Xylose-induced genetically engineered bacteria used for producing ectoine and use thereof

Abstract

The present disclosure relates to the field of genetic engineering, especially relates to a xylose-induced genetically engineered bacteria used for producing ectoine as well as a construction method and use thereof. The genetically engineered bacteria is constructed by heterologously expressing the ectABC gene cluster from Halomonas elongata on the E. coli chromosome, using the promoter of xylose transporter coding gene xylF to control the RNA polymerase from T7 bacteriophage, reconstructing a synthesis pathway of ectoine and constructing a plasmid-free system, and enhancing the expression of target genes by a strong promoter T7; the yield of ectoine reached 12-16 g/L after 20-28 h fermentation in shake flask, and reached 35-50 g/L after 24-40 h fermentation in a 5 L fermentor.

Claims

1. A genetically engineered bacterium used for producing ectoine, wherein the genetically engineered bacterium is E. coli ECT06 comprising: E. coli W3110 modified to have an ectABC gene promoted by a promoter T7 and from Halomonas elongata; deletions of only thrA and iclR genes; a lysC gene promoted by a promoter T7 and from Corynebacterium glutamicum; a ppc gene promoted by a promoter trc; and a gene encoding a RNA polymerase from T7 bacteriophage and promoted by a promoter PxylF of xylose transporter coding gene xylF.

2. The genetically engineered bacterium used for producing ectoine according to claim 1, wherein a starting host cell strain of the genetically engineered bacteria is E. coli W3110 deposited under deposit number ATCC 27325.

3. The genetically engineered bacterium used for producing ectoine according to claim 1, wherein the deposit number of the Halomonas elongata is CGMCC No. 1.6329.

4. The genetically engineered bacterium used for producing ectoine according to claim 1, wherein the nucleotide sequence of the ectABC gene comprises SEQ ID NO: 1; the nucleotide sequence of the lysC gene comprises SEQ ID NO: 2; the nucleotide sequence of the thrA gene comprises SEQ ID NO: 3; the nucleotide sequence of the iclR gene comprises SEQ ID NO: 4; the nucleotide sequence of the promoter T7 comprises SEQ ID NO: 5; the nucleotide sequence of the promoter trc comprises SEQ ID NO: 7; the nucleotide sequence of the ppc gene comprises SEQ ID NO: 8; the nucleotide sequence of the PxylF comprises SEQ ID NO: 9; and the nucleotide sequence of the gene encoding the RNA polymerase from T7 bacteriophage comprises SEQ ID NO: 10.

5. A construction method of the genetically engineered bacterium used for producing ectoine of claim 1, comprising the following steps: (1) knocking out thrA and iclR genes of a starting strain of E. coli W3110; (2) replacing a promoter of ppc gene of the starting strain with promoter trc; (3) constructing a gene fragment by ligating the promoter PxylF of xylose transporter coding gene xylF and the gene encoding T7 RNA polymerase, and transforming into the E. coli W3110; and (4) constructing a metabolic pathway from aspartate to ectoine by {circle around (1)} constructing a gene fragment T7-ectABC by ligating promoter T7 and ectABC gene, and transforming into the E. coli W3110; and {circle around (2)} constructing a gene fragment T7-lysC by ligating promoter T7 and lysC gene, and transforming into the E. coli W3110.

6. A method of using the genetically engineered bacterium according to claim 1, for production of ectoine by shake-flask fermentation comprising: (1) inoculating slant cultured cells of the genetically engineered bacterium into a seed culture medium, and culturing for 7 hours at 37° C. and 200 rpm to produce a seed liquid; (2) inoculating the seed liquid into a fermentation medium according to an inoculum size of 10-15%, and culturing for 20-28 hours at 37° C. and 200 rpm; maintaining the pH to be 7.2, adding a 60% (m/v) glucose solution to maintain the fermentation, adding a xylose solution to the fermentation medium to a final concentration of 5-15 g/L in the fermentation medium to induce expression of the ectABC gene, the lysC gene or the gene encoding T7 RNA polymerase.

7. The method according to claim 6, wherein the seed culture medium comprises sucrose 20-30 g/L, (NH.sub.4).sub.2SO.sub.4 1-5 g/L, KH.sub.2PO.sub.4 1-g/L, MgSO.sub.4.7H.sub.2O 1-2 g/L, yeast extract powder 5-10 g/L, corn steep liquor 1-3 mL/L, FeSO.sub.4.7H.sub.2O 1-3 mg/L, MnSO.sub.4.H.sub.2O 1-3 mg/L, the rest is water, pH7.0; and the fermentation medium comprises glucose 20-40 g/L, (NH.sub.4).sub.2SO.sub.4 1-3 g/L, KH.sub.2PO.sub.4 1-3 g/L, MgSO.sub.4.7H.sub.2O 1-2 g/L, yeast extract powder 0.1-0.3 g/L, corn steep liquor 1-2 mL/L, FeSO.sub.4.7H.sub.2O 80-100 mg/L, MnSO.sub.4.7H.sub.2O 80-100 mg/L, the rest is water, pH7.0.

