or weakened; 6) introducing an antisense oligonucleotide which binds complementarily to the gene transcript encoding TREK1; 7) inhibiting the transcription or translation of the protein such that the activity of TREK1 is removed or weakened; 8) adding a promoter, which is to be reversely transcribed on the 3′ terminus of the open reading frame (ORF) of the gene sequence encoding TREK1 (Reverse transcription engineering, RTE); 9) treating a TREK1 activity inhibitor; or 10) a combination of two or more selected from the methods 1) to 9) above.

9. An obese animal model prepared by the method of claim 7.

10. A method for screening a preventive or therapeutic agent for obesity, comprising: (a) administering a candidate substance for preventing or treating obesity into an animal model; and (b) measuring the level of TREK1 activity in the animal model of step (a).

11. The method of claim 1, comprising selecting the candidate substance as a substance for preventing or treating obesity, when the TREK1 activity level of the animal model is increased as a result of the measurement in step (b).

12. A method for controlling obesity, comprising regulating the expression level of TREK1.

Description

BRIEF DESCRIPTION OF DRAWINGS

[0103] FIGS. 1A to 1E are schematic diagrams showing a phenomenon in which the potassium conductivity of cells is significantly reduced and the cell membrane potential is depolarized in the process of differentiating the 3T3L1 cell line, which is a preadipocyte, into adipocytes (FIG. 1A).

[0104] FIGS. 2A to 2C confirmed the expression of 12 proteins with known functions among various K2P (two-pore potassium) ion channel proteins that maintain cell membrane potential, by comparing before and after inducing differentiation of the 3T3L1 cell line, which is a preadipocyte. Among these proteins, the expression of TREK1 is selectively very high and is specifically decreased in the differentiation process (FIG. 2A). Additionally, when spadin, known as a TREK1 inhibitor, was treated, the potassium conductivity of undifferentiated adipocytes was decreased and differentiation was further enhanced (FIG. 2B).

[0105] FIGS. 3A to 3F are diagrams showing that when 3T3L1 cells, which are preadipocytes, are treated with spadin, a TREK1 inhibitor, intracellular calcium concentration may increase and voltage-dependent calcium ion channels are involved in this process.

[0106] FIGS. 4A to 4E are views showing that when the primary cultured adipocytes are treated with spadin, a TREK1 inhibitor, or mRNA is inhibited by treatment with TREK1 shRNA, potassium conductivity is decreased, membrane potential is increased, and differentiation into adipocytes is significantly increased.

[0107] FIGS. 5A to 5I are diagrams showing that when a high-fat diet was performed using TREK1-knockout mice lacking TREK1 in order to confirm the importance of TREK1 for obesity at the individual level, the total body weight change in normal mice was not significant, but the weight of adipose tissue was significantly increased and the decomposition process of glucose was also significantly increased.

[0108] FIGS. 6A to 6C are diagrams showing that the size of adipocytes was significantly increased in TREK1-knockout mice and further increased by a high-fat diet.

[0109] FIG. 7 is a diagram showing that when ML402, an activator of TREK1, was treated in the differentiation process of 3T3 cells, which are preadipocytes, the differentiation into adipocytes was significantly reduced in a concentration-dependent manner.

DETAILED DESCRIPTION OF PREFERRED EMBODIMENTS

[0110] The present invention will be described in detail by way of Examples and Experimental Examples. However, these Examples and Experimental Examples are given for illustrative purposes only, and the scope of the present invention is not intended to be limited to or by these Examples and Experimental Examples.

Example 1. Effect of TREK1 in Differentiation Process of 3T3L1 Cells, which are Preadipocytes

[0111] The 3T3L1 cell line, a preadipocyte cell line, was treated with MDI (Dexamethasone, IBMX, insulin) as a differentiation-inducing agent, and differentiation was induced for 7 days, and the differentiation into adipocytes was confirmed by staining with oil red 0 (FIG. 1A).

