Antibody producing non-human animals
11559049 · 2023-01-24
Assignee
Inventors
- Ton Logtenberg (Driebergen, NL)
- Mark Throsby (Utrecht, NL)
- Robert A. Kramer (Utrecht, NL)
- Rui D. Pinto (Utrecht, NL)
- Cornelis A. de Kruif (De Bilt, NL)
- Erwin Houtzager (Zeist, NL)
Cpc classification
C07K16/2863
CHEMISTRY; METALLURGY
A01K2267/01
HUMAN NECESSITIES
C07K2317/51
CHEMISTRY; METALLURGY
C07K16/00
CHEMISTRY; METALLURGY
C12N5/10
CHEMISTRY; METALLURGY
A01K2217/206
HUMAN NECESSITIES
C07K16/22
CHEMISTRY; METALLURGY
C07K2317/10
CHEMISTRY; METALLURGY
A01K67/0278
HUMAN NECESSITIES
C07K16/462
CHEMISTRY; METALLURGY
A01K67/0275
HUMAN NECESSITIES
A01K2217/15
HUMAN NECESSITIES
C07K2317/14
CHEMISTRY; METALLURGY
C07K2317/94
CHEMISTRY; METALLURGY
C07K2317/24
CHEMISTRY; METALLURGY
C07K2317/64
CHEMISTRY; METALLURGY
C07K2317/76
CHEMISTRY; METALLURGY
C12N15/8509
CHEMISTRY; METALLURGY
C07K2317/34
CHEMISTRY; METALLURGY
International classification
C07K16/00
CHEMISTRY; METALLURGY
Abstract
Described are transgenic, non-human animals comprising a nucleic acid encoding an immunoglobulin light chain, whereby the immunoglobulin light chain is human, human-like, or humanized. The nucleic acid is provided with a means that renders it resistant to DNA rearrangements and/or somatic hypermutations. In one embodiment, the nucleic acid comprises an expression cassette for the expression of a desired molecule in cells during a certain stage of development in cells developing into mature B cells. Further provided is methods for producing an immunoglobulin from the transgenic, non-human animal.
Claims
1. A transgenic mouse that has been immunized to generate an immune response against an antigen, wherein the genome of said mouse comprises a transgene encoding a rearranged immunoglobulin light chain variable region, wherein the transgene comprises a single human immunoglobulin light chain V gene segment fused to a single human immunoglobulin light chain J gene segment, wherein the transgene lacks a regulatory element that contributes to somatic hypermutation of the light chain variable region, and wherein said rearranged immunoglobulin light chain variable region is linked to an endogenous immunoglobulin light chain constant region gene segment, and wherein said transgenic mouse comprises a population of B cells that secrete a repertoire of antibodies that bind said antigen, said repertoire of antibodies comprising the immunoglobulin light chain variable region encoded by said transgene and further comprising a counterpart heavy chain variable region resulting from somatic hypermutation in response to said antigen.
2. The transgenic mouse of claim 1, wherein said transgene comprises a single human immunoglobulin light chain germline V gene segment fused to a single immunoglobulin light chain germline J gene segment.
3. A transgenic murine animal that has been immunized to generate an immune response against an antigen, wherein the genome of said animal comprises a transgene encoding a rearranged immunoglobulin light chain variable region, wherein the transgene comprises a single human immunoglobulin light chain V gene segment fused to a single human immunoglobulin light chain J gene segment, wherein the transgene lacks a regulatory element that contributes to somatic hypermutation of the light chain variable region, and wherein the transgene comprises a nucleic acid sequence encoding an immunoglobulin light chain constant region, and wherein said transgenic animal comprises a population of B cells that secrete a repertoire of antibodies that bind said antigen, said repertoire of antibodies comprising the immunoglobulin light chain variable region encoded by said transgene and further comprising a counterpart heavy chain variable region resulting from somatic hypermutation in response to said antigen.
4. The transgenic animal of claim 3, that is a mouse.
5. The transgenic animal of claim 3, wherein the transgene comprises a nucleic acid sequence encoding a murine light chain constant region.
6. The transgenic animal of claim 3, wherein the transgene comprises a nucleic acid sequence encoding a human light chain constant region.
7. The transgenic animal of claim 3, wherein said transgene comprises a single human immunoglobulin light chain germline V gene segment fused to a single immunoglobulin light chain germline J gene segment.
Description
DESCRIPTION OF THE DRAWINGS
(1) The patent or application file contains at least one drawing executed in color. Copies of this patent or patent application publication with color drawing(s) will be provided by the Office upon request and payment of the necessary fee.
(2)
(3)
(4)
(5)
(6)
(7)
(8)
(9)
(10)
(11)
(12)
(13)
(14)
(15)
(16)
(17)
(18)
(19)
(20)
(21)
(22)
(23)
(24)
(25)
(26)
(27)
(28)
(29)
(30)
DETAILED DESCRIPTION OF THE INVENTION
Examples
Example 1: Human Light Chain V-Gene Clones
(31) This example describes the rationale behind the choice of two human light chain V-genes, one gene of the kappa type and one gene of the lambda type, that are used as a proof of concept for light chain expressing transgenic mice. De Wildt et al. 1999 (de Wildt et al. (1999), J. Mol. Biol. 285(3):895) analyzed the expression of human light chains in peripheral IgG-positive B-cells. Based on these data, IGKV1-39 (O12) and IGLV2-14 (2a2) were chosen as light chains as they were well represented in the B-cell repertoire. The J-segment sequence of the light chains has been chosen based upon sequences as presented in GenBank ABA26122 for IGKV1-39 (B. J. Rabquer, S. L. Smithson, A. K. Shriner and M. A. J. Westerink) and GenBank AAF20450 for IGLV2-14 (O. Ignatovich, I. M. Tomlinson, A. V. Popov, M. Bruggemann and G. J. Winter, J. Mol. Biol. 294 (2):457-465 (1999)).
(32) All framework segments are converted into germline amino acid sequences to provide the lowest immunogenicity possible in potential clinical applications.
Example 2: Obtaining Mouse Heavy Chain V-Genes that Pair with Human IGKV1-39 Gene Segment to Form Functional Antibody Binding Sites
(33) This example describes the identification of mouse heavy chain V-genes that are capable of pairing with a single, rearranged human germline IGKV1-39/J region. A spleen VH repertoire from mice that were immunized with tetanus toxoid was cloned in a phage display Fab vector with a single human IGKV1-39-C kappa light chain and subjected to panning against tetanus toxoid. Clones obtained after a single round of panning were analyzed for their binding specificity. The murine VH genes encoding tetanus toxoid-specific Fab fragments were subjected to sequence analysis to identify unique clones and assign VH, DH and JH utilization.
(34) Many of the protocols described here are standard protocols for the construction of phage display libraries and the panning of phages for binding to an antigen of interest and described in Antibody Phage Display: Methods and Protocols (editor(s): Philippa M. O'Brien and Robert Aitken).
(35) Immunizations
(36) BALB/c mice received one immunization with tetanus toxoid and were boosted after six weeks with tetanus toxoid.
(37) Splenocyte Isolation
(38) Preparation of spleen cell suspension. After dissection, the spleen was washed with PBS and transferred to a 60 mm Petri dish with 20 ml PBS. A syringe capped with 20 ml PBS and a G20 needle was used to repeatedly flush the spleen. After washing the flushed cells with PBS, the cells were carefully brought into suspension using 20 ml PBS and left on a bench for five minutes to separate the splenocytes from the debris and cell clusters. The splenocytes suspension was transferred on top of a Ficoll-Paque™ PLUS-filled tube and processed according to the manufacturer's procedures for lymphocyte isolation (Amersham Biosciences).
(39) RNA Isolation and cDNA Synthesis
(40) After isolation and pelleting of lymphocytes, the cells were suspended in TRIzol LS Reagent (Invitrogen) for the isolation of total RNA according to the accompanying manufacturer's protocol and subjected to reverse transcription reaction using 1 microgram of RNA, Superscript III RT in combination with dT20 according to manufacturer's procedures (Invitrogen).
(41) PCR Amplification of cDNA
(42) The cDNA was amplified in a PCR reaction using primer combinations that allow the amplification of approximately 110 different murine V-genes belonging to 15 VH families (Table 1; RefSeq NG_005838; Thiebe et al. 1999, European Journal of Immunology 29:2072-2081). In the first round, primer combinations that bind to the 5′ end of the V-genes and 3′ end of the J regions were used. In the second round, PCR products that were generated with the MJH-Rev2 primer were amplified in order to introduce modifications in the 3′ region to enable efficient cloning of the products. In the last round of amplification, all PCR products were amplified using primers that introduce a SfiI restriction site at the 5′ end and a BstEII restriction site at the 3′ end (see
(43) Reaction conditions for 1st round PCR: four different reactions combining all 25 forward primers (MVH1 to MVH25, Table 1 and
(44) Restriction Enzyme Digestions
(45) Purified products were digested with BstEII and SfiI in two steps. First 1 microgram of DNA was digested in 100 microliters reactions consisting of 10 microliters of 10* NEB buffer 3 (New England Biolabs), 1 microliter 100* BSA, 12.5 unit BstEII and sterile water for six hours at 60° C. in a stove. The products were purified using Qiaquick PCR Purification kit from Qiagen according to the manual instructions and eluted in 40 microliters water. Next all products were further digested with SfiI in 100 microliters reactions consisting of 10 microliters of 10* NEB buffer 2 (New England Biolabs), 1 microliter 100* BSA, 12.5 unit SfiI and sterile water for 12 hours at 50° C. in a stove. The digested fragments were purified by Qiaquick Gel Extraction kit following gel separation on a 20 cm 1.5% agarose TBE plus ethidium bromide gel at 80 V. 100 micrograms of the acceptor vector (MV1043,
(46) Ligations
(47) Each PCR product was ligated separately according to the following scheme: 70 ng digested PCR products, 300 ng digested acceptor vector, 100 units T4 Ligase (NEB), 1* ligase buffer in 30 microliters for 16 hours at 12° C. The ligation reactions were purified with phenol/chloroform/isoamyl alcohol extractions followed by glycogen precipitations (Sigma Aldrich #G1767) according to the manufacturer's protocol and finally dissolved in 25 microliters sterile water.
(48) Transformations and Library Storage
(49) The purified ligation products were transformed by electroporation using 1200 microliters TG1 electrocompetent bacteria (Stratagene #200123) per ligation batch and plated on LB carbenicillin plates containing 4% glucose. Libraries were harvested by scraping the bacteria in 50 ml LB carbenicillin. After centrifugation at 2000 g for 20 minutes at 4° C., the bacterial pellets were resuspended carefully in 2 ml ice cold 2*TY/30% glycerol on ice water and frozen on dry ice/ethanol before storage at −80° C.