8. A method of using the genetically engineered bacterium according to claim 1, for production of ectoine by fermentor fermentation comprising the following steps: (1) scraping a loop of thallus comprising the genetically engineered bacterium from a tube stored in −80° C., and spreading the loop evenly on an agar slant culture medium, culturing the agar slant culture medium at 37° C. for 15-18 hours, and then transferring into a second-generation agar slant culture medium and culturing the second-generation agar slant culture medium for 12 hours; (2) adding sterile water into the second-generation agar slant culture medium to make a bacterial suspension, then inoculating the bacterial suspension into a seed medium and culturing to a cell dry weight of 5-6 g/L wherein pH is stabilized at 7.0, temperature is kept constant at 36° C., and dissolved oxygen is 25-35% to produce a seed liquid; (3) inoculating the seed liquid into a fermentation medium in a fermentor according to a inoculum size of 15-20%, and culturing for 24-40 hours wherein pH is stabilized at 7.0, temperature is kept constant at 36° C., and dissolved oxygen is 25-35%; and (4) adding during the culturing in (3) a xylose solution to the fermentation medium to a concentration of 5-15 g/L in the fermentation medium to induce expression of the ectABC gene, the lysC gene or the gene encoding T7 RNA polymerase, and adding a 80% (m/v) glucose solution to maintain the glucose concentration in the fermentation medium at 0-2 g/L after an initial amount of glucose in the fermentation medium is consumed.

9. The method according to claim 8, wherein each agar slant culture medium comprises sucrose 1-3 g/L, Tryptone 5-10 g/L, beef extract 5-10 g/L, yeast extract 2-5 g/L, NaCl 2-5 g/L, agar 15-30 g/L, the rest is water, pH 7.0-7.2, that has been high-pressure steam sterilized at 115° C. for 15 minutes; the seed medium comprises glucose 15-30 g/L, yeast Extract 5-10 g/L, Tryptone 5-10 g/L, KH.sub.2PO.sub.4 5-15 g/L, MgSO.sub.4.7H.sub.2O 2-5 g/L, FeSO.sub.4.7H.sub.2O 5-15 mg/L, MnSO.sub.4.7H.sub.2O 5-15 mg/L, VB1 1-3 mg/L, VH 0.1-1 mg/L, defoamer, the rest is water, pH 7.0-7.2, that has been high-pressure steam sterilized at 115° C. for 15 minutes; and the fermentation medium comprises glucose 15-25 g/L, yeast extract 1-5 g/L, Tryptone 1-5 g/L, sodium citrate 0.1-1 g/L, KH.sub.2PO.sub.4 1-5 g/L, MgSO.sub.4.7H.sub.2O 0.1-1 g/L, FeSO.sub.4.7H.sub.2O 80-100 mg/L, MnSO.sub.4.H.sub.2O 80-100 mg/L, VB1 0.5-1 mg/L, VH 0.1-0.5 mg/L, defoamer, the rest is water, pH 7.0-7.2, that has been high-pressure steam sterilized at 115° C. for 15 minutes.

Description

BRIEF DESCRIPTION OF FIGURES

(1) FIG. 1: Deletion and verification of the thrA gene

(2) Wherein, M: Marker, 1: upstream homologous arm, 2: chloramphenicol resistance gene fragment, 3: downstream homologous arm, 4: overlapping fragment; 5: PCR fragment obtained by using original genomic DNA as template; 6: PCR fragment obtained by using genomic DNA with deletion of gene thrA as template, 7: PCR fragment obtained by using genomic DNA with deletion of chloramphenicol resistance gene as template;

(3) FIG. 2: Deletion and verification of iclR gene

(4) Wherein, M: Marker, 1: iclR gene deletion fragment; 2: PCR fragment obtained by using original genomic DNA as template, 3: PCR fragment obtained by using genomic DNA with deletion of iclR as template, 4: PCR fragment obtained by using genomic DNA with deletion of chloramphenicol resistance gene as template;

(5) FIG. 3: Replacement of P.sub.ppc with P.sub.trc and verification

(6) Wherein, M: Marker, 1: upstream homologous arm, 2: chloramphenicol resistance gene fragment, 3: downstream homologous arm, 4: promoter replacing fragment; 5: PCR fragment obtained before promoter replacement, 6: PCR fragment obtained after promoter replacement, 7: PCR fragment obtained by using genomic DNA with deletion of Chloramphenicol resistance gene as template;

(7) FIG. 4: Construction and PCR verification of PxylF-T7RNAP integrated fragment

(8) Wherein, M: Marker, 1: PxylF-T7RNAP overlapping fragment, 2: upstream homologous arm, 3: chloramphenicol resistance gene fragment, 4: downstream homologous arm, 5: PxylF-T7RNAP integrated fragment; 6: PCR fragment obtained after replacing lacZ with PxylF-T7RNAP integrated fragment, 7: PCR fragment obtained by using genomic DNA with deletion of chloramphenicol resistance gene as template;

(9) FIG. 5: Construction and PCR verification of T7-ectABC integrated fragment

(10) Wherein, M: Marker, 1: upstream homologous arm, 2: overlapping fragment of T7-ectABC and chloramphenicol resistance gene, 3: downstream homologous arm, 4: T7-ectABC integrated fragment; 5: the original gene fragment; 6: PCR fragment obtained after replacing ybeM gene with T7-ectABC integrated fragment;

(11) FIG. 6: Construction and PCR verification of T7-lysC integrated fragment

(12) Wherein, M: Marker, 1: upstream homologous arm, 2: overlapping fragment of T7-lysC and chloramphenicol resistance gene, 3: downstream homologous arm, 4: T7-lysC integrated fragment; 5: the original gene fragment, 6: PCR fragment of genomic DNA after replacing yghX gene with T7-lysC integrated fragment;

(13) FIG. 7: The fermentation process curve of the control strain in example 4.