[0112] 3T3-L1 cells were purchased from ATCC (American Type Culture Collection) and cultured in Dulbecco's Modified Eagle Medium (Gibco, N.Y., USA) with 10% (v/v) bovine serum (Gibco, N.Y., USA) and 1% v/v) penicillin/streptomycin (Thermo Fisher Scientific, N.J., USA). Cultures were maintained in a humidified 5% CO.sub.2 incubator at 37° C. After reaching 80% confluence, the differentiation of 3T3L1 cells was induced by replacing the medium with DMEM containing 10% FBS plus 1 μg/mL insulin, 0.5 mM isobutyl-1-methylxanthine (IBMX), 1 μM and 2 μM Rosiglitazone for 3 days. Afterward the medium was changed with DMEM containing 10% FBS plus 1 μg/mL insulin, and the cells were further cultured for 2 to 4 days. Culture medium contained a combination of IBMX, dexamethasone (Dex), insulin, rosiglitazone, and fetal bovine serum (FBS) to differentiate preadipocyte into mature adipocytes. After differentiation, experiments were conducted at three points. Each time the medium was changed over time, the cells were differentiated with IBMX medium for 3 days, and then changed to insulin medium every 2 days thereafter. As a result of confirmation by a microscope, the cell shape of 3T3-L1 was changed over time and intracellular lipid droplets were produced.

[0113] As a result of measuring the potassium ion selective conductivity by the patch clamp technique using a cell line model in which differentiation into adipocytes was well confirmed, a sharp decrease in potassium ion conductivity was confirmed from the 3rd day, the initial stage of differentiation (FIGS. 1B to D). In addition, it was confirmed that the resting membrane potential (RMP) was highly depolarized in this process (FIG. 1E). From this result, the relevance of the K2P ion channel protein, which is known to be involved in the resting membrane potential among various potassium ion channel proteins, could be expected.

[0114] In the 3T3L1 cell line, mRNA was extracted before and after induction of differentiation to confirm the expression patterns of 12 K2P proteins whose ion channel activity have been reported. Primers reported in Supplementary Table 1 of Mi Hwang, E., Kim, E., Yarishkin, O. et al. A disulphide-linked heterodimer of TWIK-1 and TREK-1 mediates passive conductance in astrocytes. Nat. Commun. 5:3227 (2014) (https://doi.org/10.1038/ncomms4227) were used.

[0115] Interestingly, it was confirmed that the expression of TREK1 among the K2P proteins was selectively very high and rapidly decreased after differentiation was induced (FIG. 2A). These results were not observed in other K2P proteins, but when spadin, which is known to act very selectively on TREK1, is treated to 3T3L1 cell line, it was confirmed that the conductivity was generated by the TREK1 protein, as most of the potassium conductivity was decreased in the undifferentiated condition (FIG. 2B). In addition, it was confirmed that when spadin was treated in the process of differentiation into adipocytes, the degree of differentiation was significantly increased (FIG. 2C).

[0116] As previously known, the process of differentiation into adipocytes must be accompanied by an increase in calcium ion concentration, and as a result of treatment with spadin, a TREK1 inhibitor, and measuring the intracellular calcium ion concentration, a significant increase in calcium ions was confirmed 30 minutes after spadin treatment (FIG. 3A). This increase in calcium ions was effectively inhibited by nifedifine, a voltage-dependent calcium ion channel inhibitor (FIGS. 3B and 3C), and it was confirmed that differentiation into adipocytes was also inhibited (FIGS. 3D and 3E). In summary, the activity of TREK1, which is a potassium ion channel, was decreased in the process of differentiation into adipocytes, and as a result, the cell membrane potential was depolarized, and voltage-dependent calcium ion channels were activated, resulting in increasing intracellular calcium ion concentration and promoting the differentiation of adipocytes.

Example 2. Effect of TREK1 in Primary Cultured Adipocytes

[0117] Since there is a possibility that the results shown in Example 1 may not reproduce the actual in vivo environment, a primary culture experiment was performed using adipocytes of mice.

[0118] The method for obtaining primary cultured adipocytes is as follows. Primary white adipocytes were isolated from inguinal WAT 6-8 week mouse (C57BL/6). The extracted WAT was washed in a 15 mL tube. The enzyme solution was mixed with collagenase Type II (Worthington Industries, Columbus, Ohio, USA) and PBS (Gibco, N.Y., USA), and the tissue was incubated in 20 mL enzyme solution in an incubator at 37° C. for 1 hour. After filtering, the tissue was added to a new 50 mL tube and centrifuged at 10,000 rpm for 10 minutes. The adipocytes floating in the solution were transferred to a new tube using a pipette. Then, the adipocytes were once more centrifuged in DMEM/F12 (Gibco, N.Y., USA) containing 10% (v/v) FBS. After transferring the fatty layer to the cell culture flask, and the flask was filled with DMEM/F12+mixture. The flask was inverted and incubated in a 37° C. CO.sub.2 incubator, and the medium was changed after about 5 days.