(50) Library Amplification
(51) Libraries were grown and harvested according to procedures as described by Kramer et al. 2003 (Kramer et al. (2003), Nucleic Acids Res. 31(11):e59) using VCSM13 (Stratagene) as helper phage strain.
(52) Selection of Phages on Coated Immunotubes
(53) Tetanus toxoid was dissolved in PBS in a concentration of 2 μg/ml and coated to MAXISORP™ Nunc-Immuno Tube (Nunc 444474) overnight at 4° C. After discarding the coating solution, the tubes were blocked with 2% skim milk (ELK) in PBS (blocking buffer) for one hour at RT. In parallel, 0.5 ml of the phage library was mixed with 1 ml blocking buffer and incubated for 20 minutes at room temperature. After blocking the phages, the phage solution was added to the tetanus toxoid-coated tubes and incubated for two hours at RT on a slowly rotating platform to allow binding. Next, the tubes were washed ten times with PBS/0.05% TWEEN™-20 detergent followed by phage elution by an incubation with 1 ml 50 mM glycine-HCl pH 2.2 ten minutes at RT on rotating wheel and directly followed by neutralization of the harvested eluent with 0.5 ml 1 M Tris-HCl pH 7.5.
(54) Harvesting Phage Clones
(55) Five ml XL1-Blue MRF (Stratagene) culture at O.D. 0.4 was added to the harvested phage solution and incubated for 30 minutes at 37° C. without shaking to allow infection of the phages. Bacteria were plated on Carbenicillin/Tetracycline 4% glucose 2*TY plates and grown overnight at 37° C.
(56) Phage Production
(57) Phages were grown and processed as described by Kramer et al. 2003 (Kramer et al. 2003, Nucleic Acids Res. 31(11):e59) using VCSM13 as helper phage strain.
(58) Phage ELISA
(59) ELISA plates were coated with 100 microliters tetanus toxoid per well at a concentration of 2 micrograms/ml in PBS overnight at 4° C. Plates coated with 100 microliters thyroglobulin at a concentration of 2 micrograms/ml in PBS were used as a negative control. Wells were emptied, dried by tapping on a paper towel, filled completely with PBS-4% skimmed milk (ELK) and incubated for one hour at room temperature to block the wells. After discarding the block solution, phage minipreps pre-mixed with 50 μl blocking solution were added and incubated for one hour at RT. Next five washing steps with PBS-0.05% Tween-20 removed unbound phages. Bound phages were detected by incubating the wells with 100 microliters anti-M13-HRP antibody conjugate (diluted 1/5000 in blocking buffer) for one hour at room temperature. Free antibody was removed by repeating the washing steps as described above, followed by TMB substrate incubation until color development was visible. The reaction was stopped by adding 100 microliters of 2 M H.sub.2SO.sub.4 per well and analyzed on an ELISA reader at 450 nm emission wavelength (Table 2). Higher numbers indicate stronger signals and thus higher incidence of specific binding of the phage-Fab complex.
(60) Sequencing
(61) Clones that gave signals at least three times above the background signal (Table 2) were propagated, used for DNA miniprep procedures (see procedures Qiagen miniPrep manual) and subjected to nucleotide sequence analysis. Sequencing was performed according to the Big Dye 1.1 kit accompanying manual (Applied Biosystems) using a reverse primer (CH1_Rev1, Table 1) recognizing a 5′ sequence of the CH1 region of the human IgG1 heavy chain (present in the Fab display vector MV1043,
Example 3: Silencing of the Mouse Kappa Light Chain Locus
(62) This example describes the silencing of the mouse endogenous kappa light chain locus. The endogenous kappa locus is modified by homologous recombination in ES cells, followed by the introduction of genetically modified ES cells in mouse embryos to obtain genetically adapted offspring.
(63) A vector that contains an assembled nucleotide sequence consisting of a part comprising the J-region to 338 bp downstream of the J5 gene segment fused to a sequence ending 3′ of the 3′ CK enhancer is used for homologous recombination in ES cells. The assembled sequence is used to delete a genomic DNA fragment spanning from 3′ of the JK region to just 3′ of the 3′ CK enhancer. As a consequence of this procedure, the CK constant gene, the 3′ enhancer and some intergenic regions are removed (see
(64) Construction of the Targeting Vector
(65) A vector that received 4.5-8 kb flanking arms on the 3′ and 5′ end fused to the deletion segment was used for targeted homologous recombination in an ES cell line. Both arms were obtained by PCR means ensuring maximum homology. The targeting strategy allows generation of constitutive KO allele. The mouse genomic sequence encompassing the Igk intronic enhancer, Igk constant region and the Igk 3′ enhancer was replaced with a PuroR cassette, which was flanked by F3 sites and inserted downstream of the Jk elements. Flp-mediated removal of the selection marker resulted in a constitutive KO allele. The replacement of the Igk MiEk-Igk C-Igk 3′E genomic region (approximately 10 kb) with a F3-Puro cassette (approx. 3 kb) was likely to decrease the efficiency of homologous recombination. Therefore, the arms of homology were extended accordingly and more ES cell colonies were analyzed after transfection in order to identify homologous recombinant clones.
(66) Generation of ES Cells Bearing the Deleted Kappa Fragment
(67) The generation of genetically modified ES cells was essentially performed as described (Seibler et al. (2003), Nucleic Acids Res. February 15; 31(4):e12). See also Example 14 for a detailed description.
(68) Generation of ES Mice by Tetraploid Embryo Complementation
(69) The production of mice by tetraploid embryo complementation using genetically modified ES cells was essentially performed as described (Eggan et al., PNAS 98:6209-6214; J. Seibler et al. (2003), Nucleic Acids Res. February 15; 31(4):e12; Hogan et al. (1994), Summary of mouse development, Manipulating the Mouse Embryo, Cold Spring Harbor Laboratory Press, Cold Spring Harbor N. Y., pp. 253-289).
Example 4: Silencing of the Mouse Lambda Light Chain Locus
(70) This example describes the silencing of the mouse endogenous lambda light chain locus. The endogenous lambda locus is modified by homologous recombination in ES cells followed by the introduction of genetically modified ES cells in mouse embryos to obtain genetically adapted offspring.
(71) Two regions of the murine lambda locus that together contain all functional lambda V regions are subject to deletion.
(72) The first region targeted for homologous recombination-based deletion is a region that is located 408 bp upstream of the start site of the IGLV2 gene segment and ends 215 bp downstream of IGLV3 gene segment, including the intergenic sequence stretch between these IGLV gene segments. The second region that is subject to a deletion involves the IGLV1 gene segment consisting of a fragment spanning from 392 bp upstream to 171 bp downstream of the IGLV1 gene segment. As a consequence of these two deletion steps, all functional V-lambda genes segments are deleted, rendering the locus functionally inactive (
(73) Construction of the Targeting Vectors
(74) Vectors that received 3-9.6 kb flanking arms on the 3′ and 5′ end fused to the deletion segment were used for targeted homologous recombination in an ES cell line. Both arms were obtained by PCR means ensuring maximum homology. In a first step, the mouse genomic sequence encompassing the Igl V2-V3 regions were replaced with a PuroR cassette flanked by F3 sites, which yields a constitutive KO allele after Flp-mediated removal of selection marker (see
(75) Generation of ES Cells Bearing the Deleted Lambda Fragment
(76) The generation of genetically modified ES cells was essentially performed as described (J. Seibler, B. Zevnik, B. Küter-Luks, S. Andreas, H. Kern, T. Hennek, A. Rode, C. Heimann, N. Faust, G. Kauselmann, M. Schoor, R. Jaenisch, K. Rajewsky, R. Kühn, F. Schwenk (2003), Nucleic Acids Res., February 15; 31(4):e12). See also, Example 14 for a detailed description. To show that both targeting events occurred on the same chromosome several double targeted clones were selected for the in vitro deletion with pCMV C31deltaCpG. The clones were expanded under antibiotic pressure on a mitotically inactivated feeder layer comprised of mouse embryonic fibroblasts in DMEM High Glucose medium containing 20% FCS (PAN) and 1200 μ/mL Leukemia Inhibitory Factor (Millipore ESG 1107). 1×10.sup.7 cells from each clone were electroporated with 20 μg of circular pCMV C31deltaCpG at 240 V and 500 μF and plated on four 10 cm dishes each. Two to three days after electroporation, cells were harvested and analyzed by PCR. Primers used were:
(77) TABLE-US-00001 (SEQ ID NO: 1) 2005_5: CCCTTTCCAATCTTTATGGG (SEQ ID NO: 2) 2005_7: AGGTGGATTGGTGTCTTTTTCTC (SEQ ID NO: 3) 2005_9: GTCATGTCGGCGACCCTACGCC
(78) PCR reactions were performed in mixtures comprising 5 μl PCR Buffer 10× (Invitrogen), 2 μl MgCl.sub.2 (50 mM), 1 μl dNTPs (10 mM), 1 μl first primer (5 μM), 1 μl second primer (5 μM), 0.4 μl Taq (5 U/ul, Invitrogen), 37.6 μl H.sub.2O, and 2 μl DNA. The program used was 95° C. for five minutes; followed by 35 cycles of 95° C. for 30 seconds; 60° C. for 30 seconds; 72° C. for 1 minute; followed by 72° C. for ten minutes.
(79) Generation of ES Mice by Tetraploid Embryo Complementation
(80) The production of mice by tetraploid embryo complementation using genetically modified ES cells was essentially performed as described (Eggan et al., PNAS 98:6209-6214; J. Seibler, B. Zevnik, B. Küter-Luks, S. Andreas, H. Kern, T. Hennek, A. Rode, C. Heimann, N. Faust, G. Kauselmann, M. Schoor, R. Jaenisch, K. Rajewsky, R. Kühn, and F. Schwenk (2003), Nucleic Acids Res., February 15; 31(4):e12; Hogan et al. (Cold Spring Harbor Laboratory Press, Cold Spring Harbor N. Y.), pp. 253-289).
