<i>Lactobacillus plantarum </i>with colorectal cancer inhibition function and use thereof

11564956 · 2023-01-31

Assignee

Inventors

Cpc classification

International classification

Abstract

The present invention relates to the technical field of microbes, in particular to a Lactobacillus plantarum which can significantly inhibit the occurrence of colorectal cancer, and its use thereof. The Lactobacillus plantarum strain CCFM164 has a deposit number CGMCC No. 14520, which has a good tolerance to gastric acid and bile salts, significantly alleviate the level of colorectal inflammation in colorectal cancer model mice, and can reduce the number of tumors in the colon and rectum of the model mice by regulating the Notch1, Notch2 signaling pathway and the expression of VEGFR2 molecule in colorectal tissue. In addition, the Lactobacillus plantarum CCFM164 can also improve the intestinal flora population and short-chain fatty acid levels in the intestine. The Lactobacillus plantarum CCFM164 is used to prepare a fermented food for the inhibition of the occurrence of colorectal cancer with wild applications.

Claims

1. A method for improving an intestinal flora, reducing abnormally high levels of short chain fatty acids in an intestine, alleviating a colorectal inflammation, and inhibiting a colorectal cancer, wherein the method comprises administering to a subject in need thereof a composition comprising Lactobacillus plantarum strain CCFM164 (CGMCC 14520), and wherein the Lactobacillus plantarum strain CCFM164 (CGMCC 14520) has at least 90% survival rate after treatment in pH 2.5 for 3 hours.

2. The method according to claim 1, wherein Lactobacillus plantarum strain CCFM164 (CGMCC 14520) has at least 75% survival rate after treatment in pH 8.0 for 3 hours.

Description

BRIEF DESCRIPTION OF THE DRAWINGS

(1) FIG. 1 depicts the effect of the claimed strain on the Notch1, Notch2 signaling pathway and the expression of the VEGFR2 in HT-29 cell lines;

(2) FIG. 2 depicts the effect of the claimed strain on the expression level of other cancer-related signaling pathways in HT-29 cell lines;

(3) FIG. 3 depicts the effect of the claimed strain on the number of colorectal tumors in colorectal cancer model mice;

(4) FIG. 4 depicts the recovery of the claimed strain on the damage colorectal tissue of the colorectal cancer model mice;

(5) FIG. 5 depicts the improvement of the claimed strain on the levels of IL-17 and IFN-γ in serum of the colorectal cancer model mice;

(6) FIG. 6 depicts the effect of the claimed strain on the Notch1 and Notch2 signaling pathway and the expression level of VEGFR2 in intestinal tissue of the colorectal cancer model mice;

(7) FIG. 7 depicts the effect of the claimed strain on the short chain fatty acids in the intestine of the colorectal cancer model mice;

(8) FIG. 8 depicts the improvement of the claimed strain on the population of the intestinal flora of the colorectal cancer model mice.

DETAILED DESCRIPTION

(9) Detailed description to the present invention is provided with drawings, embodiments and examples as follows.

Example 1: Lactobacillus plantarum CCFM164 has Good Tolerance to the Simulated Gastrointestinal Fluid

(10) The frozen Lactobacillus plantarum CCFM164 was streaked and inoculated on a MRS solid plate, and the plate was incubated at 37° C. for 24 hours under aerobic cultivation, followed by 2 to 3 times subculture in the MRS culture medium. The culture medium with Lactobacillus plantarum CCFM164 was collected and centrifuged at a speed of 8000×g for 5 minutes to obtain bacteria, and then resuspended and mixed (1:1) in pH 2.5 of artificial simulated gastric juice (MRS medium containing 1% pepsin, pH 2.5), followed by anaerobic cultivation at 37° C. The samples were collected at the beginning (0 h), 1 h, 2 h, and 3 h, respectively, and the sample were cultured on MRS medium agar plate for colony counting. The viability numbers can be counted and the survival rates can be calculated accordingly. The survival rate is the rate of the viable count at the desired time point to the viable count at the 0 hour, which is expressed in %.

