HUMANIZED UNIVERSAL LIGHT CHAIN MICE
20220394959 · 2022-12-15
Inventors
- John McWhirter (Greenville, NC, US)
- Lynn Macdonald (Harrison, NY)
- Sean Stevens (Del Mar, CA)
- Andrew J. Murphy (Croton-on-Hudson, NY)
- Margaret Karow (Santa Rosa Valley, NY)
Cpc classification
A01K2267/01
HUMAN NECESSITIES
A01K2217/15
HUMAN NECESSITIES
C07K2319/30
CHEMISTRY; METALLURGY
C07K16/00
CHEMISTRY; METALLURGY
C07K2317/24
CHEMISTRY; METALLURGY
C07K2317/76
CHEMISTRY; METALLURGY
C12N15/8509
CHEMISTRY; METALLURGY
C12N2800/30
CHEMISTRY; METALLURGY
C07K2317/92
CHEMISTRY; METALLURGY
A01K2217/072
HUMAN NECESSITIES
International classification
C07K16/00
CHEMISTRY; METALLURGY
Abstract
Mice, tissues, cells, and genetic material are provided that comprise a humanized heavy chain immunoglobulin locus, a humanized light chain locus that expresses a universal light chain, and a gene encoding an ADAM6 or ortholog or homolog or functional fragment thereof. Mice are provided that express humanized heavy chains comprising human variable domains, and that express humanized light chains comprising human variable domains wherein the light chains are derived from no more than one, or no more than two, light chain V and J or rearranged V/J sequences. Fertile male mice that express antibodies with universal light chains and humanized heavy chains are provided. Methods and compositions for making bispecific binding proteins are provided.
Claims
1.-20. (canceled)
21. A method for generating a human immunoglobulin heavy chain variable region sequence of an antibody that specifically binds to an antigen of interest comprising the steps of: (a) immunizing a genetically modified mouse with an antigen of interest, wherein the mouse: (i) has a germline genome that comprises: (A) an insertion comprising at least one unrearranged human V.sub.H gene segment, at least one unrearranged human D.sub.H gene segment, and at least one unrearranged human J.sub.H gene segment, wherein the at least one unrearranged human V.sub.H gene segment, at least one unrearranged human D.sub.H gene segment, and at least one unrearranged human J.sub.H gene segment are operably linked to a heavy chain constant region gene, wherein the insertion disrupts the function of an endogenous ADAM6 protein, and wherein the disruption of the endogenous ADAM6 function is associated with a reduction in fertility in male mice; (B) an insertion comprising a single rearranged light chain V/J sequence, wherein single rearranged light chain V/J sequences is operably linked to a light chain constant region gene, wherein the single rearranged light chain V/J sequence comprises a human Vκ1-39; and, (C) an insertion comprising an ectopic nucleic acid sequence that encodes a functional mouse ADAM6 protein, which nucleic acid sequence is integrated in the germline genome of the mouse, wherein, when the mouse is a male, the functional mouse ADAM6 protein is expressed and the male mouse has wild type fertility; (ii) generates antibodies when immunized with the antigen of interest, wherein the antibodies each comprise a human heavy chain variable domain operably linked to heavy chain constant domain and a light chain variable domain operably linked to a light chain constant domain, wherein the light chain variable domain is expressed from the rearranged light chain V/J sequence in the germline genome of the mouse or from a somatically hypermutated variant thereof; and (b) determining a human heavy chain variable region sequence that encodes a human heavy chain variable domain of an antibody that specifically binds the antigen of interest and that was generated by the genetically modified mouse.
22. The method of claim 21, wherein the at least one unrearranged human V.sub.H gene segment is selected from the group consisting of V.sub.H1-2, V.sub.H1-8, V.sub.H1-24, V.sub.H1-69, V.sub.H2-5, V.sub.H3-7, V.sub.H3-9, V.sub.H3-11, V.sub.H3-13, V.sub.H3-15, V.sub.H3-20, V.sub.H3-23, V.sub.H3-30, V.sub.H3-33, V.sub.H3-43, V.sub.H3- 48, V.sub.H4-31, V.sub.H4-39, V.sub.H4-59, V.sub.H5-51, V.sub.H6-1, and a combination thereof.
23. The method of claim 21, wherein single rearranged light chain V/J sequence is operably linked to an endogenous mouse light chain constant region gene at an endogenous mouse light chain locus.
24. The method of claim 21, wherein the single rearranged light chain V/J sequence is a rearranged Vκ1-39/Jκ sequence.
25. The method of claim 21, wherein the functional mouse ADAM6 protein is a mouse ADAM6a protein, a mouse ADAM6b protein, or both.
26. The method of claim 21, wherein the nucleic acid sequence that encodes a functional mouse ADAM6 protein is juxtaposed or is contiguous with the at least one unrearranged human V.sub.H gene segment, at least one unrearranged human D.sub.H gene segment, and/or at least one unrearranged human J.sub.H gene segment.
27. The method of claim 21, wherein the genetically modified mouse lacks: (a) an endogenous mouse λ light chain variable region locus that is capable of rearranging and forming a gene that encodes a mouse λ light chain variable region, and/or (b) an endogenous mouse κ light chain variable region locus that is capable of rearranging and forming a gene that encodes a mouse κ light chain variable region.
28. A method for generating a human immunoglobulin heavy chain variable domain sequence of an antibody that specifically binds to an antigen of interest comprising the steps of: (a) immunizing a genetically modified mouse with an antigen of interest, wherein the mouse: (i) has a germline genome that comprises: (A) an insertion comprising at least one unrearranged human V.sub.H gene segment, at least one unrearranged human D.sub.H gene segment, and at least one unrearranged human J.sub.H gene segment, wherein the at least one unrearranged human V.sub.H gene segment, at least one unrearranged human D.sub.H gene segment, and at least one unrearranged human J.sub.H gene segment are operably linked to a heavy chain constant region gene, wherein the insertion disrupts the function of an endogenous ADAM6 protein, and wherein the disruption of the endogenous ADAM6 function is associated with a reduction in fertility in male mice; (B) an insertion comprising a single rearranged light chain V/J sequences, wherein the single rearranged light chain V/J sequences is operably linked to a light chain constant region gene, wherein the single rearranged light chain V/J sequence comprises a human Vκ1-39; and, (C) an insertion comprising an ectopic nucleic acid sequence that encodes a functional mouse ADAM6 protein, which nucleic acid sequence is integrated in the germline genome of the mouse, wherein, when the mouse is a male, the functional mouse ADAM6 protein is expressed and the male mouse has wild type fertility; (ii) generates antibodies when immunized with the antigen of interest, wherein the antibodies each comprise a human heavy chain variable domain operably linked to heavy chain constant domain and a light chain variable domain operably linked to a light chain constant domain, wherein the light chain variable domain is expressed from the rearranged human light chain V/J sequence in the germline genome of the mouse or from a somatically hypermutated variant thereof; and (b) determining a human heavy chain variable domain sequence of an antibody that specifically binds the antigen of interest and that was generated by the genetically modified mouse.
29. The method of claim 28, wherein determining a human heavy variable domain sequence comprises determining a nucleotide sequence that encodes the human heavy chain variable domain sequence.
30. The method of claim 28, wherein the at least one unrearranged human V.sub.H gene segment is selected from the group consisting of V.sub.H1-2, V.sub.H1-8, V.sub.H1-24, V.sub.H1-69, V.sub.H2-5, V.sub.H3-7, V.sub.H3-9, V.sub.H3-11, V.sub.H3-13, V.sub.H3-15, V.sub.H3-20, V.sub.H3-23, V.sub.H3-30, V.sub.H3-33, V.sub.H3-43, V.sub.H3- 48, V.sub.H4-31, V.sub.H4-39, V.sub.H4-59, V.sub.H5-5, V.sub.H6-1, and a combination thereof.
31. The method of claim 28, wherein the single rearranged human light chain V/J sequence is operably linked to an endogenous mouse light chain constant region gene at an endogenous mouse light chain locus.
32. The method of claim 28, wherein the single rearranged light chain V/J sequence is a rearranged human Vκ1-39/Jκ sequence.
33. The method of claim 28, wherein the functional mouse ADAM6 protein is a mouse ADAM6a protein, a mouse ADAM6b protein, or both.
34. The method of claim 28, wherein the nucleic acid sequence that encodes a functional mouse ADAM6 protein is juxtaposed or is contiguous with the at least one unrearranged human V.sub.H gene segment, at least one unrearranged human D.sub.H gene segment, and/or at least one unrearranged human J.sub.H gene segment.
35. The method of claim 28, wherein the genetically modified mouse lacks: (a) an endogenous mouse λ light chain variable region locus that is capable of rearranging and forming a gene that encodes a mouse λ light chain variable region, and/or (b) an endogenous mouse κ light chain variable region locus that is capable of rearranging and forming a gene that encodes a mouse κ light chain variable region.
36. A method of making an antibody comprising: (a) immunizing a genetically modified mouse with an antigen of interest, wherein the mouse: (i) has a germline genome that comprises: (A) an insertion comprising at least one unrearranged human V.sub.H gene segment, at least one unrearranged human D.sub.H gene segment, and at least one unrearranged human J.sub.H gene segment, wherein the at least one unrearranged human V.sub.H gene segment, at least one unrearranged human D.sub.H gene segment, and at least one unrearranged human J.sub.H gene segment are operably linked to a heavy chain constant region gene, wherein the insertion disrupts the function of an endogenous ADAM6 protein, and wherein the disruption of the endogenous ADAM6 function is associated with a reduction in fertility in male mice; (B) an insertion comprising a single rearranged light chain V/J sequence, wherein the single rearranged human light chain V/J sequence is operably linked to a light chain constant region gene wherein the single rearranged light chain V/J sequence comprises a human Vκ1-39; and, (C) an insertion comprising an ectopic nucleic acid sequence that encodes a functional mouse ADAM6 protein, which nucleic acid sequence is integrated in the germline genome of the mouse, wherein, when the mouse is a male, the functional mouse ADAM6 protein is expressed and the male mouse has wild type fertility; (ii) generates antibodies when immunized with the antigen of interest, wherein the antibodies each comprise a human heavy chain variable domain operably linked to heavy chain constant domain and a light chain variable domain operably linked to a light chain constant domain, wherein the light chain variable domain is expressed from the rearranged light chain V/J sequence in the germline genome of the mouse or from a somatically hypermutated variant thereof; and (b) determining an amino acid sequence of a human variable domain of the antibody that specifically binds the antigen of interest or determining a nucleotide sequence that encodes a human variable domain of the antibody that specifically binds the antigen of interest; and (c) employing the amino acid sequence or the nucleotide sequence to produce the antibody.
37. The method of claim 36, wherein the at least one unrearranged human V.sub.H gene segment V.sub.H gene segment is selected from the group consisting of V.sub.H1-2, V.sub.H1-8, V.sub.H1-24, V.sub.H1-69, V.sub.H2-5, V.sub.H3-7, V.sub.H3-9, V.sub.H3-11, V.sub.H3-13, V.sub.H3-15, V.sub.H3-20, V.sub.H3-23, V.sub.H3-30, V.sub.H3-33, V.sub.H3-43, V.sub.H3-48, V.sub.H4-31, V.sub.H4-39, V.sub.H4-59, V.sub.H5-51, V.sub.H6-1, or a combination thereof.
38. The method of claim 36, wherein the no single rearranged human light chain V/J sequence is operably linked to an endogenous mouse light chain constant region gene at an endogenous mouse light chain locus.
39. The method of claim 36, wherein the single rearranged human light chain V/J sequence is a rearranged human Vκ1-39/Jκ sequence.
40. The method of claim 36, wherein the functional mouse ADAM6 protein is a mouse ADAM6a protein, a mouse ADAM6b protein, or both.
41. The method of claim 36, wherein the nucleic acid sequence that encodes a functional mouse ADAM6 protein is juxtaposed or is contiguous with the at least one unrearranged human V.sub.H gene segment, at least one unrearranged human D.sub.H gene segment, and/or at least one unrearranged human J.sub.H gene segment.
42. The method of claim 36, wherein the genetically modified mouse lacks: (a) an endogenous mouse λ light chain variable region locus that is capable of rearranging and forming a gene that encodes a mouse λ light chain variable region, and/or (b) an endogenous mouse κ light chain variable region locus that is capable of rearranging and forming a gene that encodes a mouse κ light chain variable region.
43. A method for generating a fully human antibody specific against an antigen comprising the steps of: (a) expressing in a mammalian cell: (i) a first nucleic acid sequence that encodes an immunoglobulin heavy chain, the first nucleic acid sequence comprising a human immunoglobulin heavy chain variable region sequence operably linked to a human immunoglobulin heavy chain constant region sequence, wherein the human immunoglobulin heavy chain variable region sequence was derived from a human immunoglobulin heavy chain variable region sequence in B cell of a genetically modified mouse, which genetically modified mouse comprises: (A) an insertion comprising at least one unrearranged human V.sub.H gene segment, at least one unrearranged human D.sub.H gene segment, and at least one unrearranged human J.sub.H gene segment, wherein the at least one unrearranged human V.sub.H gene segment, at least one unrearranged human D.sub.H gene segment, and at least one unrearranged human J.sub.H gene segment are operably linked to a heavy chain constant region gene, wherein the insertion disrupts the function of an endogenous ADAM6 protein, and wherein the disruption of the endogenous ADAM6 function is associated with a reduction in fertility in male mice; (B) an insertion comprising a single rearranged human light chain V/J sequence, wherein the single rearranged human light chain V/J sequence is operably linked to a light chain constant region gene, wherein the single rearranged light chain V/J sequence comprises a human Vκ1-39; and, (C) an insertion comprising an ectopic nucleic acid sequence that encodes a functional mouse ADAM6 protein, which nucleic sequence is integrated in the germline genome of the mouse, wherein, when the mouse is a male, the functional mouse ADAM6 protein is expressed and the male mouse has wild type fertility; and (ii) a second nucleic acid sequence that encodes an immunoglobulin light chain, the second nucleic acid sequence comprising a light chain variable region sequence, which is derived from same single rearranged light chain V/J sequence of (B), operably linked to a human immunoglobulin light chain constant region sequence; (b) culturing the mammalian cell so that the fully human antibody is produced; and (c) obtaining said fully human antibody.
44. The method of claim 43, wherein the at least one human V.sub.H gene segment is selected from the group consisting of V.sub.H1-2, V.sub.H1-8, V.sub.H1-24, V.sub.H1-69, V.sub.H2-5, V.sub.H3-7, V.sub.H3-9, V.sub.H3-11, V.sub.H3-13, V.sub.H3-15, V.sub.H3-20, V.sub.H3-23, V.sub.H3-30, V.sub.H3-33, V.sub.H3-43, V.sub.H3-48, V.sub.H4-31, V.sub.H4-39, V.sub.H4-59, V.sub.H5-51, V.sub.H6-1 and a combination thereof.
45. The method of claim 43, wherein the single rearranged human light chain V/J sequence is operably linked to an endogenous mouse light chain constant region gene at an endogenous mouse light chain locus.
46. The method of claim 43, wherein the single rearranged human light chain V/J sequence is a rearranged human Vκ1-39/Jκ sequence.
47. The method of claim 43, wherein the functional mouse ADAM6 protein is a mouse ADAM6a protein, a mouse ADAM6b protein, or both.
48. The method of claim 43, wherein the nucleic acid sequence that encodes a functional mouse ADAM6 protein is juxtaposed or is contiguous with the at least one unrearranged human V.sub.H gene segment, at least one unrearranged human D.sub.H gene segment, and/or at least one unrearranged human J.sub.H gene segment.
49. The method of claim 43, wherein the genetically modified mouse lacks: (a) an endogenous mouse λ light chain variable region locus that is capable of rearranging and forming a gene that encodes a mouse λ light chain variable region, and/or (b) an endogenous mouse κ light chain variable region locus that is capable of rearranging and forming a gene that encodes a mouse κ light chain variable region.
Description
BRIEF DESCRIPTION OF THE FIGURES
[0091]
[0092]
[0093]
[0094]
[0095]
[0096]
[0097]
[0098]
[0099]
[0100]
[0101]
[0102]
[0103]
[0104]
[0105]
[0106]
[0107]
[0108]
[0109]
[0110]
[0111]
[0112]
[0113]
[0114]
[0115]
[0116]
[0117]
[0118]
[0119]
[0120]
[0121]
[0122]
[0123]
[0124]
[0125]
[0126]
[0127]
[0128]
[0129]
[0130]
[0131]
[0132]
[0133]
[0134]
[0135]
[0136]
DETAILED DESCRIPTION
[0137] The term “antibody”, as used herein, includes immunoglobulin molecules comprising four polypeptide chains, two heavy (H) chains and two light (L) chains inter-connected by disulfide bonds. Each heavy chain comprises a heavy chain variable (V.sub.H) region and a heavy chain constant region (C.sub.H). The heavy chain constant region comprises three domains, C.sub.H1, C.sub.H2 and C.sub.H3. Each light chain comprises a light chain variable (V.sub.L) region and a light chain constant region (C.sub.L). The V.sub.H and V.sub.L regions can be further subdivided into regions of hypervariability, termed complementarity determining regions (CDR), interspersed with regions that are more conserved, termed framework regions (FR). Each V.sub.H and V.sub.L comprises three CDRs and four FRs, arranged from amino-terminus to carboxy-terminus in the following order: FR1, CDR1, FR2, CDR2, FR3, CDR3, FR4 (heavy chain CDRs may be abbreviated as HCDR1, HCDR2 and HCDR3; light chain CDRs may be abbreviated as LCDR1, LCDR2 and LCDR3. The term “high affinity” antibody refers to an antibody that has a K.sub.D with respect to its target epitope about of 10.sup.−9 M or lower (e.g., about 1×10.sup.−9 M, 1×10.sup.−10 M, 1×10.sup.−11 M, or about 1×10.sup.−12 M). In one embodiment, K.sub.D is measured by surface plasmon resonance, e.g., BIACORE™; in another embodiment, K.sub.D is measured by ELISA.
[0138] The phrase “bispecific antibody” includes an antibody capable of selectively binding two or more epitopes. Bispecific antibodies generally comprise two nonidentical heavy chains, with each heavy chain specifically binding a different epitope—either on two different molecules (e.g., different epitopes on two different immunogens) or on the same molecule (e.g., different epitopes on the same immunogen). If a bispecific antibody is capable of selectively binding two different epitopes (a first epitope and a second epitope), the affinity of the first heavy chain for the first epitope will generally be at least one to two or three or four or more orders of magnitude lower than the affinity of the first heavy chain for the second epitope, and vice versa. Epitopes specifically bound by the bispecific antibody can be on the same or a different target (e.g., on the same or a different protein). Bispecific antibodies can be made, for example, by combining heavy chains that recognize different epitopes of the same immunogen. For example, nucleic acid sequences encoding heavy chain variable sequences that recognize different epitopes of the same immunogen can be fused to nucleic acid sequences encoding the same or different heavy chain constant regions, and such sequences can be expressed in a cell that expresses an immunoglobulin light chain. A typical bispecific antibody has two heavy chains each having three heavy chain CDRs, followed by (N-terminal to C-terminal) a C.sub.H1 domain, a hinge, a C.sub.H2 domain, and a C.sub.H3 domain, and an immunoglobulin light chain that either does not confer epitope-binding specificity but that can associate with each heavy chain, or that can associate with each heavy chain and that can bind one or more of the epitopes bound by the heavy chain epitope-binding regions, or that can associate with each heavy chain and enable binding or one or both of the heavy chains to one or both epitopes.
[0139] The term “cell” includes any cell that is suitable for expressing a recombinant nucleic acid sequence. Cells include those of prokaryotes and eukaryotes (single-cell or multiple-cell), bacterial cells (e.g., strains of E. coli, Bacillus spp., Streptomyces spp., etc.), mycobacteria cells, fungal cells, yeast cells (e.g., S. cerevisiae, S. pombe, P. pastoris, P. methanolica, etc.), plant cells, insect cells (e.g., SF-9, SF-21, baculovirus-infected insect cells, Trichoplusia ni, etc.), non-human animal cells, human cells, or cell fusions such as, for example, hybridomas or quadromas. In some embodiments, the cell is a human, monkey, ape, hamster, rat, or mouse cell. In some embodiments, the cell is eukaryotic and is selected from the following cells: CHO (e.g., CHO K1, DXB-11 CHO, Veggie-CHO), COS (e.g., COS-7), retinal cell, Vero, CV1, kidney (e.g., HEK293, 293 EBNA, MSR 293, MDCK, HaK, BHK), HeLa, HepG2, WI38, MRC 5, Colo205, HB 8065, HL-60, (e.g., BHK21), Jurkat, Daudi, A431 (epidermal), CV-1, U937, 3T3, L cell, C127 cell, SP2/0, NS-0, MMT 060562, Sertoli cell, BRL 3A cell, HT1080 cell, myeloma cell, tumor cell, and a cell line derived from an aforementioned cell. In some embodiments, the cell comprises one or more viral genes, e.g., a retinal cell that expresses a viral gene (e.g., a PER.C6™ cell).
[0140] The phrase “complementarity determining region,” or the term “CDR,” includes an amino acid sequence encoded by a nucleic acid sequence of an organism's immunoglobulin genes that normally (i.e., in a wild type animal) appears between two framework regions in a variable region of a light or a heavy chain of an immunoglobulin molecule (e.g., an antibody or a T cell receptor). A CDR can be encoded by, for example, a germline sequence or a rearranged or unrearranged sequence, and, for example, by a naive or a mature B cell or a T cell. A CDR can be somatically mutated (e.g., vary from a sequence encoded in an animal's germline), humanized, and/or modified with amino acid substitutions, additions, or deletions. In some circumstances (e.g., for a CDR3), CDRs can be encoded by two or more sequences (e.g., germline sequences) that are not contiguous (e.g., in an unrearranged nucleic acid sequence) but are contiguous in a B cell nucleic acid sequence, e.g., as the result of splicing or connecting the sequences (e.g., V-D-J recombination to form a heavy chain CDR3).
[0141] The term “conservative,” when used to describe a conservative amino acid substitution, includes substitution of an amino acid residue by another amino acid residue having a side chain R group with similar chemical properties (e.g., charge or hydrophobicity). In general, a conservative amino acid substitution will not substantially change the functional properties of interest of a protein, for example, the ability of a variable region to specifically bind a target epitope with a desired affinity. Examples of groups of amino acids that have side chains with similar chemical properties include aliphatic side chains such as glycine, alanine, valine, leucine, and isoleucine; aliphatic-hydroxyl side chains such as serine and threonine; amide-containing side chains such as asparagine and glutamine; aromatic side chains such as phenylalanine, tyrosine, and tryptophan; basic side chains such as lysine, arginine, and histidine; acidic side chains such as aspartic acid and glutamic acid; and, sulfur-containing side chains such as cysteine and methionine. Conservative amino acids substitution groups include, for example, valine/leucine/isoleucine, phenylalanine/tyrosine, lysine/arginine, alanine/valine, glutamate/aspartate, and asparagine/glutamine. In some embodiments, a conservative amino acid substitution can be substitution of any native residue in a protein with alanine, as used in, for example, alanine scanning mutagenesis. In some embodiments, a conservative substitution is made that has a positive value in the PAM250 log-likelihood matrix disclosed in Gonnet et al. (1992) Exhaustive Matching of the Entire Protein Sequence Database, Science 256:1443-45, hereby incorporated by reference. In some embodiments, the substitution is a moderately conservative substitution wherein the substitution has a nonnegative value in the PAM250 log-likelihood matrix.
[0142] In some embodiments, residue positions in an immunoglobulin light chain or heavy chain differ by one or more conservative amino acid substitutions. In some embodiments, residue positions in an immunoglobulin light chain or functional fragment thereof (e.g., a fragment that allows expression and secretion from, e.g., a B cell) are not identical to a light chain whose amino acid sequence is listed herein, but differs by one or more conservative amino acid substitutions.
[0143] The phrase “epitope-binding protein” includes a protein having at least one CDR and that is capable of selectively recognizing an epitope, e.g., is capable of binding an epitope with a K.sub.D that is at about one micromolar or lower (e.g., a K.sub.D that is about 1×10.sup.−6 M, 1×10.sup.−7 M, 1×10.sup.−9M, 1×10.sup.−9 M, 1×10.sup.−1° M, 1×10.sup.11M, or about 1×10.sup.−12 M). Therapeutic epitope-binding proteins (e.g., therapeutic antibodies) frequently require a K.sub.D that is in the nanomolar or the picomolar range.
[0144] The phrase “functional fragment” includes fragments of epitope-binding proteins that can be expressed, secreted, and specifically bind to an epitope with a K.sub.D in the micromolar, nanomolar, or picomolar range. Specific recognition includes having a K.sub.D that is at least in the micromolar range, the nanomolar range, or the picomolar range.
[0145] The term “germline” includes reference to an immunoglobulin nucleic acid sequence in a non-somatically mutated cell, e.g., a non-somatically mutated B cell or pre-B cell or hematopoietic cell.
[0146] The phrase “heavy chain,” or “immunoglobulin heavy chain” includes an immunoglobulin heavy chain constant region sequence from any organism. Heavy chain variable domains include three heavy chain CDRs and four FR regions, unless otherwise specified. Fragments of heavy chains include CDRs, CDRs and FRs, and combinations thereof. A typical heavy chain has, following the variable domain (from N-terminal to C-terminal), a C.sub.H1 domain, a hinge, a C.sub.H2 domain, and a C.sub.H3 domain. A functional fragment of a heavy chain includes a fragment that is capable of specifically recognizing an epitope (e.g., recognizing the epitope with a K.sub.D in the micromolar, nanomolar, or picomolar range), that is capable of expressing and secreting from a cell, and that comprises at least one CDR.
[0147] The term “identity” when used in connection with sequence, includes identity as determined by a number of different algorithms known in the art that can be used to measure nucleotide and/or amino acid sequence identity. in some embodiments described herein, identities are determined using a ClustalW v. 1.83 (slow) alignment employing an open gap penalty of 10.0, an extend gap penalty of 0.1, and using a Gonnet similarity matrix (MacVector™ 10.0.2, MacVector Inc., 2008). The length of the sequences compared with respect to identity of sequences will depend upon the particular sequences, but in the case of a light chain constant domain, the length should contain sequence of sufficient length to fold into a light chain constant domain that is capable of self-association to form a canonical light chain constant domain, e.g., capable of forming two beta sheets comprising beta strands and capable of interacting with at least one C.sub.H1 domain of a human or a mouse. In the case of a C.sub.H1 domain, the length of sequence should contain sequence of sufficient length to fold into a C.sub.H1 domain that is capable of forming two beta sheets comprising beta strands and capable of interacting with at least one light chain constant domain of a mouse or a human.
[0148] The phrase “immunoglobulin molecule” includes two immunoglobulin heavy chains and two immunoglobulin light chains. The heavy chains may be identical or different, and the light chains may be identical or different.