(14) FIG. 8: The fermentation process curve of the test strain in example 4.

DETAILED DESCRIPTION

Example 1. Construction of Strain E. coli ECT 06

(15) (1) Deletions of thrA Gene and iclR Gene

(16) Deletions of thrA gene and iclR gene were performed using the Red recombination system:

(17) {circle around (1)} the upstream and downstream homologous arms of the thrA gene were obtained by PCR amplification using the genomic DNA of E. coli W3110 (ATCC 27325) as a template and upstream homologous arm primers (thrA-up-1, thrA-up-2) and downstream homologous arm primers (thrA-down-1, thrA-down-2) as primers which were designed according to the gene sequence of thrA gene;

(18) {circle around (2)} a chloramphenicol resistance gene fragment was amplified by PCR using plasmid pKD3 as a template and Cm.sup.r-thrA-up, Cm.sup.r-thrA-down as primers;

(19) {circle around (3)} a thrA gene deletion fragment was amplified by overlapping PCR using the amplified fragments obtained in step {circle around (1)} and {circle around (2)} as templates, and the thrA gene deletion fragment was composed of upstream and downstream homologous arms of the thrA gene and the chloramphenicol resistance gene fragment;

(20) {circle around (4)} transforming the thrA gene deletion fragment into the E. coli W3110 harboring plasmid pKD46 to obtain positive transformants, and then the E. coli ECT01 that a bacterium with thrA gene deletion was obtained by eliminating the chloramphenicol resistance gene fragment from the positive transformants; (the verification of thrA gene deletion by electrophoresis shown in FIG. 1: the upstream homologous arm was about 500 bp, the downstream homologous arm was about 700 bp, the chloramphenicol resistance gene fragment was about 1080 bp, the thrA gene deletion fragment was about 2500 bp; the original gene was about 2000 bp, PCR fragment obtained by PCR amplification after deletion of chloramphenicol resistance gene was about 1500 bp, the electrophoretic bands were consistent with the designed size, which proved that the thrA gene was successfully deleted).

(21) Deletion of gene iclR: a E. coli ECT02 was obtained by deleting iclR gene from E. coli ECT01 using the same method above mentioned (the primers of upstream homologous arm: iclR-up-1, iclR-up-2; the primers of downstream homologous arm: iclR-down-1, iclR-down-2; the primers of chloramphenicol resistance gene fragment: Cm.sup.r-iclR-up, Cm.sup.r-iclR-down). (the deletion of iclR gene was verified by electrophoresis shown in FIG. 2: the upstream homologous arm was about 500 bp, the downstream homologous arm was about 500 bp, the chloramphenicol resistance gene fragment was about 1080 bp, the thrA gene deletion fragment was about 1700 bp; the original gene was about 1200 bp, PCR fragment obtained by PCR amplication after deletion of chloramphenicol resistance gene was about 800 bp, the electrophoretic bands were consistent with the designed size, which proved that the iclR gene was successfully deleted).

(22) (2) Replacement the Promoter of Ppc Gene with Promoter Trc

(23) {circle around (1)} the upstream and downstream homologous arms of the the promoter of ppc were amplified by PCR using the genomic DNA of E. coli W3110 (ATCC 27325) as a template and the upstream homologous arm primers (p.sub.ppc-up-1, p.sub.ppc-up-2) and downstream homologous arm primers(p.sub.ppc-down-1, p.sub.ppc-down-2) as primers which were designed according to the gene sequence of ppc gene; the upstream homologous arm was located upstream of the promoter of ppc, and the downstream homologous arm was located in front of the ppc structure gene for 600 bp;

(24) {circle around (2)} amplifying the promoter trc from plasmid pTrc99a(the forward primer: p.sub.trc-up; the reverse primer: per-down);

(25) {circle around (3)} a chloramphenicol resistance gene fragment was amplified by PCR using plasmid pKD3 as a template and Cm.sup.r-ppc-up, Cm.sup.r-ppc-down as primers;

(26) {circle around (4)} a promoter of ppc gene replacing fragment was amplified by overlapping PCR using the amplified fragments obtained in step {circle around (1)}, {circle around (2)} and {circle around (3)} as templates, and the promoter of ppc gene replacing fragment was composed of upstream and downstream homologous arms of the promoter of ppc gene, promoter trc and the chloramphenicol resistance gene fragment;

(27) {circle around (5)} E. coli ECT03, the promoter of ppc of which was replaced with promoter trc, was obtained by transforming the promoter of ppc gene replacing fragment into the E. coli ECT02 and then eliminating the chloramphenicol resistance gene fragment; (the replacing of the promoter of ppc gene with promoter trc was verified by electrophoresis shown in FIG. 3: the upstream homologous arm was about 700 bp, the downstream homologous arm was about 800 bp, the chloramphenicol resistance gene fragment is about 1080 bp, the replacing fragment was about 2300 bp, the original gene was about 1300 bp, PCR fragment obtained by PCR amplification after deletion of chloramphenicol resistance gene was about 1500 bp. The electrophoretic bands were consistent with the designed size, which proved that the promoter was successfully replaced).