(11) The medium cultured with the strain of Lactobacillus plantarum CCFM164 was taken and centrifuged at a speed of 8000×g for 5 minutes. The bacteria were collected and resuspended (1:1) in artificial simulated intestinal fluid (MRS medium containing 0.3% bile salts from ox, 1% trypsin, pH 8.0), followed by aerobic cultivation at 37° C. The samples were collected at the 0 h, 1 h, 2 h, 3 h, and 4 h, respectively, and the samples were cultured on MRS medium agar plate for colony counting. The viability numbers can be counted and the survival rates can be calculated accordingly. The survival rate is the rate of the viable count at the desired time point to the viable count at the 0 hour, which was expressed in %. The experiment results were shown in Table 1 and Table 2. The results showed that Lactobacillus plantarum CCFM164 has a good tolerance to artificial simulated gastrointestinal fluid and intestinal fluid.

(12) TABLE-US-00001 TABLE 1 Tolerance of Lactobacillus plantarum CCFM164 to simulated gastrointestinal fluid Artificial simulated gastrointestinal fluid Treatment Time (h) 1 2 3 Survival Rate (%) 95.81 ± 2.11 92.78 ± 3.19 90.66 ± 5.15

(13) TABLE-US-00002 TABLE 2 Tolerance of Lactobacillus plantarum CCFM164 to simulated intestinal fluid Treatment Artificial simulated intestinal fluid Time (h) 1 2 3 4 Survival 92.21 ± 4.31 82.22 ± 5.28 75.82 ± 3.41 66.34 ± 6.55 Rate (%)

Example 2: Regulation of Lactobacillus plantarum CCFM164 on Notch1, Notch2, VEGFR2 and Colon Cancer-Related Signaling Pathways in HT-29 Cells

(14) The sludges of Lactobacillus plantarum CCFM164 (or control group of Lactobacillus plantarum LP60, LGG, E. coli) were washed twice with PBS and resuspended in RPMI1640 cell culture medium without antibiotics to make the cell density to about 2×10.sup.8 CFU/mL; 2 mL of the CCFM164 (or LP60, LGG, E. coli) suspension was added to a 6 well plate in which HT-29 cells had been cultured in advance (with 95% confluence), and the blank group was added with 2 mL of cell culture medium without antibiotics and placed in a cell incubator containing 5% of CO.sub.2 at 37° C. for 2 hours; after the cells were washed 3 times with PBS, 1 mL of TRIzol was added to each well (6 well plate). After being standed at room temperature for 5 minutes, the cells were repeatedly pipetted by an enzyme-free pipetman, then transferred to a 1.5 mL enzyme-free eppendorf, and the total RNAs of the cells were extracted according to the TRIzol instruction manual; a process of reverse transcription was performed in accordance with the Takara RR047A instruction manual; fluorescence-based quantitative PCR was conducted in accordance with the Bio-Rad iTaq Universal SYBR Green Supermix instruction manual, and the primers used herewith were shown in Table 3.

(15) TABLE-US-00003 TABLE 3 qPCR primer sequence Primer name Primer sequence (5′-3′) GAPDH (H) F: ATTGCCGACAGGATGCAGAA R: GCTGATCCACATCTGCTGGA Hes1 (H) F: GCTGATGGCCCTAAACAGATG R: TGGTGGTCGGAGATTCGTAG Notch1 (H) F: TCCAGCCTCACCACTCACAAG R: TTCATTTCATCTTCACCACAACTCC Notch2 (H) F: AAAAATGGGGCCAACCGAGAC R: TTCATCCAGAAGGCGCACAA VEGFR2 (H) F: ACTGTCATCCTTACCAATCCCA R: ATCTGGGGTGGGACATACAC p21 (H) F: ACAGCCACTCACCTCTTCAG R: GCCTCTTTGCTGCTTTCACA MYC (H) F: TACAGCCACCATGAGAAGGAC R: TGATCGTCTTTAGCCTTTCCA CyclinD1 (H) F: GCTGCGAAGTGGAAACCATC R: CCTCCTTCTGCACACATTTGAA β-catenin (H) F: CATCTACACAGTTTGATGCTGCT R: GCAGTTTTGTCAGTTCAGGGA FZD1 (H) F: ATCTTCTTGTCCGGCTGTTACA R: GTCCTCGGCGAACTTGTCATT KLF4 (H) F: CGGACATCAACGACGTGAG R: GACGCCTTCAGCACGAACT