[0119] When the primary cultured adipocytes were treated with spadin (1 μM concentration), a TREK1 inhibitor, the potassium ion conductivity was significantly decreased (FIGS. 4A and 4B) as in the cell line result of Example 1, and the resting membrane potential was also increased (FIG. 4C).

[0120] In addition, differentiation was induced after treatment with TREK1 shRNA (gcgtggagatctacgacaagt, CDS 998-1018), which was verified well in previous studies, in order to confirm whether the same effect was exhibited by the reduction of TREK1 protein (see Hwang, E. M. et al. A disulphide-linked heterodimer of TWIK-1 and TREK-1 mediates passive conductance in astrocytes. Nat. Commun. 5:3227 (2014)). shRNA was used in an amount of 1 μg/μL. As a result, it was confirmed that the area of the differentiated adipocytes increased significantly compared to that treated with scrambled shRNA (FIG. 4E). This result shows that a decrease in TREK1 had an effect on the membrane potential and promoted the differentiation process in the process of differentiation of adipocytes in primary cultured mice, as in cell lines.

Example 3. Effect on Fat Diet in TREK1-Deficient Mice

[0121] In order to confirm whether TREK1 was actually involved in the process of differentiation into adipocytes at the individual level, mice lacking only TREK1 were fed with a normal diet and a fat diet to confirm the effect on the obesity process (FIG. 5A).

[0122] TREK1-deficient mice were prepared by removing exon 4 after exon 2 including ATG using the CRISPR/Cas9 system. A feed with 10 kCal % fat content (Research Diets, D12450B) was fed to the normal diet group, and a feed with 60 kCal % fat content (Research Diets, D12492) was fed to the fat diet (HFD) group. The diet was continued for 12 weeks, and the amount of diet and weight were measured every 2 days.

[0123] Although there was no significant difference in total body weight in normal mice and TREK1-deficient mice during the 12-week diet (FIG. 5B), and there was no significant difference in intake (FIGS. 5C and 5D), it was confirmed that TREK1-deficient mice significantly increased the actual fat weight even by the normal diet (FIG. 5E). The TREK1-deficient mice increased their fat weight more than normal mice by way of the fat diet, and it was confirmed that the degradation efficiency was significantly reduced when glucose was injected after a 12-hour fast (FIGS. 5G to 5I).

[0124] When the actual size and number of adipocytes were confirmed using a microscope, the number of adipocytes in TREK1-deficient mice was significantly increased compared to normal mice, and it was confirmed that the size was also increased (FIG. 6A). In addition, it was confirmed that the change was further increased by the fat diet (FIGS. 6B and 6C).

[0125] Based on the results, it was confirmed that inhibiting the activity of TREK1 induced obesity in both the normal diet and the fat diet groups.

Example 4. Adipocyte Differentiation Inhibitory Effect on TREK1 Activator

[0126] Since it was confirmed through Examples 1, 2, and 3 that selective inhibition of TREK1 was essential for the differentiation process of adipocytes, it was confirmed whether treatment with an activator of TREK1 could effectively inhibit the differentiation process.

[0127] The 3T3L1 cell line, in which the same effect as in vivo and conditions was well confirmed, was treated with ML402, which has been reported to have an active effect on TREK1. Specifically, the cells were sampled on the 3rd, 5th, and 7th days by treating ML402 together from the time of differentiation at concentrations of 10 μM, 25 μM, and 100 μM, respectively. As a result of examining the effect on the differentiation process, the amount of triglycerides did not show a significant difference on the 3rd day, as compared with the control group, but decreased in a concentration-dependent manner on the 5th and 7th days, thereby confirming that the differentiation process was inhibited in a concentration-dependent manner as expected (FIG. 7).

[0128] Based on the results, it was confirmed that obesity can be suppressed by enhancing TREK1 activity.

[0129] From the foregoing, a skilled person in the art to which the present invention pertains will be able to understand that the present invention may be embodied in other specific forms without modifying the technical concepts or essential characteristics of the present invention. In this regard, the exemplary embodiments disclosed herein are only for illustrative purposes and should not be construed as limiting the scope of the present invention. The scope of the present invention is therefore indicated by the appended claims rather than by the foregoing description. All changes which come within the meaning and range of equivalency of the claims are to be embraced within the scope of the present invention.