Cell strain for reducing production of replication competent adenovirus, and construction method and use thereof
11795475 · 2023-10-24
Assignee
Inventors
- Tao Zhu (Tianjin, CN)
- Haiyan Cui (Tianjin, CN)
- Weiwei Chen (Tianjin, CN)
- Lei Duan (Tianjin, CN)
- Junqiang LI (Tianjin, CN)
- Jin Ma (Tianjin, CN)
- Chunlin Xin (Tianjin, CN)
- Zhongqi SHAO (Tianjin, CN)
- Xuefeng YU (Tianjin, CN)
- Huihua Mao (Tianjin, CN)
Cpc classification
International classification
Abstract
Provided are a cell strain HEK293.CS for reducing the production of a replication competent adenovirus, and a construction method and the use thereof. HEK293.CS is a safe adenovirus-producing cell line constructed by knocking out a gene fragment homologous to the Ad5 adenovirus E1 gene in HEK293 and providing a template plasmid to replace said gene fragment with a non-homologous sequence that stabilizes the expression of the E1 gene. Compared with the unmodified HEK293 cell strain, HEK293.CS shows no decrease in growth ability and virus production ability, but does not produce a detectable RCA. HEK293.CS can be used for the mass culture of a recombinant human type 5 adenovirus, and reducing the probability of RCA production in the manufacture process of drugs such as vaccines and antibodies.
Claims
1. A cell strain for reducing the production of replication competent adenovirus, wherein the cell strain is HEK293, and the ITR and E1 A Promoter sequences of the cell E1 gene are replaced with a heterologous control element.
2. The cell strain for reducing the production of replication competent adenovirus according to claim 1, wherein the heterologous control element is a PGK Promoter, and the base sequence of the PGK promoter is represented by the sequence of SEQ ID NO:1.
3. A method for manufacturing a vaccine or antibody, wherein a cell strain according to claim 1 is used for the production of non-proliferative adenovirus.
4. The method according to claim 3, wherein the adenovirus is a recombinant human type 5 adenovirus.
5. A modified cell or a passage cell thereof, wherein the ITR and E1A Promoter sequence (abbreviated as ITR+E1A Promoter) of E1 gene in the cell or its passage cell is replaced with a heterologous control element, the sequence of the heterologous control element is less than 35% similar to that of the ITR+E1A Promoter, the cell is a HEK293 cell; and the heterologous control element is selected from a group consisting of: a chicken β-actin promoter, a CMV promoter, an HSV TK promoter, and a PGK promoter.
6. The cell or a passage cell thereof according to claim 5, wherein the cell or its passage cell contains 1 copy or more copies of the ITR+E1A Promoter, and some or all copies of the ITR+E1 A Promoters are replaced with heterologous control elements.
7. The cell or a passage cell thereof according to claim 5, wherein the heterologous control element is less than 35%, 33%, 32%, 31%, 30%, 29%, 28%, 26%, 25%, 23%, 22% or 20% similar to the ITR+E1 A Promoter sequence.
8. The cell or a passage cell thereof according to claim 5, wherein the ITR+E1 A Promoter sequence is the sequence represented by SEQ ID NO:2 or a homologous sequence thereof.
9. The cell or a passage cell thereof according to claim 5, wherein the sequence of the heterologous control element PGK Promoter is the sequence represented by SEQ ID NO:1.
10. A method for producing an adenovirus, wherein the method comprises infecting the cell according to claim 5 or a passage cell thereof with an adenovirus.
11. The method according to claim 10, wherein the adenovirus is Ad5 adenovirus.
12. The cell strain for reducing the production of replication competent adenovirus according to claim 1, wherein the heterologous control element is selected from a group consisting of: a chicken β-actin promoter, a CMV promoter, an HSV TK promoter, and a PGK promoter.
13. The cell strain for reducing the production of replication competent adenovirus according to claim 1, wherein the cell strain contains 1 copy or more copies of the ITR+E1 A Promoter, part or all copies of the ITR+E1A Promoters are replaced with the heterologous control elements.
14. The cell or a passage cell thereof according to claim 5, wherein the cell or its passage cell contains 1 copy or more copies of the ITR+E1A Promoter, all copies of the ITR+E1A Promoters are replaced with heterologous control elements.
15. The cell or a passage cell thereof according to claim 5, wherein the heterologous control element is PGK promoter.
Description
BRIEF DESCRIPTION OF THE DRAWINGS
(1)
(2)
(3)
(4)
DETAILED DESCRIPTION OF EMBODIMENTS
(5) The technical solutions of the present invention will be further described below in conjunction with particular embodiments.
(6) In the following examples, the replacement of the ITR+E1A Promoter sequence in the HEK293 cell with a PGK promoter is described as an illustrative example. Other heterologous control elements such as a chicken β-actin promoter, a CMV promoter, and a HSV TK promoter have similar results to that of a PGK promoter.