[0149] The phrase “light chain” includes an immunoglobulin light chain sequence from any organism, and unless otherwise specified includes human κ and λ light chains and a VpreB, as well as surrogate light chains. Light chain variable (V.sub.L) domains typically include three light chain CDRs and four framework (FR) regions, unless otherwise specified. Generally, a full-length light chain includes, from amino terminus to carboxyl terminus, a V.sub.L domain that includes FR1-CDR1-FR2-CDR2-FR3-CDR3-FR4, and a light chain constant domain. Light chains include those, e.g., that do not selectively bind either a first or a second epitope selectively bound by the epitope-binding protein in which they appear. Light chains also include those that bind and recognize, or assist the heavy chain with binding and recognizing, one or more epitopes selectively bound by the epitope-binding protein in which they appear.
[0150] Universal light chains, or common light chains, refer to light chains made in mice as described herein, wherein the mice are highly restricted in the selection of gene segments available for making a light chain variable domain. As a result, such mice make a light chain derived from, in one embodiment, no more than one or two unrearranged light chain V segments and no more than one or two unrearranged light chain J segments (e.g., one V and one J, two V's and one J, one V and two J's, two V's and two J's). In one embodiment, no more than one or two rearranged light chain V/J sequences, e.g., a rearranged human Vκ1-39Jκ5 sequence or a rearranged human Vκ3-20Jκ1 sequence. In various embodiments universal light chains include somatically mutated (e.g., affinity matured) versions.
[0151] The phrase “somatically mutated” includes reference to a nucleic acid sequence from a B cell that has undergone class-switching, wherein the nucleic acid sequence of an immunoglobulin variable region (e.g., a heavy chain variable domain or including a heavy chain CDR or FR sequence) in the class-switched B cell is not identical to the nucleic acid sequence in the B cell prior to class-switching, such as, for example, a difference in a CDR or framework nucleic acid sequence between a B cell that has not undergone class-switching and a B cell that has undergone class-switching. “Somatically mutated” includes reference to nucleic acid sequences from affinity-matured B cells that are not identical to corresponding immunoglobulin variable region sequences in B cells that are not affinity-matured (i.e., sequences in the genome of germline cells). The phrase “somatically mutated” also includes reference to an immunoglobulin variable region nucleic acid sequence from a B cell after exposure of the B cell to an epitope of interest, wherein the nucleic acid sequence differs from the corresponding nucleic acid sequence prior to exposure of the B cell to the epitope of interest. The phrase “somatically mutated” refers to sequences from antibodies that have been generated in an animal, e.g., a mouse having human immunoglobulin variable region nucleic acid sequences, in response to an immunogen challenge, and that result from the selection processes inherently operative in such an animal.
[0152] The term “unrearranged,” with reference to a nucleic acid sequence, includes nucleic acid sequences that exist in the germline of an animal cell.
[0153] The phrase “variable domain” includes an amino acid sequence of an immunoglobulin light or heavy chain (modified as desired) that comprises the following amino acid regions, in sequence from N-terminal to C-terminal (unless otherwise indicated): FR1, CDR1, FR2, CDR2, FR3, CDR3, FR4.
Mice with Humanized Immunoglobulin Loci
[0154] The mouse as a genetic model has been greatly enhanced by transgenic and knockout technologies, which have allowed for the study of the effects of the directed over-expression or deletion of specific genes. Despite all of its advantages, the mouse still presents genetic obstacles that render it an imperfect model for human diseases and an imperfect platform to test human therapeutics or make them. First, although about 99% of human genes have a mouse homolog (Waterston, R. H., et. al. (2002). Initial sequencing and comparative analysis of the mouse genome. Nature 420, 520-562.), potential therapeutics often fail to cross-react, or cross-react inadequately, with mouse orthologs of the intended human targets. To obviate this problem, selected target genes can be “humanized,” that is, the mouse gene can be eliminated and replaced by the corresponding human orthologous gene sequence (e.g., U.S. Pat. Nos. 6,586,251, 6,596,541 and 7,105,348, incorporated herein by reference). Initially, efforts to humanize mouse genes by a “knockout-plus-transgenic humanization” strategy entailed crossing a mouse carrying a deletion (i.e., knockout) of the endogenous gene with a mouse carrying a randomly integrated human transgene (see, e.g., Bril, W. S., et al. (2006). Tolerance to factor VIII in a transgenic mouse expressing human factor VIII cDNA carrying an Arg(593) to Cys substitution. Thromb Haemost 95, 341-347; Homanics, G. E., et al. (2006). Production and characterization of murine models of classic and intermediate maple syrup urine disease. BMC Med Genet 7, 33; Jamsai, D., et al. (2006). A humanized BAC transgenic/knockout mouse model for HbE/beta-thalassemia. Genomics 88(3):309-15; Pan, Q., et at. (2006). Different role for mouse and human CD3delta/epsilon heterodimer in preT cell receptor (preTCR) function: human CD3delta/epsilon heterodimer restores the defective preTCR function in CD3gamma- and CD3gammadelta-deficient mice. Mol Immunol 43, 1741-1750). But those efforts were hampered by size limitations; conventional knockout technologies were not sufficient to directly replace large mouse genes with their large human genomic counterparts. A straightforward approach of direct homologous replacement, in which an endogenous mouse gene is directly replaced by the human counterpart gene at the same precise genetic location of the mouse gene (i.e., at the endogenous mouse locus), is rarely attempted because of technical difficulties. Until now, efforts at direct replacement involved elaborate and burdensome procedures, thus limiting the length of genetic material that could be handled and the precision with which it could be manipulated.
[0155] Exogenously introduced human immunoglobulin transgenes rearrange in precursor B-cells in mice (Alt, F. W., Blackwell, T. K., and Yancopoulos, G. D. (1985). Immunoglobulin genes in transgenic mice. Trends Genet 1, 231-236). This finding was exploited by engineering mice using the knockout-plus-transgenic approach to express human antibodies (Green, L. L. et al. (1994). Antigen-specific human monoclonal antibodies from mice engineered with human 1 g heavy and light chain YACs. Nat Genet 7, 13-21; Lonberg, N. (2005). Human antibodies from transgenic animals. Nat Biotechnol 23, 1117-1125; Lonberg, N., et al. (1994). Antigen-specific human antibodies from mice comprising four distinct genetic modifications. Nature 368, 856-859; Jakobovits, A., et al. (2007). From XenoMouse technology to panitumumab, the first fully human antibody product from transgenic mice. Nat Biotechnol 25, 1134-1143). The endogenous mouse immunoglobulin heavy chain and κ light chain loci were inactivated in these mice by targeted deletion of small but critical portions of each endogenous locus, followed by introducing human immunoglobulin gene loci as randomly integrated large transgenes, as described above, or minichromosomes (Tomizuka, K., et al. (2000). Double trans-chromosomic mice: maintenance of two individual human chromosome fragments containing Ig heavy and kappa loci and expression of fully human antibodies. Proc Nati Acad Sci USA 97, 722-727). Such mice represented an important advance in genetic engineering; fully human monoclonal antibodies isolated from them yielded promising therapeutic potential for treating a variety of human diseases (Gibson, T B., et al. (2006). Randomized phase III trial results of panitumumab, a fully human anti-epidermal growth factor receptor monoclonal antibody, in metastatic colorectal cancer. Clin Colorectal Cancer 6, 29-31; Jakobovits et al., 2007; Kim, Y. H., et al. (2007). Clinical efficacy of zanolimumab (HuMax-CD4): two Phase II studies in refractory cutaneous T-cell lymphoma. Blood 109(11):4655-62; Lonberg, 2005; Maker, A. V., et al. (2005). Tumor regression and autoimmunity in patients treated with cytotoxic T lymphocyte-associated antigen 4 blockade and interleukin 2: a phase I/II study. Ann Surg Oncol 12, 1005-1016; McClung, M R., et al. (2006). Denosumab in postmenopausal women with low bone mineral density. N Engl J Med 354, 821-831). But, as discussed above, these mice exhibit compromised B cell development and immune deficiencies when compared to wild type mice. Such problems potentially limit the ability of the mice to support a vigorous humoral response and, consequently, generate fully human antibodies against some antigens. The deficiencies may be due to: (1) inefficient functionality due to the random introduction of the human immunoglobulin transgenes and resulting incorrect expression due to a lack of upstream and downstream control elements (Garrett, F. E., et al. (2005). Chromatin architecture near a potential 3′ end of the igh locus involves modular regulation of histone modifications during B-Cell development and in vivo occupancy at CTCF sites. Mol Cell Biol 25, 1511-1525; Manis, J. P., et al. (2003). Elucidation of a downstream boundary of the 3′ IgH regulatory region. Mot Immunol 39, 753-760; Pawlitzky, I., et al. (2006). Identification of a candidate regulatory element within the 5′ flanking region of the mouse Igh locus defined by pro-B cell-specific hypersensitivity associated with binding of PU.1, Pax5, and E2A. J Immunol 176, 6839-6851); (2) inefficient interspecies interactions between human constant domains and mouse components of the B-cell receptor signaling complex on the cell surface, which may impair signaling processes required for normal maturation, proliferation, and survival of B cells (Hombach, J., et al. (1990). Molecular components of the B-cell antigen receptor complex of the IgM class. Nature 343, 760-762); and (3) inefficient interspecies interactions between soluble human immunoglobulins and mouse Fc receptors that might reduce affinity selection (Rao, S. P., et al. (2002). Differential expression of the inhibitory IgG Fc receptor FcgammaRIIB on germinal center cells: implications for selection of high-affinity B cells. J Immunol 169, 1859-1868) and immunoglobulin serum concentrations (Brambell, F. W., et al. (1964). A Theoretical Model of Gamma-Globulin Catabolism. Nature 203, 1352-1354; Junghans, R. P., and Anderson, C. L. (1996). The protection receptor for IgG catabolism is the beta2-microglobulin-containing neonatal intestinal transport receptor. Proc Natl Acad Sci USA 93, 5512-5516; Rao et al., 2002; Hjelm, F., et al. (2006). Antibody-mediated regulation of the immune response. Scand J Immunol 64, 177-184; Nimmerjahn, F., and Ravetch, J. V. (2007). Fc-receptors as regulators of immunity. Adv Immunol 96, 179-204). These deficiencies can be corrected by in situ humanization of only the variable regions of the mouse immunoglobulin loci within their natural locations at the endogenous heavy and light chain loci. This would effectively result in mice that make reverse chimeric (i.e., human V: mouse C) antibodies that would be capable of normal interactions and selection with the mouse environment based on retaining mouse constant regions. Further, such reverse chimeric antibodies are readily reformatted into fully human antibodies for therapeutic purposes.
[0156] A method for a large in situ genetic replacement of the mouse germline immunoglobulin variable genes with human germline immunoglobulin variable genes while maintaining the ability of the mice to generate offspring is described. Specifically, the precise replacement of six megabases of both the mouse heavy chain and κ light chain immunoglobulin variable gene loci with their human counterparts while leaving the mouse constant regions intact is described. As a result, mice have been created that have a precise replacement of their entire germline immunoglobulin variable repertoire with equivalent human germline immunoglobulin variable sequences, while maintaining mouse constant regions. The human variable regions are linked to mouse constant regions to form chimeric human-mouse immunoglobulin loci that rearrange and express at physiologically appropriate levels. The antibodies expressed are “reverse chimeras,” i.e., they comprise human variable region sequences and mouse constant region sequences. These mice having humanized immunoglobulin variable regions that express antibodies having human variable regions and mouse constant regions are called VELCOIMMUNE® humanized mice.
[0157] VELOCIMMUNE® humanized mice exhibit a fully functional humoral immune system that is essentially indistinguishable from that of wild-type mice. They display normal cell populations at all stages of B cell development. They exhibit normal lymphoid organ morphology. Antibody sequences of VELOCIMMUNE® humanized mice exhibit normal variable segment rearrangement and normal somatic hypermutation. Antibody populations in these mice reflect isotype distributions that result from normal class switching (e.g., normal isotype cis-switching). Immunizing VELOCIMMUNE® humanized mice results in robust humoral responses that generate a large diversity of antibodies having human immunoglobulin variable domains suitable as therapeutic candidates. This platform provides a plentiful source of affinity-matured human immunoglobulin variable region sequences for making pharmaceutically acceptable antibodies and other antigen-binding proteins.
[0158] It is the precise replacement of mouse immunoglobulin variable sequences with human immunoglobulin variable sequences that allows for making VELOCIMMUNE® humanized mice. Yet even a precise replacement of endogenous mouse immunoglobulin sequences at heavy and light chain loci with equivalent human immunoglobulin sequences, by sequential recombineering of very large spans of human immunoglobulin sequences, may present certain challenges due to divergent evolution of the immunoglobulin loci between mouse and man. For example, intergenic sequences interspersed within the immunoglobulin loci are not identical between mice and humans and, in some circumstances, may not be functionally equivalent. Differences between mice and humans in their immunoglobulin loci can still result in abnormalities in humanized mice, particularly when humanizing or manipulating certain portions of endogenous mouse immunoglobulin heavy chain loci. Some modifications at mouse immunoglobulin heavy chain loci are deleterious. Deleterious modifications can include, for example, loss of the ability of the modified mice to mate and produce offspring.
[0159] A precise, large-scale, in situ replacement of six megabases of the variable regions of the mouse heavy and light chain immunoglobulin loci (V.sub.H-D.sub.H-J.sub.H and Vκ-Jκ) with the corresponding 1.4 megabases human genomic sequences was performed, while leaving the flanking mouse sequences intact and functional within the hybrid loci, including all mouse constant chain genes and locus transcriptional control regions (
[0160] Humanization of the mouse immunoglobulin genes represents the largest genetic modification to the mouse genome to date. While previous efforts with randomly integrated human immunoglobulin transgenes have met with some success (discussed above), direct replacement of the mouse immunoglobulin genes with their human counterparts dramatically increases the efficiency with which fully-human antibodies can be efficiently generated in otherwise normal mice. Further, such mice exhibit a dramatically increased diversity of fully-human antibodies that can be obtained after immunization with virtually any antigen, as compared with mice bearing disabled endogenous loci and fully human antibody transgenes. Multiple versions of replaced, humanized loci exhibit completely normal levels of mature and immature B cells, in contrast to mice with randomly integrated human transgenes, which exhibit significantly reduced B cell populations at various stages of differentiation. While efforts to increase the number of human gene segments in human transgenic mice have reduced such defects, the expanded immunoglobulin repertoires have not altogether corrected reductions in B cell populations as compared to wild-type mice.
[0161] Notwithstanding the near wild-type humoral immune function observed in mice with replaced immunoglobulin loci, there are other challenges encountered when employing a direct replacement of the immunoglobulin that is not encountered in some approaches that employ randomly integrated transgenes. Differences in the genetic composition of the immunoglobulin loci between mice and humans has lead to the discovery of sequences beneficial for the propagation of mice with replaced immunoglobulin gene segments. Specifically, mouse ADAM genes located within the endogenous immunoglobulin locus are optimally present in mice with replaced immunoglobulin loci, due to their role in fertility.
Genomic Location and Function of Mouse ADAM6
[0162] Male mice that lack the ability to express any functional ADAM6 protein exhibit a severe defect in the ability of the mice to mate and to generate offspring. The mice lack the ability to express a functional ADAM6 protein by virtue of a replacement of all or substantially all mouse immunoglobulin variable region gene segments with human variable region gene segments. The loss of ADAM6 function results because the ADAM locus is located within a region of the endogenous mouse immunoglobulin heavy chain variable region gene locus, proximal to the 3′ end of the V.sub.H gene segment locus that is upstream of the D.sub.H gene segments. In order to breed mice that are homozygous for a replacement of all or substantially all endogenous mouse heavy chain variable gene segments with human heavy chain variable gene segments, it is generally a cumbersome approach to set up males and females that are each homozygous for the replacement and await a productive mating. Successful litters are relatively rare, and average litter size is very low. Instead, males heterozygous for the replacement have been employed to mate with females homozygous for the replacement to generate progeny that are heterozygous for the replacement, then breed a homozygous mouse therefrom. The inventors have determined that the likely cause of the loss in fertility in the mate mice is the absence in homozygous male mice of a functional ADAM6 protein.
[0163] The ADAM6 protein is a member of the ADAM family of proteins, where ADAM is an acronym for A Disintegrin And Metalloprotease. The ADAM family of proteins is large and diverse, with diverse functions. Some members of the ADAM family are implicated in spermatogenesis and fertilization. For example, ADAM2 encodes a subunit of the protein fertilin, which is implicated in sperm-egg interactions. ADAM3, or cyritestin, appears necessary for sperm binding to the zona pellucida. The absence of either ADAM2 or ADAM3 results in infertility. It has been postulated that ADAM2, ADAM3, and ADAM6 form a complex on the surface of mouse sperm cells.
[0164] The human ADAM6 gene, normally found between human V.sub.H gene segments V.sub.H1-2 and V.sub.H6-1, appears to be a pseudogene (
[0165] The position of the intergenic sequence in mice that encodes ADAM6a and ADAM6b renders the intergenic sequence susceptible to modification when modifying an endogenous mouse heavy chain. When V.sub.H gene segments are deleted or replaced, or when D.sub.H gene segments are deleted or replaced, there is a high probability that a resulting mouse will exhibit a severe deficit in fertility. In order to compensate for the deficit, the mouse is modified to include a nucleotide sequence that encodes a protein that will complement the loss in ADAM6 activity due to a modification of the endogenous mouse ADAM6 locus. In various embodiments, the complementing nucleotide sequence is one that encodes a mouse ADAM6a, a mouse ADAM6b, or a homolog or ortholog or functional fragment thereof that rescues the fertility deficit.
[0166] The nucleotide sequence that rescues fertility can be placed at any suitable position. It can be placed in the intergenic region, or in any suitable position in the genome (i.e., ectopically). In one embodiment, the nucleotide sequence can be introduced into a transgene that randomly integrates into the mouse genome. In one embodiment, the sequence can be maintained episomally, that is, on a separate nucleic acid rather than on a mouse chromosome. Suitable positions include positions that are transcriptionally permissive or active, e.g., a ROSA26 locus.
[0167] The term “ectopic” is intended to include a displacement, or a placement at a position that is not normally encountered in nature (e.g., placement of a nucleic acid sequence at a position that is not the same position as the nucleic acid sequence is found in a wild-type mouse). The term in various embodiments is used in the sense of its object being out of its normal, or proper, position. For example, the phrase “an ectopic nucleotide sequence encoding . . . ” refers to a nucleotide sequence that appears at a position at which it is not normally encountered in the mouse. For example, in the case of an ectopic nucleotide sequence encoding a mouse ADAM6 protein (or an ortholog or homolog or fragment thereof that provides the same or similar fertility benefit on male mice), the sequence can be placed at a different position in the mouse's genome than is normally found in a wild-type mouse. A functional homolog or ortholog of mouse ADAM6 is a sequence that confers a rescue of fertility loss (e.g., loss of the ability of a male mouse to generate offspring by mating) that is observed in an ADAM6.sup.−/− mouse. Functional homologs or orthologs include proteins that have at least about 89% identity or more, e.g., up to 99% identity, to the amino acid sequence of ADAM6a and/or to the amino acid sequence of ADAM6b, and that can complement, or rescue ability to successfully mate, of a mouse that has a genotype that includes a deletion or knockout of ADAM6a and/or ADAM6b.
[0168] The ectopic position can be anywhere (e.g., as with random insertion of a transgene containing a mouse ADAM6 sequence), or can be, e.g., at a position that approximates (but is not precisely the same as) its location in a wild-type mouse (e.g., in a modified endogenous mouse immunoglobulin locus, but either upstream or downstream of its natural position, e.g., within a modified immunoglobulin locus but between different gene segments, or at a different position in a mouse V-D intergenic sequence). One example of an ectopic placement is placement within a humanized immunoglobulin heavy chain locus. For example, a mouse comprising a replacement of one or more endogenous V.sub.H gene segments with human V.sub.H gene segments, wherein the replacement removes an endogenous ADAM6 sequence, can be engineered to have a mouse ADAM6 sequence located within sequence that contains the human V.sub.H gene segments. The resulting modification would generate an (ectopic) mouse ADAMS sequence within a human gene sequence, and the (ectopic) placement of the mouse ADAMS sequence within the human gene sequence can approximate the position of the human ADAMS pseudogene (i.e., between two V segments) or can approximate the position of the mouse ADAMS sequence (i.e., within the V-D intergenic region).
[0169] In various aspects, mice that comprise deletions or replacements of the endogenous heavy chain variable region locus or portions thereof can be made that contain an ectopic nucleotide sequence that encodes a protein that confers similar fertility benefits to mouse ADAM6 (e.g., an ortholog or a homolog or a fragment thereof that is functional in a male mouse). The ectopic nucleotide sequence can include a nucleotide sequence that encodes a protein that is an ADAM6 homolog or ortholog (or fragment thereof) of a different mouse strain or a different species, e.g., a different rodent species, and that confers a benefit in fertility, e.g., increased number of litters over a specified time period, and/or increased number of pups per litter, and/or the ability of a sperm cell of a male mouse to traverse through a mouse oviduct to fertilize a mouse egg.
[0170] In one embodiment, the ADAMS is a homolog or ortholog that is at least 89% to 99% identical to a mouse ADAM6 protein (e.g., at least 89% to 99% identical to mouse ADAM6a or mouse ADAM6b). In one embodiment, the ectopic nucleotide sequence encodes one or more proteins independently selected from a protein at least 89% identical to mouse ADAM6a, a protein at least 89% identical to mouse ADAM6b, and a combination thereof. In one embodiment, the homolog or ortholog is a rat, hamster, mouse, or guine pig protein that is or is modified to be about 89% or more identical to mouse ADAM6a and/or mouse ADAM6b. In one embodiment, the homolog or ortholog is 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to a mouse ADAM6a and/or mouse ADAM6b.
Ectopic ADAM6 in Humanized Heavy Chain Mice
[0171] Mice that make human antibodies have been available for some time now. Although they represent an important advance in the development of human therapeutic antibodies, these mice display a number of significant abnormalities that limit their usefulness. For example, they display compromised B cell development. The compromised development may be due to a variety of differences between the transgenic mice and wild-type mice.
[0172] Human antibodies might not optimally interact with mouse pre B cell or B cell receptors on the surface of mouse cells that signal for maturation, proliferation, or survival during clonal selection. Fully human antibodies might not optimally interact with a mouse Fc receptor system; mice express Fc receptors that do not display a one-to-one correspondence with human Fc receptors. Finally, various mice that make fully human antibodies do not include all genuine mouse sequences, e.g., downstream enhancer elements and other locus control elements, which may be required for wild-type B cell development.
[0173] Mice that make fully human antibodies generally comprise endogenous immunoglobulin loci that are disabled in some way, and human transgenes that comprise variable and constant immunoglobulin gene segments are introduced into a random location in the mouse genome. As long as the endogenous locus is sufficiently disabled so as not to rearrange gene segments to form a functional immunoglobulin gene, the goal of making fully human antibodies in such a mouse can be achieved—albeit with compromised B cell development.
[0174] Although compelled to make fully human antibodies from the human transgene locus, generating human antibodies in a mouse is apparently an unfavored process. In some mice, the process is so unfavored as to result in formation of chimeric human variable/mouse constant heavy chains (but not light chains) through the mechanism of trans-switching. By this mechanism, transcripts that encode fully human antibodies undergo isotype switching in trans from the human isotype to a mouse isotype. The process is in trans, because the fully human transgene is located apart from the endogenous locus that retains an undamaged copy of a mouse heavy chain constant region gene. Although in such mice trans-switching is readily apparent the phenomenon is still insufficient to rescue B cell development, which remains frankly impaired. In any event, trans-switched antibodies made in such mice retain fully human light chains, since the phenomenon of trans-switching apparently does not occur with respect to light chains; trans-switching presumably relies on switch sequences in endogenous loci used (albeit differently) in normal isotype switching in cis. Thus, even when mice engineered to make fully human antibodies select a trans-switching mechanism to make antibodies with mouse constant regions, the strategy is still insufficient to rescue normal B cell development.
[0175] A primary concern in making antibody-based human therapeutics is making a sufficiently large diversity of human immunoglobulin variable region sequences to identify useful variable domains that specifically recognize particular epitopes and bind them with a desirable affinity, usually—but not always—with high affinity. Prior to the development of VELOCIMMUNE® humanized mice, there was no indication that mice expressing human variable regions with mouse constant regions would exhibit any significant differences from mice that made human antibodies from a transgene. That supposition, however, was incorrect.
[0176] VELOCIMMUNE® humanized mice, which contain a precise replacement of mouse immunoglobulin variable regions with human immunoglobulin variable regions at the endogenous mouse loci, display a surprising and remarkable similarity to wild-type mice with respect to B cell development. In a surprising and stunning development, VELOCIMMUNE® humanized mice displayed an essentially normal, wild-type response to immunization that differed only in one significant respect from wild-type mice—the variable regions generated in response to immunization are fully human.
[0177] VELOCIMMUNE® humanized mice contain a precise, large-scale replacement of germline variable regions of mouse immunoglobulin heavy chain (IgH) and immunoglobulin light chain (e.g., κ light chain, Igκ) with corresponding human immunoglobulin variable regions, at the endogenous loci. In total, about six megabases of mouse loci are replaced with about 1.4 megabases of human genomic sequence. This precise replacement results in a mouse with hybrid immunoglobulin loci that make heavy and light chains that have a human variable regions and a mouse constant region. The precise replacement of mouse V.sub.H-D.sub.H-J.sub.H and Vκ-Jκ segments leave flanking mouse sequences intact and functional at the hybrid immunoglobulin loci. The humoral immune system of the mouse functions like that of a wild-type mouse. B cell development is unhindered in any significant respect and a rich diversity of human variable regions is generated in the mouse upon antigen challenge.
[0178] VELOCIMMUNE® humanized mice are possible because immunoglobulin gene segments for heavy and κ light chains rearrange similarly in humans and mice, which is not to say that their loci are the same or even nearly so—clearly they are not. However, the loci are similar enough that humanization of the heavy chain variable gene locus can be accomplished by replacing about 3 million base pairs of contiguous mouse sequence that contains all the V.sub.H, D.sub.H, and J.sub.H gene segments with about 1 million bases of contiguous human genomic sequence covering basically the equivalent sequence from a human immunoglobulin locus.
[0179] In some embodiments, further replacement of certain mouse constant region gene sequences with human gene sequences (e.g., replacement of mouse C.sub.H1 sequence with human C.sub.H1 sequence, and replacement of mouse C.sub.L sequence with human C.sub.L sequence) results in mice with hybrid immunoglobulin loci that make antibodies that have human variable regions and partly human constant regions, suitable for, e.g., making fully human antibody fragments, e.g., fully human Fab's. Mice with hybrid immunoglobulin loci exhibit normal variable gene segment rearrangement, normal somatic hypermutation, and normal class switching. These mice exhibit a humoral immune system that is indistinguishable from wild type mice, and display normal cell populations at all stages of B cell development and normal lymphoid organ structures—even where the mice lack a full repertoire of human variable region gene segments. Immunizing these mice results in robust humoral responses that display a wide diversity of variable gene segment usage.
[0180] The precise replacement of mouse germline variable region gene segments allows for making mice that have partly human immunoglobulin loci. Because the partly human immunoglobulin loci rearrange, hypermutate, and class switch normally, the partly human immunoglobulin loci generate antibodies in a mouse that comprise human variable regions. Nucleotide sequences that encode the variable regions can be identified and cloned, then fused (e.g., in an in vitro system) with any sequences of choice, e.g., any immunoglobulin isotype suitable for a particular use, resulting in an antibody or antigen-binding protein derived wholly from human sequences.