(16) The results were shown in FIG. 1 and FIG. 2. The Lactobacillus plantarum CCFM164 showed a downregulation at the transcription levels of Notch1, Notch2, Hes1, and VEGFR2 genes in HT-29 cells, while LGG only showed a certain downregulation at the transcription levels of Notch1 and Hes1 genes, but LGG did not show a significant downregulation of Notch2 and VEGFR2; the Lactobacillus plantarum CCFM164 also significantly inhibited the transcription of Notch1 and Hes1 in comparison with LGG; the Lactobacillus plantarum LP60 and E. coli did not significantly downregulate the transcription levels of Notch1, Notch2, Hes1 and VEGFR2, and LP60 upregulated the expression level of Notch1 instead. Test results for other tumor-related signaling molecules indicated that the transcriptional regulation of LGG on tumor-related signaling molecules, except for Notch1/2, VEGFR2, CyclinD1, and KLF4, was stronger than the Lactobacillus plantarum CCFM164. It means that not all strains of Lactobacillus plantarum can inhibit the occurrence of colorectal cancer, and the inhibition mechanism of Lactobacillus plantarum CCFM164 to the occurrence of colorectal cancer is also different from LGG. The Lactobacillus plantarum CCFM164 mainly achieves the occurrence of colorectal tumors by regulating the levels of Notch signaling pathway and the level of VEGFR2. For example, E. coli in the control group only showed a certain downregulation at the transcription level of CyclinD1 but did not affect other molecules, and the Lactobacillus plantarum LP60 did not significantly affect the transcription levels of other molecules.

Example 3: Lactobacillus plantarum CCFM164 has No Toxic and Side Effects on Mice

(17) The Lactobacillus plantarum CCFM164 were resuspended in 2% (w/v) of sucrose solution to give a bacterial suspension with a concentration of 4.0×10.sup.9 CFU/mL. 10 healthy male BALB/c mice with a weight about 25 g were chosen and administered with above bacteria suspension by intragastric gavage once daily. The death and weight of the mice were observed and recorded for one week.

(18) The results were shown in Table 4, which showed that administration of the Lactobacillus plantarum CCFM164 with a concentration of 4.0×10.sup.9 CFU/mL did not have significant influences on mice. There was no significant change in body weight and death of mice, and there was no obvious pathological symptom in the appearance of the mice.

(19) TABLE-US-00004 TABLE 4 Changes in body weight and death of mice Time (day) 1 2 3 4 5 6 7 Weight (g) 25.5 ± 1.6 25.5 ± 1.7 25.6 ± 1.5 25.6 ± 1.6 25.7 ± 1.8 25.6 ± 1.9 25.7 ± 1.9 Death — — — — — — — Note: “—”, no death of mice.

Example 4: Alleviating Effect of Lactobacillus plantarum CCFM164 on Colorectal Cancer of Mice

(20) 48 healthy male BALB/c mice with weight from 20 to 25 g were chosen and divided into 6 groups randomly: blank control group, colorectal cancer model control group, Lactobacillus plantarum CCFM164 intervention group, Lactobacillus plantarum LP60 control group, LGG control group, E. coli control group, and 8 mice per group.

(21) The model control group, Lactobacillus plantarum CCFM164 intervention group, Lactobacillus plantarum LP60 control group, LGG control group and E. coli control group were developed colorectal cancer models by an AOM-DSS method. That is, after initial AOM intraperitoneal injection (7.5 mg/kg), 2% (m/v) DSS was given in the drinking water for 4 days followed by regular drinking water for 7 days; and mice were subjected to a second DSS cycle with 2% (m/v) DSS given in the drinking water for 4 days followed by regular drinking water for 15 days.

(22) During the process of modeling, the mice in the intervention groups were administered with 0.25 mL suspension of Lactobacillus plantarum CCFM164 prepared according to Example 3 of the present invention with a concentration of 4.0×10.sup.9 CFU/mL, while the mice in the LP60 control group were administered with an equal amount of LP60, the mice in LGG control group were administered with an equal amount of LGG, the mice in E. coli control group were administered with an equal amount of E. coli, and the remaining 2 groups were administered with an equal amount of 2% (w/v) bacteria-free sucrose solution.