(7) A method for modifying the HEK293 cell by Crispr/Cas9n technology, wherein it comprises a specific target site sequence for ITR and E1A Promoter of E1 gene in the HEK293 cell, the base sequence of the specific target site is represented by SEQ ID NO:2 of the Sequence Listing; the sgRNA oligonucleotide sequence specifically targeting to ITR and E1A Promoter (ITR+E1A Promoter sequence is represented by SEQ ID NO:2 of the Sequence Listing), and the base sequence is shown in Table 1; the designed and synthesized homologous repair template PGK Promoter as shown in
(8) TABLE-US-00001 TABLE 1 sgRNA sequences Names Sequences sgRNA1 top CACCGTTGTGACGTGGCGCGGGGCG, the strand sequence represented by SEQ ID NO:3 of the Sequence Listing sgRNA1 bottom AAACCGCCCCGCGCCACGTCACAAC, the strand sequence represented by SEQ ID NO: 4 of the Sequence Listing sgRNA2 top CACCGCCACCCCCTCATTATCATAT, the strand sequence represented by SEQ ID NO: 5 of the Sequence Listing sgRNA2 bottom AAACATATGATAATGAGGGGGTGGC, the strand sequence represented by SEQ ID NO: 6 of the Sequence Listing sgRNA3 top CACCGCCTCCGAGCCGCTCCGACAC, the strand sequence represented by SEQ ID NO: 7 of the Sequence Listing sgRNA3 bottom AAACGTGTCGGAGCGGCTCGGAGGC, the strand sequence represented by SEQ ID NO: 8 of the Sequence Listing sgRNA4 top CACCGTACTCGCTGGCACTCAAGAG, the strand sequence represented by SEQ ID NO: 9 of the Sequence Listing sgRNA4 bottom AAACCTCTTGAGTGCCAGCGAGTAC, the strand sequence represented by SEQ ID NO: 10 of the Sequence Listing
(9) The above method for modifying the HEK293 cell by Crispr/Cas9n technology includes the following steps:
(10) S1. Designing and synthesizing a sgRNA specifically targeting to the ITR and E1A Promoter of E1 gene in the HEK293 cell, and annealing to form a double strand;
(11) S2. Constructing a double-stranded sgRNA into a PX462.V2.0 vector; S3. Designing and synthesizing a homologous repair template plasmid; S4. After mixing the sgRNA and the homologous repair template plasmid constructed in steps S2 and S3, they are transfected into the HEK293 cell, then screening a monoclonal cell strain in which E1 gene is successfully replaced, and its RCA forming ability after virus inoculation is detected.
(12) The final concentrations of PX462.V2.0-sgRNA and homologous repair template plasmid in step S4: PX462.V2.0-sgRNA1, PX462.V2.0-sgRNA2, PX462.V2.0-sgRNA3, and PX462.V2.0-sgRNA4 are respectively 20 ng/μL, and the PGK Promoter repair template plasmid is 25 ng/μL.
(13) A method for modifying E1 gene in the HEK293 cell by Crispr/Cas9n system, particularly it includes the following steps:
(14) (1) Selecting the target site of the ITR and E1 Promoter of E1 gene in the HEK293 cell, and designing the specific sequence of sgRNA by using software;
(15) (2) Designing and synthesizing sgRNA and homologous repair template plasmid, and cloning the sgRNA into the BbsI-digested vector backbone to obtain PX462.V2.0-sgRNA;
(16) (3) Mixing the obtained PX462.V2.0-sgRNA with the homologous repair template plasmid to the following final concentrations: PX462.V2.0-sgRNA1, PX462.V2.0-sgRNA2, PX462.V2.0-sgRNA3, and PX462.V2.0-sgRNA4 are respectively 20 ng/μL, and the PGK Promoter repair template plasmid is 25 ng/μL.
(17) (4) Transfecting the mixed PX462.V2.0-sgRNA and the homologous repair template plasmid into the HEK293 cell, and then the cell is subjected to resistance pressurization, thereby screening a gene-editing cell HEK293 in which the sequence of ITR and E1 Promoter of E1 gene is completely replaced.
Example 1
(18) Constructing a Crispr/Cas9n System for the ITR and E1 Promoter of E1 Gene in the HEK293 Cell
(19) First, according to the HEK293 genomic sequence in NCBI, the ITR and E1 Promoter of E1 gene is selected as a target site to design sgRNA. The target site sequence is shown in
(20) Second, the construction of the specific sgRNA sequence of PX462.V2.0-sgRNA:
(21) (1) Designing and synthesizing the sgRNA that recognizes the ITR and E1 Promoter of E1 gene;
(22) (2) Annealing the synthesized sgRNA oligonucleotide in vitro;
(23) (3) Digesting PX462.V2.0 through the Bsal site and ligating it with sgRNA, then designating as PX462.V2.0-sgRNA.
(24) Finally, a homologous repair template plasmid is designed according to the target site sequence of the sgRNA.