(28) (3) Expression of T7 RNA Polymerase (T7RNAP)

(29) {circle around (1)} a promoter PxylF of xylose transporter coding gene xylF was amplified by PCR using the genomic DNA of E. coli W3110 (ATCC 27325) as a template and PxylF-up, PxylF-down as primers which were designed according to the gene sequence of xylF;

(30) {circle around (2)} a T7RNAP fragment was amplified by PCR using the genomic DNA of E. coli BL21(DE3) as a template and T7RNAP-up, T7RNAP-down as primers which were designed according to the gene sequence of T7RNAP;

(31) {circle around (3)} a chloramphenicol resistance gene fragment was amplified by PCR using plasmid pKD3 as a template and Cm.sup.r-lacZ-up, Cm.sup.r-lacZ-down as primers;

(32) {circle around (4)} the upstream and downstream homologous arms of the lacZ gene were amplified by PCR using the genomic DNA of E. coli W3110(ATCC27325) as a template and the upstream homologous arm primers(lacZ-up-1, lacZ-up-2), downstream homologous arm primers(lacZ-down-1, lacZ-down-2) as primers which were designed according to the gene sequence of lacZ gene; the upstream and downstream homologous arms were both located inside the lacZ gene;

(33) {circle around (5)} an integrated fragment PxylF-T7RNAP was amplified by overlapping PCR using the amplified fragments obtained in step {circle around (1)}, {circle around (2)}, {circle around (3)} and {circle around (4)} as templates, and the integrated fragment PxylF-T7RNAP was composed of upstream and downstream homologous arms of lacZ gene, the chloramphenicol resistance gene fragment, the promoter PxylF and the T7RNAP fragment;

(34) {circle around (6)} E. coli ECT04 was obtained by transforming the integrated fragment PxylF-T7RNAP into the E. coli ECT03 harboring plasmid pKD46 and eliminating the chloramphenicol resistance gene fragment, in which the lacZ gene was replaced with T7RNAP promoted by a promoter PxylF; (the expression of PxylF-T7RNAP integrated fragment was verified by electrophoresis shown in FIG. 4: the upstream homologous arm was about 451 bp, the downstream homologous arm was about 456 bp, the chloramphenicol resistance gene fragment was about 1024 bp, the overlapping fragment PxylF-T7RNAP was about 3000 bp, the integrated fragment PxylF-T7RNAP was about 5000 bp; the original gene fragment was about 3700 bp, PCR fragment obtained by PCR amplication after deletion of chloramphenicol resistance gene was about 4000 bp. The electrophoretic bands were consistent with the designed size, which proved that the integrated fragment PxylF-T7RNAP was successfully integrated).

(35) (4) Construction of Metabolic Pathway from Aspartate to Ectoine

(36) {circle around (1)} an ectABC gene was amplified by PCR using the genomic DNA of Halomonas elongata (CGMCC 1.6329) as a template and ectABC-up, ectABC-down as primers which were designed according to the gene sequence of ectABC, and a T7-ectABC fragment was obtained by PCR using primers which were performed by adding promoter T7 and terminator T7 to the 5′ and 3′ ends of the ectABC fragment amplification primers;

(37) {circle around (2)} a chloramphenicol resistance gene fragment was amplified by PCR using plasmid pKD3 as a template and Cm.sup.r-ybeM-up, Cm.sup.r-ybeM-down as primers;

(38) {circle around (3)} the upstream and downstream homologous arms of the ybeM gene were amplified by PCR using the genomic DNA of E. coli W3110(ATCC27325) as a template and the upstream homologous arm primers(ybeM-up-1, ybeM-up-2), downstream homologous arm primers(ybeM-down-1 ybeM-down-2) as primers which were designed according to the gene sequence of ybeM gene; the upstream and downstream homologous arms were both located inside the ybeM gene; the nucleotide sequence of the ybeM gene was a sequence shown in a sequence table as SEQ ID NO: 11;

(39) {circle around (4)} an integrated fragment T7-ectABC was amplified by overlapping PCR using the amplified fragments obtained in step {circle around (1)}, {circle around (2)} and {circle around (3)} as templates, and the integrated fragment T7-ectABC was composed of upstream and downstream homologous arms of ybeM gene, the promoter T7, the chloramphenicol resistance gene fragment, ectABC fragment and the terminator T7;

(40) {circle around (5)} a E. coli ECT05 was obtained by transforming the integrated fragment T7-ectABC into the E. coli ECT04 and eliminating the chloramphenicol resistance gene fragment, in which the ybeM gene was replaced by a promoter T7 promoted ectABC; (the integration of integrated fragment T7-ectABC was verified by electrophoresis shown in FIG. 5: the upstream homologous arm was about 488 bp, the downstream homologous arm was about 645 bp, the chloramphenicol resistance gene fragment was about 1024 bp, the T7-ectABC was about 2500 bp; the integrated fragment T7-ectABC was about 4500 bp, the original gene fragment was about 2000 bp, the electrophoretic bands were consistent with the designed size, which proved that the integrated fragment T7-ectABC was successfully integrated).