(23) After completion of developing the model, the serum, colon and rectum of model mice were taken, where the colon and rectum were cut along the axis for calculation of the number of tumors. Meanwhile, the colon tissues were taken and prepared as paraffin sections, then stained through HE staining.

(24) The results of tumor numbers were shown in FIG. 3. It could be seen by comparing the blank control group and the model control group that the AOM-DSS method could induce mice to develop colorectal cancer. The results showed that the intervention group which was intragastric administrated the Lactobacillus plantarum CCFM164 claimed in the present invention could significantly reduce the number of tumors, and the effect of the Lactobacillus plantarum CCFM164 was better than LGG. However, the inhibitory effect of LP60 and E. coli on tumorigenesis was not obvious, and 3 mice died in the E. coli group. H&E staining results were shown in FIG. 4. It could be clearly seen from the slices section that severe lesions had occurred in the model group, LP60 control group and E. coli control group. In comparison with the normal mice, malignant proliferating cells had increased significantly, and the tumors had grown inward. The integrity of cell infiltration, tumor or intestinal mucosa after intragastric administration of Lactobacillus plantarum CCFM164 has been improved, and the improvement is stronger than the LGG group.

Example 5: Regulation of Lactobacillus plantarum CCFM164 on the Colitis-Associated Inflammatory Factors in the Serum of Mice with Colorectal Cancer

(25) The serum obtained in Example 4 was taken, and the content of cytokines in the serum was measured by a flow cytometer. The concentrations of the colitis-associated inflammatory factors such as IL-17 and IFN-γ were measured in accordance with the manual of the kit (Milliplex Map kit) and the manual of Luminex.

(26) The results were shown in FIG. 5. In comparison with the blank control group, the levels of IL-17 and IFN-γ in the serum of colorectal cancer model mice were significantly increased (the data corresponding to each column in the figure are the relative concentration of cytokines in the serum compared to the blank control group). The Lactobacillus plantarum CCFM164 could significantly reduced the levels of IL-17 and IFN-γ to normal levels, but the LGG, LP60 and E. coli had no significant inhibitory effect on the increase of IL-17 and IFN-γ levels.

Example 6: Regulation of Lactobacillus plantarum CCFM164 on the Notch 1 and Notch 2 Signaling Pathway and the Expression Level of VEGFR2 in Colon Tissue of the Mice

(27) About 1 cm of colon tissue in Example 4 was taken, and 1 mL of TRIzol and 3 steel balls that have been sterilized through dry heat sterilization were added, then a tissue crusher was used to crush the tissue at a frequency of 70 Hz for 30 s as a cycle and repeat 3 times. After that, the solution was transferred to an 1.5 mL RNase-free eppendorf, and the total RNA was extracted, reverse transcribed, and then subjected to qPCR according to the method of Example 2. The primers used herewith are shown in Table 5.

(28) TABLE-US-00005 TABLE 5 qPCR primer sequence Primer name Primer sequence (5′-3′) GAPDH (M) F: TGGCCTTCCGTGTTCCTAC R: GAGTTGCTGTTGAAGTCGCA Hes1 (M) F: TCAACACGACACCGGACAAA R: ATGCCGGGAGCTATCTTTCTT Notch1 (M) F: CCCTTGCTCTGCCTAACGC R: GGAGTCCTGGCATCGTTGG Notch2 (M) F: AACATTGGGTTGATGATGAAGG R: GAGGAGTGAGTGCCAGGGAT VEGFR2 (M) F: GCAGAAGCAGCACGAAGTGTT R: GGAAGATGTACTCGATCTCA

(29) The results were shown in FIG. 6. All of LP60, LGG, E. coli and Lactobacillus plantarum CCFM164 downregulated the transcription levels of the abnormally elevated Notch1 gene in colon tissue of the mice; only the Lactobacillus plantarum CCFM164 downregulated the transcription levels of Notch2 gene; only the LGG and Lactobacillus plantarum CCFM164 signifigently downregulated the transcription levels of Hest gene in mice, and the effect of the Lactobacillus plantarum CCFM164 was better than LGG; only the Lactobacillus plantarum CCFM164 signifigently downregulated the transcription levels of VEGFR2.