[0181] Large-scale humanization by recombineering methods were used to modify mouse embryonic stem (ES) cells to precisely replace up to 3 megabases of the mouse heavy chain immunoglobulin locus that included essentially all of the mouse V.sub.H, D.sub.H, and J.sub.H gene segments with equivalent human gene segments with up to a 1 megabase human genomic sequence containing some or essentially all human V.sub.H, D.sub.H, and J.sub.H gene segments. Up to a 0.5 megabase segment of the human genome comprising one of two repeats encoding essentially all human Vκ and Jκ gene segments was used to replace a 3 megabase segment of the mouse immunoglobulin κ light chain locus containing essentially all of the mouse Vκ and Jκ gene segments.
[0182] Mice with such replaced immunoglobulin loci can comprise a disruption or deletion of the endogenous mouse ADAM6 locus, which is normally found between the 3′-most V.sub.H gene segment and the 5′-most D.sub.H gene segment at the mouse immunoglobulin heavy chain locus. Disruption in this region can lead to reduction or elimination of functionality of the endogenous mouse ADAM6 locus. If the 3′-most V.sub.H gene segments of the human heavy chain repertoire are used in a replacement, an intergenic region containing a pseudogene that appears to be a human ADAM6 pseudogene is present between these V.sub.H gene segments, i.e., between human V.sub.H1-2 and V.sub.H1-6. However, male mice that comprise this human intergenic sequence exhibit little or no fertility.
[0183] Mice are described that comprise the replaced loci as described above, and that also comprise an ectopic nucleic acid sequence encoding a mouse ADAM6, where the mice exhibit essentially normal fertility. In one embodiment, the ectopic nucleic acid sequence is SEQ ID NO:3, placed between human V.sub.H1-2 and V.sub.H1-6 at the modified endogenous mouse heavy chain locus. The direction of transcription of the ADAM6 genes of SEQ ID NO:3 are opposite with respect to the direction of transcription of the surrounding human V.sub.H gene segments. Although examples herein show rescue of fertility by placing the ectopic sequence between the indicated human V.sub.H gene segments, skilled persons will recognize that placement of the ectopic sequence at any suitable transcriptionally-permissive locus in the mouse genome (or even extrachromosomally) will be expected to similarly rescue fertility in a male mouse.
[0184] The phenomenon of complementing a mouse that lacks a functional ADAM6 locus with an ectopic sequence that comprises a mouse ADAM6 gene or ortholog or homolog or functional fragment thereof is a general method that is applicable to rescuing any mice with nonfunctional or minimally functional endogenous ADAM6 loci. Thus, a great many mice that comprise an ADAM6-disrupting modification of the immunoglobulin heavy chain locus can be rescued with the compositions and methods of the invention. Accordingly, the invention comprises mice with a wide variety of modifications of immunoglobulin heavy chain loci that compromise endogenous ADAM6 function. Some (non-limiting) examples are provided in this description. In addition to the VELOCIMMUNE® humanized mice described, the compositions and methods related to ADAM6 can be used in a great many applications, e.g., when modifying a heavy chain locus in a wide variety of ways.
[0185] In one aspect, a mouse is provided that comprises an ectopic ADAM6 sequence that encodes a functional ADAM6 protein (or ortholog or homolog or functional fragment thereof), a replacement of all or substantially all mouse V.sub.H gene segments with one or more human V.sub.H gene segments, a replacement of all or substantially all mouse D.sub.H gene segments and J.sub.H gene segments with human D.sub.H and human J.sub.H gene segments; wherein the mouse lacks a C.sub.H1 and/or hinge region. In one embodiment, the mouse makes a single variable domain binding protein that is a dimer of immunoglobulin chains selected from: (a) human V.sub.H-mouse C.sub.H1-mouse C.sub.H2-mouse C.sub.H3; (b) human V.sub.H-mouse hinge-mouse C.sub.H2-mouse C.sub.H3; and, (c) human V.sub.H-mouse C.sub.H2-mouse C.sub.H3.
[0186] In one aspect, the nucleotide sequence that rescues fertility is placed within a human immunoglobulin heavy chain variable region sequence (e.g., between human V.sub.H1-2 and V.sub.H1-6 gene segments) in a mouse that has a replacement of all or substantially all mouse immunoglobulin heavy chain variable gene segments (mV.sub.H's, mD.sub.H's, and mJ.sub.H's) with one or more human immunoglobulin heavy chain variable gene segments (hV.sub.H's, hD.sub.H's, and hJ.sub.H's), and the mouse further comprises a replacement of all or substantially all mouse immunoglobulin κ light chain variable gene segments (mVκ's, mJκ's) with one or more human immunoglobulin κ light chain variable gene segments (hVκ's and hJκ's). In one embodiment, the nucleotide sequence is placed between a human V.sub.H1-2 gene segment and a human V.sub.H1-6 gene segment in a VELOCIMMUNE® humanized mouse (U.S. Pat. Nos. 6,596,541 and 7,105,348, incorporated herein by reference). In one embodiment, the VELOCIMMUNE® humanized mouse so modified comprises a replacement with all or substantially all human immunoglobulin heavy chain variable gene segments (all hV.sub.H's, hD.sub.H's, and hJ.sub.H's) and all or substantially all human immunoglobulin κ light chain variable gene segments (hVκ's and hJκ's).
[0187] In one aspect, a functional mouse ADAM6 locus (or ortholog or homolog or functional fragment thereof) can be placed in the midst of human V.sub.H gene segments that replace endogenous mouse V.sub.H gene segments. In one embodiment, all or substantially all mouse V.sub.H gene segments are removed and replaced with one or more human V.sub.H gene segments, and the mouse ADAM6 locus is placed immediately adjacent to the 3′ end of the human V.sub.H gene segments, or between two human V.sub.H gene segments. In a specific embodiment, the mouse ADAM6 locus is placed between two V.sub.H gene segments near the 3′ terminus of the inserted human V.sub.H gene segments. In a specific embodiment, the replacement includes human V.sub.H gene segments V.sub.H1-2 and V.sub.H6-1, and the mouse ADAM6 locus is placed downstream of the V.sub.H1-2 gene segment and upstream of the V.sub.H6-1 gene segment. In a specific embodiment, the arrangement of human V.sub.H gene segments is then the following (from upstream to downstream with respect to direction of transcription of the human V.sub.H gene segments): human V.sub.H1-2-mouse ADAM6 locus-human V.sub.H6-1. In a specific embodiment, the ADAM6 pseudogene between human V.sub.H1-2 and human V.sub.H6-1 is replaced with the mouse ADAM6 locus. In one embodiment, the orientation of one or more of mouse ADAM6a and mouse ADAM6b of the mouse ADAM6 locus is opposite with respect to direction of transcription as compared with the orientation of the human V.sub.H gene segments. Alternatively, the mouse ADAM6 locus can be placed in the intergenic region between the 3′-most human V.sub.H gene segment and the 5′-most D.sub.H gene segment. This can be the case whether the 5′-most D.sub.H segment is mouse or human.
[0188] Similarly, a mouse modified with one or more human V.sub.L gene segments (e.g., Vκ or Vλ segments) replacing all or substantially all endogenous mouse V.sub.H gene segments can be modified so as to either maintain the endogenous mouse ADAM6 locus, as described above, e.g., by employing a targeting vector having a downstream homology arm that includes a mouse ADAM6 locus or functional fragment thereof, or to replace a damaged mouse ADAM6 locus with an ectopic sequence positioned between two human V.sub.L gene segments or between the human V.sub.L gene segments and a D.sub.H gene segment (whether human or mouse, e.g., Vλ+m/hD.sub.H), or a J gene segment (whether human or mouse, e.g., Vκ+J.sub.H). In one embodiment, the replacement includes two or more human V.sub.L gene segments, and the mouse ADAM6 locus or functional fragment thereof is placed between the two 3′-most V.sub.L gene segments. In a specific embodiment, the arrangement of human V.sub.L gene segments is then the following (from upstream to downstream with respect to direction of transcription of the human gene segments): human V.sub.L3′-1-mouse ADAM6 locus-human V.sub.L3′. In one embodiment, the orientation of one or more of mouse ADAM6a and mouse ADAM6b of the mouse ADAM6 locus is opposite with respect to direction of transcription as compared with the orientation of the human V.sub.L gene segments. Alternatively, the mouse ADAM6 locus can be placed in the intergenic region between the 3′-most human V.sub.L gene segment and the 5′-most D.sub.H gene segment. This can be the case whether the 5′-most D.sub.H segment is mouse or human.
[0189] In one aspect, a mouse is provided with a replacement of one or more endogenous mouse V.sub.H gene segments, and that comprises at least one endogenous mouse D.sub.H gene segment. In such a mouse, the modification of the endogenous mouse V.sub.H gene segments can comprise a modification of one or more of the 3′-most V.sub.H gene segments, but not the 5′-most D.sub.H gene segment, where care is taken so that the modification of the one or more 3′-most V.sub.H gene segments does not disrupt or render the endogenous mouse ADAMS locus nonfunctional. For example, in one embodiment the mouse comprises a replacement of all or substantially all endogenous mouse V.sub.H gene segments with one or more human V.sub.H gene segments, and the mouse comprises one or more endogenous D.sub.H gene segments and a functional endogenous mouse ADAM6 locus.
[0190] In another embodiment, the mouse comprises the modification of endogenous mouse 3′-most V.sub.H gene segments, and a modification of one or more endogenous mouse D.sub.H gene segments, and the modification is carried out so as to maintain the integrity of the endogenous mouse ADAM6 locus to the extent that the endogenous ADAM6 locus remains functional. In one example, such a modification is done in two steps: (1) replacing the 3′-most endogenous mouse V.sub.H gene segments with one or more human V.sub.H gene segments employing a targeting vector with an upstream homology arm and a downstream homology arm wherein the downstream homology arm includes all or a portion of a functional mouse ADAM6 locus; (2) then replacing and endogenous mouse D.sub.H gene segment with a targeting vector having an upstream homology arm that includes a all or a functional portion of a mouse ADAM6 locus.
[0191] In various aspects, employing mice that contain an ectopic sequence that encodes a mouse ADAM6 protein or an ortholog or homolog or functional homolog thereof are useful where modifications disrupt the function of endogenous mouse ADAM6. The probability of disrupting endogenous mouse ADAM6 function is high when making modifications to mouse immunoglobulin loci, in particular when modifying mouse immunoglobulin heavy chain variable regions and surrounding sequences. Therefore, such mice provide particular benefit when making mice with immunoglobulin heavy chain loci that are deleted in whole or in part, are humanized in whole or in part, or are replaced (e.g., with Vκ or Vλ sequences) in whole or in part. Methods for making the genetic modifications described for the mice described below are known to those skilled in the art.
[0192] Mice containing an ectopic sequence encoding a mouse ADAMS protein, or a substantially identical or similar protein that confers the fertility benefits of a mouse ADAMS protein, are particularly useful in conjunction with modifications to a mouse immunoglobulin heavy chain variable region gene locus that disrupt or delete the endogenous mouse ADAM6 sequence. Although primarily described in connection with mice that express antibodies with human variable regions and mouse constant regions, such mice are useful in connection with any genetic modifications that disrupt the endogenous mouse ADAM6 gene. Persons of skill will recognize that this encompasses a wide variety of genetically modified mice that contain modifications of the mouse immunoglobulin heavy chain variable region gene locus. These include, for example, mice with a deletion or a replacement of all or a portion of the mouse immunoglobulin heavy chain gene segments, regardless of other modifications. Non-limiting examples are described below.
[0193] In some aspects, genetically modified mice are provided that comprise an ectopic mouse, rodent, or other ADAM6 gene (or ortholog or homolog or fragment) functional in a mouse, and one or more human immunoglobulin variable and/or constant region gene segments.
[0194] In one aspect, a mouse is provided that comprises an ectopic ADAM6 sequence that encodes a functional ADAM6 protein, a replacement of all or substantially all mouse V.sub.H gene segments with one or more human V.sub.H gene segments; a replacement of all or substantially all mouse D.sub.H gene segments with one or more human D.sub.H gene segments; and a replacement of all or substantially all mouse J.sub.H gene segments with one or more human J.sub.H gene segments.
[0195] In one embodiment, the mouse further comprises a replacement of a mouse C.sub.H1 nucleotide sequence with a human C.sub.H1 nucleotide sequence. In one embodiment, the mouse further comprises a replacement of a mouse hinge nucleotide sequence with a human hinge nucleotide sequence. In one embodiment, the mouse further comprises a replacement of an immunoglobulin light chain variable locus (V.sub.L and J.sub.L) with a human immunoglobulin light chain variable locus. In one embodiment, the mouse further comprises a replacement of a mouse immunoglobulin light chain constant region nucleotide sequence with a human immunoglobulin light chain constant region nucleotide sequence. In a specific embodiment, the V.sub.L, J.sub.L, and C.sub.L are immunoglobulin κ light chain sequences. In a specific embodiment, the mouse comprises a mouse C.sub.H2 and a mouse C.sub.H3 immunoglobulin constant region sequence fused with a human hinge and a human C.sub.H1 sequence, such that the mouse immunoglobulin loci rearrange to form a gene that encodes a binding protein comprising (a) a heavy chain that has a human variable region, a human C.sub.H1 region, a human hinge region, and a mouse C.sub.H2 and a mouse C.sub.H3 region; and (b) a gene that encodes, an immunoglobulin light chain that comprises a human variable domain and a human constant region.
[0196] In one aspect, a mouse is provided that comprises an ectopic ADAM6 sequence that encodes a functional ADAM6 protein, a replacement of all or substantially all mouse V.sub.H gene segments with one or more human V.sub.L gene segments, and optionally a replacement of all or substantially all D.sub.H gene segments and/or J.sub.H gene segments with one or more human D.sub.H gene segments and/or human J.sub.H gene segments, or optionally a replacement of all or substantially all D.sub.H gene segments and J.sub.H gene segments with one or more human J.sub.L gene segments.
[0197] In one embodiment, the mouse comprises a replacement of all or substantially all mouse V.sub.H, D.sub.H, and J.sub.H gene segments with one or more V.sub.L, one or more D.sub.H, and one or more J gene segments (e.g., Jκ or Jλ), wherein the gene segments are operably linked to an endogenous mouse hinge region, wherein the mouse forms a rearranged immunoglobulin chain gene that contains, from 5′ to 3′ in the direction of transcription, human V.sub.L-human or mouse D.sub.H-human or mouse J-mouse hinge-mouse C.sub.H2-mouse C.sub.H3. In one embodiment, the J region is a human Jκ region. In one embodiment, the J region is a human J.sub.H region. In one embodiment, the J region is a human Jλ region. In one embodiment, the human V.sub.L region is selected from a human Vλ region and a human Vκ region.
[0198] In specific embodiments, the mouse expresses a single variable domain antibody having a mouse or human constant region and a variable region derived from a human Vκ, a human D.sub.H and a human Jκ; a human Vκ, a human D.sub.H, and a human J.sub.H; a human Vλ, a human D.sub.H, and a human Jλ; a human Vλ, a human D.sub.H, and a human J.sub.H; a human Vκ, a human D.sub.H, and a human Jλ; a human Vλ, a human D.sub.H, and a human Jκ. In specific embodiment, recombination recognition sequences are modified so as to allow for productive rearrangements to occur between recited V, D, and J gene segments or between recited V and J gene segments.
[0199] In one aspect, a mouse is provided that comprises an ectopic ADAM6 sequence that encodes a functional ADAM6 protein (or ortholog or homolog or functional fragment thereof), a replacement of all or substantially all mouse V.sub.H gene segments with one or more human V.sub.L gene segments, a replacement of all or substantially all mouse D.sub.H gene segment and J.sub.H gene segments with human J.sub.1 gene segments; wherein the mouse lacks a C.sub.H1 and/or hinge region.
[0200] In one embodiment, the mouse lacks a sequence encoding a C.sub.H1 domain. In one embodiment, the mouse lacks a sequence encoding a hinge region. In one embodiment, the mouse lacks a sequence encoding a C.sub.H1 domain and a hinge region.
[0201] In a specific embodiment, the mouse expresses a binding protein that comprises a human immunoglobulin light chain variable domain (λ or κ) fused to a mouse C.sub.H2 domain that is attached to a mouse C.sub.H3 domain.
[0202] In one aspect, a mouse is provided that comprises an ectopic ADAM6 sequence that encodes a functional ADAM6 protein (or ortholog or homolog or functional fragment thereof), a replacement of all or substantially all mouse V.sub.H gene segments with one or more human V.sub.L gene segments, a replacement of all or substantially all mouse D.sub.H and J.sub.H gene segments with human J.sub.L gene segments.
[0203] In one embodiment, the mouse comprises a deletion of an immunoglobulin heavy chain constant region gene sequence encoding a C.sub.H1 region, a hinge region, a C.sub.H1 and a hinge region, or a C.sub.H1 region and a hinge region and a C.sub.H2 region.
[0204] In one embodiment, the mouse makes a single variable domain binding protein comprising a homodimer selected from the following: (a) human V.sub.L-mouse C.sub.H1-mouse C.sub.H2-mouse C.sub.H3; (b) human V.sub.L-mouse hinge-mouse C.sub.H2-mouse C.sub.H3; (c) human V.sub.L-mouse C.sub.H2-mouse C.sub.H3.
[0205] In one aspect, a mouse is provided with a disabled endogenous heavy chain immunoglobulin locus, comprising a disabled or deleted endogenous mouse ADAM6 locus, wherein the mouse comprises a nucleic acid sequence that expresses a human or mouse or human/mouse or other chimeric antibody. In one embodiment, the nucleic acid sequence is present on a transgene integrated that is randomly integrated into the mouse genome. In one embodiment, the nucleic acid sequence is on an episome (e.g., a chromosome) not found in a wild-type mouse.
Common, or Universal, Light Chain
[0206] Prior efforts to make useful multispecific epitope-binding proteins, e.g., bispecific antibodies, have been hindered by variety of problems that frequently share a common paradigm: in vitro selection or manipulation of sequences to rationally engineer, or to engineer through trial-and-error, a suitable format for pairing a heterodimeric bispecific human immunoglobulin. Unfortunately, most if not all of the in vitro engineering approaches provide largely ad hoc fixes that are suitable, if at all, for individual molecules. On the other hand, in vivo methods for employing complex organisms to select appropriate pairings that are capable of leading to human therapeutics have not been realized.
[0207] Generally, native mouse sequences are frequently not a good source for human therapeutic sequences. For at least that reason, generating mouse heavy chain immunoglobulin variable regions that pair with a common human light chain is of limited practical utility. More in vitro engineering efforts would be expended in a trial-and-error process to try to humanize the mouse heavy chain variable sequences while hoping to retain epitope specificity and affinity while maintaining the ability to couple with the common human light chain, with uncertain outcome. At the end of such a process, the final product may maintain some of the specificity and affinity, and associate with the common light chain, but ultimately immunogenicity in a human would likely remain a profound risk.
[0208] Therefore, a suitable mouse for making human therapeutics would include a suitably large repertoire of human heavy chain variable region gene segments in place of endogenous mouse heavy chain variable region gene segments. The human heavy chain variable region gene segments should be able to rearrange and recombine with an endogenous mouse heavy chain constant domain to form a reverse chimeric heavy chain (i.e., a heavy chain comprising a human variable domain and a mouse constant region). The heavy chain should be capable of class switching and somatic hypermutation so that a suitably large repertoire of heavy chain variable domains are available for the mouse to select one that can associate with the limited repertoire of human light chain variable regions.
[0209] A mouse that selects a common light chain for a plurality of heavy chains has a practical utility. In various embodiments, antibodies that express in a mouse that can only express a common light chain will have heavy chains that can associate and express with an identical or substantially identical light chain. This is particularly useful in making bispecific antibodies. For example, such a mouse can be immunized with a first immunogen to generate a B cell that expresses an antibody that specifically binds a first epitope. The mouse (or a mouse genetically the same) can be immunized with a second immunogen to generate a B cell that expresses an antibody that specifically binds the second epitope. Variable heavy regions can be cloned from the B cells and expresses with the same heavy chain constant region, and the same light chain, and expressed in a cell to make a bispecific antibody, wherein the light chain component of the bispecific antibody has been selected by a mouse to associate and express with the light chain component.
[0210] The inventors have engineered a mouse for generating immunoglobulin light chains that will suitably pair with a rather diverse family of heavy chains, including heavy chains whose variable regions depart from germline sequences, e.g., affinity matured or somatically mutated variable regions. In various embodiments, the mouse is devised to pair human light chain variable domains with human heavy chain variable domains that comprise somatic mutations, thus enabling a route to high affinity binding proteins suitable for use as human therapeutics.
[0211] The genetically engineered mouse, through the long and complex process of antibody selection within an organism, makes biologically appropriate choices in pairing a diverse collection of human heavy chain variable domains with a limited number of human light chain options. In order to achieve this, the mouse is engineered to present a limited number of human light chain variable domain options in conjunction with a wide diversity of human heavy chain variable domain options. Upon challenge with an antigen, the mouse maximizes the number of solutions in its repertoire to develop an antibody to the antigen, limited largely or solely by the number or light chain options in its repertoire. In various embodiments, this includes allowing the mouse to achieve suitable and compatible somatic mutations of the light chain variable domain that will nonetheless be compatible with a relatively large variety of human heavy chain variable domains, including in particular somatically mutated human heavy chain variable domains.
[0212] To achieve a limited repertoire of light chain options, the mouse is engineered to render nonfunctional or substantially nonfunctional its ability to make, or rearrange, a native mouse light chain variable domain. This can be achieved, e.g., by deleting the mouse's light chain variable region gene segments. The endogenous mouse locus can then be modified by an exogenous suitable human light chain variable region gene segment of choice, operably linked to the endogenous mouse light chain constant domain, in a manner such that the exogenous human variable region gene segments can combine with the endogenous mouse light chain constant region gene and form a rearranged reverse chimeric light chain gene (human variable, mouse constant). In various embodiments, the light chain variable region is capable of being somatically mutated. In various embodiments, to maximize ability of the light chain variable region to acquire somatic mutations, the appropriate enhancer(s) is retained in the mouse. For example, in modifying a mouse κ light chain locus to replace endogenous mouse κ light chain gene segments with human κ light chain gene segments, the mouse κ intronic enhancer and mouse κ 3′ enhancer are functionally maintained, or undisrupted.
[0213] A genetically engineered mouse is provided that expresses a limited repertoire of reverse chimeric (human variable, mouse constant) light chains associated with a diversity of reverse chimeric (human variable, mouse constant) heavy chains. In various embodiments, the endogenous mouse κ light chain gene segments are deleted and replaced with a single (or two) rearranged human light chain region, operably linked to the endogenous mouse Cκ gene. In embodiments for maximizing somatic hypermutation of the rearranged human light chain region, the mouse κ intronic enhancer and the mouse κ 3′ enhancer are maintained. In various embodiments, the mouse also comprises a nonfunctional λ light chain locus, or a deletion thereof or a deletion that renders the locus unable to make a λ light chain.
[0214] A genetically engineered mouse is provided that, in various embodiments, comprises a light chain variable region locus lacking endogenous mouse light chain V.sub.L and J.sub.L gene segments and comprising a rearranged human light chain variable region, in one embodiment a rearranged human V.sub.L/J.sub.L sequence, operably linked to a mouse constant region, wherein the locus is capable of undergoing somatic hypermutation, and wherein the locus expresses a light chain comprising the human V.sub.L/J.sub.L sequence linked to a mouse constant region. Thus, in various embodiments, the locus comprises a mouse κ 3′ enhancer, which is correlated with a normal, or wild type, level of somatic hypermutation.
[0215] The genetically engineered mouse in various embodiments when immunized with an antigen of interest generates B cells that exhibit a diversity of rearrangements of human immunoglobulin heavy chain variable regions that express and function with one or with two rearranged light chains, including embodiments where the one or two light chains comprise human light chain variable regions that comprise, e.g., 1 to 5 somatic mutations. In various embodiments, the human light chains so expressed are capable of associating and expressing with any human immunoglobulin heavy chain variable region expressed in the mouse.
Epitope-Binding Proteins that Bind More than One Epitope
[0216] The compositions and methods of described herein can be used to make binding proteins that bind more than one epitope with high affinity, e.g., bispecific antibodies. Advantages of the invention include the ability to select suitably high binding (e.g., affinity matured) heavy chain immunoglobulin chains each of which will associate with a single light chain.
[0217] Synthesis and expression of bispecific binding proteins has been problematic, in part due to issues associated with identifying a suitable light chain that can associate and express with two different heavy chains, and in part due to isolation issues. The methods and compositions described herein allow for a genetically modified mouse to select, through otherwise natural processes, a suitable light chain that can associate and express with more than one heavy chain, including heavy chains that are somatically mutated (e.g., affinity matured). Human V.sub.L and V.sub.H sequences from suitable B cells of immunized mice as described herein that express affinity matured antibodies having reverse chimeric heavy chains (i.e., human variable and mouse constant) can be identified and cloned in frame in an expression vector with a suitable human constant region gene sequence (e.g., a human IgG1). Two such constructs can be prepared, wherein each construct encodes a human heavy chain variable domain that binds a different epitope. One of the human V.sub.Ls (e.g., human Vκ1-39Jκ5 or human Vκ3-20Jλ1), in germline sequence or from a B cell wherein the sequence has been somatically mutated, can be fused in frame to a suitable human constant region gene (e.g., a human κ constant gene). These three fully-human heavy and light constructs can be placed in a suitable cell for expression. The cell will express two major species: a homodimeric heavy chain with the identical light chain, and a heterodimeric heavy chain with the identical light chain. To allow for a facile separation of these major species, one of the heavy chains is modified to omit a Protein A-binding determinant, resulting in a differential affinity of a homodimeric binding protein from a heterodimeric binding protein. Compositions and methods that address this issue are described in U.S. Ser. No. 12/832,838, filed 25 Jun. 2010, entitled “Readily Isolated Bispecific Antibodies with Native Immunoglobulin Format,” published as US 2010/0331527A1, hereby incorporated by reference.
[0218] In one aspect, an epitope-binding protein as described herein is provided, wherein human V.sub.L and V.sub.H sequences are derived from mice described herein that have been immunized with an antigen comprising an epitope of interest.
[0219] In one embodiment, an epitope-binding protein is provided that comprises a first and a second polypeptide, the first polypeptide comprising, from N-terminal to C-terminal, a first epitope-binding region that selectively binds a first epitope, followed by a constant region that comprises a first C.sub.H3 region of a human IgG selected from IgG1, IgG2, IgG4, and a combination thereof; and, a second polypeptide comprising, from N-terminal to C-terminal, a second epitope-binding region that selectively binds a second epitope, followed by a constant region that comprises a second C.sub.H3 region of a human IgG selected from IgG1, IgG2, IgG4, and a combination thereof, wherein the second C.sub.H3 region comprises a modification that reduces or eliminates binding of the second C.sub.H3 domain to protein A.
[0220] In one embodiment, the second C.sub.H3 region comprises an H95R modification (by IMGT exon numbering; H435R by EU numbering). In another embodiment, the second C.sub.H3 region further comprises a Y96F modification (IMGT; Y436F by EU).