Example 5: Construction of the CAGGS Expression Insert Based on a Rearranged Human Germline IGKV1-39/J-Ck Gene (IGKV1-39/J-Ck)
(81) This example describes the construction of a CAGGS expression cassette incorporating the rearranged human germline IGKV1-39/J region. This insert expression cassette encompasses cloning sites, a Kozak sequence, a leader sequence containing an intron, an open reading frame of the rearranged IGKV1-39 region, a rat CK constant region from allele a and a translational stop sequence (IGKV1-39/J-Ck;
(82) At the 5′ end of the expression cassette, a NotI site was introduced and on the 3′ site a NheI site. Both sites are used for cloning in the CAGGS expression module. After gene assembly according to methods used by GeneArt, the insert is digested with NotI-NheI and cloned into the expression module containing a CAGGS promoter, a stopper sequence flanked by LoxP sites (“floxed”), a polyadenylation signal sequence and, at the 5′ and 3′ end, sequences to facilitate homologous recombination into the Rosa26 locus of mouse ES cell lines. Promoter and/or cDNA fragments were amplified by PCR, confirmed by sequencing and/or cloned directly from delivered plasmids into an RMCE exchange vector harboring the indicated features. A schematic drawing and the confirmed sequence of the final targeting vector pCAGGS-IgVK1-39 are shown in
Example 6: CAGGS Expression Insert Based on the Rearranged Germline IGLV2-14/J V Lambda Region (IGLV2-14/J-Ck)
(83) This example describes the sequence and insertion of an expression cassette incorporating the rearranged germline IGLV2-14/J V lambda region. This insert encompasses cloning sites, a Kozak sequence, a leader sequence containing an intron, an open reading frame of the rearranged IGLV2-14/J region, a rat CK constant region from allele a and a translational stop sequence (IGLV2-14/J-Ck;
(84) At the 5′ end of the expression cassette, a NotI site was introduced and on the 3′ site a NheI site. Both sites are used for cloning in the CAGGS expression module as described by TaconicArtemis. After gene assembly according to methods used by GeneArt, the insert was digested with NotI-NheI and cloned into the expression module containing a CAGGS promoter, a stopper sequence flanked by LoxP sites (“floxed”), a polyadenylation signal sequence and, at the 5′ and 3′ end, sequences to facilitate homologous recombination into the Rosa26 locus of mouse ES cell lines. To construct the final ROSA26 RMCE targeting vector, promoter and/or cDNA fragments were amplified by PCR. Amplified products were confirmed by sequencing and/or cloned directly from delivered plasmids into an RMCE exchange vector harboring the indicated features. A schematic drawing and the confirmed sequence of the final targeting vector pCAGGS-IgVL2-14 is shown in
Example 7: Expression of IGKV1-39/J-Ck in HEK293 Cell Lines (pSELECT-IGKV1-39/J-Ck)
(85) This example describes a method to verify that the IGKV1-39/J-Ck constructs described in Example 5 enable expression and detection of the IGKV1-39/J-Ck L chain in HEK293 cells. The IGKV1-39/J insert (
(86) The VH of anti-tetanus toxoid (TT) IgG MG1494 was cloned into IgG expression vector MV1056 using restriction sites SfiI and BstEII. The resulting clone was sequence verified. HEK293T cells were transfected with five different vector combinations as shown in Table 4 (see Example 8 for details of vector 0817678_pSELECT_0815427). Supernatants were harvested and IgG concentrations determined (see Table 4). No IgG could be detected for supernatants A and B containing light chain only as expected (detection antibody recognized Fc part of IgG). IgG concentration in supernatants C and D was comparable to that of positive control supernatant E, indicating correct expression of the light chain constructs.
(87) Binding to T was analyzed by ELISA to check functionality of the produced antibodies, using hemoglobin as negative control antigen. No TT-specific binding could be detected for supernatants A and B containing light chain only, as expected. TT-specific binding for supernatants C and D was at least as good as for positive control supernatant E, confirming correct expression of the light chain constructs and functional assembly with heavy chain. Antibodies were detected not only using an anti-human IgG secondary antibody, but also an anti-rat Ckappa light chain secondary antibody. The results confirm that the anti-rat Ckappa antibody (BD Pharmingen #553871, clone MRK-1) recognizes the light chain expressed by the pSELECT vectors.
(88) Supernatants were analyzed by non-reducing SDS-PAGE and Western blot (not shown). Detection using an anti-human IgG heavy chain antibody did not show bands for supernatants A and B containing light chain only, as expected. Results for supernatants C and D were comparable to positive control supernatant E, with a band close to the 170 kD marker as expected for intact IgG. Additional lower molecular weight bands were observed as well for supernatants C, D and E, which might represent degradation products, IgG fragments resulting from (partial) reduction and/or irrelevant protein bands due to non-specific binding of the detection antibody.
(89) Detection using an anti-rat Ckappa light chain antibody showed a band close to the 26 kD marker for supernatants A and B, as expected for light chain only. This band was much more intense for A compared to B, indicating that the free IGKV1-39 light chain may be better expressed and/or more stable than the free IGLV2-14 light chain. No bands were detected for control supernatant E as expected, since the expressed IgG contains a human Ckappa light chain. For supernatants C and D, expected bands close to the 170 kD marker were observed; lower molecular weight bands were also observed, but to a lesser extent than above using the anti-human IgG antibody.
(90) In conclusion, transfection of the light chain expression constructs combined with the heavy chain of anti-tetanus toxoid (TT) IgG MG1494 resulted in IgG production comparable to the positive control construct for both the pSELECT kappa and lambda light chain constructs. Both IgG productions yielded ELISA signals in a TT ELISA that were better than or comparable to the control IgG. SDS-PAGE and Western blot analysis confirmed the presence of intact IgG. The tested anti-rat Ckappa antibody worked efficiently in both ELISA and Western blot. Culture supernatant from cells transfected with light chain constructs only did not result in detectable IgG production nor in detectable TT-specific binding, while free light chain was detected on Western blot.
Example 8: Expression of IGLV2-14/J-Ck in HEK293 Cell Lines (pSELECT-IGLV2-14/J-Ck)
(91) This example describes a method to verify that the IGLV2-14/J constructs described in Example 6 enable expression and detection of the IGLV2-14/J-Ck L chain in HEK293 cells. The IGLV2-14/J-Ck insert (
Example 9: Construction of a VK Promoter-Driven Expression Construct Containing an IGKV1-39/J Insert and Multiple Enhancer Elements Derived from the Murine CK Locus (VkP-IGKV1-39/J-Ck; VkP-O12)
(92) This example describes the construction of an expression cassette that contains relevant elements to enable B-cell and developmental/differentiation stage-specific expression of the rearranged human IGKV1-39 VK region, based on the IGKV1-39 VK promoter region, leader containing an intron, germline V-gene, CDR3, IGKJ segment, mouse intergenic region located between Jk and CK, rat Ck allele a open reading frame, and a mouse intergenic fragment from the 3′ end of the mouse CK gene ending just 3′ of the 3′ CK enhancer.
(93) Optimized open reading frames of the leader, IGKV1-39 rearranged gene, and rat CK allele a gene, as described in Example 5, was used for the construction of the expression cassette. The VK promoter region was obtained by gene synthesis procedures (GeneArt, GmbH) and is almost identical to the sequence of the human IGKV1-39 region between −500 bp and the ATG (start site) of the gene. The only deviation from the natural sequence is the introduction of a GCCACCATGG Kozak sequence (SEQ ID NO:102) at the ATG (start) site in order to promote translation. A genomic fragment from a mouse BAC clone (TaconicArtemis) is used as the basis for the introduction of individual elements. This fragment is identical to the sequence of the mouse VK locus starting with the intron donor site located directly 3′ of the JK5 region and ending just 3′ of the 3′ CK enhancer and covers approximately 12.5 kb.
(94) The final construct contains from 5′ to 3′ end the following elements: human genomic IGKV1-39 promoter (500 bp), a Kozak sequence, a human IGKV1-39 leader part 1 (optimized), a human IGKV1-39 leader intron, a human IGKV1-39 leader part 2 (optimized), a human IGKV1-39 germline gene (optimized), a human J-region (optimized), a mouse intergenic region including the intron enhancer element, a rat (Rattus norvegicus) kappa constant region (optimized), and a mouse intergenic region including the 3′ kappa enhancer. The elements of this expression cassette are shown in
Example 10: Construction of a VK Promoter-Driven Expression Construct Containing an IGLV2-14/J Clone and Multiple CK Locus-Derived Enhancer Elements (VkP-IGLVL2-14/J-Ck; VkP-2a2)
(95) This example describes the same construct as described in Example 9, except that the IGKV1-39 gene and J-region are replaced by the optimized human IGLV2-14 germline gene including a unique V-J region (VkP-IGLV2-14/J-Ck; VkP-2a2;
Example 11: Construction of a VK Promoter-Driven Expression Construct Containing an IGKV1-39 Clone Lacking the CK Intron Enhancer Element (VkP-IGKV1-39/J-Ck-Δ1; VkP-O12-Del1)
(96) The construct described in Example 9 was modified by removing the CK intron enhancer element, located in the intergenic region between the human J region and the rat CK region by standard PCR modification and DNA cloning methodologies (GeneArt, GmBH). The resulting expression cassette is shown in
(97) An outline of the pVkP-O12-del1 vector and the targeting strategy is depicted in
Example 12: Construction of a VK Promoter-Driven Expression Construct Containing an IGKV1-39 Clone Lacking the CK Intron Enhancer Element and a Truncated 3′ CK Enhancer Element (VkP-IGKV1-39/J-Ck-Δ2; VkP-O12-Del2)
(98) The construct described in Example 11 was modified by truncating the 3′ CK enhancer element and deleting part of the intergenic region 3′ of the rat Ck gene, to remove potential inhibitory elements. This was achieved by removing the intergenic sequence between an EcoRV site (located 3′ of the rat Ck gene) and the NcoI site present in the 3′ enhancer (5993 bp) and further removing the sequence between the 3′ enhancer BstXI site and the BstXI site 3′ of the 3′ enhancer (474 bp) using standard methods. The resulting expression cassette is shown in
(99) An outline of the pVkP-O12-del2 vector and the targeting strategy is depicted in
Example 13: Expression of Vk Constructs in Cell Lines
(100) The constructs described in Examples 9-12 are tested for their ability to produce light chain proteins in the myeloma cell lines MPC11 (ATCC CCL167), B-cell lymphoma WEHI231 (ATCC CRL-1702), the T-cell lymphoma EL4 (ATCC TIB-39) and in HEK293 (ATCC CRL1573). The enhancer and promoter elements in the construct enable expression in the B-cell lines but not in cell lines derived from other tissues. After transfection of the cell lines using purified linearized DNA and Fugene6 (Roche) cells are cultured for transient expression. Cells and supernatant are harvested and subjected to SDS-PAGE analysis followed by western blotting using a specific anti-rat-C-kappa antibody. Supernatants are analyzed in ELISA for secreted L chains using the anti-rat CK antibody (Beckton Dickinson #550336).
Example 14: Generation of Transgenic ES Lines
(101) All constructs as described in Examples 3, 4, 5, 6, 9, 10, 11 and 12 were used to generate individual stable transgenic ES lines by means of homologous recombination. The methods for generation of transgenic ES lines via homologous recombination are known in the field (e.g., Eggan et al., PNAS 98:6209-6214; J. Seibler, B. Zevnik, B. Kiiter-Luks, S. Andreas, H. Kern, T. Hennek, A. Rode, C. Heimann, N. Faust, G. Kauselmann, M. Schoor, R. Jaenisch, K. Rajewsky, R. Kiihn, F. Schwenk (2003), Nucleic Acids Res., February 15; 31(4):e12; Hogan et al. (Cold Spring Harbor Laboratory Press, Cold Spring Harbor N. Y.), pp. 253-289).