Example 7: Lactobacillus plantarum CCFM164 Downregulated the Expression Level of Butyric Acid in the Intestine of Model Mice

(30) 50 mg fecal samples of the mice in Example 4 were taken, and 5004, of saturated NaCl solution was added and adequately shaken with the samples, then 20 μL of 10% sulfuric acid solution was added and adequately shaken again, then 8004, of ether was added and adequately shaken once again; After being centrifuged at a speed of 18000×g, 4° C. for 15 minutes, the supernatant was taken and adequately shaken with 0.25 g of sodium sulfate anhydrous, and the mixture was centrifuged again at a speed of 18000×g, 4° C. for 15 minutes; the supernatant was transferred into a gas bottle for gas analysis.

(31) The results were shown in FIG. 7. There was no significant changes in the content of acetic acid and propionic acid in the intestine of model mice with colon cancer. However, the content of butyric acid increased significantly compared with the blank group. The Lactobacillus plantarum CCFM164 and LGG could significantly reduce abnormally elevated levels of butyric acid, and the extent of the Lactobacillus plantarum CCFM164 on reducing butyric acid levels was much greater than LGG. The LP60 only had a certain effect on acetic acid, and E. coli had no significant effect on the levels of all three acids.

Example 8: Recovery of the Lactobacillus plantarum CCFM164 on Dysregulation of Intestinal Flora in Colon Cancer Mouse Model

(32) The metagenome of 0.1 g feces of mice in Example 4 were taken and extracted according to the instructions of the kit (FastDNA Spin Kit for Soil) with slight modification, the specific method is shown below. Add about 0.1 g of feces to a Lysing Matrix E tube, and add 978 μL of Sodium Phosphate Buffer and 122 μL of MT Buffer, then stand the tube at room temperature for 30 min; use Fastprep with a speed of 6.0, set the time to 40, and start crushing; centrifuge the mixture at a speed of 14000×g, 4° C. for 10 min and take the supernatant, after that add 250 μL of PPS, mix upside down; centrifuge the mixture at a speed of 14000×g, 4° C. for 10 min and take the supernatant, add 1 mL of Binding Matrix Suspension, mix upside down and take the supernatant, and then add 1 mL of Binding Matrix Suspension. After upside down mixing, leave the mixture at room temperature for 3 minutes, and discard 650 μL of the supernatant. After vortex and resuspension, transfer 650 μL of the suspension to a SPIN Fitter, centrifuge at 14000×g, 4° C. for 2 min, then discard the liquid in the tube and repeat above steps; add 500 μL of SEWS-M (add 100 mL of absolute ethanol before use it and vortex and mix thoroughly), then centrifuge at 14000×g, 4° C. for 1 min and discard the liquid in the tube, after that centrifuge again under the same conditions; use a new liquid collection tube and let it stand at room temperature for 5 minutes; add 50 μL of DES and place it in a metal bath at 55° C. for 5 minutes; then centrifuge at 14000×g, 4° C. for 1 minute, and the DNA solution can be obtained in the liquid collection tube. The obtained DNA solution was sent to a second-generation sequencer for sequencing and analysis.

(33) The results were shown in FIG. 8. The Firmicutes in the intestine of model mice was significantly reduced, while the Verrucomicrobia and Fusobacteria were significantly increased. Ingestion of the Lactobacillus plantarum CCFM164 could significantly increase the abundance of Firmicutes in the intestine of model mice and inhibit the abnormally increased Verrucomicrobia and Fusobacteria; LGG could also partially restore the dysfunctional intestinal flora population. However, LGG had no significant inhibitory effect on the abnormally increased Verrucomicrobia, and the abundance of Firmicutes was still low; LP60 or E. coli can partially restore the proportion of the Firmicutes, but not other bacteria.

Example 9: Dairy Products Made from Lactobacillus plantarum CCFM164 as Claimed in the Present Invention

(34) The raw milk (skim milk) was sterilized by heat at 95° C. for 20 min, and cooled to 4° C., and then a Lactobacillus plantarum CCFM164 ferment described in the present specification was added to make its concentration reaches 10.sup.6 CFU/mL or more, and store it under refrigeration at 4° C. Thus, the dairy product containing Lactobacillus plantarum CCFM164 as claimed in the present invention was obtained.