(41) (5) Introducing of lysC Gene from Corynebacterium glutamicum

(42) {circle around (1)} a lysC gene was amplified by PCR using the genomic DNA of Corynebacterium glutamicum ATCC13032 as a template and lysC-up, lysC-down as primers which were designed according to the gene sequence of lysC, and a T7-lysC fragment was obtained by PCR using primers which were performed by adding promoter T7 and terminator T7 to the 5′ and 3′ ends of the lysC fragment amplification primers;

(43) {circle around (2)} a chloramphenicol resistance gene fragment was amplified by PCR using plasmid pKD3 as a template and Cm.sup.r-yghX-up, Cm.sup.r-yghX-down as primers;

(44) {circle around (3)} the upstream and downstream homologous arms of the yghX gene were amplified by PCR using the genomic DNA of E. coli W3110(ATCC27325) as a template and the upstream homologous arm primers(yghX-up-1,yghX-up-2), downstream homologous arm primers(yghX-down-1, yghX-down-2) as primers which were designed according to the gene sequence of yghX gene; the upstream and downstream homologous arms were both located inside the yghX gene;

(45) the nucleotide sequence of the yghX gene was a sequence shown in a sequence table as SEQ ID NO: 12;

(46) {circle around (4)} an integrated fragment T7-lysC was amplified by overlapping PCR using the amplified fragments obtained in step {circle around (1)}, {circle around (2)} and {circle around (3)} as templates, and the integrated fragment T7-lysC was composed of upstream and downstream homologous arms of yghX gene, the promoter T7, the chloramphenicol resistance gene fragment, lysC gene fragment and the terminator T7;

(47) {circle around (5)} a E. coli ECT06 was obtained by transforming the integrated fragment T7-lysC into the E. coli ECT05 and eliminating the chloramphenicol resistance gene fragment, in which the yghX gene was replaced by a promoter T7 promoted lysC; (the integration of integrated fragment T7-lysC was verified by electrophoresis shown in FIG. 6: the upstream homologous arm was about 418 bp, the downstream homologous arm was about 480 bp, the chloramphenicol resistance gene fragment was about 1024 bp, the T7-lysC was about 1500 bp, the integrated fragment T7-lysC was about 3500 bp, the original gene fragment was about 1732 bp. As can be seen in FIG. 6, the electrophoretic bands were consistent with the designed size, which proves that the T7-lysC was successfully integrated).

(48) The primers used in the experiment are shown in the following table:

(49) TABLE-US-00001 Primers Sequence (5′-3′) SEQ ID NO: thrA-up-1 GCAACGGGCAATATGTCTCT 13 thrA-up-2 GCTCAAGACGCCAGGTGGTTGGTGATTTTG 14 thrA-down-1 CGTTACATCCGTGAAGATTGCCGAAGTGGAT 15 thrA-down-2 AGCACCCACAGCCACTCAT 16 Cm.sup.r-thrA-up AACCACCTGGCGTCTTGAGCGATTGTGTAGG 17 Cm.sup.r-thrA-down CAATCTTCACGGATGTAACGCACTGAGAAGC 18 iclR-up-1 TTTCCGCCGACAGGGATT 19 iclR-up-2 GCTCAAGACGTTTCGCGGGAATGGGTG 20 iclR-down-1 CGTTACATCCAAGCGGCGAAGGAAGTGAC 21 iclR-down-2 ATAGAGGCGTCGCCAGCT 22 Cm.sup.r-iclR-up TCCCGCGAAACGTCTTGAGCGATTGTGTAGG 23 Cm.sup.r-iclR-down TTCGCCGCTTGGATGTAACGCACTGAGAAGC 24 p.sub.ppc-up-1 GCTATGAATGCCCACCGAAT 25 p.sub.ppc-up-2 GCTCAAGACGCGTCATTAAATTCACGACGCTT 26 p.sub.ppc-down-1 CGTTACATCCGAAGCTGTGGTATGGCTGTGC 27 p.sub.ppc-down-2 CCATTTGGCTTCATCTACCG 28 p.sub.trc-up GTGAATTCAGGAAACAGACCATGAACGAACA 29 ATATTCCGCA ptrc-down GCATGGTACCAATATCGCCGAATGTAACGAC 30 Cm.sup.r-ppc-up TTTAATGACGCGTCTTGAGCGATTGTGTAGG 31 Cm.sup.r-ppc-down CCACAGCTTCGGATGTAACGCACTGAGAAGC 32 PxylF-up GAGATAATTCACAAGTGTGCGCT 33 PxylF-down TAGTAAATCCCATGGTGTAGGGCCTTCTGTAG 34 T7RNAP-up CTACACCATGGGATTTACTAACTGGAAGAGGCAC 35 T7RNAP-down CCGGCACAGTATCAAGGTATTT 36 lacZ-up-1 TCAAATTCAGCCGATAGCGG 37 lacZ-up-2 GAATTATCTCGCTTTCCAGTCGGGAAACCT 38 lacZ-down-1 CGTTACATCCCAGGTAGCAGAGCGGGTAAACT 39 lacZ-down-2 GGATTTCCTTACGCGAAATACG 40 Cm.sup.r-lacZ-up ACTGTGCCGGCGTCTTGAGCGATTGTGTAGG 41 Cm.sup.r-lacZ-down CTGCTACCTGGGATGTAACGCACTGAGAAGC 42 ectABC-up AATAATCGTCTAATACGACTCACTATAGGGTCTAGAAATAATT 43 TTGTTTAACTTTAAGAAGGAGATATACCATGAACGCAACCACA GAGCC ectABC-down GCTCAAGACGCAAAAAACCCCTCAAGACCCGTTT 44 AGAGGCCCCAAGGGGTTATGCTAGGCTGCGAACA ACGAAAGAG ybeM-up-1 ACAGCCAGAATGCCAGTGC 45 ybeM-up-2 AGTCGTATTAGACGATTATTCGGCGTTACACT 46 ybeM-down-1 CGTTACATCCTCGGCGCTTGATTCACC 47 ybeM-down-2 CGTTTGTCCGCTCTTCTTACC 48 Cm.sup.r-ybeM-up GGGTTTTTTGCGTCTTGAGCGATTGTGTAGG 49 Cm.sup.r-ybeM-down CAAGCGCCGAGGATGTAACGCACTGAGAAGC 50 lysC-up CGCTTCAATCTAATACGACTCACTATAGGGTCTAGA 51 AATAATTTTGTTTAACTTTAAGAAGGAGATATACCA CAAAGATGGCCCTGGTC lysC-down GCTCAAGACGCAAAAAACCCCTCAAGACCCGTTT 52 AGAGGCCCCAAGGGGTTATGCTAGACTGCGATGGT GGTCATTGT yghX-up-1 GCGCAACGTAGAACAGGAATT 53 yghX-up-2 AGTCGTATTAGATTGAAGCGCCTTTACTACTCC 54 yghX-down-1 CGTTACATCCGTCATAGTAATCCAGCAACTCTTGTG 55 yghX-down-2 GAGCAGGTATTTACGTGAACCG 56 Cm.sup.r-yghX-up GGGTTTTTTGCGTCTTGAGCGATTGTGTAGG 57 Cm.sup.r-yghX-down TTACTATGACGGATGTAACGCACTGAGAAGC 58

Example 2. Shake-Flask Fermentation Experiment

(50) The strain E. coli ECT 06 constructed in example 1 was used as a production strain to produce ectonie by fermentation.

(51) (1) Seed culture: a loop of thallus was inoculated into a 500 mL erlenmeyer flask with 30 mL seed medium, and cultured for 7 hours at 37° C. and 200 rpm.

(52) (2) Shake-flask fermentation: the seed solution was inoculated into a 500 mL baffled shake flask with 30 mL fermentation medium according to a inoculum size of 15%, and cultured for 28 hours at 37° C. and 200 rpm; the phenol red was used as an indicator, NH.sub.4OH was supplemented through a microsyringe to kept the pH at 7.2, and 60% (m/v) glucose solution was used for maintaining the fermentation(the phenol red was used as an indicator, and it will be seen as sugar deficiency when the color of the fermentation broth no longer changed, and then 2 ml of 60% glucose solution can be added), the expression of the target gene was induced by adding 60% (m/v) xylose solution (final concentration of xylose in the fermentation broth was 15 g/L) at the initial stage of fermentation, and the fermentation period was 28 h.

(53) (3) Collection of the fermentation broth: the fermentation broth was centrifuged at 13000 rpm, collecting the supernate phase and detecting the content of ectoine. The result showed the yield of ectoine reached 16 g/L after 28 h fermentation in shake flask.

(54) (4) Detection method:

(55) the supernate was diluted 200 times with deionized water and filtered by a 0.22 μm microfiltration membrane, the resulting sample was to be detected; the detection was performed by an UltiMate 3000 (Thermo Scientific) high performance liquid chromatograph using a TSK-GEL C18 chromatographic column with 2% acetonitrile at a flow rate was 1 mL/min as the mobile phase, the column temperature was 30° C., and 20 μL sample was injected by using a trace sample injection needle, the ultraviolet detection wavelength was 210 nm, and the retention time was about 2.953 min.

(56) The seed medium: sucrose 30 g/L, (NH.sub.4).sub.2SO.sub.4 5 g/L, KH.sub.2PO.sub.4 5 g/L, MgSO.sub.4.7H.sub.2O 2 g/L, yeast extract powder 10 g/L, corn steep liquor 3 mL/L, FeSO.sub.4.7H.sub.2O 3 mg/L, MnSO.sub.4.H.sub.2O 3 mg/L, the rest is water, pH7.0.