[0221] In one embodiment, the second C.sub.H3 region is from a modified human IgG1, and further comprises a modification selected from the group consisting of D16E, L18M, N44S, K52N, V57M, and V82I (IMGT; D356E, L358M, N384S, K392N, V397M, and V422I by EU).
[0222] In one embodiment, the second C.sub.H3 region is from a modified human IgG2, and further comprises a modification selected from the group consisting of N44S, K52N, and V82I (IMGT; N384S, K392N, and V422I by EU).
[0223] In one embodiment, the second C.sub.H3 region is from a modified human IgG4, and further comprises a modification selected from the group consisting of Q15R, N44S, K52N, V57M, R69K, E79Q, and V82I (IMGT; Q355R, N384S, K392N, V397M, R409K, E419Q, and V422I by EU).
[0224] One method for making an epitope-binding protein that binds more than one epitope is to immunize a first mouse in accordance with the invention with an antigen that comprises a first epitope of interest, wherein the mouse comprises an endogenous immunoglobulin light chain variable region locus that does not contain an endogenous mouse V.sub.L that is capable of rearranging and forming a light chain, wherein at the endogenous mouse immunglobulin light chain variable region locus is a single rearranged human V.sub.L region operably linked to the mouse endogenous light chain constant region gene, and the rearranged human V.sub.L region is selected from a human Vκ1-39Jλ5 and a human Vκ3-20Jκ1, and the endogenous mouse V.sub.H gene segments have been replaced in whole or in part with human V.sub.H gene segments, such that immunoglobulin heavy chains made by the mouse are solely or substantially heavy chains that comprise human variable domains and mouse constant domains. When immunized, such a mouse will make a reverse chimeric antibody, comprising only one of two human light chain variable domains (e.g., one of human Vκ1-39Jκ5 or human Vκ3-20Jκ1). Once a B cell is identified that encodes a V.sub.H that binds the epitope of interest, the nucleotide sequence of the V.sub.H (and, optionally, the V.sub.L) can be retrieved (e.g., by PCR) and cloned into an expression construct in frame with a suitable human immunoglobulin constant domain. This process can be repeated to identify a second V.sub.H domain that binds a second epitope, and a second V.sub.H gene sequence can be retrieved and cloned into an expression vector in frame to a second suitable immunoglobulin constant domain. The first and the second immunoglobulin constant domains can the same or different isotype, and one of the immunoglobulin constant domains (but not the other) can be modified as described herein or in US 2010/0331527A1, and epitope-binding protein can be expressed in a suitable cell and isolated based on its differential affinity for Protein A as compared to a homodimeric epitope-binding protein, e.g., as described in US 2010/0331527A1.
[0225] In one embodiment, a method for making a bispecific epitope-binding protein is provided, comprising identifying a first affinity-matured (e.g., comprising one or more somatic hypermutations) human V.sub.H nucleotide sequence (V.sub.H1) from a mouse as described herein, identifying a second affinity-matured (e.g., comprising one or more somatic hypermutations) human V.sub.H nucleotide sequence (V.sub.H2) from a mouse as described herein, cloning V.sub.H1 in frame with a human heavy chain lacking a Protein A-determinant modification as described in US 2010/0331527A1 for form heavy chain 1 (HCl), cloning V.sub.H2 in frame with a human heavy chain comprising a Protein A-determinant as described in US 2010/0331527A1 to form heavy chain 2 (HC2), introducing an expression vector comprising HCl and the same or a different expression vector comprising HC2 into a cell, wherein the cell also expresses a human immunoglobulin light chain that comprises a human Vκ1-39/human Jκ5 or a human Vκ3-20/human Jκ1 fused to a human light chain constant domain, allowing the cell to express a bispecific epitope-binding protein comprising a V.sub.H domain encoded by V.sub.H1 and a V.sub.H domain encoded by V.sub.H2, and isolating the bispecific epitope-binding protein based on its differential ability to bind Protein A as compared with a monospecific homodimeric epitope-binding protein. In a specific embodiment, HCl is an IgG1, and HC2 is an IgG1 that comprises the modification H95R (IMGT; H435R by EU) and further comprises the modification Y96F (IMGT; Y436F by EU). In one embodiment, the VH domain encoded by V.sub.H1, the V.sub.H domain encoded by V.sub.H2, or both, are somatically mutated.
Human V.SUB.H .Genes that Express with a Common Human V.SUB.L
[0226] A variety of human variable regions from affinity-matured antibodies raised against four different antigens were expressed with either their cognate light chain, or at least one of a human light chain selected from human Vκ1-39Jκ5, human Vκ3-20Jκ1, or human VpreBJλ5 (see Example 10). For antibodies to each of the antigens, somatically mutated high affinity heavy chains from different gene families paired successfully with rearranged human germline Vκ1-39Jκ5 and Vκ3-20Jκ1 regions and were secreted from cells expressing the heavy and light chains. For Vκ1-39Jκ5 and Vκ3-20Jκ1, V.sub.H domains derived from the following human V.sub.H gene families expressed favorably: 1-2, 1-8, 1-24, 2-5, 3-7, 3-9, 3-11, 3-13, 3-15, 3-20, 3-23, 3-30, 3-33, 3-48, 4-31, 4-39, 4-59, 5-51, and 6-1. Thus, a mouse that is engineered to express a limited repertoire of human V.sub.L domains from one or both of Vκ1-39Jκ5 and Vκ3-20Jκ1 will generate a diverse population of somatically mutated human V.sub.H domains from a V.sub.H locus modified to replace mouse V.sub.H gene segments with human V.sub.H gene segments.
[0227] Mice genetically engineered to express reverse chimeric (human variable, mouse constant) immunoglobulin heavy chains associated with a single rearranged light chain (e.g., a Vκ1-39/J or a Vκ3-20/J), when immunized with an antigen of interest, generated B cells that comprised a diversity of human V.sub.H rearrangements and expressed a diversity of high-affinity antigen-specific antibodies with diverse properties with respect to their ability to block binding of the antigen to its ligand, and with respect to their ability to bind variants of the antigen (see Examples 14 through 15).
[0228] Thus, the mice and methods described herein are useful in making and selecting human immunoglobulin heavy chain variable domains, including somatically mutated human heavy chain variable domains, that result from a diversity of rearrangements, that exhibit a wide variety of affinities (including exhibiting a K.sub.D of about a nanomolar or less), a wide variety of specificities (including binding to different epitopes of the same antigen), and that associate and express with the same or substantially the same human immunoglobulin light chain variable region.
[0229] In one aspect, a first mouse comprising a humanized heavy chain variable region locus is bred with a second mouse comprising a nucleic acid sequence encoding a common, or universal, light chain locus as described herein. In one embodiment, the first or the second mouse comprises an ectopic nucleic acid sequence encoding a mouse ADAM6 or ortholog or homolog or functional fragment thereof. Progeny are bred to obtain mice homozygous for a humanized heavy chain locus, and homozygous for the universal light chain locus. In one embodiment, the first mouse or the second mouse comprises a modification of an endogenous mouse light chain locus to render the endogenous mouse light chain locus nonfunctional (e.g., a deletion or a knockout of, e.g., a λ and/or κ endogenous locus). In one embodiment, the first mouse comprises a replacement of all or substantially all functional endogenous mouse V, D, and J gene segments with one or more unrearranged human V, D, and J gene segments (e.g., all or substantially all functional human V, D, and J gene segments); and the mouse comprises a replacement of all or substantially all functional light chain V and J gene segments with no more than one or no more than two rearranged light chain V/J sequences. In one embodiment the first mouse further comprises an ectopic nucleic acid sequence that encodes a mouse ADAM6 or ortholog or homolog or functional fragment thereof. In one embodiment, the ectopic nucleic acid sequence is at a humanized immunoglobulin heavy chain locus.
[0230] In one embodiment, mice that comprise the ectopic sequence and that are homozygous for the universal light chain locus and for the humanized heavy chain locus are immunized with an antigen of interest to generate antibodies that comprise a plurality of somtatically mutated human variable domains that associate and express with a universal light chain. In one embodiment, human heavy chain variable domain nucleic acid sequences identified in the mouse are employed in an expression system to make a fully human antibody comprising the human heavy chain variable domain and a light chain comprising a universal light chain sequence of the mouse.
[0231] The following examples are provided so as to describe to those of ordinary skill in the art how to make and use methods and compositions of the invention, and are not intended to limit the scope of what the inventors regard as their invention. Efforts have been made to ensure accuracy with respect to numbers used (e.g., amounts, temperature, etc.) but some experimental errors and deviations should be accounted for. Unless indicated otherwise, parts are parts by weight, molecular weight is average molecular weight, temperature is indicated in Celsius, and pressure is at or near atmospheric.
EXAMPLES
Example I
Humanization of Mouse Immunoglobulin Genes
[0232] Human and mouse bacterial artificial chromsomes (BACs) were used to engineer 13 different BAC targeting vectors (BACvecs) for humanization of the mouse immunoglobulin heavy chain and κ light chain loci. Tables 1 and 2 set forth detailed descriptions of the steps performed for the construction of all BACvecs employed for the humanization of the mouse immunoglobulin heavy chain and κ light chain loci, respectively.
[0233] Identification of Human and Mouse BACs.
[0234] Mouse BACs that span the 5′ and 3′ ends of the immunoglobulin heavy chain and K light chain loci were identified by hybridization of filters spotted with BAC library or by PCR screening mouse BAC library DNA pools. Filters were hybridized under standard conditions using probes that corresponded to the regions of interest. Library pools were screened by PCR using unique primer pairs that flank the targeted region of interest. Additional PCR using the same primers was performed to deconvolute a given well and isolate the corresponding BAC of interest. Both BAC filters and library pools were generated from 129 SvJ mouse ES cells (Incyte Genomics/Invitrogen). Human BACs that cover the entire immunoglobulin heavy chain and κ light chain loci were identified either by hybridization of filters spotted with BAC library (Caltech B, C, or D libraries & RPCI-11 library, Research Genetics/Invitrogen) through screening human BAC library pools (Caltech library, invitrogen) by a PCR-based method or by using a BAC end sequence database (Caltech D library, TIGR).
[0235] Construction of BACvecs (Tables 1 and 2).
[0236] Bacterial homologous recombination (BHR) was performed as described (Valenzuela et al., 2003; Zhang, Y., et al. (1998). A new logic for DNA engineering using recombination in Escherichia coli. Nat Genet 20, 123-128). In most cases, linear fragments were generated by ligating PCR-derived homology boxes to cloned cassettes followed by gel isolation of ligation products and electroporation into BHR-competent bacteria harboring the target BAC. After selection on appropriate antibiotic petri dishes, correctly recombined BACs were identified by PCR across both novel junctions followed by restriction analysis on pulsed-field gels (Schwartz, D. C., and Cantor, C. R. (1984) Separation of yeast chromosome-sized DNAs by pulsed field gradient gel electrophoresis. Cell 37, 67-75) and spot-checking by PCR using primers distributed across the human sequences.
[0237] A 3 hV.sub.H BACvec was constructed using three sequential BHR steps for the initial step of humanization of the immunoglobulin heavy chain locus (
[0238] In a similar fashion, 12 additional BACvecs were engineered for humanization of the heavy chain and κ light chain loci. In some instances, BAC ligation was performed in lieu of BHR to conjoin two large BACs through introduction of rare restriction sites into both parental BACvecs by BHR along with careful placement of selectable markers. This allowed for the survival of the desired ligation product upon selection with specific drug marker combinations. Recombinant BACs obtained by ligation after digestion with rare restriction enzymes were identified and screened in a similar fashion to those obtained by BHR (as described above).
TABLE-US-00001 TABLE 1 BACvec Step Description Process 3hV.sub.H 1 Insert upstream mouse homology box into human proximal BHR BAC CTD-2572o2 2 Insert downstream mouse homology box into human proximal BHR BAC CTD-2572o2 3 Insert 3hV.sub.H/27hD.sub.H/9hJ.sub.H into mouse proximal BAC CT7-302a07 BHR to create 3hV.sub.H BACvec DC 1 Insert cassette at distal end of mouse IgH locus using mouse BHR BAC CT7-253i20 18hV.sub.H 1 Insert specR marker at downstream end of 3hV.sub.H insertion BHR using human BAC CTD-2572o2 2 Insert I-CeuI and Not sites flanking puroR at upstream end of BHR 3hV.sub.H insertion 3 Insert Not site at downstream end of Rel2-408p02 BAC (≈10 kb BHR downstream of V.sub.H2-5) 4 Insert I-Ceu1 site at upstream end of Rel2-408p02 BAC (≈23 BHR kb upstream of V.sub.H1-18) 5 Ligate 184 kb fragment from step 4 into 153 kb vector from step Ligation 2 6 Trim human homology from CTD-2572o2 BAC deleting ≈85 kb BHR and leaving 65 kb homology to 3hV.sub.H 7 Insert cassette and Not site at distal end of mouse IgH locus in BHR CT7-253i20 BAC 8 Subclone mouse distal homology arm for insertion upstream Ligation from human BACs 9 Insert 20 kb mouse arm upstream of Rel2-408p02 BHR 10 Swap selection cassette from hygR to neoR to create 18hV.sub.H BHR BACvec 39hV.sub.H 1 Insert I-CeuI and PI-SceI sites flanking hygR into distal end of BHR human BAC CTD-2534n10 2 Insert CmR at proximal end of CTD-2534n10 BAC to allow for BHR selection for ligation to RP11-72n10 BAC 3 Insert PI-SceI site into RP11-72n10 BAC for ligation to CTD- BHR 2534n10 BAC 4 Insert I-CeuI and Ascl sites flanking puroR at distal end of BHR RP11-72n10 BAC 5 Ligate 161 kb fragment from construct of step 4 into construct of Ligation step 2 replacing hygR 6 Insert neoR and Ascl site at proximal end of mouse distal BHR homology arm using CT7-253i20 BAC 7 Insert specR and I-CeuI site at distal end of mouse distal BHR homology arm 8 Ligate mouse distal homology arm onto human insert from step Ligation 5 9 Swap selection cassette from neo to hyg using UbCp and pA BHR as homolgy boxes to create 39hV.sub.H BACvec 53hV.sub.H 1 Insert specR at proximal end of human CTD-3074b5 BAC BHR 2 Insert Ascl site at distal end of human CTD-3074b5 BAC BHR 3 Insert hygR and Ascl site at proximal end of mouse distal BHR homology arm using CT7-253i20 BAC 4 Ligate mouse distal homology arm onto construct from step 2 Ligation 5 Swap selection cassette from hyg to neo using UbCp and pA BHR as homolgy boxes to create 53hV.sub.H BACvec 70hV.sub.H 1 Insert PI-SceI and I-CeuI sites flanking spec at distal end of BHR human CTD-2195p5 BAC 2 Insert I-CeuI site at proximal end of RP11-926p12 BAC for BHR ligation to CTD-2195p5 BAC 3 Insert PI-SceI and Ascl sites at distal end of RP11-926p12 BHR BAC for ligation of mouse arm 4 Ligate mouse distal homology arm onto construct from step 3 Ligation 5 Ligate mouse distal homology arm and hIgH fragment from Ligation RP11-926p12 BAC onto CTD-2195p5 BAC to create 70 hV.sub.H BACvec 80hV.sub.H 1 Insert I-CeuI and Ascl sites flanking hygR at distal end of CTD- BHR 2313e3 BAC 2 Ligate mouse dista homology arm onto human CTD-2313e3 Ligation BAC from step 1 to create 80hV.sub.H BACvec
TABLE-US-00002 TABLE 2 BACvec Step Description Process Igκ-PC 1 Insert loxP site within mouse J-C intron using CT7-254m04 BHR BAC Igκ-DC 1 Insert loxP site at distal end of mouse IgK locus using CT7- BHR 302g12 BAC 6hVκ 1 Insert PI-SceI site ≈400 bp downstream from hJκ5 in CTD- BHR 2366j12 BAC 2 Insert I-CeuI and Asci sites flanking hygR at distal end of CTD- BHR 2366j12 BAC 3 Insert I-CeuI and PI-SceI sites flanking puroR ≈xxbp BHR downstream from mJκx using CT7-254m04 BAC 4 Insert hIgVκ/Jκ upstream from mouse Enhκ/Cκ using construct Ligation from step 3 5 Replace cmR in construct of step 4 with specR BHR 6 Insert Neo selection cassette at distal end of mouse Igκ locus BHR using CT7-302g12 BAC 7 Ligate mouse distal homology arm upstream of human insert in Ligation construct of step 6 to create 6hVκ BACvec 16hVκ 1 Insert NeoR at distal end of RP11-1061b13 BAC BHR 2 Replace cmR in construct of step 1 with specR BHR 3 Insert Hyg selection cassette at distal end of mouse Igκ locus BHR using CT7-302g12 BAC 4 Ligate mouse distal homology arm upstream of human insert Ligation from construct of step 2 to create 16hVκ BACvec 30hVκ 1 Insert HygR at distal end of RP11-99g6 BAC BHR 2 Replace cmR in construct of step 1 with specR BHR 3 Insert Neo selection cassette at distal end of mouse Igκ locus BHR using CT7-302g12 BAC 4 Ligate mouse distal homology arm upstream of human insert Ligation from construct of step 2 to create 30hVκ BACvec 40hVκ 1 Insert NeoR at distal end of hIgH locus in CTD-2559d6 BAC BHR 2 Replace cmR in construct of step 1 with specR BHR 3 Ligate mouse distal homology arm upstream of hIgH locus in Ligation construct of step 2 to create 40hVκ BACvec
[0239] Modification of Embryonic Stem (ES) Cells and Generation of Mice.
[0240] ES cell (F1H4) targeting was performed using the VELOCIGENE® genetic engineering method as described (Valenzuela et al, 2003). Derivation of mice from modified ES cells by either blastocyst (Valenzuela et al., 2003) or 8-cell injection (Poueymirou et al., 2007) was as described. Targeted ES cells and mice were confirmed by screening DNA from ES cells or mice with unique sets of probes and primers in a PCR based assay (e.g.,
[0241] Karyotype Analysis and Fluorescent In Situ Hybridization (FISH).
[0242] Karyotype Analysis was performed by Coriell Cell Repositories (Coriell Institute for Medical Research, Camden, N.J.). FISH was performed on targeted ES cells as described (Valenzuela et al., 2003). Probes corresponding to either mouse BAC DNA or human BAC DNA were labeled by nick translation (Invitrogen) with the fluorescently labeled dUTP nucleotides spectrum orange or spectrum green (Vysis).
[0243] Immunoglobulin Heavy Chain Variable Gene Locus.
[0244] Humanization of the variable region of the heavy chain locus was achieved in nine sequential steps by the direct replacement of about three million base pairs (Mb) of contiguous mouse genomic sequence containing all V.sub.H, D.sub.H and J.sub.H gene segments with about one Mb of contiguous human genomic sequence containing the equivalent human gene segments (
[0245] The intron between J.sub.H gene segments and constant region genes (the J-C intron) contains a transcriptional enhancer (Neuberger, M. S. (1983) Expression and regulation of immunoglobulin heavy chain gene transfected into lymphoid cells. EMBO J 2, 1373-1378) followed by a region of simple repeats required for recombination during isotype switching (Kataoka, T. et al. (1980) Rearrangement of immunoglobulin gamma 1-chain gene and mechanism for heavy-chain class switch. Proc Natl Acad Sci USA 77, 919-923). The junction between human V.sub.H-D.sub.H-J.sub.H region and the mouse C.sub.H region (the proximal junction) was chosen to maintain the mouse heavy chain intronic enhancer and switch domain in order preserve both efficient expression and class switching of the humanized heavy chain locus within the mouse. The exact nucleotide position of this and subsequent junctions in all the replacements was possible by use of the VELOCIGENE® genetic engineering method (supra), which employed bacterial homologous recombination driven by synthesized oligonucleotides. Thus, the proximal junction was placed about 200 bp downstream from the last J.sub.H gene segment and the distal junction was placed several hundred upstream of the most 5′ V.sub.H gene segment of the human locus and about 9 kb downstream from the mouse V.sub.H1-86 gene segment, also known as J558.55. The mouse V.sub.H1-86 (J558.55) gene segment is the most distal heavy chain variable gene segment, reported to be a pseudogene in C57BL/6 mice, but potentially active, albeit with a poor RSS sequence, in the targeted 129 allele. The distal end of the mouse heavy chain locus reportedly may contain control elements that regulate locus expression and/or rearrangement (Pawlitzky et al., 2006).
[0246] A first insertion of human immunoglobulin DNA sequence into the mouse was achieved using 144 kb of the proximal end of the human heavy chain locus containing 3 V.sub.H, all 27 D.sub.H and 9 J.sub.H human gene segments inserted into the proximal end of the mouse IgH locus, with a concomitant 16.6 kb deletion of mouse genomic sequence, using about 75 kb of mouse homology arms (Step A,
[0247] Targeted ES cells from Step A were re-targeted with a BACvec that produced a 19 kb deletion at the distal end of the heavy chain locus (Step B,
[0248] The remainder of the human heavy chain variable region was added to the 3 hV.sub.H allele in a series of 5 steps using the VELOCIGENE® genetic engineering method (Steps E-H,
TABLE-US-00003 TABLE 3 Func- Hybrid Human Targeting Targeting % Total tional Allele sequence construct efficiency usage V.sub.H V.sub.H 3hV.sub.H 144 kb 240 kb 0.2% 5 3 3 3hV.sub.H/DC 144 kb 110 kb 0.1% 5 3 3 3hV.sub.H-CRE 144 kb — .sup. 8% 5 3 3 18hV.sub.H 340 kb 272 kb 0.1% 25 18 12 39hV.sub.H 550 kb 282 kb 0.2% 60 39 25 53hV.sub.H 655 kb 186 kb 0.4% 65 53 29 70hV.sub.H 850 kb 238 kb 0.5% 90 70 39 80hV.sub.H 940 kb 124 kb 0.2% 100 80 43 80hV.sub.HdNeo 940 kb — 2.6% 100 80 43
[0249] Immunoglobulin κ Light Chain Variable Gene Locus.
[0250] The κ light chain variable region was humanized in eight sequential steps by the direct replacement of about three Mb of mouse sequence containing all Vκ and Jκ gene segments with about 0.5 Mb of human sequence containing the proximal human Vκ and Jκ gene segments in a manner similar to that of the heavy chain (
[0251] The variable region of the human κ light chain locus contains two nearly identical 400 kb repeats separated by a 800 kb spacer (Weichhold, G. M. et al. (1993) The human immunoglobulin kappa locus consists of two copies that are organized in opposite polarity, Genomics 16:503-511). Because the repeats are so similar, nearly all of the locus diversity can be reproduced in mice by using the proximal repeat. Further, a natural human allele of the κ light chain locus missing the distal repeat has been reported (Schaible, G. et al. (1993) The immunoglobulin kappa locus: polymorphism and haplotypes of Caucasoid and non-Caucasoid individuals, Hum Genet 91:261-267). About three Mb of mouse κ light chain variable gene sequence were replaced with about 0.5 Mb of human κ light chain variable gene sequence to effectively replace all of the mouse Vκ and Jκ gene segments with the proximal human Vκ and all of the human Jκ gene segments (
[0252] A human genomic fragment of about 480 kb in size containing the entire immunoglobulin κ light chain variable region was inserted in four sequential steps (
TABLE-US-00004 TABLE 4 Func- Hybrid Human Targeting Targeting % Total tional Allele sequence construct efficiency usage Vκ Vκ Igκ-PC 0 132 kb 1.1% — — — Igκ-PC/DC 0 90 kb 0.4% — — — Igκ-CRE 0 — .sup. 1% — — — 6hVκ 110 kb 122 kb 0.3% 14 6 4 16hVκ 240 kb 203 kb 0.4% 47 16 11 30hVκ 390 kb 193 kb 0.1% 70 30 18 40hVκ 480 kb 185 kb 0.2% 100 40 25 40hVκdHyg 480 kb — 0.7% 100 40 25
Example II
Generation of Fully Humanized Mice by Combination of Multiple Humanized Immunoglobulin Alleles
[0253] At several points, ES cells bearing a portion of the human immunoglobulin heavy chain or κ light chain variable repertoires as described in Example 1 were microinjected and the resulting mice bred to create multiple versions of VELOCIMMUNE® humanized mice with progressively larger fractions of the human germline immunoglobulin repertoires (Table 5;
[0254] Mice doubly homozygous for both immunoglobulin heavy chain and κ light chain humanizations were generated from a subset of the alleles described in Example 1. All genotypes observed during the course of breeding to generate the doubly homozygous mice occurred in roughly Mendelian proportions. Male progeny homozygous for each of the human heavy chain alleles showed reduced fertility. Reduced fertility resulted from loss of mouse ADAM6 activity. The mouse heavy chain variable gene locus contains two embedded functional ADAM6 genes (ADAM6a and ADAM6b). During humanization of the mouse heavy chain variable gene locus, the inserted human genomic sequence contained an ADAM6 pseudogene. Mouse ADAM6 may be required for fertility, and thus lack of mouse ADAM6 genes in humanized heavy chain variable gene loci might lead to reduced fertility in these mice notwithstanding the presence of the human pseudogene. Examples 7-9 describe the precise replacement of deleted mouse ADAM6 genes back into a humanized heavy chain variable gene locus, and restoration of a wild-type level of fertility in mice with a humanized heavy chain immunoglobulin locus.
TABLE-US-00005 TABLE 5 Version of Heavy Chain κ Light Chain VELOCIMMUNE ® Human 5′ V.sub.H Human 5′ Vκ Mouse V.sub.H Allele gene Vκ Allele gene V1 18 18hV.sub.H V.sub.H1-18 16 16hVκ Vκ1-16 V2 39 39hV.sub.H V.sub.H4-39 30 30hVκ Vκ2-29 V3 80 80hV.sub.H V.sub.H3-74 40 40hVκ Vκ2-40
Example III
Lymphocyte Populations in Mice with Humanized Immunoglobulin Genes
[0255] Mature B cell populations in the three different versions of VELOCIMMUNE® mice were evaluated by flow cytometry.
[0256] Briefly, cell suspensions from bone marrow, spleen and thymus were made using standard methods. Cells were resuspended at 5×10.sup.5 cells/mL in BD Pharmingen FACS staining buffer, blocked with anti-mouse CD16/32 (BD Pharmingen), stained with the appropriate cocktail of antibodies and fixed with BD CYTOFIX™ all according to the manufacturer's instructions. Final cell pellets were resuspended in 0.5 mL staining buffer and analyzed using BD FACSCALIBUR™ and BD CELLQUEST PRO™ software. All antibodies (BD Pharmingen) were prepared in a mass dilution/cocktail and added to a final concentration of 0.5 mg/10.sup.5 cells. Antibody cocktails for bone marrow (A-D) staining were as follows: A: anti-mouse IgM.sup.b-FITC, anti-mouse IgM.sup.a-PE, anti-mouse CD45R(B220)-APC; B: anti-mouse CD43(S7)-PE, anti-mouse CD45R(B220)-APC; C: anti-mouse CD24(HSA)-PE; anti-mouse CD45R(B220)-APC; D: anti-mouse BP-1-PE, anti-mouse CD45R(B220)-APC. Antibody cocktails for spleen and inguinal lymph node (E-H) staining were as follows: E: anti-mouse IgM.sup.b-FITC, anti-mouse IgM.sup.a-PE, anti-mouse CD45R(B220)-APC; F: anti-mouse Ig, λ1, λ2, λ3 Light Chain-FITC, anti mouse Igκ Light Chain-PE, anti-mouse CD45R(B220)-APC; G: anti-mouse Ly6G/C-FITC, anti-mouse CD49b(DX5)-PE, anti-mouse CD11b-APC; H: anti-mouse CD4(L3T4)-FITC, anti-mouse CD45R(B220)-PE, anti-mouse CD8a-APC. Results are shown in
[0257] Lymphocytes isolated from spleen or lymph node of homozygous VELOCIMMUNE® humanized mice were stained for surface expression of the markers B220 and IgM and analyzed using flow cytometry (
[0258] Allelic Exclusion and Locus Choice.