(35) Though reference is made to preferred examples for detailed illustration of the present invention and non-limiting thereto, a skilled person in the art should understand that the technical solutions provided by the present invention can be changed or replaced by equivalents without departing from the spirit and scope of the technical solutions described herein, which should fall within the scope of the appended claims.

SEQUENCE LISTING

(36) This application contains a sequence listing which has been submitted in ASCII text file via EFS-Web and is hereby incorporated by reference in its entirety. The ASCII-formatted sequence listing, is named P1616US00 sequence listing.txt, and is 6,574 bytes in size.

(37) SEQ ID NO: 1 in the sequence listing file is the corresponding GAPDH(H) upstream primer, and SEQ ID NO: 2 in the sequence listing file is the corresponding GAPDH(H) downstream primer;

(38) SEQ ID NO: 3 in the sequence listing file is the corresponding Hes1(H) upstream primer, and SEQ ID NO: 4 in the sequence listing file is the corresponding Hes1(H) downstream primer;

(39) SEQ ID NO: 5 in the sequence listing file is the corresponding Notch1(H) upstream primer, and SEQ ID NO: 6 in the sequence listing file is the corresponding Notch1(H) downstream primer;

(40) SEQ ID NO: 7 in the sequence listing file is the corresponding Notch2(H) upstream primer, and SEQ ID NO: 8 in the sequence listing file is the corresponding Notch2(H) downstream primer;

(41) SEQ ID NO: 9 in the sequence listing file is the corresponding VEGFR2(H) upstream primer, and SEQ ID NO: 10 in the sequence listing file is the corresponding VEGFR2(H) downstream primer;

(42) SEQ ID NO: 11 in the sequence listing file is the corresponding p21(H) upstream primer, and SEQ ID NO: 12 in the sequence listing file is the corresponding p21(H) downstream prime;

(43) SEQ ID NO: 13 in the sequence listing file is the corresponding MYC(H) upstream primer, and SEQ ID NO: 14 in the sequence listing file is the corresponding MYC(H) downstream primer;

(44) SEQ ID NO: 15 in the sequence listing file is the corresponding CyclinD1(H) upstream primer, and SEQ ID NO: 16 in the sequence listing file is the corresponding CyclinD1(H) downstream primer;

(45) SEQ ID NO: 17 in the sequence listing file is the corresponding β-catenin(H) upstream primer, and SEQ ID NO: 18 in the sequence listing file is the corresponding β-catenin(H) downstream primer;

(46) SEQ ID NO: 19 in the sequence listing file is the corresponding FZD1(H) upstream primer, and SEQ ID NO: 20 in the sequence listing file is the corresponding FZD1(H) downstream primer;

(47) SEQ ID NO: 21 in the sequence listing file is the corresponding KLF4(H) upstream primer, and SEQ ID NO: 22 in the sequence listing file is the corresponding KLF4(H) downstream primer;

(48) SEQ ID NO: 23 in the sequence listing file is the corresponding GAPDH(M) upstream primer, and SEQ ID NO: 24 in the sequence listing file is the corresponding GAPDH(M) downstream primer;

(49) SEQ ID NO: 25 in the sequence listing file is the corresponding Hes1(M) upstream primer, and SEQ ID NO:26 in the sequence listing file is the corresponding Hes1(M) downstream primer;

(50) SEQ ID NO: 27 in the sequence listing file is the corresponding Notch1(M) upstream primer, and SEQ ID NO: 28 in the sequence listing file is the corresponding Notch1(M) downstream primer;

(51) SEQ ID NO: 29 in the sequence listing file is the corresponding Notch2(M) upstream primer, and SEQ ID NO: 30 in the sequence listing file is the corresponding Notch2(M) downstream primer;

(52) SEQ ID NO: 31 in the sequence listing file is the corresponding VEGFR2(M) upstream primer, and SEQ ID NO: 32 in the sequence listing file is the corresponding VEGFR2(M) downstream primer.