(102) For all constructs described in Examples 5 and 6, and Examples 9-12, the RMCE ES cell line (derived from mouse strain 129S6B6F1-Gt(ROSA)26Sortm10Arte) was grown on a mitotically inactivated feeder layer comprised of mouse embryonic fibroblasts (MEF) in DMEM High Glucose medium containing 15% FBS (PAN 1302-P220821). Leukemia Inhibitory Factor (Chemicon ESG 1107) was added to the medium at a concentration of 900 U/mL. For manipulation, 2×10.sup.5 ES-cells were plated on 3.5 cm dishes in 2 ml medium. Directly before transfection, 2 ml fresh medium was added to the cells. Three μl Fugene6 Reagent (Roche; Catalog No. 1 814 443) was mixed with 100 μl serum free medium (OptiMEM I with Glutamax I; Invitrogen; Catalog No. 51985-035) and incubated for five minutes. One hundred μl of the Fugene/OptiMEM solution was added to 2 μg circular vector and 2 μg CAGGS-Flp and incubated for 20 minutes. This transfection complex was added dropwise to the cells and mixed. Fresh medium was added to the cells the following day. From day 2 onwards, the medium was replaced daily with medium containing 250 μg/mL G418 (Geneticin; Invitrogen; Catalog No. 10131-019). Seven days after transfection, single clones were isolated, expanded, and molecular analyzed by Southern blotting according to standard procedures.
(103) For each construct, analysis of multiple clones by restriction enzyme digestion of genomic DNA of single clones followed by hybridization with 5′ probes, 3′ probes, and internal probes resulted in clones that comprised a correct, single insertion at the correct position in the Rosa26 locus. An example is provided in
Example 15: Generation of Transgenic Mouse Strains
(104) All ES cell lines that were generated and verified for their modifications as described in Example 14 were used to generate stable transgenic mice by means of tetraploid recombination. The methods are known in the field. In general, after administration of hormones, superovulated Balb/c females were mated with Balb/c males. Blastocysts were isolated from the uterus at dpc 3.5. For microinjection, blastocysts were placed in a drop of DMEM with 15% FCS under mineral oil. A flat tip, piezo actuated microinjection-pipette with an internal diameter of 12-15 micrometers was used to inject 10-15 targeted C57BL/6 N.tac ES cells into each blastocyst. After recovery, injected blastocysts were transferred to each uterine horn of 2.5 days post coitum, pseudopregnant NMRI females. Chimerism was measured in chimeras (G0) by coat color contribution of ES cells to the Balb/c host (black/white). Highly chimeric mice were bred to strain C57BL/6 females. Depending on the project requirements, the C57BL/6 mating partners are non-mutant (W) or mutant for the presence of a recombinase gene (Flp-Deleter or Cre-deleter or CreER inducible deleter or combination of Flp-deleter/CreER). Germline transmission was identified by the presence of black, strain C57BL/6, offspring (G1).
(105) For example, ESC clone IgVK1-39 2683 8 (see Examples 5 and 14) was injected in a total of 62 blastocysts in three independent experiments. Three litters were obtained with a total of six pups. All pups were chimeric. Three heterozygous offspring pups were obtained that were used for further crossing.
(106) ESC Clone Kappa 2692 A-CIO (see Examples 3 and 14) was injected in a total of 54 blastocysts in three independent experiments. Three litters were obtained with a total of eleven pups, of which ten were chimeric. Eight heterozygous offspring pups were obtained that were used for further crossing.
(107) ESC Clone Kappa 2692 B-C1 (see Examples 3 and 14) was injected in a total of 51 blastocysts in three independent experiments. Two litters were obtained with a total of six pups, of which four were chimeric. Three heterozygous offspring pups were obtained that were used for further crossing.
Example 16: Breeding
(108) This example describes the breeding for obtaining mice that contain transgenic expression cassettes as described Example 14 and knock-out mice in which the endogenous lambda and kappa loci have been silenced. The localization of V-lambda on chromosome 16 and CD19 on chromosome 7 allow standard breeding procedures. The breeding of the co-localized Vk locus and Rosa26 locus on chromosome 6 with a distance of about 24 cM requires special attention during the screening as only a percentage of the offspring shows crossover in a way that both modifications are brought together on one chromosome.
(109) All four loci have to be combined in a single mouse strain that is homo- or heterozygous for CD19-cre (not described) and modified Rosa26 transgene and homozygous for the other loci. Breeding is performed by standard breeding and screening techniques as appropriate and offered by commercial breeding companies (e.g., TaconicArtemis).
Example 17: Immunizations of Mice
(110) Primary and booster immunization of mice are performed using standard protocols.
(111) To validate the transgenic expression of human rearranged V.sub.κ O12 (IGKV1-39)—rat C.sub.κ light chains (see Examples 5, 14-16) in B cells from CD19-HuV.sub.κ1 mice and to assess its impact on VH repertoire size, diversity of VH family usage and V(D)J recombination after immunization, the CD19-HuV.sub.κ1 transgenic mice are immunized with tetanus toxin vaccine (TT vaccine) and VH sequence diversity of randomly picked clones from CD19-HuV.sub.κ1 mice are compared with TT-immunized wt mice and CD19-Cre HuVk1 negative littermates. Data on the SHM frequency of the human V.sub.κ O12 transgene in the immunized mice are obtained. A diverse collection of at least 40 TT-specific, clonally-unrelated mAbs containing the human V.sub.κ O12 are recovered from CD19-HuV.sub.κ1 mice by phage display.
(112) For this, three adult CD19-HuV.sub.κ1 mice are vaccinated with TT vaccine using standard immunization procedures. After immunization, serum titers are measured using TT specific ELISA (TT: Statens Serum Institute, Art. no. 2674) and spleen suspensions subjected to cell sorting by the FACS procedure after staining with a rat C.sub.κ-specific monoclonal antibody to isolate transgenic B cells (clone RG7/9.1; BD Pharmingen #553901, Lot #06548). RNA from rat C.sub.κ-positive B cells are extracted and the resulting cDNA material used for library building and SHM analysis.
(113) The standard monoclonal mouse anti-rat CK antibody (clone RG7/9.1; BD Pharmingen #553901, Lot #06548) is used in FACS analysis of transgene expressing B cells (Meyer et al. (1996), Int. Immunol. 8:1561). The clone RG7/9.1 antibody reacts with a monotypic (common) kappa chain determinant. This anti-rat CK antibody (clone RG7/9.1 (BD Pharmingen #553901, Lot #06548) is labeled with R-phycoerythrin (PE) using the LYNX rapid conjugation kit according to the manufacturer's instructions for FACS analysis and sorting. The labeled antibody is firstly tested by flow cytometry for binding to rat C.sub.κ-containing functional light chain proteins produced into transiently transfected HEK-293T cells; the un-conjugated antibody serves as a positive control. Two other antibodies shown to bind to rat C.sub.κ by ELISA and Western-blot (see Example 7) are tested as well by flow cytometry.
(114) Fab-phage display library building is carried out with a set of optimized degenerate PCR primers designed to amplify C57BL/6 VH genes; the minimal library size is 10.sup.6 clones, and minimal insert frequency is 80%. The vector used, MV1043 (
(115) Before selection, VH sequencing of 96 randomly picked clones is performed to validate VH repertoire diversity that is compared to diversity obtained from an unselected library previously generated using the same procedures from BALB/c mice immunized with TT. A library from C57Bl/6 wt mice that are immunized in the same way allows diversity comparison between two preselected libraries sharing the same vaccine and the same genetic background.
(116) Several independent selections are performed on TT coated in immunotubes. Variables that may be included are selections using biotinylated antigens in solution or selections on captured TT. Based on the number and diversity of ELISA-positive clones obtained in the first selections, decisions on additional rounds of selection are made. Clones are considered positive when>3× positive over a negative control clone. Positive clones are analyzed by ELISA against a panel of negative control antigens to verify antigen specificity. The aim is to identify at least 40 unique VH regions, as based on unique CDR3 sequences and V.sub.HDJ.sub.H rearrangements.
(117) Amplification of the cDNA material from rat CK-positive sorted B cells is performed with a PCR forward primer specific to the human leader sequence and a PCR reverse primer specific to the rat CK sequence, in a region not redundant with the mouse CK sequence, as reported in a recent study (Brady et al. (2006), JIM 315:61). Primer combinations and annealing temperatures are firstly tested on cDNA from HEK-293T cells transfected with 0817676_pSELECT_0815426=pSELECT vector with IGKV1-39 DNA cassette (see Example 7).
(118) The amplification products is cloned in pJET-1 vector and after XL1-blue transformation, 96 colonies are sequenced for assessing VL SHM frequency by direct comparison to the V.sub.κ O12 (IGKV1-39) germline sequence. The R/S ratio method, as described in our study on human TT-specific antibodies (de Kruif et al. (2009), J. Mol. Biol. 387:548) allows discrimination between random mutations and antigen-driven mutations that occurred on VL sequences.
Example 18: Immunofluorescent Analysis of B Cell Populations in Transgenic Mouse Lines
(119) This example describes the use of antibodies and flow cytometry to analyze B cell populations in primary (bone marrow) and secondary (spleen, peritoneal) lymphoid organs and blood. Methods and reagents are described in Middendorp et al. (2002), J. Immunol. 168:2695; and Middendorp et al. (2004), J. Immunol. 172:1371. For analysis of early B cell development in bone marrow, cells were surface stained with combinations of antibodies (Becton Dickinson) specific for B220, CD19, CD25, IgM, IgD, mouse Ckappa, mouse Clambda and rat Ckappa to detect pro-B cells, pre-B cells, large pre-B cells, early and late immature B cells and recirculating B cell populations expressing the transgene on their surface. DAPI staining (Invitrogen) was included to exclude dead cells from the analysis and FC block (Becton Dickinson) to inhibit antibody interaction with Fc receptors on myeloid cells. For analysis of surface transgene expression on B cell populations in peripheral lymphoid organs and blood, cells were stained with combinations of antibodies (Becton Dickinson) specific for B220, CD5, CD19, CD21, CD23, IgM, IgD, mouse Ckappa, mouse Clambda and rat Ckappa. DAPI staining was included to exclude dead cells from the analysis and FC block to inhibit antibody interaction with Fc receptors on myeloid cells. In addition, combinations of antibodies (Becton Dickinson) specific for CD3, CD4, CD11b, CD11c and NK1.1 were included to determine if transgene expression occurred in cell types outside of the B cell compartment.