[0259] The ability to maintain allelic exclusion was examined in mice heterozygous for different versions of the humanized immunoglobulin heavy chain locus.
[0260] The humanization of the immunoglobulin loci was carried out in an F1 ES line (F1H4 (Valenzuela et al, 2003)), derived from 129S6/SvEvTac and C57BL/6NTac heterozygous embryos. The human heavy chain germline variable gene sequences are targeted to the 129S6 allele, which carries the IgM.sup.a haplotype, whereas the unmodified mouse C576BL/6N allele bears the IgM.sup.b haplotype. These allelic forms of IgM can be distinguished by flow cytometry using antibodies specific to the polymorphisms found in the IgM.sup.a or IgM.sup.b alleles. As shown in
[0261] Polymorphisms of the Cκ regions are not available in 129S6 or C57BL/6N to examine allelic exclusion of humanized versus non-humanized κ light chain loci. However, VELOCIMMUNE® humanized mice all possess wild type mouse λ light chain loci, therefore, it is possible to observe whether rearrangement and expression of humanized κ light chain loci can prevent mouse λ light chain expression. The ratio of the number of cells expressing the humanized κ light chain relative to the number of cells expressing mouse λ light chain was relatively unchanged in VELOCIMMUNE® humanized mice compared with wild type mice, regardless of the number of human Vκ gene segments inserted at the κ light chain locus (
[0262] B Cell Development.
[0263] Because the mature B cell populations in VELOCIMMUNE® humanized mice resemble those of wild type mice (described above), it is possible that defects in early B cell differentiation are compensated for by the expansion of mature B cell populations. The various stages of B cell differentiation were examined by analysis of B cell populations using flow cytometry. Table 6 sets forth the ratio of the fraction of cells in each B cell lineage defined by FACs, using specific cell surface markers, in VELOCIMMUNE® humanized mice compared to wild type littermates.
[0264] Early B cell development occurs in the bone marrow, and different stages of B cell differentiation are characterized by changes in the types and amounts of cell surface marker expression. These differences in surface expression correlate with the molecular changes occurring at the immunoglobulin loci inside the cell. The pro-B to pre-B cell transition requires the successful rearrangement and expression of functional heavy chain protein, while transition from the pre-B to mature B stage is governed by the correct rearrangement and expression of a κ or λ light chain. Thus, inefficient transition between stages of B cell differentiation can be detected by changes in the relative populations of B cells at a given stage.
TABLE-US-00006 TABLE 6 Spleen Bone Marrow Emerging Version of pro-B pre-B Immature Mature B220.sup.hi Mature VELOCIMMUNE ® CD43.sup.hi CD24.sup.hi B220.sup.lo B220.sup.hi IgM.sup.+ B220.sup.hi Mice B220.sup.lo B220.sup.lo IgM.sup.+ IgM.sup.+ IgD.sup.+ IgM+ V1 1.1 1.0 0.9 1.0 1.1 1.0 V2 1.0 1.0 1.0 1.0 1.0 1.0 V3 1.0 1.0 1.1 1.0 1.0 1.1
[0265] No major defects were observed in B cell differentiation in any of the VELOCIMMUNE® humanized mice. The introduction of human heavy chain gene segments does not appear to affect the pro-B to pre-B transition, and introduction of human κ light chain gene segments does not affect the pre-B to B transition in VELOCIMMUNE® humanized mice. This demonstrates that “reverse chimeric” immunoglobulin molecules possessing human variable regions and mouse constants function normally in the context of B cell signaling and co-receptor molecules leading to appropriate B cell differentiation in a mouse environment. In contrast, the balance between the different populations during B cell differentiation are perturbed to varying extents in mice that contain randomly integrated immunoglobulin transgenes and inactivated endogenous heavy chain or κ light chain loci (Green and Jakobovits (1998)).
Example IV
Variable Gene Repertoire in Humanized Immunoglobulin Mice
[0266] Usage of human variable gene segments in the humanized antibody repertoire of VELOCIMMUNE® humanized mice was analyzed by reverse transcriptase-polymerase chain reaction (RT-PCR) of human variable regions from multiple sources including splenocytes and hybridoma cells. Variable region sequence, gene segment usage, somatic hypermutation, and junctional diversity of rearranged variable region gene segments were determined.
[0267] Briefly, total RNA was extracted from 1×10.sup.7-2×10.sup.7 splenocytes or about 10.sup.4-10.sup.5 hybridoma cells using TRIZOL™ (Invitrogen) or Qiagen RNEASY™ Mini Kit (Qiagen) and primed with mouse constant region specific primers using the SUPERSCRIPT™ III One-Step RT-PCR system (Invitrogen). Reactions were carried out with 2-5 μL of RNA from each sample using the aforementioned 3′ constant specific primers paired with pooled leader primers for each family of human variable regions for both the heavy chain and κ light chain, separately. Volumes of reagents and primers, and RT-PCR/PCR conditions were performed according to the manufacturer's instructions. Primers sequences were based upon multiple sources (Wang, X. and Stollar, B. D. (2000) Human immunoglobulin variable region gene analysis by single cell RT-PCR, J Immunol Methods 244:217-225; Ig-primer sets, Novagen). Where appropriate, nested secondary PCR reactions were carried out with pooled family-specific framework primers and the same mouse 3′ immunoglobulin constant-specific primer used in the primary reaction. Aliquots (5 μL) from each reaction were analyzed by agarose electrophoresis and reaction products were purified from agarose using a MONTAGE™ Gel Extraction Kit (Millipore). Purified products were cloned using the TOPO™ TA Cloning System (Invitrogen) and transformed into DH10β E. coli cells by electroporation. Individual clones were selected from each transformation reaction and grown in 2 mL LB broth cultures with antibiotic selection overnight at 37° C. Plasmid DNA was purified from bacterial cultures by a kit-based approach (Qiagen).
[0268] Immunoglobulin Variable Gene Usage.
[0269] Plasmid DNA of both heavy chain and κ light chain clones were sequenced with either T7 or M13 reverse primers on the ABI 3100 Genetic Analyzer (Applied Biosystems). Raw sequence data were imported into SEQUENCHER™ (v4.5, Gene Codes). Each sequence was assembled into contigs and aligned to human immunoglobulin sequences using IMGT V-Quest (Brochet, X. et al. (2008) IMGT/V-QUEST: the highly customized and integrated system for IG and TR standardized V-J and V-D-J sequence analysis. Nucleic Acids Res 36:W503-508) search function to identify human V.sub.H, D.sub.H, J.sub.H and Vκ, Jκ segment usage. Sequences were compared to germline sequences for somatic hypermutation and recombination junction analysis.
[0270] Mice were generated from ES cells containing the initial heavy chain modification (3 hV.sub.H-CRE Hybrid Allele, bottom of
[0271] In a similar experiment, B cells from non-immunized wild type and VELOCIMMUNE® humanized mice were separated by flow cytometry based upon surface expression of B220 and IgM or IgG. The B220.sup.+ IgM.sup.+ or surface IgG.sup.+ (sIgG.sup.+) cells were pooled and V.sub.H and Vκ sequences were obtained following RT-PCR amplification and cloning (described above). Representative gene usage in a set of RT-PCR amplified cDNAs from unimmunized VELOCIMMUNE® 1 humanized mice (Table 7) and VELOCIMMUNE® 3 humanized mice (Table 8) was recorded (*defective RSS; †missing or pseudogene).
TABLE-US-00007 TABLE 7 Observed V.sub.H 1-18 3 1-17P 0 3-16* 0 3-15 13 3-13 9 3-11 6 3-9 8 1-8 6 3-7 2 2-5 2 1-3 0 1-2 11 6-1 5 J.sub.H 1 2 2 1 3 8 4 33 5 5 6 16 D.sub.H 1-1 1 2-2 2 3-3 4 4-4 0 5-5 0 5-18 4 6-6 5 1-7 7 2-8 0 3-9 4 3-10 2 4-11 1 5-12 1 6-13 3 1-14 0 2-15 0 3-16 1 4-17 0 6-19 2 1-20 2 2-21 1 3-22 0 4-23 2 5-24 1 6-25 1 1-26 6 7-27 10 Vκ 1-16 2 3-15 1 1-12 5 3-11 1 1-9 5 1-8 2 3-7* 0 1-6 5 1-5 8 5-2 6 4-1 8 Jκ 1 12 2 10 3 5 4 10 5 0
TABLE-US-00008 TABLE 8 Observed V.sub.H 7-81† 0 3-74† 0 3-73 1 3-72 2 2-70 2 1-69 3 3-66 1 3-64 1 4-61 1 4-59 10 1-58 0 3-53 0 5-51 5 3-49 2 3-48 7 1-46 1 1-45 0 3-43 10 4-39 4 3-38* 0 3-35* 0 4-34 8 3-33 14 4-31 4 3-30 13 4-28 0 2-26 0 1-24 3 3-23 18 3-21 0 3-20 0 1-18 4 1-17P 1 3-16* 0 3-15 13 3-13 6 3-11 5 3-9 31 1-8 7 3-7 11 2-5 1 1-3 0 1-2 6 6-1 9 D.sub.H 1-1 7 2-2 8 3-3 9 4-4 4 5-5 6 5-18 6 6-6 29 1-7 30 2-8 4 3-9 8 3-10 10 4-11 4 5-12 5 6-13 17 1-14 2 2-15 3 3-16 4 4-17 3 6-19 8 1-20 3 2-21 1 3-22 5 4-23 2 5-24 2 6-25 2 1-26 17 7-27 7 J.sub.H 1 2 2 8 3 26 4 95 5 11 6 58 Vκ 2-40 1 1-39 34 1-37 2 1-33 35 2-30 8 2-29 2 2-28 7 1-27 5 2-24 7 6-21* 3 3-20 10 1-17 13 1-16 10 3-15 13 1-12 13 3-11 13 1-9 11 1-8 1 3-7* 0 1-6 6 1-5 7 5-2 0 4-1 21 Jκ 1 50 2 37 3 28 4 64 5 22
[0272] As shown in Tables 7 and 8, nearly all of the functional human V.sub.H, D.sub.H, J.sub.H, Vκ and Jκ gene segments are utilized. Of the functional variable gene segments described but not detected in the VELOCIMMUNE® humanized mice of this experiment, several have been reported to possess defective recombination signal sequences (RSS) and, thus, would not be expected to be expressed (Feeney, A. J. (2000) Factors that influence formation of B cell repertoire. Immunol Res 21:195-202). Analysis of several other sets of immunoglobulin sequences from various VELOCIMMUNE® humanized mice, isolated from both naïve and immunized repertoires, has shown usage of these gene segments, albeit at lower frequencies (data not shown). Aggregate gene usage data has shown that all functional human V.sub.H, D.sub.H, Vκ, and Jκ gene segments contained in VELOCIMMUNE® humanized mice have been observed in various naïve and immunized repertoires (data not shown). Although the human V.sub.H7-81 gene segment has been identified in the analysis of human heavy chain locus sequences (Matsuda, F. et al. (1998) The complete nucleotide sequence of the human immunoglobulin heavy chain variable region locus, J Exp Med 188:2151-2162), it is not present in the VELOCIMMUNE® humanized mice as confirmed by re-sequencing of the entire VELOCIMMUNE® 3 humanized mouse genome.
[0273] Sequences of heavy and light chains of antibodies are known to show exceptional variability, especially in short polypeptide segments within the rearranged variable domain. These regions, known as hypervariable regions or complementary determining regions (CDRs) create the binding site for antigen in the structure of the antibody molecule. The intervening polypeptide sequences are called framework regions (FRs). There are three CDRs (CDR1, CDR2, CDR3) and 4 FRs (FR1, FR2, FR3, FR4) in both heavy and light chains. One CDR, CDR3, is unique in that this CDR is created by recombination of both the V.sub.H, D.sub.H and J.sub.H and Vκ and Jκ gene segments and generates a significant amount of repertoire diversity before antigen is encountered. This joining is imprecise due to both nucleotide deletions via exonuclease activity and non-template encoded additions via terminal deoxynucleotidyl transferase (TdT) and, thus, allows for novel sequences to result from the recombination process. Although FRs can show substantial somatic mutation due to the high mutability of the variable region as a whole, variability is not, however, distributed evenly across the variable region. CDRs are concentrated and localized regions of high variability in the surface of the antibody molecule that allow for antigen binding. Heavy chain and light chain sequences of selected antibodies from VELOCIMMUNE® humanized mice around the CDR3 junction demonstrating junctional diversity are shown in
[0274] As shown in
[0275] Somatic Hypermutation.
[0276] Additional diversity is added to the variable regions of rearranged immunoglobulin genes during the germinal center reaction by a process termed somatic hypermutation. B cells expressing somatically mutated variable regions compete with other B cells for access to antigen presented by the follicular dendritic cells. Those B cells with higher affinity for the antigen will further expand and undergo class switching before exiting to the periphery. Thus, B cells expressing switched isotypes typically have encountered antigen and undergone germinal center reactions and will have increased numbers of mutations relative to naïve B cells. Further, variable region sequences from predominantly naïve sIgM.sup.+ B cells would be expected to have relatively fewer mutations than variable sequences from sIgG.sup.+ B cells which have undergone antigen selection.
[0277] Sequences from random V.sub.H or Vκ clones from sIgM.sup.+ or sIgG.sup.+ B cells from non-immunized VELOCIMMUNE® humanized mice or sIgG.sup.+ B cells from immunized mice were compared with their germline variable gene segments and changes relative to the germline sequence annotated. The resulting nucleotide sequences were translated in silico and mutations leading to amino acid changes also annotated. The data were collated from all the variable regions and the percent change at a given position was calculated (
[0278] As shown in
[0279] The gene usage and somatic hypermutation observed in VELOCIMMUNE® humanized mice demonstrate that essentially all gene segments present are capable of rearrangement to form fully functionally reverse chimeric antibodies in these mice. Further, VELOCIMMUNE® humanized mouse derived antibodies fully participate within the mouse immune system to undergo affinity selection and maturation to create fully mature human antibodies that can effectively neutralize their target antigen. VELOCIMMUNE® humanized mice are able to mount robust immune responses to multiple classes of antigens that result in usage of a wide range of human antibodies that are both high affinity and suitable for therapeutic use (data not shown).
Example V
Analysis of Lymphoid Structure and Serum Isotypes
[0280] The gross structures of spleen, inguinal lymph nodes, Peyer's patches and thymus of tissue samples from wild type or VELOCIMMUNE® humanized mice stained with H&E were examined by light microscopy. The levels of immunoglobulin isotypes in serum collected from wild-type and VELOCIMMUNE® humanized mice were analyzed using LUMINEX™ technology.
[0281] Lymphoid Organ Structure.
[0282] The structure and function of the lymphoid tissues are in part dependent upon the proper development of hematopoietic cells. A defect in B cell development or function may be exhibited as an alteration in the structure of the lymphoid tissues. Upon analysis of stained tissue sections, no significant difference in appearance of secondary lymphoid organs between wild type and VELOCIMMUNE® humanized mice was identified (data not shown).
[0283] Serum Immunoglobulin Levels.
[0284] The level of expression of each isotype is similar in wild type and VELOCIMMUNE® humanized mice (
Example VI
Immunization and Antibody Production in Humanized Immunoglobulin Mice
[0285] Different versions of VELOCIMMUNE® humanized mice were immunized with antigen to examine the humoral response to foreign antigen challenge.
[0286] Immunization and Hybridoma Development.
[0287] VELOCIMMUNE® humanized and wild-type mice can be immunized with an antigen in the form of protein, DNA, a combination of DNA and protein, or cells expressing the antigen. Animals are typically boosted every three weeks for a total of two to three times. Following each antigen boost, serum samples from each animal are collected and analyzed for antigen-specific antibody responses by serum titer determination. Prior to fusion, mice received a final pre-fusion boost of 5 pg protein or DNA, as desired, via intra-peritoneal and/or intravenous injections. Splenocytes are harvested and fused to Ag8.653 myeloma cells in an electrofusion chamber according to the manufacture's suggested protocol (Cyto Pulse Sciences Inc., Glen Burnie, Md.). Ten days after culture, hybridomas are screened for antigen specificity using an ELISA assay (Harlow, E. and Lane, D. (1988) Antibodies: A Laboratory Manual. Cold Spring Harbor Press, New York). Alternatively, antigen specific B cells are isolated directly from immunized VELOCIMMUNE® humanized mice and screened using standard techniques, including those described here, to obtain human antibodies specific for an antigen of interest.
[0288] Serum Titer Determination.
[0289] To monitor animal anti-antigen serum response, serum samples are collected about 10 days after each boost and the titers are determined using antigen specific ELISA. Briefly, Nunc MAXISORP™ 96 well plates are coated with 2 μg/mL antigen overnight at 4° C. and blocked with bovine serum albumin (Sigma, St. Louis, Mo.). Serum samples in a serial 3 fold dilutions are allowed to bind to the plates for one hour at room temperature. The plates are then washed with PBS containing 0.05% Tween-20 and the bound IgG are detected using HRP-conjugated goat anti-mouse Fc (Jackson Immuno Research Laboratories, Inc., West Grove, Pa.) for total IgG titer, or biotin-labeled isotype specific or light chain specific polyclonal antibodies (SouthernBiotech Inc.) for isotype specific titers, respectively. For biotin-labeled antibodies, following plate wash, HRP-conjugated streptavidin (Pierce, Rockford, Ill.) is added. All plates are developed using colorimetric substrates such as BD OPTEIA™ (BD Biosciences Pharmingen, San Diego, Calif.). After the reaction is stopped with 1 M phosphoric acid, optical absorptions at 450 nm are recorded and the data are analyzed using PRISM™ software from Graph Pad. Dilutions required to obtain two-fold of background signal are defined as titer.
[0290] In one experiment, VELOCIMMUNE® humanized mice were immunized with human interleukin-6 receptor (hIL-6R). A representative set of serum titers for VELOCIMMUNE® and wild type mice immunized with hIL-6R is shown in
[0291] VELOCIMMUNE® humanized and wild-type mice mounted strong responses towards the IL-6R with similar titer ranges (
[0292] Affinity Determination of Antibody Binding to Antigen in Solution.
[0293] An ELISA-based solution competition assay is typically designed to determine antibody-binding affinity to the antigen.
[0294] Briefly, antibodies in conditioned medium are premixed with serial dilutions of antigen protein ranging from 0 to 10 mg/mL. The solutions of the antibody and antigen mixture are then incubated for two to four hours at room temperature to reach binding equilibria. The amounts of free antibody in the mixtures are then measured using a quantitative sandwich ELISA. Ninety-six well MAXISORB™ plates (VWR, West Chester, Pa.) are coated with 1 μg/mL antigen protein in PBS solution overnight at 4° C. followed by BSA nonspecific blocking. The antibody-antigen mixture solutions are then transferred to these plates followed by one-hour incubation. The plates are then washed with washing buffer and the plate-bound antibodies were detected with an HRP-conjugated goat anti-mouse IgG polyclonal antibody reagent (Jackson Immuno Research Lab) and developed using colorimetric substrates such as BD OPTEIA™ (BD Biosciences Pharmingen, San Diego, Calif.). After the reaction is stopped with 1 M phosphoric acid, optical absorptions at 450 nm are recorded and the data are analyzed using PRISM™ software from Graph Pad. The dependency of the signals on the concentrations of antigen in solution are analyzed with a 4 parameter fit analysis and reported as IC.sub.50, the antigen concentration required to achieve 50% reduction of the signal from the antibody samples without the presence of antigen in solution.
[0295] In one experiment, VELOCIMMUNE® humanized mice were immunized with hIL-6R (as described above).
[0296] After immunized mice receive a third antigen boost, serum titers are determined by ELISA. Splenocytes are isolated from selected wild type and VELOCIMMUNE® humanized mouse cohorts and fused with Ag8.653 myeloma cells to form hybridomas and grown under selection (as described above). Out of a total of 671 anti-IL-6R hybridomas produced, 236 were found to express antigen-specific antibodies. Media harvested from antigen positive wells was used to determine the antibody affinity of binding to antigen using a solution competition ELISA. Antibodies derived from VELOCIMMUNE® humanized mice exhibit a wide range of affinity in binding to antigen in solution (
Example VII
Construction of a Mouse ADAM6 Targeting Vector
[0297] A targeting vector for insertion of mouse ADAM6a and ADAM6b genes into a humanized heavy chain locus was constructed using VELOCIGENE® genetic engineering technology (supra) to modify a Bacterial Artificial Chromosome (BAC) 929d24 obtained from Dr. Fred Alt (Havard University). 929d24 BAC DNA was engineered to contain genomic fragments containing the mouse ADAM6a and ADAM6b genes and a hygromycin cassette for targeted deletion of a human ADAMS pseudogene (hADAM6ψ) located between human V.sub.H1-2 and V.sub.H6-1 gene segments of a humanized heavy chain locus (
[0298] First, a genomic fragment containing the mouse ADAM6b gene, ˜800 bp of upstream (5′) sequence and ˜4800 bp of downstream (3′) sequence was subcloned from the 929d24 BAC clone. A second genomic fragment containing the mouse ADAM6a gene, ˜300 bp of upstream (5′) sequence and ˜3400 bp of downstream (3′) sequence, was separately subcloned from the 929d24 BAC clone. The two genomic fragments containing the mouse ADAM6b and ADAM6a genes were ligated to a hygromycin cassette flanked by Frt recombination sites to create the targeting vector (Mouse ADAM6 Targeting Vector,
[0299] A separate modification was made to a BAC clone containing a replacement of the mouse heavy chain locus with the human heavy chain locus, including the human ADAM6 pseudogene located between the human V.sub.H1-2 and V.sub.H6-1 gene segments of the humanized locus for the subsequent ligation of the mouse ADAM6 targeting vector (
[0300] Briefly, a neomycin cassette flanked by IoxP recombination sites was engineered to contain homology arms containing human genomic sequence at positions 3′ of the human V.sub.H1-2 gene segment (5′ with respect to hADAM6ψ) and 5′ of human V.sub.H6-1 gene segment (3′ with respect to hADAM6ψ; see middle of
[0301] Following digestion of BAC DNA derived from both constructs, the genomic fragments were ligated together to construct an engineered BAC clone containing a humanized heavy chain locus containing an ectopically placed genomic sequence comprising mouse ADAM6a and ADAM6b nucleotide sequences. The final targeting construct for the deletion of a human ADAM6 gene within a humanized heavy chain locus and insertion of mouse ADAM6a and ADAM6b sequences in ES cells contained, from 5′ to 3′, a 5′ genomic fragment containing ˜13 kb of human genomic sequence 3′ of the human V.sub.H1-2 gene segment, ˜800 bp of mouse genomic sequence downstream of the mouse ADAM6b gene, the mouse ADAM6b gene, ˜4800 bp of genomic sequence upstream of the mouse ADAM6b gene, a 5′ Frt site, a hygromycin cassette, a 3′ Frt site, ˜300 bp of mouse genomic sequence downstream of the mouse ADAM6a gene, the mouse ADAM6a gene, ˜3400 bp of mouse genomic sequence upstream of the mouse ADAM6a gene, and a 3′ genomic fragment containing ˜30 kb of human genomic sequence 5′ of the human V.sub.H6-1 gene segment (bottom of
[0302] The engineered BAC clone (described above) was used to electroporate mouse ES cells that contained a humanized heavy chain locus to created modified ES cells comprising a mouse genomic sequence ectopically placed that comprises mouse ADAM6a and ADAM6b sequences within a humanized heavy chain locus. Positive ES cells containing the ectopic mouse genomic fragment within the humanized heavy chain locus were identified by a quantitative PCR assay using TAQMAN™ probes (Lie, Y. S. and Petropoulos, C. J. (1998) Advances in quantitative PCR technology: 5′nuclease assays. Curr Opin Biotechnol 9(1):43-48). The upstream and downstream regions outside of the modified portion of the humanized heavy chain locus were confirmed by PCR using primers and probes located within the modified region to confirm the presence of the ectopic mouse genomic sequence within the humanized heavy chain locus as well as the hygromycin cassette. The nucleotide sequence across the upstream insertion point included the following, which indicates human heavy chain genomic sequence upstream of the insertion point and an I-Ceu I restriction site (contained within the parentheses below) linked contiguously to mouse genomic sequence present at the insertion point: (CCAGCTTCAT TAGTAATCGT TCATCTGTGG TAAAAAGGCA GGATTTGAAG CGATGGAAGA TGGGAGTACG GGGCGTTGGA AGACAAAGTG CCACACAGCG CAGCCTTCGT CTAGACCCCC GGGCTAACTA TAACGGTCCT AAGGTAGCGA G) GGGATGACAG ATTCTCTGTT CAGTGCACTC AGGGTCTGCC TCCACGAGAA TCACCATGCC CTTTCTCAAG ACTGTGTTCT GTGCAGTGCC CTGTCAGTGG (SEQ ID NO:4). The nucleotide sequence across the downstream insertion point at the 3′ end of the targeted region included the following, which indicates mouse genomic sequence and a PI-Sce I restriction site (contained within the parentheses below) linked contiguously with human heavy chain genomic sequence downstream of the insertion point: (AGGGGTCGAG GGGGAATTTT ACAAAGAACA AAGAAGCGGG CATCTGCTGA CATGAGGGCC GAAGTCAGGC TCCAGGCAGC GGGAGCTCCA CCGCGGTGGC GCCATTTCAT TACCTCTTTC TCCGCACCCG ACATAGATAAAGCTT) ATCCCCCACC AAGCAAATCC CCCTACCTGG GGCCGAGCTT CCCGTATGTG GGAAAATGAA TCCCTGAGGT CGATTGCTGC ATGCAATGAA ATTCAACTAG (SEQ ID NO:5).
[0303] Targeted ES cells described above were used as donor ES cells and introduced into an 8-cell stage mouse embryo by the VELOCIMOUSE® mouse engineering method (see, e.g., U.S. Pat. Nos. 7,659,842, 7,576,259, 7,294,754). Mice bearing a humanized heavy chain locus containing an ectopic mouse genomic sequence comprising mouse ADAM6a and ADAM6b sequences were identified by genotyping using a modification of allele assay (Valenzuela et al., 2003) that detected the presence of the mouse ADAM6a and ADAM6b genes within the humanized heavy chain locus.