Example 2
(25) Cell Transfection
(26) HEK293 cells are inoculated at a density of 4×10.sup.5/well in a six-well plate, and transfected when they grow to 70%-90% (about 18-20 h) fusion rate. Transfecting the cells with 20 μL of premixed PX462.V2.0-sgRNA and PGK Promoter template repair plasmid (the following final concentrations: PX462.V2.0-sgRNA1, PX462.V2.0-sgRNA2, PX462.V2.0-sgRNA3, PX462.V2.0-sgRNA4 are respectively 20 ng/μL, and PGK Promoter Repair template plasmid is 25 ng/μL) and 5 μL of Lipo2000 transfection reagent, then adding SCR7 non-homologous recombination inhibitor (final concentration: 0.01 mM) after 12 h, and adding Puromycin (final concentration: 3 μg/mL) after 36 h for screening.
Example 3
(27) Screening Verification
(28) The method shown in
(29) The validation primers are shown in Table 2. It can be seen from the sequencing results in
(30) TABLE-US-00002 TABLE 2 Primer sequences for detection Names Sequences ProF TCTCGCACATTCTTCACGTC, the sequence repre- sented by SEQ ID NO: 11 of the Sequence Listing AdR CGTTAACCACACACGCAATC, the sequence repre- sented by SEQ ID NO: 12 of the Sequence Listing YSF CTGCTTCGCCGAGTCTAAC, the sequence represented by SEQ ID NO: 13 of the Sequence Listing YSR CCACATCCGTCGCTTACA, the sequence represented by SEQ ID NO: 14 of the Sequence Listing YZF CTGTTCCAGAAGCCCTAT, the sequence represented by SEQ ID NO: 15 of the Sequence Listing YZR ACACCTCCGTGGCAGATA, the sequence represented by SEQ ID NO: 16 of the Sequence Listing
Example 4
(31) Detection of the Virus-Producing Ability
(32) HEK293 and the modified HEK293 cells are separately inoculated into 10 cm cell culture dishes, each kind of cells are respectively infected with Ad5-EBOV (GP) and Ad5-TB (Ag85A) viruses having a MOI (multiplicity of infection) of 10. The infected cells are harvested on the third day, at that time most of the cells are lysed and floated, indicating that the viruses are replicated. After harvesting the cells and the supernatant, the viruses are released from the lysed cells after three cycles of repeated freezing/thawing, and the cell debris is removed by centrifugation, followed by purification through column chromatography. The ratio of virus particles/cells is given as a measure of the cell productivity for the growth of different viruses through dividing the total virus particles by the number of cells at the time of infection, thereby determining the virus-producing ability of the cells before and after the transformation. Table 3 shows that the yields of the adenoviral vectors produced by HEK293 or the modified HEK293 cells are nearly equivalent.
(33) TABLE-US-00003 TABLE 3 Comparison of virus-producing ability of the HEK293 cell and that of the modified HEK293.CS cell after transformation Yields of the viruses (IFU/ml) Viruses HEK293 cell modified HEK293 Ad5-EBOV (GP) (3 ± 0.02) × 10.sup.9 (2.1 ± 0.01) × 10.sup.9 Ad5-TB (Ag85A) (3 ± 0.03) × 10.sup.9 .sup. (3 ± 0.02) × 10.sup.9
Example 5
(34) RCA Detection
(35) 3×10.sup.10 or 3×10.sup.11 purified Ad5-GP virus particles after the propagation of HEK293 or the modified HEK293 are used, and RCA is detected by using the existing biological test method (Quality control of clinical grade gene therapy products of recombinant adenovirus. [J]. Zhang Xiaozhi, Lin Hong, Yang Xiaoyan, et al. Chinese Medical Journal, 2004, 84 (10), 849-852.) Zhang Xiaozhi et al., Chinese Journal of Medicine, 2004). The detection results are shown in Table 4. It can be seen from Table 4, when the sample size is 3×10.sup.10 VP, one RCA can be detected in the Ad5-GP viruses propagated in HEK293 cells, and when the sample size is increased to 3×10.sup.11 VP, 13 RCAs are detected in the Ad5-GP viruses propagated in HEK293 cells, but no RCA is detected in the two sample sizes of the Ad5-GP viruses propagated in the modified HEK293 cells.
(36) TABLE-US-00004 TABLE 4 Comparison of the RCA formation ability of the HEK293 cell and that of the modified HEK293.CS cell after transformation The cell for The number of RCAs in The number of RCAs in producing viruses 3 × 10.sup.10 viruses 3 × 10.sup.11 viruses HEK293 1 13 The modified 0 0 HEK293
(37) The above detailed description of the cell strain for reducing the production of the replication competent adenovirus and construction method and use thereof referring to the Examples are illustrative and not limiting, and several examples can be listed according to the limited scope, therefore the variations and modifications within the spirit of the invention should fall into the protection scope of the invention.