(120) Three mice heterozygous for the human IGKV1-39/rat Ckappa transgene and heterozygous for the CD19-Cre transgene on a C57BL6 background (HuVk1/CD19-Cre) were analyzed. As controls for the FACS analysis, three littermate mice wild-type for the human IGKV1-39/rat Ckappa transgene and heterozygous for the CD19-Cre transgene on a C57BL6 background (CD19-Cre) and two C57BL6/NTac mice (Wt) were included. All animals were allowed to acclimatize in the animal facility for one week before analysis and all mice were male and six weeks of age. Lymphocytes were isolated from the femurs, spleens, peritoneal cavity and blood of mice using conventional techniques as previously described (Middendorp et al. (2002), J. Immunol. 168:2695; and Middendorp et al. (2004), J. Immunol. 172:1371). Antibodies were pre-combined as shown in
(121) Transgenic mice were similar in weight, appearance and activity to wild-type mice. No gross anatomical alterations were observed during the harvesting of tissues. No difference was observed in the numbers of B cells in the bone marrow (BM) and spleen (Table 9) or in the numbers of B cells, T cells and myeloid cells in peripheral organs between transgenic and wild-type mice. In addition, the frequency or proportion of the cells in the different lymphocyte developmental pathways was not altered in transgenic mice when compared to wild-type mice. Thus in the double transgenic (HuVk1/CD19-Cre) and transgenic (CD19-Cre) mice lymphoid and most importantly B cell development was indistinguishable from wild-type mice.
(122) In the peripheral lymphoid organs, staining with the transgene specific antibody (anti-ratCkappa-PE) was only observed in the B cell populations. T cell, myeloid cell and NK cell populations were all negative for surface expression of the transgene in the spleen (
(123) Differentiation of B cells from multilineage precursors to mature B cells occurs in the bone marrow. In the lymphocytes analyzed from the bone marrow, extracellular and transgene expression was not detectable in the earliest B cell progenitors the pro- and pre-B cell consistent with the pattern of normal light chain expression (
(124) Thus, overall this analysis demonstrates that expression of the human IGKV1-39/Ckappa transgene is restricted to the B cell compartment and the temporal regulation of its expression is similar to the endogenous kappa and lambda light chains resulting in normal development of all B cell populations. The apparent lower level of expression of the transgene could be explained by the strength of the promoter in comparison to the promoter and enhancers present on endogenous light chain genes or by a delay in transgene expression that gives the endogenous light chains a competitive advantage in pairing with the rearranged heavy chain. This is consistent with the observation that as B cells mature the relative intensity of transgene staining increases compared to the endogenous light chains. In addition, the observation that B cells numbers are normal and that every surface Ig+ B cell co-expresses an endogenous and transgenic light chain supports the conclusion that the IGKV1-39 variable region is capable of pairing with a normal repertoire of different murine heavy chain variable regions. We conclude from this analysis that insertion of the IGKV1-39/rat Ckappa transgene driven by the CD19-Cre activated CAGGS promoter in the Rosa locus facilitates timely and B cell-specific expression of the transgene and that the transgene is capable of pairing with a normal repertoire of murine heavy chains.
Example 19: Epibase® T-Cell Epitope Profile for IGKV1-39
(125) The protein sequence of IGKV1-39 (
(126) Free energies were converted into Kd-values through ΔG.sub.bind=RT ln(Kd).
(127) Peptides were classified as strong (S), medium (M), weak and non (N) binders. The following cutoffs were applied:
(128) S: strong binder: Kd<0.1 μM.
(129) M: medium binder: 0.1 μM≤Kd<0.8 μM.
(130) N: weak and non-binder: 0.8 μM≤Kd.
(131) Peptides corresponding to self-peptides were treated separately. The list of self-peptides was taken from 293 antibody germline sequences. They are referred to as “germline-filtered” peptides.
(132) S- and M-peptides are mapped onto the target sequence in so-called epitope maps; S-affinities are plotted quantitatively; M-values are presented qualitatively. As a general overview of the results, Table 6 lists the number of strong and medium binders in the analyzed proteins, for the groups of HLA class II receptors corresponding to the DRB1, DQ, DP and DRB3/4/5 genes. Counting was done separately for strong and medium affinity binders. Peptides binding to multiple allotypes of the same group were counted as one. Values between brackets refer to germline-filtered peptides. In Table 7, the sequence is shown in a format suitable for experimental work. The sequence is broken down in consecutive 15-mers overlapping by 12 residues. For each 15-mer, the promiscuity is listed (the number of allotypes out of a total of 47 for which the 15-mer contains a critical binder), as well as the implied serotypes. The Epibase® profile and epitope maps are shown in
(133) It was concluded that IGKV1-39 contains no strong non-self DRB1 binders. Typically, significantly more binders were found for DRB1 than for other HLA genes. This is in agreement with experimental evidence that allotypes belonging to the DRB1 group are more potent peptide binders. Medium strength epitopes for DRB1 allotypes are expected to contribute to the population response, and cannot be disregarded. Again, no non-self DRB1 binders were found in IGKV1-39.
(134) In the humoral response raised against an antigen, the observed T.sub.H cell activation/proliferation is generally interpreted in terms of the DRB1 specificity. However, one cannot ignore the possible contribution of the DRB3/4/5, DQ and DP genes. Given the lower expression levels of these genes as compared to DRB1, the focus was on the class of strong epitopes for DRB3/4/5, DQ and DP. “Critical epitopes” are those epitopes that are strong binders for any DRB1, DRB3/4/5, DQ or DP allotype or are medium binders for DRB1. IGKV1-39 contains no strong or medium non-self binders for DRB3/4/5, DQ, or DP.
(135) A number of peptides are also present in germline sequences (values between brackets in Table 6). Such peptides may very well bind to HLA but they are assumed to be self and, hence, non-immunogenic. In total, six strong and 16 medium germline-filtered DRB1 binders were found in IGKV1-39. Framework region 1 up to framework region 3 is an exact match for germline V-segment VKI 2-1-(1) O12 (VBase), a.k.a. IGKV1-39*01 (IMGT). Framework region 4 is an exact match for germline J-segment JK1 (V-base) a.k.a. IGKJ1*01(IMGT). It is hardly surprising that these segments do not contain any non-self epitopes.
Example 20: Production Characteristics of IGKV1-39
(136) There is a great demand for antibody discovery platforms that yield therapeutic antibodies that are thermodynamically stable and give good expression yields. These characteristics are important in ensuring the stability of the drug substance during production and after injection of the drug product into the patient. In addition good expression yields impact directly on the cost of drug manufacture and thus pricing, patient access and profitability. Virtually all therapeutic antibodies in clinical use today are composed of human IgG1 and kappa constant regions but use different heavy and light chain variable regions that confer specificity. Human variable heavy and light chain domains can be divided into families that have greater than 80% sequence divergence. When rearranged examples of these families in germline configuration are combined and compared for stability and yield it is clear that the gene families are not equal in terms of biophysical properties. In particular V.sub.H3, V.sub.H1 and V.sub.H5 have favourable stability for the heavy chains and Vk1 and Vk3 have the best stability and yield of light chains. In addition when mutations are introduced as part of the somatic hypermutation process they can interfere with V.sub.H/V.sub.L pairing. To assess the effect that different light chain genes with different rates of mutation have on the production characteristics of a fixed V.sub.H chain, a Fab phage display library was built of light chains (kappa and lambda) from six naïve healthy donors combined with a panel of 44 TT binding heavy chains from immunized donors. After one round of selection TT binding Fab clones were isolated. Several of these shared the same V.sub.H gene as the TT clone PG1433 in combination with different light chains. The Fab light chain fragments were recloned into a kappa expression vector and transfected in combination with DNA encoding the heavy chain of PG1433 into 293 cells and specific IgG production measured by ELISA. As demonstrated in Table 8 the selected clones containing PG1433 V.sub.H combined with different light chains had between five- and ten-fold lower protein expression PG1433 V.sub.H combined with IGKV1-39. Note that all of the light chains contained amino acid mutations within their coding regions that might disrupt V.sub.H paring and reduce production stability. Thus, in addition to reducing the chances of unwanted immunogenicity, it is expected that the use of the light chain IGKV1-39 without mutations contributes to improved production stability and yields of various specificity-contributing V.sub.H genes. Indeed stable clones generated by the transfection of different V.sub.H genes all paired with IGKV1-39 are able to be passaged extensively and still retain robust production characteristics as shown in
Example 21: Generation of Mice Expressing Fully Human VH and VL Regions
(137) Transgenic mice described herein are crossed with mice that already contain a human VH locus. Examples of appropriate mice comprising a human VH locus are disclosed in Taylor et al. (1992), Nucleic Acids Res. 20:6287-95; Lonberg et al. (1994), Nature 368:856-9; Green et al. (1994), Nat. Genet. 7:13-21; Dechiara et al. (2009), Methods Mol. Biol. 530:311-24.).
(138) After crossing and selecting for mice that are at least heterozygous for the IGKV1-39 transgene and the human VH locus, selected mice are immunized with a target. VH genes are harvested as described hereinabove. This method has the advantage that the VH genes are already fully human and thus do not require humanization.
Example 22: Isolation, Characterization, Oligoclonics Formatting and Production of Antibodies Targeting Human IL6 for Treatment of Chronic Inflammatory Diseases Such as Rheumatoid Arthritis
(139) A spleen VH repertoire from transgenic mice that are immunized with human recombinant IL6 is cloned in a phage display Fab vector with a single human IGKV1-39-C kappa light chain (identical to the mouse transgene) and subjected to panning against the immunogen human IL6. Clones that are obtained after two to four rounds of panning are analyzed for their binding specificity. VH genes encoding IL6-specific Fab fragments are subjected to sequence analysis to identify unique clones and assign VH, DH and JH utilization. The Fab fragments are reformatted as IgG1 molecules and transiently expressed. Unique clones are then grouped based on non-competition in binding assays and subjected to affinity and functional analysis. The most potent anti-IL6 IgG1 mAbs are subsequently expressed as combinations of two, three, four or five heavy chains comprising different VH-regions in the Oligoclonics format, together with one IGKV1-39-C-based kappa light chain and tested in vitro for complex formation with IL-6. The Oligoclonics are also tested in vivo for clearance of human IL-6 from mice. An Oligoclonic with the most potent clearance activity is chosen and the murine VH genes humanized according to conventional methods. The humanized IgG1 are transfected into a mammalian cell line to generate a stable clone. An optimal subclone is selected for the generation of a master cell bank and the generation of clinical trial material.
(140) Many of the protocols described here are standard protocols for the construction of phage display libraries and the panning of phages for binding to an antigen of interest and are described, for example, in Antibody Phage Display: Methods and Protocols (2002), Editor(s) Philippa M. O'Brien, Robert Aitken, Humana Press, Totowa, N.J., USA.