[0304] Mice bearing a humanized heavy chain locus that contains mouse ADAM6a and ADAM6b genes are bred to a FLPe deletor mouse strain (see, e.g., Rodriguez, C. I. et al. (2000) High-efficiency deletor mice show that FLPe is an alternative to Cre-IoxP. Nature Genetics 25:139-140) in order to remove any FRTed hygromycin cassette introduced by the targeting vector that is not removed, e.g., at the ES cell stage or in the embryo. Optionally, the hygromycin cassette is retained in the mice.
[0305] Pups are genotyped and a pup heterozygous for a humanized heavy chain locus containing an ectopic mouse genomic fragment that comprises mouse ADAM6a and ADAM6b sequences is selected for characterizing mouse ADAM6 gene expression and fertility.
Example VIII
Characterization of ADAM6 Rescue Mice
[0306] Flow Cytometry.
[0307] Three mice at age 25 weeks homozygous for human heavy and human κ light chain variable gene loci (H/κ) and three mice at age 18-20 weeks homozygous for human heavy and human κ light chain having the ectopic mouse genomic fragment encoding the mouse ADAM6a and ADAM6b genes within both alleles of the human heavy chain locus (H/κ-A6) were sacrificed for identification and analysis of lymphocyte cell populations by FACs on the BD LSR II System (BD Bioscience). Lymphocytes were gated for specific cell lineages and analyzed for progression through various stages of B cell development. Tissues collected from the animals included blood, spleen and bone marrow. Blood was collected into BD microtainer tubes with EDTA (BD Biosciences). Bone marrow was collected from femurs by flushing with complete RPMI medium supplemented with fetal calf serum, sodium pyruvate, HEPES, 2-mercaptoethanol, non-essential amino acids, and gentamycin. Red blood cells from blood, spleen and bone marrow preparations were lysed with an ammonium chloride-based lysis buffer (e.g., ACK lysis buffer), followed by washing with complete RPMI medium.
[0308] For staining of cell populations, 1×10.sup.6 cells from the various tissue sources were incubated with anti-mouse CD16/CD32 (2.4G2, BD Biosciences) on ice for 10 minutes, followed by labeling with one or a combination of the following antibody cocktails for 30 min on ice.
[0309] Bone marrow: anti-mouse FITC-CD43 (1B11, BioLegend), PE-ckit (268, BioLegend), PeCy7-IgM (II/41, eBioscience), PerCP-Cy5.5-IgD (11-26c.2a, BioLegend), APC-eFluor780-B220 (RA3-682, eBioscience), A700-CD19 (1D3, BD Biosciences).
[0310] Peripheral blood and spleen: anti-mouse FITC-κ (187.1, BD Biosciences), PE-λ (RML-42, BioLegend), PeCy7-IgM (11141, eBioscience), PerCP-Cy5.5-IgD (11-26c.2a, BioLegend), APC-CD3 (145-2C11, BD), A700-CD19 (1D3, BD), APC-eFluor780-B220 (RA3-6B2, eBioscience). Following incubation with the labeled antibodies, cells were washed and fixed in 2% formaldehyde. Data acquisition was performed on an LSRII flow cytometer and analyzed with FlowJo. Results from a representative H/κ and H/κ-A6 mouse are shown in
[0311] The results demonstrate that B cells of H/κ-A6 mice progress through the stages of B cell development in a similar fashion to H/κ mice in the bone marrow and peripheral compartments, and show normal patterns of maturation once they enter the periphery. H/κ-A6 mice demonstrated an increased CD43.sup.intCD19.sup.+ cell population as compared to H/κ mice (
[0312] Testis Morphology and Sperm Characterization.
[0313] To determine if infertility in mice having humanized immunoglobulin heavy chain variable loci is due to testis and/or sperm production defects, testis morphology and sperm content of the epididymis was examined.
[0314] Briefly, testes from two groups of five mice per group (Group 1: mice homozygous for human heavy and κ light chain variable gene loci, mADAM6.sup.−/−; Group 2: mice heterozygous for human heavy chain variable gene loci and homozygous for κ light chain variable gene loci, mADAM6.sup.+/−) were dissected with the epididymis intact and weighed. The specimens were then fixed, embedded in paraffin, sectioned and stained with hematoxylin and eosin (HE) stain. Testis sections (2 testes per mouse, for a total of 20) were examined for defects in morphology and evidence of sperm production, while epididymis sections were examined for presence of sperm.
[0315] In this experiment, no differences in testis weight or morphology was observed between mADAM6.sup.−/− mice and mADAM6.sup.+/− mice. Sperm was observed in all genotypes, both in the testes and the epididymis. These results establish that the absence of mouse ADAM6a and ADAM6b genes does not lead to detectable changes in testis morphology, and that sperm is produced in mice in the presence and absence of these two genes. Defects in fertility of male ADAM6.sup.−/− mice are therefore not likely to be due to low sperm production.
[0316] Sperm Motility and Migration.
[0317] Mice that lack other ADAM gene family members are infertile due to defects in sperm motility or migration. Sperm migration is defined as the ability of sperm to pass from the uterus into the oviduct, and is normally necessary for fertilization in mice. To determine if the deletion of mouse ADAM6a and ADAM6b affects this process, sperm migration was evaluated in mADAM6.sup.−/− mice. Sperm motility was also examined.
[0318] Briefly, sperm was obtained from testes of (1) mice heterozygous for human heavy chain variable gene loci and homozygous for human κ light chain variable gene locui (ADAM6.sup.+/−); (2) mice homozyogous for human heavy chain variable gene loci and homozygous for human κ light chain variable gene loci (ADAM6.sup.−/−); (3) mice homozygous for human heavy chain variable gene loci and homozygous for wild-type κ light chain (ADAM6.sup.−/−mκ); and, (4) wild-type C57 BL/6 mice (WT). No significant abnormalities were observed in sperm count or overall sperm motility by inspection. For all mice, cumulus dispersal was observed, indicating that each sperm sample was able to penetrate the cumulus cells and bind the zona pellucida in vitro. These results establish that ADAM6.sup.−/− mice have sperm that are capable of penetrating the cumulus and binding the zona pellucida.
[0319] Fertilization of mouse ova in vitro (IVF) was done using sperm from mice as described above. A slightly lower number of cleaved embryos were present for ADAM6.sup.−/− the day following IVF, as well as a reduced number of sperm bound to the eggs. These results establish that sperm from ADAM6.sup.−/− mice, once exposed to an ovum, are capable of penetrating the cumulus and binding the zona pellucida.
[0320] In another experiment, the ability of sperm from ADAM6.sup.−/− mice to migrate from the uterus and through the oviduct was determined in a sperm migration assay.
[0321] Briefly, a first group of five superovulated female mice were set up with five ADAM6.sup.−/− males. A second group of five superovulated female mice were set up with five ADAM6.sup.+/− males. The mating pairs were observed for copulation, and five to six hours post-copulation the uterus and attached oviduct from all females were removed and flushed for analysis. Flush solutions were checked for eggs to verify ovulation and obtain a sperm count. Sperm migration was evaluated in two different ways. First, both oviducts were removed from the uterus, flushed with saline, and any sperm identified were counted. The presence of eggs was also noted as evidence of ovulation. Second, oviducts were left attached to the uterus and both tissues were fixed, embedded in paraffin, sectioned and stained (as described above). Sections were examined for presence of sperm, in both the uterus and in both oviducts.
[0322] For the five females mated with the five ADAM6.sup.−/− males, very little sperm was found in the flush solution from the oviduct. Flush solutions from oviducts of the five females mated with the five ADAM6.sup.+/− males exhibited a sperm level about 25- to 30-fold higher (avg, n=10 oviducts) than present in flush solutions from the oviducts of the five females mated with the five ADAM6.sup.−/− males.
[0323] Histological sections of uterus and oviduct were prepared. The sections were examined for sperm presence in the uterus and the oviduct (the Colliculus tubarius). Inspection of histological sections of oviduct and uterus revealed that for female mice mated with ADAM6.sup.−/− mice, sperm was found in the uterus but not in the oviduct. Further, sections from females mated with ADAM6.sup.−/− mice revealed that sperm was not found at the uterotubal junction (UTJ). In sections from females mated with ADAM6.sup.+/− mice, sperm was identified in the UTJ and in the oviduct.
[0324] These results establish that mice lacking ADAM6a and ADAM6b genes make sperm that exhibit an in viva migration defect. In all cases, sperm was observed within the uterus, indicating that copulation and sperm release apparently occur as normal, but little to no sperm was observed within the oviducts after copulation as measured either by sperm count or histological observation. These results establish that mice lacking ADAM6a and ADAM6b genes produce sperm that exhibit an inability to migrate from the uterus to the oviduct. This defect apparently leads to infertility because sperm are unable to cross the uterine-tubule junction into the oviduct, where eggs are fertilized. Taken together, all of these results converge to the support the hypothesis that mouse ADAM6 genes help direct sperm with normal motility to migrate out of the uterus, through the uterotubal junction and the oviduct, and thus approach an egg to achieve the fertilization event. The mechanism by which ADAM6 achieves this may be directly by action of the ADAM6 proteins, or through coordinate expression with other proteins, e.g., other ADAM proteins, in the sperm cell, as described below.
[0325] ADAM Gene Family Expression.
[0326] A complex of ADAM proteins are known to be present as a complex on the surface of maturing sperm. Mice lacking other ADAM gene family members lose this complex as sperm mature, and exhibit a reduction of multiple ADAM proteins in mature sperm. To determine if a lack of ADAM6a and ADAM6b genes affects other ADAM proteins in a similar manner, Western blots of protein extracts from testis (immature sperm) and epididymis (maturing sperm) were analyzed to determine the expression levels of other ADAM gene family members.
[0327] In this experiment, protein extracts were analyzed from four ADAM6.sup.−/− and four ADAM6.sup.+/− mice. The results showed that expression of ADAM2 and ADAM3 were not affected in testis extracts. However, both ADAM2 and ADAM3 were dramatically reduced in epididymis extracts. This demonstrates that the absence of ADAM6a and ADAM6b in sperm of ADAM6.sup.−/− mice may have a direct affect on the expression and perhaps function of other ADAM proteins as sperm matures (e.g., ADAM2 and ADAM3). This suggests that ADAM6a and ADAM6b are part of an ADAM protein complex on the surface of sperm, which might be critical for proper sperm migration.
Example IX
Human Heavy Chain Variable Gene Usage in ADAM6 Rescue Mice
[0328] Selected human heavy chain variable gene usage was determined for mice homozygous for human heavy and κ light chain variable gene loci either lacking mouse ADAM6a and ADAM6b genes (mADAM6.sup.−/−) or containing an ectopic genomic fragment encoding for mouse ADAM6a and ADAM6b genes (ADAM6.sup.+/+; see Example 1) by a quantitative PCR assay using TAQMAN™ probes (as described above).
[0329] Briefly, CD19.sup.+ B cells were purified from the spleens of mADAM6.sup.−/− and ADAM6.sup.+/+ mice using mouse CD19 Microbeads (Miltenyi Biotec) and total RNA was purified using the RNEASY™ Mini kit (Qiagen). Genomic RNA was removed using a RNase-free DNase on-column treatment (Qiagen). About 200 ng mRNA was reverse-transcribed into cDNA using the First Stand cDNA Synthesis kit (Invitrogen) and then amplified with the TAQMAN™ Universal PCR Master Mix (Applied Biosystems) using the ABI 7900 Sequence Detection System (Applied Biosystems). Relative expression of each gene was normalized to the mouse κ Constant (mCκ). Table 9 sets forth the sense/antisense/TAQMAN™ MGB probe combinations used in this experiment.
TABLE-US-00009 TABLE 9 SEQ Human ID V.sub.H Sequence (5′-3′) NOs: V.sub.H6-1 Sense: 6 CAGGTACAGCTGCAGCAGTCA Anti-sense: 7 GGAGATGGCACAGGTGAGTGA Probe: 8 TCCAGGACTGGTGAAGC V.sub.H1-2 Sense: 9 TAGTCCCAGTGATGAGAAAGAGAT Anti-sense: 10 GAGAACACAGAAGTGGATGAGATC Probe: 11 TGAGTCCAGTCCAGGGA V.sub.H3-23 Sense: 12 AAAAATTGAGTGTGAATGGATAAGAGTG Anti-sense: 13 AACCCTGGTCAGAAACTGCCA Probe: 14 AGAGAAACAGTGGATACGT V.sub.H1-69 Sense: 15 AACTACGCACAGAAGTTCCAGG Anti-sense: 16 GCTCGTGGATTTGTCCGC Probe: 17 CAGAGTCACGATTACC mCκ Sense: 18 TGAGCAGCACCCTCACGTT Anti-sense: 19 GTGGCCTCACAGGTATAGCTGTT Probe: 20 ACCAAGGACGAGTATGAA
[0330] In this experiment, expression of all four human V.sub.H genes was observed in the samples analyzed. Further, the expression levels were comparable between mADAM6.sup.−/− and ADAM6.sup.+/+ mice. These results demonstrate that human V.sub.H genes that were both distal to the modification site (V.sub.H3-23 and V.sub.H1-69) and proximal to the modification site (V.sub.H1-2 and V.sub.H6-1) were all able to recombine to form a functionally expressed human heavy chain. These results demonstrate that the ectopic genomic fragment comprising mouse ADAM6a and ADAM6b sequences inserted into a human heavy chain genomic sequence did not affect V(D)J recombination of human heavy chain gene segments within the locus, and these mice are able to recombine human heavy chain gene segments in normal fashion to produce functional heavy chain immunoglobulin proteins.
Example X
Identification of Human Heavy Chain Variable Regions That Associate with Selected Human Light Chain Variable Regions
[0331] An in vitro expression system was constructed to determine if a single rearranged human germline light chain could be co-expressed with human heavy chains from antigen-specific human antibodies.
[0332] Methods for generating human antibodies in genetically modified mice are known (see e.g., U.S. Pat. No. 6,596,541, Regeneron Pharmaceuticals, VELOCIMMUNE® humanized mouse). The VELOCIMMUNE® humanized mouse technology involves generation of a genetically modified mouse having a genome comprising human heavy and light chain variable regions operably linked to endogenous mouse constant region loci such that the mouse produces an antibody comprising a human variable region and a mouse constant region in response to antigenic stimulation. The DNA encoding the variable regions of the heavy and light chains of the antibodies produced from a VELOCIMMUNE® humanized mouse are fully human. Initially, high affinity chimeric antibodies are isolated having a human variable region and a mouse constant region. As described below, the antibodies are characterized and selected for desirable characteristics, including affinity, selectivity, epitope, etc. The mouse constant regions are replaced with a desired human constant region to generate a fully human antibody containing a non-IgM isotype, for example, wild type or modified IgG1, IgG2, IgG3 or IgG4. While the constant region selected may vary according to specific use, high affinity antigen-binding and target specificity characteristics reside in the variable region.
[0333] A VELOCIMMUNE® humanized mouse was immunized with a growth factor that promotes angiogenesis (Antigen C) and antigen-specific human antibodies were isolated and sequenced for V gene usage using standard techniques recognized in the art. Selected antibodies were cloned onto human heavy and light chain constant regions and 69 heavy chains were selected for pairing with one of three human light chains: (1) the cognate κ light chain linked to a human κ constant region, (2) a rearranged human germline Vκ1-39Jκ5 linked to a human κ constant region, or (3) a rearranged human germline Vκ3-20Jκ1 linked to a human κ constant region. Each heavy chain and light chain pair were co-transfected in CHO-K1 cells using standard techniques. Presence of antibody in the supernatant was detected by anti-human IgG in an ELISA assay. Antibody titer (ng/ml) was determined for each heavy chain/light chain pair and titers with the different rearranged germline light chains were compared to the titers obtained with the parental antibody molecule (i.e., heavy chain paired with cognate light chain) and percent of native titer was calculated (Table 10). V.sub.H: Heavy chain variable gene. ND: no expression detected under current experimental conditions.
TABLE-US-00010 TABLE 10 Antibody Titer (ng/mL) Percent of Native Titer V.sub.H Cognate LC Vκ1-39Jκ5 Vκ3-20Jκ1 Vκ1-39Jκ5 Vκ3-20Jκ1 3-15 63 23 11 36.2 17.5 1-2 103 53 ND 51.1 — 3-23 83 60 23 72.0 27.5 3-33 15 77 ND 499.4 — 4-31 22 69 17 309.4 76.7 3-7 53 35 28 65.2 53.1 — 22 32 19 148.8 89.3 1-24 3 13 ND 455.2 — 3-33 1 47 ND 5266.7 — 3-33 58 37 ND 63.1 — — 110 67 18 60.6 16.5 3-23 127 123 21 96.5 16.3 3-33 28 16 2 57.7 7.1 3-23 32 50 38 157.1 119.4 — 18 45 18 254.3 101.7 3-9 1 30 23 2508.3 1900.0 3-11 12 26 6 225.9 48.3 1-8 16 ND 13 — 81.8 3-33 54 81 10 150.7 19.1 — 34 9 ND 25.9 — 3-20 7 14 54 203.0 809.0 3-33 19 38 ND 200.5 — 3-11 48 ND 203 — 423.6 — 11 23 8 212.7 74.5 3-33 168 138 182 82.0 108.2 3-20 117 67 100 57.5 86.1 3-23 86 61 132 70.7 154.1 3-33 20 12 33 60.9 165.3 4-31 69 92 52 133.8 75.0 3-23 87 78 62 89.5 71.2 1-2 31 82 51 263.0 164.6 3-23 53 93 151 175.4 285.4 — 11 8 17 75.7 151.4 3-33 114 36 27 31.6 23.4 3-15 73 39 44 53.7 59.6 3-33 1 34 16 5600.0 2683.3 3-9 58 112 57 192.9 97.6 3-33 67 20 105 30.1 157.0 3-33 34 21 24 62.7 70.4 3-20 10 49 91 478.4 888.2 3-33 66 32 25 48.6 38.2 3-23 17 59 56 342.7 329.8 — 58 108 19 184.4 32.9 — 68 54 20 79.4 29.9 3-33 42 35 32 83.3 75.4 — 29 19 13 67.1 43.9 3-9 24 34 29 137.3 118.4 3-30/33 17 33 7 195.2 43.1 3-7 25 70 74 284.6 301.6 3-33 87 127 ND 145.1 — 6-1 28 56 ND 201.8 — 3-33 56 39 20 69.9 36.1 3-33 10 53 1 520.6 6.9 3-33 20 67 10 337.2 52.3 3-33 11 36 18 316.8 158.4 3-23 12 42 32 356.8 272.9 3-33 66 95 15 143.6 22.5 3-15 55 68 ND 123.1 — — 32 68 3 210.9 10.6 1-8 28 48 ND 170.9 — 3-33 124 192 21 154.3 17.0 3-33 0 113 ND 56550.0 — 3-33 10 157 1 1505.8 12.5 3-33 6 86 15 1385.5 243.5 3-23 70 115 22 163.5 31.0 3-7 71 117 21 164.6 29.6 3-33 82 100 47 122.7 57.1 3-7 124 161 41 130.0 33.5
[0334] In a similar experiment, VELOCIMMUNE® humanized mice were immunized with several different antigens and selected heavy chains of antigen specific human antibodies were tested for their ability to pair with different rearranged human germline light chains (as described above). The antigens used in this experiment included an enzyme involved in cholesterol homeostasis (Antigen A), a serum hormone involved in regulating glucose homeostasis (Antigen B), a growth factor that promotes angiogenesis (Antigen C) and a cell-surface receptor (Antigen D). Antigen specific antibodies were isolated from mice of each immunization group and the heavy chain and light chain variable regions were cloned and sequenced. From the sequence of the heavy and light chains, V gene usage was determined and selected heavy chains were paired with either their cognate light chain or a rearranged human germline Vκ1-39Jκ5 region. Each heavy/light chain pair was co-transfected in CHO-K1 cells and the presence of antibody in the supernatant was detected by anti-human IgG in an ELISA assay. Antibody titer (pg/ml) was determined for each heavy chain/light chain pairing and titers with the different rearranged human germline light chains were compared to the titers obtained with the parental antibody molecule (i.e., heavy chain paired with cognate light chain) and percent of native titer was calculated (Table 11). V.sub.H: Heavy chain variable gene. Vκ: κ light chain variable gene. ND: no expression detected under current experimental conditions.
TABLE-US-00011 TABLE 11 Percent- Titer (μg/ml) of Na- Anti- Anti- V.sub.H V.sub.H + V.sub.H + tive gen body V.sub.H Vκ Alone Vκ Vκ1-39Jκ5 Titer A 320 1-18 2-30 0.3 3.1 2.0 66 321 2-5 2-28 0.4 0.4 1.9 448 334 2-5 2-28 0.4 2.7 2.0 73 313 3-13 3-15 0.5 0.7 4.5 670 316 3-23 4-1 0.3 0.2 4.1 2174 315 3-30 4-1 0.3 0.2 3.2 1327 318 4-59 1-17 0.3 4.6 4.0 86 B 257 3-13 1-5 0.4 3.1 3.2 104 283 3-13 1-5 0.4 5.4 3.7 69 637 3-13 1-5 0.4 4.3 3.0 70 638 3-13 1-5 0.4 4.1 3.3 82 624 3-23 1-17 0.3 5.0 3.9 79 284 3-30 1-17 0.3 4.6 3.4 75 653 3-33 1-17 0.3 4.3 0.3 7 268 4-34 1-27 0.3 5.5 3.8 69 633 4-34 1-27 0.6 6.9 3.0 44 C 730 3-7 1-5 0.3 1.1 2.8 249 728 3-7 1-5 0.3 2.0 3.2 157 691 3-9 3-20 0.3 2.8 3.1 109 749 3-33 3-15 0.3 3.8 2.3 62 750 3-33 1-16 0.3 3.0 2.8 92 724 3-33 1-17 0.3 2.3 3.4 151 706 3-33 1-16 0.3 3.6 3.0 84 744 1-18 1-12 0.4 5.1 3.0 59 696 3-11 1-16 0.4 3.0 2.9 97 685 3-13 3-20 0.3 0.5 3.4 734 732 3-15 1-17 0.3 4.5 3.2 72 694 3-15 1-5 0.4 5.2 2.9 55 743 3-23 1-12 0.3 3.2 0.3 10 742 3-23 2-28 0.4 4.2 3.1 74 693 3-23 1-12 0.5 4.2 4.0 94 D 136 3-23 2-28 0.4 5.0 2.7 55 155 3-30 1-16 0.4 1.0 2.2 221 163 3-30 1-16 0.3 0.6 3.0 506 171 3-30 1-16 0.3 1.0 2.8 295 145 3-43 1-5 0.4 4.4 2.9 65 49 3-48 3-11 0.3 1.7 2.6 155 51 3-48 1-39 0.1 1.9 0.1 4 159 3-7 6-21 0.4 3.9 3.6 92 169 3-7 6-21 0.3 1.3 3.1 235 134 3-9 1-5 0.4 5.0 2.9 58 141 4-31 1-33 2.4 4.2 2.6 63 142 4-31 1-33 0.4 4.2 2.8 67
[0335] The results obtained from these experiments demonstrate that somatically mutated, high affinity heavy chains from different gene families are able to pair with rearranged human germline Vκ1-39Jκ5 and Vκ3-20Jκ1 regions and be secreted from the cell as a normal antibody molecule. As shown in Table 10, antibody titer was increased for about 61% (42 of 69) heavy chains when paired with the rearranged human Vκ1-39Jκ5 light chain and about 29% (20 of 69) heavy chains when paired with the rearranged human Vκ3-20Jκ1 light chain as compared to the cognate light chain of the parental antibody. For about 20% (14 of 69) of the heavy chains, both rearranged human germline light chains conferred an increase in expression as compared to the cognate light chain of the parental antibody. As shown in Table 11, the rearranged human germline Vκ1-39Jκ5 region conferred an increase in expression of several heavy chains specific for a range of different classes of antigens as compared to the cognate light chain for the parental antibodies. Antibody titer was increased by more than two-fold for about 35% (15/43) of the heavy chains as compared to the cognate light chain of the parental antibodies. For two heavy chains (315 and 316), the increase was greater than ten-fold as compared to the parental antibody. Within all the heavy chains that showed increase expression relative to the cognate light chain of the parental antibody, family three (V.sub.H3) heavy chains are over represented in comparison to other heavy chain variable region gene families. This demonstrates a favorable relationship of human V.sub.H3 heavy chains to pair with rearranged human germline Vκ1-39Jκ5 and Vκ3-20Jκ1 light chains.
Example XI
Generation of a Rearranged Human Germline Light Chain Locus
[0336] Various rearranged human germline light chain targeting vectors were made using VELOCIGENE® genetic engineering technology (see, e.g., U.S. Pat. No. 6,586,251 and Valenzuela et al. (2003) High-throughput engineering of the mouse genome coupled with high-resolution expression analysis, Nature Biotech. 21(6):652-659) to modify mouse genomic Bacterial Artificial Chromosome (BAC) clones 302g12 and 254m04 (Invitrogen). Using these two BAC clones, genomic constructs were engineered to contain a single rearranged human germline light chain region and inserted into an endogenous κ light chain locus that was previously modified to delete the endogenous K variable and joining gene segments.
[0337] Construction of Rearranged Human Germline Light Chain Targeting Vectors.
[0338] Three different rearranged human germline light chain regions were made using standard molecular biology techniques recognized in the art. The human variable gene segments used for constructing these three regions included rearranged human Vκ1-39Jκ5 sequence, a rearranged human Vκ3-20Jκ1 sequence and a rearranged human VpreBJI5 sequence.
[0339] A DNA segment containing exon 1 (encoding the leader peptide) and intron 1 of the mouse Vκ3-7 gene was made by de novo DNA synthesis (Integrated DNA Technologies). Part of the 5′ untranslated region up to a naturally occurring BlpI restriction enzyme site was included. Exons of human Vκ1-39 and Vκ3-20 genes were PCR amplified from human genomic BAC libraries. The forward primers had a 5′ extension containing the splice acceptor site of intron 1 of the mouse Vκ3-7 gene. The reverse primer used for PCR of the human Vκ1-39 sequence included an extension encoding human Jκ5, whereas the reverse primer used for PCR of the human Vκ3-20 sequence included an extension encoding human Jκ1. The human VpreBJλ5 sequence was made by de novo DNA synthesis (Integrated DNA Technologies). A portion of the human Jκ-Cκ intron including the splice donor site was PCR amplified from plasmid pBS-296-HA18-PIScel. The forward PCR primer included an extension encoding part of either a human Jκ5, Jκ1, or Jλ5 sequence. The reverse primer included a PI-Scel site, which was previously engineered into the intron.
[0340] The mouse Vκ3-7 exon1/intron 1, human variable light chain exons, and human Jκ-Cκ intron fragments were sewn together by overlap extension PCR, digested with BlpI and PI-Scel, and ligated into plasmid pBS-296-HA18-PIScel, which contained the promoter from the human Vκ3-15 variable gene segment. A loxed hygromycin cassette within plasmid pBS-296-HA18-PIScel was replaced with a FRTed hygromycin cassette flanked by Notl and Ascl sites. The Notl/PI-Scel fragment of this plasmid was ligated into modified mouse BAC 254m04, which contained part of the mouse Jκ-Cκ intron, the mouse Cκ exon, and about 75 kb of genomic sequence downstream of the mouse κ locus which provided a 3′ homology arm for homologous recombination in mouse ES cells. The Notl/Ascl fragment of this BAC was then ligated into modified mouse BAC 302g12, which contained a FRTed neomycin cassette and about 23 kb of genomic sequence upstream of the endogenous κ locus for homologous recombination in mouse ES cells.