(57) The fermentation medium: glucose 40 g/L, (NH.sub.4).sub.2SO.sub.4 3 g/L, KH.sub.2PO.sub.4 3 g/L, MgSO.sub.4.7H.sub.2O 2 g/L, yeast extract powder 0.3 g/L, corn steep liquor 2 mL/L, FeSO.sub.4.7H.sub.2O 100 mg/L, MnSO.sub.4.7H.sub.2O 100 mg/L, the rest is water, pH7.0.

Example 3. Shake-Flask Fermentation Experiment

(58) The strain E. coli ECT06 constructed in example 1 was used to produce ectonie.

(59) (1) Seed culture: a loop of thallus was inoculated into a 500 mL erlenmeyer flask with 30 mL seed medium, and cultured for 7 hours at 37° C. and 200 rpm.

(60) (2) Shake-flask fermentation: the seed solution was inoculated into a 500 mL baffled shake flask with 30 mL fermentation medium according to a inoculum size of 10%, and cultured for 20 hours at 37° C. and 200 rpm; the phenol red was used as an indicator, and the pH was kept at 7.2 by supplementing NH.sub.4OH, the 60% (m/v) glucose solution was used for maintaining the fermentation(the phenol red was used as an indicator, and the color of the fermentation broth no longer changed meaning sugar deficiency, and then 1 mL of 60% glucose solution was added), the expression of the target gene was induced by adding 60% (m/v) xylose solution (final concentration of xylose in the fermentation broth was 5 g/L) at the initial stage of fermentation, and the fermentation period was 20 h.

(61) (3) Collection of the fermentation broth: the fermentation broth was centrifuged at 13000 rpm, collecting the supernate phase and detecting the content of ectoine. The result showed the yield of ectoine reached 12 g/L after 20 h fermentation in shake flask.

(62) (4) Detection method:

(63) the supernate was diluted 200 times with deionized water and filtered by a 0.22 μm microfiltration membrane, the resulting sample was to be detected; the detection of ectoine was performed by using an UltiMate 3000 (Thermo Scientific) high performance liquid chromatograph, and 20 μL sample was injected with a trace sample injection needle, the chromatographic column was a TSK-GEL C18 chromatographic column, and the column temperature was 30° C., the mobile phase was 2% acetonitrile, the flow rate was 1 mL/min, the ultraviolet detection wavelength was 210 nm, and the retention time was about 2.953 min.

(64) The seed medium: sucrose 20 g/L, (NH.sub.4).sub.2SO.sub.4 1 g/L, KH.sub.2PO.sub.4 1 g/L, MgSO.sub.4.7H.sub.2O 1 g/L, yeast extract powder 5 g/L, corn steep liquor 1 mL/L, FeSO.sub.4.7H.sub.2O 1 mg/L, MnSO.sub.4.H.sub.2O 1 mg/L, the rest is water, pH7.0;

(65) The fermentation medium: glucose 20 g/L, (NH.sub.4).sub.2SO.sub.4 1 g/L, KH.sub.2PO.sub.4 1 g/L, MgSO.sub.4.7H.sub.2O 1 g/L, yeast extract powder 0.1 g/L, corn steep liquor 1 mL/L, FeSO.sub.4.7H.sub.2O 80 mg/L, MnSO.sub.4.7H.sub.2O 80 mg/L, the rest is water, pH7.0.

Example 4. Fermentation Experiment in a 5 L Fermentor

(66) Test strain: the strain E. coli ECT06 constructed in example 1.

(67) Control strain: the strain E. coli ECT06 constructed in the Chinese patent application “A Genetically Engineered Bacteria Used for Producing Ectoine as well as the Construction Method and Use Thereof”, application number: 201510410080.2.

(68) Both of the two strains above mentioned were adopted to execute the fermentor fermentation experiment respectively under the same condition to produce ectoine, and the method specifically comprises the following steps:

(69) (1) slant culture: a loop of thallus was scraped off from the strain deposit tube stored in −80° C., and spread evenly on the agar slant culture medium to culture for 15 hours, then transferred into a second-generation agar slant to culture for 12 hours.

(70) (2) seed culture: proper amount of sterile water was added into four tubes of agar slant to make a bacterial suspension, then inoculated into a 7.5 L fermentor with 2 L seed medium and cultured to a cell dry weight of 6 g/L, during the period the pH was stabilized to be about 7.0 by automated addition of NH.sub.4OH, the temperature was kept constantly at 36° C. by temperature electrode, and the dissolved oxygen was 25-35% by variation of the stirrer speed and aeration rate.

(71) (3) fermentor fermentation: the seed liquid was inoculated into a fermentation medium according to a inoculum size of 20%, and cultured for 40 hours, during the period the pH was stabilized to be about 7.0, the temperature was kept constantly at 36° C., and the dissolved oxygen was 25-35%; and when the glucose in the medium was exhausted, a 80% (m/v) glucose solution was added to maintain the glucose concentration in the fermentation medium at 0-2 g/L;

(72) Xylose was added to the fermentation medium at the initial fermentation stage of the test strain with a 15 g/L of final concentration in the fermentation broth to induce the expression of the target gene (there is no addition of xylose in the fermentation process of the control strain).