(141) Immunizations
(142) Transgenic mice receive three immunizations with human IL6 every two weeks using the adjuvant Sigma titerMax according to manufacturer's instructions.
(143) RNA Isolation and cDNA Synthesis
(144) Three days after the last immunization, spleens and lymphnodes from the mice are removed and passed through a 70 micron filter into a tube containing PBS pH 7.4 to generate a single cell suspension. After washing and pelleting of lymphocytes, cells are suspended in TRIzol LS Reagent (Invitrogen) for the isolation of total RNA according to the manufacturer's protocol and subjected to reverse transcription reaction using 1 microgram of RNA, Superscript III RT in combination with dT20 according to manufacturer's procedures (Invitrogen).
(145) The generation of Fab phage display libraries is carried out as described in Example 2.
(146) Selection of Phages on Coated Immunotubes
(147) Human recombinant IL6 is dissolved in PBS in a concentration of 5 μg/ml and coated to MAXISORP™ Nunc-Immuno Tube (Nunc 444474) overnight at 4° C. After discarding the coating solution, the tubes are blocked with 2% skim milk (ELK) in PBS (blocking buffer) for one hour at Room Temperature (RT). In parallel, 0.5 ml of the phage library is mixed with 1 ml blocking buffer and incubated for 20 minutes at room temperature. After blocking the phages, the phage solution is added to the IL6-coated tubes and incubated for two hours at RT on a slowly rotating platform to allow binding. Next, the tubes are washed ten times with PBS/0.05% TWEEN™-20 detergent followed by phage elution by incubating with 1 ml 50 mM glycine-HCl pH 2.2 ten minutes at RT on rotating wheel and directly followed by neutralization of the harvested eluent with 0.5 ml 1 M Tris-HCl pH 7.5.
(148) Harvesting Phage Clones
(149) A 5 ml XL1-Blue MRF (Stratagene) culture at O.D. 0.4 is added to the harvested phage solution and incubated for 30 minutes at 37° C. without shaking to allow infection of the phages. Bacteria are plated on Carbenicillin/Tetracycline 4% glucose 2*TY plates and grown overnight at 37° C.
(150) Phage Production
(151) Phages are grown and processed as described by Kramer et al. 2003 (Kramer et al. 2003, Nucleic Acids Res. 31(11):e59) using VCSM13 as helper phage strain.
(152) Phage ELISA
(153) ELISA plates are coated with 100 microliters human recombinant IL6 per well at a concentration of 2.5 micrograms/ml in PBS overnight at 4° C. Plates coated with 100 microliters thyroglobulin at a concentration of 2 micrograms/ml in PBS are used as a negative control. Wells are emptied, dried by tapping on a paper towel, filled completely with PBS-4% skimmed milk (ELK) and incubated for one hour at room temperature to block the wells. After discarding the block solution, phage minipreps pre-mixed with 50 μl blocking solution are added and incubated for one hour at RT. Unbound phages are subsequently removed by five washing steps with PBS-0.05% Tween-20. Bound phages are detected by incubating the wells with 100 microliters anti-M13-HRP antibody conjugate (diluted 1/5000 in blocking buffer) for one hour at room temperature. Free antibody is removed by repeating the washing steps as described above, followed by TMB substrate incubation until color development was visible. The reaction is stopped by adding 100 microliters of 2 M H2SO4 per well and analyzed on an ELISA reader at 450 nm emission wavelength.
(154) Sequencing
(155) Clones that give signals at least three times above the background signal are propagated, used for DNA miniprep procedures (see procedures Qiagen miniPrep manual) and subjected to nucleotide sequence analysis. Sequencing is performed according to the Big Dye 1.1 kit accompanying manual (Applied Biosystems) using a reverse primer (CH1_Rev1, Table 1) recognizing a 5′ sequence of the CH1 region of the human IgG1 heavy chain (present in the Fab display vector MV1043,
(156) Construction and Expression of Chimeric IgG1
(157) Vector MV1057 (
(158) IgG1 Binding and Competition Analysis
(159) IgG1 antibodies are titrated in ELISA using IL6-coated plates as described above and an anti-human IgG peroxidase conjugate. Competition ELISAs to group antibodies based on epitope recognition are performed by incubating Fab phages together with IgG1 or with commercial antibodies against IL6 (e.g., Abcam cat. no. ab9324) in IL6-coated plates, followed by detection of bound Fab phage using an anti-M13 peroxidase conjugate.
(160) IgG1 Affinity Measurements
(161) The affinities of the antibodies to IL6 are determined with the Quantitative kinetic protocol on the Octet (ForteBio). Antibodies are captured onto an Anti-Human IgG Fc Capture biosensor and exposed to free IL6 and analyzed using proprietary software to calculate the Kd of each antibody.
(162) Functional Activity of IL6 Antibodies
(163) To test the ability of the selected antibodies to inhibit binding between IL6 and IL6 receptor (IL6R), an ELISA based assay is used. Various concentrations of antibody are mixed with a fixed concentration (10 ng/ml) of biotinylated IL6 as described by Naoko et al. 2007, Can. Res. 67:817-875. The IL6-antibody immune complex is added to immobilized IL6R. The binding of biotinylated IL6 to IL6R is detected with horseradish peroxidase-conjugated streptavidin. The reduction of ELISA signal is a measurement of inhibition. As positive control for inhibition of binding between IL6 and IL6R either anti-IL6R antibody (Abcam cat. no. ab34351; clone B-R6) or anti IL6 antibody (Abcam cat. no. ab9324) is used.
(164) In vitro blocking activity of the selected anti-IL6 antibodies is measured in a proliferation assay using the IL6-dependent cell line 7TD1. Briefly, cells are incubated with different concentrations of human IL6 with or without the anti-IL6 antibody. The available amount of IL6 determines the degree of proliferation. Thus if an added antibody blocks IL6 binding the proliferation readout is reduced compared to a non binding antibody control. Proliferation is measured by the incorporation of 5-bromo-2′-deoxy-uridine (BrdU) into the DNA using the BrdU proliferation kit (Roche cat. no. 11444611001) according to the manufacturer's instructions.
(165) Generation of Anti-IL6 Oligoclonics
(166) The most potent anti-IL6 antibodies are selected from each epitope group. The expression constructs expressing these antibodies are transfected into HEK293T cells in non-competing groups of three in different ratios (1:1:1; 3:1:1; 1:3:1; 1:1:3; 3:3:1; 1:3:3; 3:1:3; 10:1:1; 1:10:1; 1:1:10; 10:10:1; 1:10:10; 10:1:10; 3:10:1; 10:3:1; 1:10:3; 3:1:10; 10:1:3; 1:3:10). Antibody containing supernatants are harvested and purified and characterized as above.
(167) Complex Formation and In Vivo Clearance of Anti-IL6 Oligoclonics
(168) To measure the ability of anti-IL6 Oligoclonics to form immune complexes and to analyze these complexes Size Exclusion Chromatography (SEC) is used according to the approach disclosed by Min-Soo Kim et al. (2007), JMB 374:1374-1388, to characterize the immune-complexes formed with different antibodies to TNFα. Different molar ratios of the anti-IL6 Oligoclonics are mixed with human IL6 and incubated for 20 hours at 4° C. or 25° C. The mixture is analyzed on an HPLC system fitted with a size exclusion column; different elution times are correlated to molecular weight using a molecular weight standards.
(169) The ability of antibodies to form complexes with IL6 is correlated with their ability to rapidly clear the cytokine from the circulation in vivo. This is confirmed by measuring the clearance of radiolabelled IL6 from mice. Briefly, female, six- to eight-week-old Balb/c mice are obtained and 18 hours before the experiment, the animals are injected intravenously (IV) via the lateral tail vein with different doses of purified anti-IL6 Oligoclonics. On day 0, the mice are injected IV with 50 microliters of radiolabeled IL-6 (1×10E7 cpm/mL) under the same conditions. Blood samples (approximately 50 microliters) are collected at several time intervals and stored at 4° C. The samples are centrifuged for five minutes at 4000×g and the radioactivity of the serum determined. All pharmacokinetic experiments are performed simultaneously with three animals for each treatment.
(170) Generation of Anti-IL6 Oligoclonics Stable Clones and Preclinical Development
(171) A lead anti-IL6 Oligoclonic is selected based on the in vitro and in vivo potency as determined above. The murine VH genes are humanized according to standard methods and combined with the fully human IGKV1-39 light chain in an expression vector as described above. Examples of humanization methods include those based on paradigms such as resurfacing (E. A. Padlan et al. (1991), Mol. Immunol. 28:489), superhumanization (P. Tan, D. A., et al. (2002), J. Immunol. 169:1119) and human string content optimization (G. A. Lazar et al. (2007), Mol. Immunol. 44:1986). The three constructs are transfected into PER.C6 cells at the predetermined optimal ratio (described above) under the selective pressure of G418 according to standard methods. A stable high producing anti-IL6 Oligoclonic clone is selected and a working and qualified master cell bank generated.