[0341] Rearranged Human Germline Vκ1-39Jκ6 Targeting Vector (
[0342] Restriction enzyme sites were introduced at the 5′ and 3′ ends of an engineered light chain insert for cloning into a targeting vector: an Asci site at the 5′ end and a PI-Scel site at the 3′ end. Within the 5′ Ascl site and the 3′ PI-Scel site the targeting construct from 5′ to 3′ included a 5′ homology arm containing sequence 5′ to the endogenous mouse κ light chain locus obtained from mouse BAC clone 302g12, a FRTed neomycin resistance gene, a genomic sequence including the human Vκ3-15 promoter, a leader sequence of the mouse Vκ3-7 variable gene segment, a intron sequence of the mouse Vκ3-7 variable gene segment, an open reading frame of a rearranged human germline Vκ1-39Jκ5 region, a genomic sequence containing a portion of the human Jκ-Cκ intron, and a 3′ homology arm containing sequence 3′ of the endogenous mouse Jκ5 gene segment obtained from mouse BAC clone 254m04 (
[0343] Targeted insertion of the rearranged human germline Vκ1-39Jκ5 region into BAC DNA was confirmed by polymerase chain reaction (PCR) using primers located at sequences within the rearranged human germline light chain region. Briefly, the intron sequence 3′ to the mouse Vκ3-7 leader sequence was confirmed with primers ULC-ml F (AGGTGAGGGT ACAGATAAGT GTTATGAG; SEQ ID NO:60) and ULC-ml R (TGACAAATGC CCTAATTATA GTGATCA; SEQ ID NO:61). The open reading frame of the rearranged human germline Vκ1-39Jκ5 region was confirmed with primers 1633-h2F (GGGCAAGTCA GAGCATTAGC A; SEQ ID NO:62) and 1633-h2R (TGCAAACTGG ATGCAGCATA G; SEQ ID NO:63). The neomycin cassette was confirmed with primers neoF (ggtggagagg ctattcggc; SEQ ID NO:64) and neoR (gaacacggcg gcatcag; SEQ ID NO:65). Targeted BAC DNA was then used to electroporate mouse ES cells to created modified ES cells for generating chimeric mice that express a rearranged human germline Vκ1-39Jκ5 region.
[0344] Positive ES cell clones were confirmed by Taqman™ screening and karyotyping using probes specific for the engineered Vκ1-39Jκ5 light chain region inserted into the endogenous locus. Briefly, probe neoP (TGGGCACAAC AGACAATCGG CTG; SEQ ID NO:66) which binds within the neomycin marker gene, probe ULC-m1P (CCATTATGAT GCTCCATGCC TCTCTGTTC; SEQ ID NO:67) which binds within the intron sequence 3′ to the mouse Vκ3-7 leader sequence, and probe 1633h2P (ATCAGCAGAA ACCAGGGAAA GCCCCT; SEQ ID NO:68) which binds within the rearranged human germline Vκ1-39Jκ5 open reading frame. Positive ES cell clones were then used to implant female mice to give rise to a litter of pups expressing the germline Vκ1-39Jκ5 light chain region.
[0345] Alternatively, ES cells bearing the rearranged human germline Vκ1-39Jκ5 light chain region are transfected with a construct that expresses FLP in order to remove the FRTed neomycin cassette introduced by the targeting construct. Optionally, the neomycin cassette is removed by breeding to mice that express FLP recombinase (e.g., U.S. Pat. No. 6,774,279). Optionally, the neomycin cassette is retained in the mice.
[0346] Rearranged Human Germline Vκ3-20Jκ1 Targeting Vector (
[0347] In a similar fashion, an engineered light chain locus expressing a rearranged human germline Vκ3-20Jκ1 region was made using a targeting construct including, from 5′ to 3′, a 5′ homology arm containing sequence 5′ to the endogenous mouse κ light chain locus obtained from mouse BAC clone 302g12, a FRTed neomycin resistance gene, a genomic sequence including the human Vκ3-15 promoter, a leader sequence of the mouse Vκ3-7 variable gene segment, an intron sequence of the mouse Vκ3-7 variable gene segment, an open reading frame of a rearranged human germline Vκ3-20Jκ1 region, a genomic sequence containing a portion of the human Jκ-Cκ intron, and a 3′ homology arm containing sequence 3′ of the endogenous mouse Jκ5 gene segment obtained from mouse BAC clone 254m04 (
[0348] Targeted insertion of the rearranged human germline Vκ3-20Jκ1 region into BAC DNA was confirmed by polymerase chain reaction (PCR) using primers located at sequences within the rearranged human germline Vκ3-20Jκ1 light chain region. Briefly, the intron sequence 3′ to the mouse Vκ3-7 leader sequence was confirmed with primers ULC-ml F (SEQ ID NO:60) and ULC-m1R (SEQ ID NO:61). The open reading frame of the rearranged human germline Vκ3-20Jκ1 region was confirmed with primers 1635-h2F (TCCAGGCACC CTGTCTTTG; SEQ ID NO:70) and 1635-h2R (AAGTAGCTGC TGCTAACACT CTGACT; SEQ ID NO:71). The neomycin cassette was confirmed with primers neoF (SEQ ID NO:64) and neoR (SEQ ID NO:65). Targeted BAC DNA was then used to electroporate mouse ES cells to created modified ES cells for generating chimeric mice that express the rearranged human germline Vκ3-20Jκ1 light chain.
[0349] Positive ES cell clones were confirmed by Taqman™ screening and karyotyping using probes specific for the engineered Vκ3-20Jκ1 light chain region inserted into the endogenous κ light chain locus. Briefly, probe neoP (SEQ ID NO:66) which binds within the neomycin marker gene, probe ULC-m1P (SEQ ID NO:67) which binds within the mouse Vκ3-7 leader sequence, and probe 1635h2P (AAAGAGCCAC CCTCTCCTGC AGGG; SEQ ID NO:72) which binds within the human Vκ3-20Jκ1 open reading frame. Positive ES cell clones were then used to implant female mice. A litter of pups expressing the human germline Vκ3-20Jκ1 light chain region.
[0350] Alternatively, ES cells bearing human germline Vκ3-20Jκ1 light chain region can be transfected with a construct that expresses FLP in oder to remove the FRTed neomycin cassette introduced by the targeting construct. Optionally, the neomycin cassette may be removed by breeding to mice that express FLP recombinase (e.g., U.S. Pat. No. 6,774,279). Optionally, the neomycin cassette is retained in the mice.
[0351] Rearranged Human Germline VpreBJI5 Targeting Vector (
[0352] In a similar fashion, an engineered light chain locus expressing a rearranged human germline VpreBJI5 region was made using a targeting construct including, from 5′ to 3′, a 5′ homology arm containing sequence 5′ to the endogenous mouse κ light chain locus obtained from mouse BAC clone 302g12, a FRTed neomycin resistance gene, an genomic sequence including the human Vκ3-15 promoter, a leader sequence of the mouse Vκ3-7 variable gene segment, an intron sequence of the mouse Vκ3-7 variable gene segment, an open reading frame of a rearranged human germline VpreBJλ5 region, a genomic sequence containing a portion of the human Jκ-Cκ intron, and a 3′ homology arm containing sequence 3′ of the endogenous mouse Jκ5 gene segment obtained from mouse BAC clone 254m04 (
[0353] Targeted insertion of the rearranged human germline VpreBJλ5 region into BAC DNA was confirmed by polymerase chain reaction (PCR) using primers located at sequences within the rearranged human germline VpreBJλ5 region light chain region. Briefly, the intron sequence 3′ to the mouse Vκ3-7 leader sequence was confirmed with primers ULC-m1F (SEQ ID NO:60 and ULC-m1R (SEQ ID NO:61). The open reading frame of the rearranged human germline VpreBJλ5 region was confirmed with primers 1616-h1F (TGTCCTCGGC CCTTGGA; SEQ ID NO:74) and 1616-h1R (CCGATGTCAT GGTCGTTCCT; SEQ ID NO:75). The neomycin cassette was confirmed with primers neoF (SEQ ID NO:64) and neoR (SEQ ID NO:65). Targeted BAC DNA was then used to electroporate mouse ES cells to created modified ES cells for generating chimeric mice that express the rearranged human germline VpreBJλ0.5 light chain.
[0354] Positive ES cell clones are confirmed by Taqman™ screening and karyotyping using probes specific for the engineered VpreBJλ5 light chain region inserted into the endogenous κ light chain locus. Briefly, probe neoP (SEQ ID NO:66) which binds within the neomycin marker gene, probe ULC-ml P (SEQ ID NO:67) which binds within the mouse IgVκ3-7 leader sequence, and probe 1616h1P (ACAATCCGCC TCACCTGCAC CCT; SEQ ID NO:76) which binds within the human VpreBJλ5 open reading frame. Positive ES cell clones are then used to implant female mice to give rise to a litter of pups expressing a germline light chain region.
[0355] Alternatively, ES cells bearing the rearranged human germline VpreBJI5 light chain region are transfected with a construct that expresses FLP in order to remove the FRTed neomycin cassette introduced by the targeting construct. Optionally, the neomycin cassette is removed by breeding to mice that express FLP recombinase (e.g., U.S. Pat. No. 6,774,279). Optionally, the neomycin cassette is retained in the mice.
Example XII
Generation of Mice Expressing a Single Rearranged Human Light Chain
[0356] Targeted ES cells described above were used as donor ES cells and introduced into an 8-cell stage mouse embryo by the VELOCIMOUSE® method (see, e.g., U.S. Pat. No. 7,294,754 and Poueymirou et al. (2007) F0 generation mice that are essentially fully derived from the donor gene-targeted ES cells allowing immediate phenotypic analyses, Nature Biotech. 25(1):91-99. VELOCIMICE® independently bearing an engineered human germline Vκ1-39Jκ5 light chain region, a Vκ3-20Jκ1 light chain region or a VpreBJλ5 light chain region are identified by genotyping using a modification of allele assay (Valenzuela et al., supra) that detects the presence of the unique rearranged human-germline light chain region.
[0357] Pups are genotyped and a pup heterozygous or homozygous for the unique rearranged human germline light chain region are selected for characterizing expression of the rearranged human germline light chain region.
[0358] Flow Cytometry.
[0359] Expression of the rearranged human light chain region in the normal antibody repertoire of common light chain mice was validated by analysis of immunoglobulin κ and λ expression in splenocytes and peripheral blood of common light chain mice. Cell suspensions from harvested spleens and peripheral blood of wild type (n=5), Vκ1-39Jκ5 common light chain heterozygote (n=3), Vκ1-39Jκ5 common light chain homozygote (n=3), Vκ3-20Jκ1 common light chain heterozygote (n=2), and Vκ3-20Jκ1 common light chain homozygote (n=2) mice were made using standard methods and stained with CD19.sup.+, Igl.sup.+ and Igk.sup.+ using fluorescently labeled antibodies (BD Pharmigen).
[0360] Briefly, 1×10.sup.6 cells were incubated with anti-mouse CD16/CD32 (clone 2.4G2, BD Pharmigen) on ice for 10 minutes, followed by labeling with the following antibody cocktail for 30 minutes on ice: APC conjugated anti-mouse CD19 (clone 1D3, BD Pharmigen), PerCP-Cy5.5 conjugated anti-mouse CD3 (clone 17A2, BioLegend), FITC conjugated anti-mouse Igκ (clone 187.1, BD Pharmigen), PE conjugated anti-mouse Igλ (clone RML-42, BioLegend). Following staining, cells were washed and fixed in 2% formaldehyde. Data acquisition was performed on an LSRII flow cytometer and analyzed with FlowJo™. Gating: total B cells (CD19.sup.+CD3.sup.−), Igk.sup.+ B cells (Igk.sup.+Igl.sup.−CD19.sup.+CD3.sup.−), B cells (Igκ.sup.−Igl.sup.+CD19.sup.+CD3.sup.−). Data gathered from blood and splenocyte samples demonstrated similar results. Table 12 sets forth the percent positive CD19.sup.+ B cells from peripheral blood of one representative mouse from each group that are Igl.sup.+, Igk.sup.+, or Igl.sup.+Igk.sup.+. Percent of CD19.sup.+ B cells in peripheral blood from wild type (WT) and mice homozygous for either the Vκ1-39Jκ5 or Vκ3-20Jκ1 common light chain are shown in
TABLE-US-00012 TABLE 12 CD19.sup.+ B cells Mouse Genotype IgI.sup.+ Igk.sup.+ IgI.sup.+Igk.sup.+ wild type 4.8 93 0.53 Vκ1-39Jκ5 1.4 93 2.6 Vκ3-20Jκ1 4.2 88 6
[0361] Common Light Chain Expression.
[0362] Expression of each common light chain (Vκ1-39Jκ5 and Vκ3-20Jκ1) was analyzed in heterozygous and homozygous mice using a quantitative PCR assay (e.g. Taqman™).
[0363] Briefly, CD19.sup.+ B cells were purified from the spleens of wild type, mice homozygous for a replacement of the mouse heavy chain and κ light chain variable region loci with corresponding human heavy chain and κ light chain variable region loci (Hκ), as well as mice homozygous and heterozygous for each rearranged human light chain region (Vκ1-39Jκ5 or Vκ3-20Jκ1) using mouse CD19 Microbeads (Miltenyi Biotec) according to manufacturer's specifications. Total RNA was purified from CD19.sup.+ B cells using RNeasy™ Mini kit (Qiagen) according to the manufacturer's specifications and genomic RNA was removed using a RNase-free DNase on-column treatment (Qiagen). 200 ng mRNA was reverse-transcribed into cDNA using the First Stand cDNA Synthesis kit (Invitrogen) and the resulting cDNA was amplified with the Taqman™ Universal PCR Master Mix (Applied Biosystems). All reactions were performed using the ABI 7900 Sequence Detection System (Applied Biosystems) using primers and Taqman™ MGB probes spanning (1) the Vκ-Jκ junction for both common light chains, (2) the Vκ gene alone (i.e. Vκ1-39 and Vκ3-20), and (3) the mouse Cκ region. Table 13 sets forth the sequences of the primers and probes employed for this assay. Relative expression was normalized to expression of the mouse Cκ region. Results are shown in
TABLE-US-00013 TABLE 13 SEQ Primer/Probe Description ID Region (5′-3′) NOs: Vκ1-39Jκ5 (sense) 77 Junction AGCAGTCTGC AACCTGAAGA TTT (anti-sense) 78 GTTTAATCTC CAGTCGTGTC CCTT (probe) 79 CCTCCGATCA CCTTC Vκ1-39 (sense) 80 AAACCAGGGA AAGCCCCTAA (anti-sense) 81 ATGGGACCCC ACTTTGCA (probe) 82 CTCCTGATCT ATGCTGCAT Vκ3-20Jκ1 (sense) 83 Junction CAGCAGACTG GAGCCTGAAG A (anti-sense) 84 TGATTTCCAC CTTGGTCCCT T (probe) 85 TAGCTCACCT TGGACGTT Vκ3-20 (sense) 86 CTCCTCATCT ATGGTGCATC CA (anti-sense) 87 GACCCACTGC CACTGAACCT (probe) 88 CCACTGGCAT CCC Mouse Cκ (sense) 89 TGAGCAGCAC CCTCACGTT (anti-sense) 90 GTGGCCTCAC AGGTATAGCT GTT (probe) 91 ACCAAGGACG AGTATGAA
[0364] Antigen Specific Common Light Chain Antibodies.
[0365] Common light chain mice bearing either a Vκ1-39Jκ5 or Vκ3-20Jκ1 common light chain at the endogenous mouse κ light chain locus were immunized with β-galactosidase and antibody titer was measured.
[0366] Briefly, β-galactosidase (Sigma) was emulsified in TITERMAX™ adjuvant (Sigma), as per the manufacturer's instructions. Wild type (n=7), Vκ1-39Jκ5 common light chain homozgyotes (n=2) and Vκ3-20Jκ1 common light chain homozygotes (n=5) were immunized by subcutaneous injection with 100 μg β-galactosidase/TITERMAX™. Mice were boosted by subcutaneous injection two times, 3 weeks apart, with 50 μg β-galactosidase/TITERMAX™. After the second boost, blood was collected from anaesthetized mice using a retro-orbital bleed into serum separator tubes (BD Biosciences) as per the manufacturer's instructions. To measure anti-β-galactosidase IgM or IgG antibodies, ELISA plates (Nunc) were coated with 1 μg/mL β-galactosidase overnight at 4° C. Excess antigen was washed off before blocking with PBS with 1% BSA for one hour at room temperature. Serial dilutions of serum were added to the plates and incubated for one hour at room temperature before washing. Plates were then incubated with HRP conjugated anti-IgM (Southern Biotech) or anti-IgG (Southern Biotech) for one hour at room temperature. Following another wash, plates were developed with TMB substrate (BD Biosciences). Reactions were stopped with 1N sulfuric acid and OD.sub.450 was read using a Victor X5 Plate Reader (Perkin Elmer). Data was analyzed with GRAPHPAD™ Prism and signal was calculated as the dilution of serum that is two times above background. Results are shown in
[0367] As shown in this Example, the ratio of κ/λ B cells in both the splenic and peripheral compartments of Vκ1-39Jκ5 and Vκ3-20Jκ1 common light chain mice demonstrated a near wild type pattern (Table 12 and
Example XIII
Breeding of Mice Expressing a Single Rearranged Human Germline Light Chain
[0368] This Example describes several other genetically modified mouse strains that can be bred to any one of the common light chain mice described herein to create multiple genetically modified mouse strains harboring multiple genetically modified immunoglobulin loci.
[0369] Endogenous Igλ Knockout (KO).
[0370] To optimize the usage of the engineered light chain locus, mice bearing one of the rearranged human germline light chain regions are bred to another mouse containing a deletion in the endogenous λ light chain locus. In this manner, the progeny obtained will express, as their only light chain, the rearranged human germline light chain region as described in Example 11. Breeding is performed by standard techniques recognized in the art and, alternatively, by a commercial breeder (e.g., The Jackson Laboratory). Mouse strains bearing an engineered light chain locus and a deletion of the endogenous λ light chain locus are screened for presence of the unique light chain region and absence of endogenous mouse λ light chains.
[0371] Humanized Endogenous Heavy Chain Locus.
[0372] Mice bearing an engineered human germline light chain locus are bred with mice that contain a replacement of the endogenous mouse heavy chain variable gene locus with the human heavy chain variable gene locus (see U.S. Pat. No. 6,596,541; the VELOCIMMUNE® humanized mouse, Regeneron Pharmaceuticals, Inc.). The VELOCIMMUNE® humanized mouse comprises a genome comprising human heavy chain variable regions operably linked to endogenous mouse constant region loci such that the mouse produces antibodies comprising a human heavy chain variable region and a mouse heavy chain constant region in response to antigenic stimulation. The DNA encoding the variable regions of the heavy chains of the antibodies is isolated and operably linked to DNA encoding the human heavy chain constant regions. The DNA is then expressed in a cell capable of expressing the fully human heavy chain of the antibody.
[0373] Mice bearing a replacement of the endogenous mouse V.sub.H locus with the human V.sub.H locus and a single rearranged human germline V.sub.L region at the endogenous κ light chain locus are obtained. Reverse chimeric antibodies containing somatically mutated heavy chains (human V.sub.H and mouse C.sub.H) with a single human light chain (human V.sub.L and mouse C.sub.L) are obtained upon immunization with an antigen of interest. V.sub.H and V.sub.L nucleotide sequences of B cells expressing the antibodies are identified and fully human antibodies are made by fusion the V.sub.H and V.sub.L nucleotide sequences to human C.sub.H and C.sub.L nucleotide sequences in a suitable expression system.
Example XIV
Generation of Antibodies from Mice Expressing Human Heavy Chains and a Rearranged Human Germline Light Chain Region
[0374] After breeding mice that contain the engineered human light chain region to various desired strains containing modifications and deletions of other endogenous Ig loci (as described in Example 12), selected mice can be immunized with an antigen of interest.
[0375] Generally, a VELOCIMMUNE® humanized mouse containing one of the single rearranged human germline light chain regions is challenged with an antigen, and lymphatic cells (such as B-cells) are recovered from serum of the animals. The lymphatic cells are fused with a myeloma cell line to prepare immortal hybridoma cell lines, and such hybridoma cell lines are screened and selected to identify hybridoma cell lines that produce antibodies containing human heavy chain variables and a rearranged human germline light chains which are specific to the antigen used for immunization. DNA encoding the variable regions of the heavy chains and the light chain are isolated and linked to desirable isotypic constant regions of the heavy chain and light chain. Due to the presence of the endogenous mouse sequences and any additional cis-acting elements present in the endogenous locus, the single light chain of each antibody may be somatically mutated. This adds additional diversity to the antigen-specific repertoire comprising a single light chain and diverse heavy chain sequences. The resulting cloned antibody sequences are subsequently expressed in a cell, such as a CHO cell. Alternatively, DNA encoding the antigen-specific chimeric antibodies or the variable domains of the light and heavy chains are identified directly from antigen-specific lymphocytes.
[0376] Initially, high affinity chimeric antibodies are isolated having a human variable region and a mouse constant region. As described above, the antibodies are characterized and selected for desirable characteristics, including affinity, selectivity, epitope, etc. The mouse constant regions are replaced with a desired human constant region to generate the fully human antibody containing a somatically mutated human heavy chain and a single light chain derived from a rearranged human germline light chain region of the invention. Suitable human constant regions include, for example wild type or modified IgG1 or IgG4.
[0377] Separate cohorts of VELOCIMMUNE® humanized mice containing a replacement of the endogenous mouse heavy chain locus with human V.sub.H, D.sub.H, and J.sub.H gene segments and a replacement of the endogenous mouse κ light chain locus with either the engineered germline Vκ1-39Jκ5 human light chain region or the engineered germline Vκ3-20Jκ1 human light chain region (described above) were immunized with a human cell surface receptor protein (Antigen E). Antigen E is administered directly onto the hind footpad of mice with six consecutive injections every 3-4 days. Two to three micrograms of Antigen E are mixed with 10 μg of CpG oligonucleotide (Cat #tlrl-modn—ODN1826 oligonucleotide; InVivogen, San Diego, Calif.) and 25 μg of Adju-Phos (Aluminum phosphate gel adjuvant, Cat #H-71639-250; Brenntag Biosector, Frederikssund, Denmark) prior to injection. A total of six injections are given prior to the final antigen recall, which is given 3-5 days prior to sacrifice. Bleeds after the 4th and 6th injection are collected and the antibody immune response is monitored by a standard antigen-specific immunoassay.
[0378] When a desired immune response is achieved splenocytes are harvested and fused with mouse myeloma cells to preserve their viability and form hybridoma cell lines. The hybridoma cell lines are screened and selected to identify cell lines that produce Antigen E-specific common light chain antibodies. Using this technique several anti-Antigen E-specific common light chain antibodies (i.e., antibodies possessing human heavy chain variable domains, the same human light chain variable domain, and mouse constant domains) are obtained.
[0379] Alternatively, anti-Antigen E common light chain antibodies are isolated directly from antigen-positive B cells without fusion to myeloma cells, as described in U.S. 2007/0280945A1, herein specifically incorporated by reference in its entirety. Using this method, several fully human anti-Antigen E common light chain antibodies (i.e., antibodies possessing human heavy chain variable domains, either an engineered human Vκ1-39Jκ5 light chain or an engineered human Vκ3-20Jκ1 light chain region, and human constant domains) were obtained.
[0380] The biological properties of the exemplary anti-Antigen E common light chain antibodies generated in accordance with the methods of this Example are described in detail below.
Example XV
Heavy Chain Gene Segment Usage in Antigen-Specific Common Light Chain Antibodies
[0381] To analyze the structure of the human anti-Antigen E common light chain antibodies produced, nucleic acids encoding heavy chain antibody variable regions were cloned and sequenced. From the nucleic acid sequences and predicted amino acid sequences of the antibodies, gene usage was identified for the heavy chain variable region (HCVR) of selected common light chain antibodies obtained from immunized VELOCIMMUNE® humanized mice containing either the engineered human Vκ1-39Jκ5 light chain or engineered human Vκ3-20Jκ1 light chain region. Results are shown in Tables 14 and 15, which demonstrate that mice according to the invention generate antigen-specific common light chain antibodies from a variety of human heavy chain gene segments, due to a variety of rearrangements, when employing either a mouse that expresses a light chain from only a human Vκ1-39- or a human Vκ3-20-derived light chain. Human V.sub.H gene segments of the 2, 3, 4, and 5 families rearranged with a variety of human D.sub.H segments and human J.sub.H segments to yield antigen-specific antibodies.
TABLE-US-00014 TABLE 14 Vκ1-39Jκ5 Common Light Chain Antibodies HCVR HCVR Antibody V.sub.H D.sub.H J.sub.H Antibody V.sub.H D.sub.H J.sub.H 2952 2-5 6-6 1 6030 3-30 6-6 5 5978 2-5 6-6 1 6032 3-30 6-6 5 5981 2-5 3-22 1 2985 3-30 6-13 4 6027 3-13 6-6 5 2997 3-30 6-13 4 3022 3-23 3-10 4 3011 3-30 6-13 4 3028 3-23 3-3 4 3047 3-30 6-13 4 5999 3-23 6-6 4 5982 3-30 6-13 4 6009 3-23 2-8 4 6002 3-30 6-13 4 6011 3-23 7-27 4 6003 3-30 6-13 4 5980 3-30 1-1 4 6012 3-30 6-13 4 3014 3-30 1-7 4 6013 3-30 6-13 4 3015 3-30 1-7 4 6014 3-30 6-13 4 3023 3-30 1-7 4 6015 3-30 6-13 4 3024 3-30 1-7 4 6016 3-30 6-13 4 3032 3-30 1-7 4 6017 3-30 6-13 4 6024 3-30 1-7 4 6020 3-30 6-13 4 6025 3-30 1-7 4 6034 3-30 6-13 4 6031 3-30 1-7 4 2948 3-30 7-27 4 6007 3-30 3-3 4 2987 3-30 7-27 4 2982 3-30 3-22 5 2996 3-30 7-27 4 6001 3-30 3-22 5 3005 3-30 7-27 4 6005 3-30 3-22 5 3012 3-30 7-27 4 6035 3-30 5-5 2 3020 3-30 7-27 4 3013 3-30 5-12 4 3021 3-30 7-27 4 3042 3-30 5-12 4 3025 3-30 7-27 4 2955 3-30 6-6 1 3030 3-30 7-27 4 3043 3-30 6-6 3 3036 3-30 7-27 4 3018 3-30 6-6 4 5997 3-30 7-27 4 2949 3-30 6-6 5 6033 3-30 7-27 4 2950 3-30 6-6 5 3004 3-30 7-27 5 2954 3-30 6-6 5 6028 3-30 7-27 6 2978 3-30 6-6 5 3010 4-59 3-16 3 3016 3-30 6-6 5 3019 4-59 3-16 3 3017 3-30 6-6 5 6018 4-59 3-16 3 3033 3-30 6-6 5 6026 4-59 3-16 3 3041 3-30 6-6 5 6029 4-59 3-16 3 5979 3-30 6-6 5 6036 4-59 3-16 3 5998 3-30 6-6 5 6037 4-59 3-16 3 6004 3-30 6-6 5 2964 4-59 3-22 3 6010 3-30 6-6 5 3027 4-59 3-16 4 6019 3-30 6-6 5 3046 5-51 5-5 3 6021 3-30 6-6 5 6000 1-69 6-13 4 6022 3-30 6-6 5 6006 1-69 6-6 5 6023 3-30 6-6 5 6008 1-69 6-13 4
TABLE-US-00015 TABLE 15 Vκ3-20Jκ1 Common Light Chain Antibodies HCVR HCVR Antibody V.sub.H D.sub.H J.sub.H Antibody V.sub.H D.sub.H J.sub.H 5989 3-30 3-3 3 5992 4-39 1-26 3 5994 3-33 1-7 4 2975 5-51 6-13 5 5985 3-33 2-15 4 2972 5-51 3-16 6 5987 3-33 2-15 4 5986 5-51 3-16 6 5995 3-33 2-15 4 5993 5-51 3-16 6 2968 4-39 1-26 3 5996 5-51 3-16 6 5988 4-39 1-26 3 5984 3-53 1-1 4 5990 4-39 1-26 3
Example XVI
Determination of Blocking Ability of Antigen-Specific Common Light Chain Antibodies by LUMINEX™ Assay
[0382] Ninety-eight human common light chain antibodies raised against Antigen E were tested for their ability to block binding of Antigen E's natural ligand (Ligand Y) to Antigen E in a bead-based assay.