(73) The slant culture medium: sucrose 3 g/L, tryptone 10 g/L, beef extract 10 g/L, yeast extract 5 g/L, NaCl 5 g/L, agar 30 g/L, the rest is water, pH 7.0-7.2, carrying out high-pressure steam sterilization at 115° C. for 15 minutes.

(74) The seed medium: glucose 30 g/L, yeast extract 10 g/L, tryptone 10 g/L, KH.sub.2PO.sub.4 15 g/L, MgSO.sub.4.7H.sub.2O 5 g/L, FeSO.sub.4.7H.sub.2O 15 mg/L, MnSO.sub.4.H.sub.2O 15 mg/L, VB1 3 mg/L, VH 1 mg/L, defoamer 2 drops, the rest is water, pH 7.0-7.2, carrying out high-pressure steam sterilization at 115° C. for 15 minutes.

(75) The fermentation medium: glucose 25 g/L, yeast extract 5 g/L, tryptone 5 g/L, sodium citrate 1 g/L, KH.sub.2PO.sub.4 5 g/L, MgSO.sub.4.7H.sub.2O 1 g/L, FeSO.sub.4.7H.sub.2O 100 mg/L, MnSO.sub.4.H.sub.2O 100 mg/L, VB1 1 mg/L, VH 0.5 mg/L, defoamer 2 drops, the rest is water, pH 7.0-7.2, carrying out high-pressure steam sterilization at 115° C. for 15 minutes.

(76) The results are shown in the following table, FIG. 7 and FIG. 8:

(77) TABLE-US-00002 specific Yield of Substrate production Ectoine Conversion Fermentation rate Strains OD.sub.600 (g/L) (%) Period (h) (g/L/h) Control 78.9 25.2 9.8 40 0.63 Strain Test Strain 83.0 50.1 27.8 40 1.25

Example 5. Fermentation Experiment in a 5 L Fermentor

(78) The strain E. coli ECT06 constructed in example 1 was used as the producing strain to produce ectoine, and the method specifically comprises the following steps:

(79) (1) slant culture: a loop of thallus was scraped off from the stain deposit tube stored in −80° C., and spread evenly on the agar slant culture medium to culture 18 hours, then transferred into a second-generation agar slant to culture 12 hours.

(80) (2) seed culture: proper amount of sterile water was added into four tubes of agar slant to make a bacterial suspension, then inoculated into a 7.5 L fermentor with 2 L seed medium and cultured to a cell dry weight of 5 g/L, during the period the pH was stabilized to be about 7.0 by automated addition of NH.sub.4OH, the temperature was kept constantly at 36° C. by temperature electrode, and the dissolved oxygen was 25-35% by variation of the stirrer speed and aeration rate.

(81) (3) fermentor fermentation: the seed liquid was inoculated into a fermentation medium according to an inoculum size of 15%, and cultured for 24 hours, during the period the pH was stabilized to be about 7.0, the temperature was kept at 36° C., and the dissolved oxygen was 25-35%;

(82) the expression of the target gene was induced by adding 5 g/L xylose to the fermentation medium at the initial fermentation stage, and when the glucose in the medium was consumed, a 80% (m/v) glucose solution was added by a mode of fed-batch to maintain the glucose concentration in the fermentation medium at 0-2 g/L.

(83) The concentration of ectoine in the fermentation broth reached 35 g/L after 24 h culture.

(84) The slant culture: sucrose 1 g/L, tryptone 5 g/L, beef extract 5 g/L, yeast extract 2 g/L, NaCl 2 g/L, agar 15 g/L, the rest is water, pH 7.0-7.2, carrying out high-pressure steam sterilization at 115° C. for 15 minutes.

(85) The seed medium: glucose 15 g/L, yeast extract 5 g/L, tryptone 5 g/L, KH.sub.2PO.sub.4 5 g/L, MgSO.sub.4.7H.sub.2O 2 g/L, FeSO.sub.4.7H.sub.2O 5 mg/L, MnSO.sub.4.H.sub.2O 5 mg/L, VB1 1 mg/L, VH 0.1 mg/L, defoamer 2 drops, the rest is water, pH 7.0-7.2, carrying out high-pressure steam sterilization at 115° C. for 15 minutes.

(86) The fermentation medium: glucose 15 g/L, yeast extract 1 g/L, tryptone 1 g/L, sodium citrate 0.1 g/L, KH.sub.2PO.sub.4 1 g/L, MgSO.sub.4.7H.sub.2O 0.1 g/L, FeSO.sub.4.H.sub.2O 80 mg/L, MnSO.sub.4.H.sub.2O 80 mg/L, VB1 0.5 mg/L, VH 0.1 mg/L, defoamer 2 drops, the rest is water, pH 7.0-7.2, carrying out high-pressure steam sterilization at 115° C. for 15 minutes.