(172) TABLE-US-00002 TABLE 1 List of primers DO- Primer Sequence 0012 CH1_Rev1 TGCCAGGGGGAAGACCGATG (SEQ ID NO: 4) 0656 MVH-1 GCCGGCCATGGCCGAGGTRMAGCTTCAGGAGTCAGGAC (SEQ ID NO: 5) 0657 MVH-2 GCCGGCCATGGCCGAGGTSCAGCTKCAGCAGTCAGGAC (SEQ ID NO: 6) 0658 MVH-3 GCCGGCCATGGCCCAGGTGCAGCTGAAGSASTCAGG (SEQ ID NO: 7) 0659 MVH-4 GCCGGCCATGGCCGAGGTGCAGCTTCAGGAGTCSGGAC (SEQ ID NO: 8) 0660 MVH-5 GCCGGCCATGGCCGARGTCCAGCTGCAACAGTCYGGAC (SEQ ID NO: 9) 0661 MVH-6 GCCGGCCATGGCCCAGGTCCAGCTKCAGCAATCTGG (SEQ ID NO: 10) 0662 MVH-7 GCCGGCCATGGCCCAGSTBCAGCTGCAGCAGTCTGG (SEQ ID NO: 11) 0663 MVH-8 GCCGGCCATGGCCCAGGTYCAGCTGCAGCAGTCTGGRC (SEQ ID NO: 12) 0664 MVH-9 GCCGGCCATGGCCCAGGTYCAGCTYCAGCAGTCTGG (SEQ ID NO: 13) 0665 MVH-10 GCCGGCCATGGCCGAGGTCCARCTGCAACAATCTGGACC (SEQ ID NO: 14) 0666 MVH-11 GCCGGCCATGGCCCAGGTCCACGTGAAGCAGTCTGGG (SEQ ID NO: 15) 0667 MVH-12 GCCGGCCATGGCCGAGGTGAASSTGGTGGAATCTG (SEQ ID NO: 16) 0668 MVH-13 GCCGGCCATGGCCGAVGTGAAGYTGGTGGAGTCTG (SEQ ID NO: 17) 0669 MVH-14 GCCGGCCATGGCCGAGGTGCAGSKGGTGGAGTCTGGGG (SEQ ID NO: 18) 0670 MVH-15 GCCGGCCATGGCCGAKGTGCAMCTGGTGGAGTCTGGG (SEQ ID NO: 19) 0671 MVH-16 GCCGGCCATGGCCGAGGTGAAGCTGATGGARTCTGG (SEQ ID NO: 20) 0672 MVH-17 GCCGGCCATGGCCGAGGTGCARCTTGTTGAGTCTGGTG (SEQ ID NO: 21) 0673 MVH-18 GCCGGCCATGGCCGARGTRAAGCTTCTCGAGTCTGGA (SEQ ID NO: 22) 0674 MVH-19 GCCGGCCATGGCCGAAGTGAARSTTGAGGAGTCTGG (SEQ ID NO: 23) 0675 MVH-20 GCCGGCCATGGCCGAAGTGATGCTGGTGGAGTCTGGG (SEQ ID NO: 24) 0676 MVH-21 GCCGGCCATGGCCCAGGTTACTCTRAAAGWGTSTGGCC (SEQ ID NO: 25) 0677 MVH-22 GCCGGCCATGGCCCAGGTCCAACTVCAGCARCCTGG (SEQ ID NO: 26) 0678 MVH-23 GCCGGCCATGGCCCAGGTYCARCTGCAGCAGTCTG (SEQ ID NO: 27) 0679 MVH-24 GCCGGCCATGGCCGATGTGAACTTGGAAGTGTCTGG (SEQ ID NO: 28) 0680 MVH-25 GCCGGCCATGGCCGAGGTGAAGGTCATCGAGTCTGG (SEQ ID NO: 29) 0681 ExtMVH-1 CAGTCACAGATCCTCGCGAATTGGCCCA ATGGCCSANG (SEQ ID NO: 30) 0682 ExtMVH-2 CAGTCACAGATCCTCGCGAATTGGCCCA
ATGGCCSANC (SEQ ID NO: 31) 0683 MJH-Rev1 GGGGGTGTCGTTTTGGCTGAGGAGAC
GTGG (SEQ ID NO: 32) 0684 MJH-Rev2 GGGGGTGTCGTTTTGGCTGAGGAGAC
GTGG (SEQ ID NO: 33) 0685 MJH-Rev3 GGGGGTGTCGTTTTGGCTGCAGAGAC
AGAG (SEQ ID NO: 34) 0686 MJH-Rev4 GGGGGTGTCGTTTTGGCTGAGGAGAC
GAGG (SEQ ID NO: 35) 0687 ExtMJH-Rev1& GGGGGTGTCGTTTTGGCTGAGGAGAC
GTGG (SEQ ID NO: 36) 0688 ExtMJH-Rev2in GGGGGTGTCGTTTTGGCTGAGGAGAC
GTGG (SEQ ID NO: 37) 0690 ExtMJH-Rev3 GGGGGTGTCGTTTTGGCTGAGGAGAC
AGAG (SEQ ID NO: 38) 0691 ExtMJH-Rev4 GGGGGTGTCGTTTTGGCTGAGGAGAC
GAGG (SEQ ID NO: 39)
(173) TABLE-US-00003 TABLE 2 Phage ELISA signal levels as measured at 450 nm. TT-coated plates represent plates that were coated with tetanus toxoid. Thyroglobulin-coated plates are used as negative controls. 10/10 and 15/15 indicate the number of wash steps with PBS-Tween ® during panning procedures. The 10/10 tetanus toxoid and 10/10 thyroglobulin plates and the 15/15 tetanus toxoid and 15/15 thyroglobulin plates are duplicates from each other except for the coating agent. OD values higher than three times the background are assumed specific. 1 2 3 4 5 6 7 8 9 10 11 12 TT-coated plate 10/10 washings A 0.139 0.093 0.089 0.121 0.117 0.598 0.146 0.115 0.18 0.155 0.543 0.601 B 0.136 0.404 0.159 0.187 0.489 0.134 0.216 0.092 0.222 0.108 0.181 0.484 C 0.197 0.526 0.09 0.213 0.395 0.155 0.108 0.12 0.183 0.136 0.092 0.866 D 0.143 0.258 0.101 0.422 0.088 0.243 0.485 0.251 0.304 0.198 0.478 0.091 E 0.445 0.169 0.526 0.481 0.206 0.285 0.111 0.119 0.128 0.2 0.118 0.098 F 0.237 0.291 0.594 0.139 0.206 0.565 0.543 0.091 0.136 0.227 0.228 0.099 G 0.459 0.102 0.152 0.659 0.203 0.452 0.152 0.133 0.094 0.102 0.375 0.098 H 0.341 0.623 0.745 0.415 0.682 0.527 0.655 0.114 0.258 0.284 0.685 0.113 TT-coated plate 15/15 washings A 0.247 0.582 0.421 0.428 0.133 0.082 0.262 0.079 0.343 0.414 0.095 0.292 B 0.065 0.364 0.073 0.042 0.049 0.071 0.046 0.103 0.078 0.057 0.048 0.155 C 0.081 0.044 0.066 0.082 0.225 0.444 0.203 0.362 0.122 0.047 0.052 0.309 D 0.092 0.11 0.59 0.22 0.33 0.544 0.058 0.159 0.047 0.174 0.086 0.05 E 0.469 0.577 0.206 0.304 0.13 0.749 0.431 0.062 0.167 0.049 0.056 0.049 F 0.846 0.07 0.561 0.656 0.882 0.094 0.383 0.13 0.152 0.098 0.134 0.048 G 0.537 0.052 0.49 0.105 0.337 0.193 0.514 0.294 0.068 0.35 0.525 0.05 H 0.061 0.306 0.157 0.853 0.054 0.534 0.102 0.235 0.441 0.412 0.565 0.061 Thyroglobulin-coated plate 10/10 washings A 0.047 0.051 0.045 0.043 0.051 0.044 0.046 0.042 0.047 0.048 0.049 0.05 B 0.042 0.042 0.042 0.042 0.043 0.041 0.041 0.042 0.043 0.045 0.042 0.046 C 0.044 0.043 0.043 0.044 0.043 0.044 0.043 0.042 0.043 0.041 0.044 0.046 D 0.045 0.044 0.044 0.044 0.045 0.046 0.045 0.056 0.045 0.049 0.048 0.73 E 0.046 0.045 0.046 0.044 0.045 0.044 0.044 0.044 0.047 0.046 0.047 0.926 F 0.048 0.045 0.044 0.046 0.044 0.043 0.044 0.046 0.046 0.046 0.046 0.792 G 0.051 0.048 0.045 0.045 0.044 0.043 0.048 0.045 0.048 0.051 0.045 0.053 H 0.064 0.05 0.049 0.047 0.05 0.051 0.047 0.046 0.047 0.047 0.047 0.056 Thyroglobulin-coated plate 15/15 washings A 0.036 0.049 0.045 0.044 0.046 0.047 0.046 0.042 0.042 0.043 0.042 0.041 B 0.045 0.042 0.041 0.043 0.043 0.043 0.045 0.045 0.047 0.048 0.044 0.045 C 0.049 0.047 0.047 0.046 0.046 0.046 0.045 0.047 0.046 0.045 0.045 0.052 D 0.047 0.049 0.048 0.048 0.048 0.048 0.047 0.052 0.048 0.046 0.048 0.456 E 0.049 0.047 0.047 0.047 0.047 0.049 0.047 0.048 0.047 0.046 0.048 0.412 F 0.05 0.047 0.046 0.046 0.046 0.046 0.046 0.046 0.046 0.047 0.048 0.528 G 0.05 0.048 0.045 0.045 0.046 0.049 0.048 0.046 0.053 0.049 0.05 0.057 H 0.057 0.05 0.046 0.045 0.047 0.049 0.047 0.047 0.046 0.047 0.053 0.048
(174) TABLE-US-00004 TABLE 3 Protein sequence analysis of ELISA positive tetanus toxoid binders. CDR3 sequence, CDR3 length, VH family members and specific name, JH origin and DH origin of the clones is indicated. CDR3 / SEQ ID NO: CDR3 length VH DH JH V Gene family HGAYYTYDEKAWFAY (SEQ ID NO: 40) 15 musIGHV192 DSP2.11 JH3 mouse VH7183 HGAYYTYDEKAWFAY (SEQ ID NO: 40) 15 musIGHV192 DSP2.11 JH3 mouse VH7183 HGAYYTYDEKAWFAY (SEQ ID NO: 40) 15 musIGHV192 DSP2.11 JH3 mouse VH7183 HGAYYTYDEKAWFAY (SEQ ID NO: 40) 15 musIGHV192 DSP2.11 JH3 mouse VH7183 HGAYYTYDEKAWFAY (SEQ ID NO: 40) 15 musIGHV192 DSP2.11 JH3 mouse VH7183 HGAYYTYDEKAWFAY (SEQ ID NO: 40) 15 musIGHV192 DSP2.11 JH3 mouse VH7183 HGAYYTYDEKAWFAY (SEQ ID NO: 40) 15 musIGHV192 DSP2.11 JH3 mouse VH7183 HGAYYTYDEKAWFAY (SEQ ID NO: 40) 15 musIGHV192 DSP2.11 JH3 mouse VH7183 HGAYYTYDEKAWFAY (SEQ ID NO: 40) 15 musIGHV192 DSP2.11 JH3 mouse VH7183 HGAFYTYDEKPWFAY (SEQ ID NO: 41) 15 musIGHV192 IGHD2-14*01 JH3 mouse VH7183 HISYYRYDEEVSFAY (SEQ ID NO: 42) 15 musIGHV192 IGHD2-14*01 JH3 mouse VH7183 HISYYRYDEEVSFAY (SEQ ID NO: 42) 