[0383] The extracellular domain (ECD) of Antigen E was conjugated to two myc epitope tags and a 6× histidine tag (Antigen E-mmH) and amine-coupled to carboxylated microspheres at a concentration of 20 μg/mL in MES buffer. The mixture was incubated for two hours at room temperature followed by bead deactivation with 1M Tris pH 8.0 followed by washing in PBS with 0.05% (v/v) Tween-20. The beads were then blocked with PBS (Irvine Scientific, Santa Ana, Calif.) containing 2% (w/v) BSA (Sigma-Aldrich Corp., St. Louis, Mo.). In a 96-well filter plate, supernatants containing Antigen E-specific common light chain antibodies, were diluted 1:15 in buffer. A negative control containing a mock supernatant with the same media components as for the antibody supernatant was prepared. Antigen E-labeled beads were added to the supernatants and incubated overnight at 4° C. Biotinylated-Ligand Y protein was added to a final concentration of 0.06 nM and incubated for two hours at room temperature. Detection of biotinylated-Ligand Y bound to Antigen E-myc-myc-6His labeled beads was determined with R-Phycoerythrin conjugated to Streptavidin (Moss Inc, Pasadena, Md.) followed by measurement in a LUMINEX™ flow cytometry-based analyzer. Background Mean Fluorescence Intensity (MFI) of a sample without Ligand Y was subtracted from all samples. Percent blocking was calculated by division of the background-subtracted MFI of each sample by the adjusted negative control value, multiplying by 100 and subtracting the resulting value from 100.
[0384] In a similar experiment, the same 98 human common light chain antibodies raised against Antigen E were tested for their ability to block binding of Antigen E to Ligand Y-labeled beads.
[0385] Briefly, Ligand Y was amine-coupled to carboxylated microspheres at a concentration of 20 μg/mL diluted in MES buffer. The mixture and incubated two hours at room temperature followed by deactivation of beads with 1M Tris pH 8 then washing in PBS with 0.05% (v/v) Tween-20. The beads were then blocked with PBS (Irvine Scientific, Santa Ana, Calif.) containing 2% (w/v) BSA (Sigma-Aldrich Corp., St. Louis, Mo.). In a 96-well filter plate, supernatants containing Antigen E-specific common light chain antibodies were diluted 1:15 in buffer. A negative control containing a mock supernatant with the same media components as for the antibody supernatant was prepared. A biotinylated-Antigen E-mmH was added to a final concentration of 0.42 nM and incubated overnight at 4° C. Ligand Y-labeled beads were then added to the antibody/Antigen E mixture and incubated for two hours at room temperature. Detection of biotinylated-Antigen E-mmH bound to Ligand Y-beads was determined with R-Phycoerythrin conjugated to Streptavidin (Moss Inc, Pasadena, Md.) followed by measurement in a LUMINEX™ flow cytometry-based analyzer. Background Mean Fluorescence Intensity (MFI) of a sample without Antigen E was subtracted from all samples. Percent blocking was calculated by division of the background-subtracted MFI of each sample by the adjusted negative control value, multiplying by 100 and subtracting the resulting value from 100.
[0386] Tables 16 and 17 show the percent blocking for all 98 anti-Antigen E common light chain antibodies tested in both LUMINEX™ assays. ND: not determined under current experimental conditions.
TABLE-US-00016 TABLE 16 Vκ1-39Jκ5 Common Light Chain Antibodies % Blocking of % Blocking of Antibody Antigen E-Labeled Beads Antigen E In Solution 2948 81.1 47.8 2948G 38.6 ND 2949 97.6 78.8 2949G 97.1 73.7 2950 96.2 81.9 2950G 89.8 31.4 2952 96.1 74.3 2952G 93.5 39.9 2954 93.7 70.1 2954G 91.7 30.1 2955 75.8 30.0 2955G 71.8 ND 2964 92.1 31.4 2964G 94.6 43.0 2978 98.0 95.1 2978G 13.9 94.1 2982 92.8 78.5 2982G 41.9 52.4 2985 39.5 31.2 2985G 2.0 5.0 2987 81.7 67.8 2987G 26.6 29.3 2996 87.3 55.3 2996G 95.9 38.4 2997 93.4 70.6 2997G 9.7 7.5 3004 79.0 48.4 3004G 60.3 40.7 3005 97.4 93.5 3005G 77.5 75.6 3010 98.0 82.6 3010G 97.9 81.0 3011 87.4 42.8 3011G 83.5 41.7 3012 91.0 60.8 3012G 52.4 16.8 3013 80.3 65.8 3013G 17.5 15.4 3014 63.4 20.7 3014G 74.4 28.5 3015 89.1 55.7 3015G 58.8 17.3 3016 97.1 81.6 3016G 93.1 66.4 3017 94.8 70.2 3017G 87.9 40.8 3018 85.4 54.0 3018G 26.1 12.7 3019 99.3 92.4 3019G 99.3 88.1 3020 96.7 90.3 3020G 85.2 41.5 3021 74.5 26.1 3021G 81.1 27.4 3022 65.2 17.6 3022G 67.2 9.1 3023 71.4 28.5 3023G 73.8 29.7 3024 73.9 32.6 3024G 89.0 10.0 3025 70.7 15.6 3025G 76.7 24.3 3027 96.2 61.6 3027G 98.6 75.3 3028 92.4 29.0 3028G 87.3 28.8 3030 6.0 10.6 3030G 41.3 14.2 3032 76.5 31.4 3032G 17.7 11.0 3033 98.2 86.1 3033G 93.6 64.0 3036 74.7 32.7 3036G 90.1 51.2 3041 95.3 75.9 3041G 92.4 51.6 3042 88.1 73.3 3042G 60.9 25.2 3043 90.8 65.8 3043G 92.8 60.3
TABLE-US-00017 TABLE 17 Vκ3-20Jκ1 Common Light Chain Antibodies % Blocking of % Blocking of Antibody Antigen E-Labeled Beads Antigen E In Solution 2968 97.1 73.3 2968G 67.1 14.6 2969 51.7 20.3 2969G 37.2 16.5 2970 92.2 34.2 2970G 92.7 27.2 2971 23.4 11.6 2971G 18.8 18.9 2972 67.1 38.8 2972G 64.5 39.2 2973 77.7 27.0 2973G 51.1 20.7 2974 57.8 12.4 2974G 69.9 17.6 2975 49.4 18.2 2975G 32.0 19.5 2976 1.0 1.0 2976G 50.4 20.4
[0387] In the first LUMINEX™ experiment described above, 80 common light chain antibodies containing the Vκ1-39Jκ5 engineered light chain were tested for their ability to block Ligand Y binding to Antigen E-labeled beads. Of these 80 common light chain antibodies, 68 demonstrated >50% blocking, while 12 demonstrated <50% blocking (6 at 25-50% blocking and 6 at <25% blocking). For the 18 common light chain antibodies containing the Vκ3-20Jκ1 engineered light chain, 12 demonstrated >50% blocking, while 6 demonstrated <50% blocking (3 at 25-50% blocking and 3 at <25% blocking) of Ligand Y binding to Antigen E-labeled beads.
[0388] In the second LUMINEX™ experiment described above, the same 80 common light chain antibodies containing the Vκ1-39Jκ5 engineered light chain were tested for their ability to block binding of Antigen E to Ligand Y-labeled beads. Of these 80 common light chain antibodies, 36 demonstrated >50% blocking, while 44 demonstrated <50% blocking (27 at 25-50% blocking and 17 at <25% blocking). For the 18 common light chain antibodies containing the Vκ3-20Jκ1 engineered light chain, 1 demonstrated >50% blocking, while 17 demonstrated <50% blocking (5 at 25-50% blocking and 12 at <25% blocking) of Antigen E binding to Ligand Y-labeled beads.
[0389] The data of Tables 16 and 17 establish that the rearrangements described in Tables 14 and 15 generated anti-Antigen E-specific common light chain antibodies that blocked binding of Ligand Y to its cognate receptor Antigen E with varying degrees of efficacy, which is consistent with the anti-Antigen E common light chain antibodies of Tables 14 and 15 comprising antibodies with overlapping and non-overlapping epitope specificity with respect to Antigen E.
Example XVII
Determination of Blocking Ability of Antigen-Specific Common Light Chain Antibodies by ELISA
[0390] Human common light chain antibodies raised against Antigen E were tested for their ability to block Antigen E binding to a Ligand Y-coated surface in an ELISA assay.
[0391] Ligand Y was coated onto 96-well plates at a concentration of 2 μg/mL diluted in PBS and incubated overnight followed by washing four times in PBS with 0.05% Tween-20. The plate was then blocked with PBS (Irvine Scientific, Santa Ana, Calif.) containing 0.5% (w/v) BSA (Sigma-Aldrich Corp., St. Louis, Mo.) for one hour at room temperature. In a separate plate, supernatants containing anti-Antigen E common light chain antibodies were diluted 1:10 in buffer. A mock supernatant with the same components of the antibodies was used as a negative control. Antigen E-mmH (described above) was added to a final concentration of 0.150 nM and incubated for one hour at room temperature. The antibody/Antigen E-mmH mixture was then added to the plate containing Ligand Y and incubated for one hour at room temperature. Detection of Antigen E-mmH bound to Ligand Y was determined with Horse-Radish Peroxidase (HRP) conjugated to anti-Penta-His antibody (Qiagen, Valencia, Calif.) and developed by standard calorimetric response using tetramethylbenzidine (TMB) substrate (BD Biosciences, San Jose, Calif.) neutralized by sulfuric acid. Absorbance was read at OD450 for 0.1 sec. Background absorbance of a sample without Antigen E was subtracted from all samples. Percent blocking was calculated by division of the background-subtracted MFI of each sample by the adjusted negative control value, multiplying by 100 and subtracting the resulting value from 100.
[0392] Tables 18 and 19 show the percent blocking for all 98 anti-Antigen E common light chain antibodies tested in the ELISA assay. ND: not determined under current experimental conditions.
TABLE-US-00018 TABLE 18 Vκ1-39Jκ5 Common Light Chain Antibodies % Blocking of Antibody Antigen E In Solution 2948 21.8 2948G 22.9 2949 79.5 2949G 71.5 2950 80.4 2950G 30.9 2952 66.9 2952G 47.3 2954 55.9 2954G 44.7 2955 12.1 2955G 25.6 2964 34.8 2964G 47.7 2978 90.0 2978G 90.2 2982 59.0 2982G 20.4 2985 10.5 2985G ND 2987 31.4 2987G ND 2996 29.3 2996G ND 2997 48.7 2997G ND 3004 16.7 3004G 3.5 3005 87.2 3005G 54.3 3010 74.5 3010G 84.6 3011 19.4 3011G ND 3012 45.0 3012G 12.6 3013 39.0 3013G 9.6 3014 5.2 3014G 17.1 3015 23.7 3015G 10.2 3016 78.1 3016G 37.4 3017 61.6 3017G 25.2 3018 40.6 3018G 14.5 3019 94.6 3019G 92.3 3020 80.8 3020G ND 3021 7.6 3021G 20.7 3022 2.4 3022G 15.0 3023 9.1 3023G 19.2 3024 7.5 3024G 15.2 3025 ND 3025G 13.9 3027 61.4 3027G 82.7 3028 40.3 3028G 12.3 3030 ND 3030G 9.5 3032 ND 3032G 13.1 3033 77.1 3033G 32.9 3036 17.6 3036G 24.6 3041 59.3 3041G 30.7 3042 39.9 3042G 16.1 3043 57.4 3043G 46.1
TABLE-US-00019 TABLE 19 Vκ3-20Jκ1 Common Light Chain Antibodies % Blocking of Antibody Antigen E In Solution 2968 68.9 2968G 15.2 2969 10.1 2969G 23.6 2970 34.3 2970G 41.3 2971 6.3 2971G 27.1 2972 9.6 2972G 35.7 2973 20.7 2973G 23.1 2974 ND 2974G 22.0 2975 8.7 2975G 19.2 2976 4.6 2976G 26.7
[0393] As described in this Example, of the 80 common light chain antibodies containing the Vκ1-39Jκ5 engineered light chain tested for their ability to block Antigen E binding to a Ligand Y-coated surface, 22 demonstrated >50% blocking, while 58 demonstrated <50% blocking (20 at 25-50% blocking and 38 at <25% blocking). For the 18 common light chain antibodies containing the Vκ3-20Jκ1 engineered light chain, one demonstrated >50% blocking, while 17 demonstrated <50% blocking (5 at 25-50% blocking and 12 at <25% blocking) of Antigen E binding to a Ligand Y-coated surface.
[0394] These results are also consistent with the Antigen E-specific common light chain antibody pool comprising antibodies with overlapping and non-overlapping epitope specificity with respect to Antigen E.
Example XVIII
BIACORE™ Affinity Determination for Antigen-Specific Common Light Chain Antibodies
[0395] Equilibrium dissociation constants (K.sub.D) for selected antibody supernatants were determined by SPR (Surface Plasmon Resonance) using a BIAcore™ T100 instrument (GE Healthcare). All data was obtained using HBS-EP (10 mM HEPES, 150 mM NaCl, 0.3 mM EDTA, 0.05% Surfactant P20, pH 7.4) as both the running and sample buffers, at 25° C. Antibodies were captured from crude supernatant samples on a CMS sensor chip surface previously derivatized with a high density of anti-human Fc antibodies using standard amine coupling chemistry. During the capture step, supernatants were injected across the anti-human Fc surface at a flow rate of 3 μL/min, for a total of 3 minutes. The capture step was followed by an injection of either running buffer or analyte at a concentration of 100 nM for 2 minutes at a flow rate of 35 μL/min. Dissociation of antigen from the captured antibody was monitored for 6 minutes. The captured antibody was removed by a brief injection of 10 mM glycine, pH 1.5. All sensorgrams were double referenced by subtracting sensorgrams from buffer injections from the analyte sensorgrams, thereby removing artifacts caused by dissociation of the antibody from the capture surface. Binding data for each antibody was fit to a 1:1 binding model with mass transport using BIACORE™ T100 Evaluation software v2.1. Results are shown in Tables 20 and 21.
TABLE-US-00020 TABLE 20 Vκ1-39Jκ5 Common Light Chain Antibodies 100 nM Antigen E Antibody K.sub.D (nM) T.sub.1/2 (min) 2948 8.83 28 2948G 95.0 1 2949 3.57 18 2949G 6.37 9 2950 4.91 17 2950G 13.6 5 2952 6.25 7 2952G 7.16 4 2954 2.37 24 2954G 5.30 9 2955 14.4 6 2955G 12.0 4 2964 14.8 6 2964G 13.0 9 2978 1.91 49 2978G 1.80 58 2982 6.41 19 2982G 16.3 9 2985 64.4 9 2985G 2.44 8 2987 21.0 11 2987G 37.6 4 2996 10.8 9 2996G 24.0 2 2997 7.75 19 2997G 151 1 3004 46.5 14 3004G 1.93 91 3005 2.35 108 3005G 6.96 27 3010 4.13 26 3010G 2.10 49 3011 59.1 5 3011G 41.7 5 3012 9.71 20 3012G 89.9 2 3013 20.2 20 3013G 13.2 4 3014 213 4 3014G 36.8 3 3015 29.1 11 3015G 65.9 0 3016 4.99 17 3016G 18.9 4 3017 9.83 8 3017G 55.4 2 3018 11.3 36 3018G 32.5 3 3019 1.54 59 3019G 2.29 42 3020 5.41 39 3020G 41.9 6 3021 50.1 6 3021G 26.8 4 3022 25.7 17 3022G 20.8 12 3023 263 9 3023G 103 5 3024 58.8 7 3024G 7.09 10 3025 35.2 6 3025G 42.5 8 3027 7.15 6 3027G 4.24 18 3028 6.89 37 3028G 7.23 22 3030 46.2 7 3030G 128 3 3032 53.2 9 3032G 13.0 1 3033 4.61 17 3033G 12.0 5 3036 284 12 3036G 18.2 10 3041 6.90 12 3041G 22.9 2 3042 9.46 34 3042G 85.5 3 3043 9.26 29 3043G 13.1 22
TABLE-US-00021 TABLE 21 Vκ3-20Jκ1 Common Light Chain Antibodies 100 nM Antigen E Antibody K.sub.D (nM) T.sub.1/2 (min) 2968 5.50 8 2968G 305 0 2969 34.9 2 2969G 181 1 2970G 12.3 3 2971G 32.8 22 2972 6.02 13 2972G 74.6 26 2973 5.35 39 2973G 11.0 44 2974 256 0 2974G 138 0 2975 38.0 2 2975G 134 1 2976 6.73 10 2976G 656 8
[0396] The binding affinities of common light chain antibodies comprising the rearrangements shown in Tables 14 and 15 vary, with nearly all exhibiting a K.sub.D in the nanomolar range. The affinity data is consistent with the common light chain antibodies resulting from the combinatorial association of rearranged variable domains described in Tables 14 and 15 being high-affinity, clonally selected, and somatically mutated. Coupled with data previously shown, the common light chain antibodies described in Tables 14 and 15 comprise a collection of diverse, high-affinity antibodies that exhibit specificity for one or more epitopes on Antigen E.
Example XIX
Determination of Binding Specificities of Antigen-Specific Common Light Chain Antibodies by LUMINEX™ Assay
[0397] Selected anti-Antigen E common light chain antibodies were tested for their ability to bind to the ECD of Antigen E and Antigen E ECD variants, including the cynomolgous monkey ortholog (Mf Antigen E), which differs from the human protein in approximately 10% of its amino acid residues; a deletion mutant of Antigen E lacking the last 10 amino acids from the C-terminal end of the ECD (Antigen E-ACT); and two mutants containing an alanine substitution at suspected locations of interaction with Ligand Y (Antigen E-Ala1 and AntigenE-Ala2). The Antigen E proteins were produced in CHO cells and each contained a myc-myc-His C-terminal tag.
[0398] For the binding studies, Antigen E ECD protein or variant protein (described above) from 1 mL of culture medium was captured by incubation for 2 hr at room temperature with 1×10.sup.6 microsphere (Luminex™) beads covalently coated with an anti-myc monoclonal antibody (MAb 9E10, hybridoma cell line CRL-1729™; ATCC, Manassas, Va.). The beads were then washed with PBS before use. Supernatants containing anti-Antigen E common light chain antibodies were diluted 1:4 in buffer and added to 96-well filter plates. A mock supernatant with no antibody was used as negative control. The beads containing the captured Antigen E proteins were then added to the antibody samples (3000 beads per well) and incubated overnight at 4° C. The following day, the sample beads were washed and the bound common light chain antibody was detected with a R-phycoerythrin-conjugated anti-human IgG antibody. The fluorescence intensity of the beads (approximately 100 beads counted for each antibody sample binding to each Antigen E protein) was measured with a Luminex™ flow cytometry-based analyzer, and the median fluorescence intensity (MFI) for at least 100 counted beads per bead/antibody interaction was recorded. Results are shown in Tables 22 and 23.
TABLE-US-00022 TABLE 22 Vκ1-39Jκ5 Common Light Chain Antibodies Mean Fluorescence Intensity (MFI) Antigen Antigen Antigen Antigen Mf Antibody E-ECD E-ΔCT E-Ala1 E-Ala2 Antigen E 2948 1503 2746 4953 3579 1648 2948G 537 662 2581 2150 863 2949 3706 4345 8169 5678 5142 2949G 3403 3318 7918 5826 5514 2950 3296 4292 7756 5171 4749 2950G 2521 2408 7532 5079 3455 2952 3384 1619 1269 168 911 2952G 3358 1001 108 55 244 2954 2808 3815 7114 5039 3396 2954G 2643 2711 7620 5406 3499 2955 1310 2472 4738 3765 1637 2955G 1324 1802 4910 3755 1623 2964 5108 1125 4185 346 44 2964G 4999 729 4646 534 91 2978 6986 2800 14542 10674 8049 2978G 5464 3295 11652 8026 6452 2982 4955 2388 13200 9490 6772 2982G 3222 2013 8672 6509 4949 2985 1358 832 4986 3892 1669 2985G 43 43 128 244 116 2987 3117 1674 7646 5944 2546 2987G 3068 1537 9202 6004 4744 2996 4666 1917 12875 9046 6459 2996G 2752 1736 8742 6150 4873 2997 5164 2159 12167 8361 5922 2997G 658 356 3392 2325 1020 3004 2794 1397 8542 6268 3083 3004G 2753 1508 8267 5808 4345 3005 5683 2221 12900 9864 5868 3005G 4344 2732 10669 7125 5880 3010 4829 1617 2642 3887 44 3010G 3685 1097 2540 3022 51 3011 2859 2015 7855 5513 3863 3011G 2005 1072 6194 4041 3181 3012 3233 2221 8543 5637 3307 3012G 968 378 3115 2261 1198 3013 2343 1791 6715 4810 2528 3013G 327 144 1333 1225 370 3014 1225 1089 5436 3621 1718 3014G 1585 851 5178 3705 2411 3015 3202 2068 8262 5554 3796 3015G 1243 531 4246 2643 1611 3016 4220 2543 8920 5999 5666 3016G 2519 1277 6344 4288 4091 3017 3545 2553 8700 5547 5098 3017G 1972 1081 5763 3825 3038 3018 2339 1971 6140 4515 2293 3018G 254 118 978 1020 345 3019 5235 1882 7108 4249 54 3019G 4090 1270 4769 3474 214 3020 3883 3107 8591 6602 4420 3020G 2165 1209 6489 4295 2912 3021 1961 1472 6872 4641 2742 3021G 2091 1005 6430 3988 2935 3022 2418 793 7523 2679 36 3022G 2189 831 6182 3051 132 3023 1692 1411 5788 3898 2054 3023G 1770 825 5702 3677 2648 3024 1819 1467 6179 4557 2450 3024G 100 87 268 433 131 3025 1853 1233 6413 4337 2581 3025G 1782 791 5773 3871 2717 3027 4131 1018 582 2510 22 3027G 3492 814 1933 2596 42 3028 4361 2545 9884 5639 975 3028G 2835 1398 7124 3885 597 3030 463 277 1266 1130 391 3030G 943 302 3420 2570 1186 3032 2083 1496 6594 4402 2405 3032G 295 106 814 902 292 3033 4409 2774 8971 6331 5825 3033G 2499 1234 6745 4174 4210 3036 1755 1362 6137 4041 1987 3036G 2313 1073 6387 4243 3173 3041 3674 2655 8629 5837 4082 3041G 2519 1265 6468 4274 3320 3042 2653 2137 7277 5124 3325 3042G 1117 463 4205 2762 1519 3043 3036 2128 7607 5532 3366 3043G 2293 1319 6573 4403 3228
TABLE-US-00023 TABLE 23 Vκ3-20Jκ1 Common Light Chain Antibodies Mean Fluorescence Intensity (MFI) Antigen Antigen Antigen Antigen Mf Antibody E-ECD E-ΔCT E-Ala1 E-Ala2 Antigen E 2968 6559 3454 14662 3388 29 2968G 2149 375 9109 129 22 2969 2014 1857 7509 5671 3021 2969G 1347 610 6133 4942 2513 2970 5518 1324 14214 607 32 2970G 4683 599 12321 506 31 2971 501 490 2506 2017 754 2971G 578 265 2457 2062 724 2972 2164 2158 8408 6409 3166 2972G 1730 992 6364 4602 2146 2973 3527 1148 3967 44 84 2973G 1294 276 1603 28 44 2974 1766 722 8821 241 19 2974G 2036 228 8172 135 26 2975 1990 1476 8669 6134 2468 2975G 890 315 4194 3987 1376 2976 147 140 996 1079 181 2976G 1365 460 6024 3929 1625
[0399] The anti-Antigen E common light chain antibody supernatants exhibited high specific binding to the beads linked to Antigen E-ECD. For these beads, the negative control mock supernatant resulted in negligible signal (<10 MFI) when combined with the Antigen E-ECD bead sample, whereas the supernatants containing anti-Antigen E common light chain antibodies exhibited strong binding signal (average MFI of 2627 for 98 antibody supernatants; MFI>500 for 91/98 antibody samples).
[0400] As a measure of the ability of the selected anti-Antigen E common light chain antibodies to identify different epitopes on the ECD of Antigen E, the relative binding of the antibodies to the variants were determined. All four Antigen E variants were captured to the anti-myc LUMINEX™ beads as described above for the native Antigen E-ECD binding studies, and the relative binding ratios (MFI.sub.variant/MFI.sub.Antigen E-ECD) were determined. For 98 tested common light chain antibody supernatants shown in Tables 21 and 22, the average ratios (MFI.sub.variant/MFI.sub.Antigen E-ECD) differed for each variant, likely reflecting different capture amounts of proteins on the beads (average ratios of 0.61, 2.9, 2.0, and 1.0 for Antigen E-ACT, Antigen E-Ala1, Antigen E-Ala2, and Mf Antigen E, respectively). For each protein variant, the binding for a subset of the 98 tested common light chain antibodies showed greatly reduced binding, indicating sensitivity to the mutation that characterized a given variant. For example, 19 of the common light chain antibody samples bound to the Mf Antigen E with MFI.sub.variant/MFI.sub.Antigen E-ECD of <8%. Since many in this group include high or moderately high affinity antibodies (5 with K.sub.D <5 nM, 15 with K.sub.D<50 nM), it is likely that the lower signal for this group results from sensitivity to the sequence (epitope) differences between native Antigen E-ECD and a given variant rather than from lower affinities.
[0401] These data establish that the common light chain antibodies described in Tables 14 and 15 represent a diverse group of Antigen-E-specific common light chain antibodies that specifically recognize more than one epitope on Antigen E.