15 musIGHV192 IGHD2-14*01 JH3 mouse VH7183 GWRAFAY (SEQ ID NO: 43) 7 musIGHV131 DSP2.9 JH3 mouse VH7183 GWRAFAY (SEQ ID NO: 43) 7 musIGHV131 DSP2.9 JH3 mouse VH7183 GWRAFAY (SEQ ID NO: 43) 7 musIGHV131 DSP2.9 JH3 mouse VH7183 DRGNYYGMDY (SEQ ID NO: 44) 10 musIGHV178 DSP2.1 JH4 mouse VH7183 LGDYYVDWFFAV (SEQ ID NO: 45) 12 musIGHV165 DFL16.1 JH1 mouse VH7183 NFPAWFAF (SEQ ID NO: 46) 8 musIGHV547 DST4.3inv JH3 mouse VJH558 NFPAWFAY (SEQ ID NO: 46) 8 musIGHV547 DSP2.1 JH3 mouse VJH558 NFPAWFVY (SEQ ID NO: 46) 8 musIGHV547 DSP2.1 JH3 mouse VJH558 SFTPVPFYYGYDWYFDV (SEQ ID NO: 47) 17 musIGHV532 DSP2.3 JH1 mouse VJH558 SFTPVPFYYGYDWYFDV (SEQ ID NO: 47) 17 musIGHV532 DSP2.3 JH1 mouse VJH558 SDYDWYFDV (SEQ ID NO: 48) 9 musIGHV286 DSP2.2 JH1 mouse VJH558 SDYDWYFDV (SEQ ID NO: 48) 9 musIGHV286 DSP2.2 JH1 mouse VJH558 DSKWAYYFDY (SEQ ID NO: 49) 10 musIGHV532 DST4.3 JH2 mouse VJH558 GDYTGYGMDY (SEQ ID NO: 50) 10 musIGHV125 DSP2.13 JH4 mouse VHSM7 GDYTGYGMDY (SEQ ID NO: 50) 10 musIGHV125 DSP2.13 JH4 mouse VHSM7 GGYDGYWFPY (SEQ ID NO: 51) 10 musIGHV125 DSP2.9 JH3 mouse VHSM7
(175) TABLE-US-00005 TABLE 4 Vector combinations that were transfected to HEK293T. Combined Conc. Code HC vector LC vector vector Prep name (μg/ml) A x 0817676_pSELECT_0815426 x PIGKV1-39/ — (IGKV1-39) P1 B x 0817678_pSELECT_0815427 x PIGLV2-14/ — (IGLV2-14) P1 C MV1110 0817676_pSELECT_0815426 x PMV1110/ 11.0 (IGKV1-39) IGKV1-39/P1 D MV1110 0817678_pSELECT_0815427 x PMV1110/ 15.4 (IGLV2-14) IGLV2-14/P1 E x x MG1494 MG1494/P2 16.1
(176) TABLE-US-00006 TABLE 5 HLA allotypes considered in T.sub.H-epitope profiling. The corresponding serotypes are shown, as well as allotype frequencies in the Caucasian population (Klitz et al. (2003), Tissue Antigens 62: 296-307; Gjertson and Terasake (eds) in: HLA 1997; Gjertson and Terasake (eds) in: HLA 1998; Castelli et al. (2002), J. Immunol. 169: 6928-6934). Frequencies can add up to more than 100% since each individual has two alleles for each gene. If all allele frequencies of a single gene were known, they would add up to slightly less than 200% due to homozygous individuals. HLA type Serotype Population % HLA type Serotype Population % DRB1*0101 DR1 17.4 DRB4*0103 DR53 21 DRB1*0102 DR1 4.9 DR35*0101 DR51 15.8 DRB1*0301 DR17(3) 21.2 DRB5*0202 DR51 5.7 DRB1*0401 DR4 11.5 DQA1*0101/DQB1*0501 DQ5(1) 20.5 DRB1*0402 DR4 3.1 DQA1*0102/DQB1*0502 DQ5(1) 2.6 DRB1*0404 DR4 5.5 DQA1*0102/DQB1*0602 DQ6(1) 26.5 DRB1*0405 DR4 2.2 DQA1*0102/DQB1*0604 DQ6(1) 6.7 DRB1*0407 DR4 <2 DQA1*0103/DQB1*0603 DQ6(1) 11 DRB1*0701 DR7 23.4 DQA1*0104/DQB1*0503 DQ5(1) 4 DRB1*0801 DR8 3.3 DQA1*0201/DQB1*0202 DQ2 20.9 DRB1*0802 DR8 <2 DQA1*0201/DQB1*0303 DQ9(3) 7.2 DRB1*0901 DR9 <2 DQA1*0301/DQB1*0301 DQ7(3) 12.5 DRB1*1101 DR11(5) 17 DQA1*0301/DQB1*0302 DQ8(3) 18.3 DRB1*1104 DR11(5) 5.7 DQA1*0401/DQB1*0402 DQ4 4.5 DRB1*1201 DR12(5) 3.1 DQA1*0501/DQB1*0201 DQ2 24.6 DRB1*1301 DR13(6) 15.4 DQA1*0501/DQB1*0301 DQ7(3) 20.9 DRB1*1302 DR13(6) 10.8 DPA1*0103/DPB1*0201 DPw2 19.9 DRB1*1401 DR14(6) 4.2 DPA1*0103/DPB1*0401 DPw4 65.1 DRB1*1501 DR15(2) 13.2 DPA1*0103/DPB1*0402 DPw4 24.3 DRB1*1601 DR16(2) 5.5 DPA1*0201/DPB1*0101 DPw1 6.3 DRB3*0101 DR52 24.6 DPA1*0201/DPB1*0301 DPw3 <2 DRB3*0202 DR52 43 DPA1*0201/DPB1*0501 DPw5 <2 DRB3*0301 DR52 10 DPA1*0201/DPB1*0901 — 2.4 DPB4*0101 DR53 25.5
(177) TABLE-US-00007 TABLE 6 T.sub.H epitope counts for IGKV1-39. Peptides binding to multiple HLAs of the same group (DRB1, DRB3/4/5, DP, DQ) are counted as one. Values between brackets refer to germline-filtered peptides. DRB1 DRB3/4/5 DQ DP Strong Medium Strong Medium Strong Medium Strong Medium Merus IGKV1-39 0 (+6) 0 (+16) 0 (+0) 0 (+5) 0 (+3) 0 (+9) 0 (+0) 0 (+9)
(178) TABLE-US-00008 TABLE 7 Mapping of Epibase ® predictions for Merus IGKV1-39 in the classical 15-mer peptide format. This table shows the allotype count of critical epitopes (SEQ ID NOs: 52-83) and implicated serotypes for each of the 15-mers spanning the Merus IGKV1-39 sequence. Start Allotype 15 mer Position 15-mer sequence count Implicated serotypes 1 1 DIQMTQSPSSLSASV 6 DR1, DR4, DR7, DR9 2 4 MTQSPSSLSASVGDR 5 DR1, DR4, DR9 3 7 SPSSLSASVGDRVTI 0 4 10 SLSASVGDRVTITCR 0 5 13 ASVGDRVTITCRASQ 0 6 16 GDRVTITCRASQSIS 2 DR11(5), DR7 7 19 VTITCRASQSISSYL 4 DQ2, DR11(5), DR4, DR7 8 22 TCRASQSISSYLNWY 2 DQ2, DR4 9 25 ASQSISSYLNWYQQK 5 DR13(6), DR15(2), DR4 10 28 SISSYLNWYQQKPGK 8 DR12(5), DR13(6), DR15(2), DR16(2), DR4, DR8 11 31 SYLNWYQQKPGKAPK 10 DR1, DR12(5), DR16(2), DR4, DR51, DR8 12 34 NWYQQKPGKAPKLLI 9 DR1, DR15(2), DR4, DR51, DR8 13 37 QQKPGKAPKLLIYAA 7 DQ4, DR1, DR11(5), DR15(2), DR51, DR8 14 40 PGKAPKLLIYAASSL 7 DQ4, DR1, DR11(5), DR4, DR8 15 43 APKLLIYAASSLQSG 15 DR1, DR11(5), DR12(5), DR13(6), DR14(6), DR15(2), DR4, DR51, DR8, DR9 16 46 LLIYAASSLQSGVPS 15 DR1, DR11(5), DR12(5), DR13(6), DR14(6), DR15(2), DR4, DR51, DR8, DR9 17 49 YAASSLQSGVPSRFS 1 DR15(2) 18 52 SSLQSGVPSRFSGSG 1 DR15(2) 19 55 QSGVPSRFSGSGSGT 0 20 58 VPSRFSGSGSGTDFT 0 21 61 RFSGSGSGTDFTLTI 0 22 64 GSGSGTDFTLTISSL 1 DR52 23 67 SGTDFTLTISSLQPE 4 DR4, DR52, DR7, DR9 24 70 DFTLTISSLQPEDFA 4 DQ2, DR4, DR7, DR9 25 73 LTISSLQPEDFATYY 1 DQ2 26 76 SSLQPEDFATYYCQQ 0 27 79 QPEDFATYYCQQSYS 1 DR4 28 82 DFATYYCQQSYSTPP 5 DR4, DR51, DR7 29 85 TYYCQQSYSTPPTFG 4 DR4, DR51, DR7 30 88 CQQSYSTPPTFGQGT 0 31 91 SYSTPPTFGQGTKVE 0 32 94 TPPTFGQGTKVEIK 0
(179) TABLE-US-00009 TABLE 8 The V.sub.H gene from PG1433 paired with various light chain genes with differing rates of amino acid mutation were compared for production levels with the original clone containing the IGKV1-39 gene. Number of Light amino acid concentration IgG name chain gene mutations (μg/ml) PG1433 1-39 0 63, 45.5, 38.6 (avg = 49) PG1631 1-12 4 10.5 PG1632 1-27 7 9.3 PG1634 1D-12 10 10.8 PG1635 1D-33 6 10.2 PG1642 1-5 8 7.1 PG1644 1-9 3 7.8 PG1650 1D-39 3 9.1 PG1652 2D-28 3 7.1 PG1653 3-15 14 7 PG1654 3-20 2 5.2 PG1674 1-40 7 8.2 PG1678 2-11 2 8.1 PG1680 2-14 15 10.8 PG1682 3-1 13 9.9 PG1683 6-57 6 13.9
(180) TABLE-US-00010 TABLE 9 Numbers of lymphocytes harvested from the bone marrow and spleen of wild-type and transgenic mice *10e6/ml total vol total cells cells (ml) *10.sup.6 Bone Marrow Wt 18.82 5.05 95.0 Wt 19.24 4.96 95.4 CD19-Cre 23.42 5.08 119.0 CD19-Cre 20.58 4.82 99.2 CD19-Cre 25.77 5.15 132.7 CD19-Cre/HuVk1 17.71 5.06 89.6 CD19-Cre/HuVk1 12.60 5.33 67.2 CD19-Cre/HuVk1 18.13 5.27 95.5 Spleen Wt 41.70 5.36 223.5 Wt 37.85 4.71 178.3 CD19-Cre 60.19 3.77 226.9 CD19-Cre 35.06 3.66 128.3 CD19-Cre 80.69 4.60 371.2 CD19-Cre/HuVk1 51.67 4.48 231.5 CD19-Cre/HuVk1 58.80 6.24 366.9 CD19-Cre/HuVk1 24.37 6.25 152.3