Method for reducing inflammation of chondrocytes caused by uric acid crystals using <i>Lactobacillus plantarum </i>TCI227
11793842 · 2023-10-24
Assignee
Inventors
Cpc classification
A61P19/06
HUMAN NECESSITIES
International classification
A01N63/00
HUMAN NECESSITIES
A61P19/06
HUMAN NECESSITIES
Abstract
The present disclosure provides a method for regulating expression of IL-1β gene, MMP1a gene and TIMP1 gene of chondrocytes using a Lactobacillus plantarum strain TCI227.
Claims
1. A method for reducing inflammation of chondrocytes caused by uric acid crystals, comprising administering to a subject in need thereof a composition comprising an effective amount of Lactobacillus plantarum TCI227 deposited in Deutsche Sammlung von Mikrooruanismen and Zellkulturen under an accession number of DSM 33287.
2. The method according to claim 1, wherein the Lactobacillus plantarum TCI227 down-regulates expression of IL-1β gene and MMP1a gene and upregulates expression of TIMP1 gene to achieve the reduction of inflammation of chondrocytes caused by uric acid crystals.
3. The method according to claim 1, wherein the effective amount of the Lactobacillus plantarum TCI 227 is at least 5×10.sup.8 cells/mL.
4. The method according to claim 1, wherein the Lactobacillus plantarum TCI227 comprises an inactivated bacterium.
5. The method according to claim 1, wherein the composition is a medicament or a food product.
Description
BRIEF DESCRIPTION OF THE DRAWINGS
(1) The following drawings form part of the present specification and are included here to further demonstrate some aspects of the present invention, which can be better understood by reference to one or more of these drawings, in combination with the detailed description of the embodiments presented herein.
(2)
(3)
(4)
(5)
(6)
(7)
DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENT
(8) In the following detailed description of the embodiments of the present invention, reference is made to the accompanying drawings, which are shown to illustrate the specific embodiments in which the present disclosure may be practiced. These embodiments are provided to enable those skilled in the art to practice the present disclosure. It is understood that other embodiments may be used and that changes can be made to the embodiments without departing from the scope of the present invention. The following description is therefore not to be considered as limiting the scope of the present invention.
(9) Definition
(10) As used herein, the data provided represent experimental values that can vary within a range of ±20%, preferably within ±10%, and most preferably within ±5%.
(11) Statistical analysis was performed using Excel. Data are expressed as mean±standard deviation (SD), and the difference between each group is analyzed by the Student's t-test.
(12) According to the present invention, Lactobacillus plantarum is a Gram-positive anaerobic bacterium that grows at temperatures above 15° C. but not exceeding 45° C. and produces lactic acid.
(13) As used herein, the term “treating” or “treatment” refers to alleviating, reducing, ameliorating, relieving, or controlling one or more clinical signs of a disease or disorder, and lowering, stopping, or reversing the progression of severity regarding the condition or symptom being treated.
(14) According to the present invention, the medicament can be manufactured to a dosage form suitable for parenteral or oral administration, using techniques well known to those skilled in the art, including, but not limited to, injection (e.g., sterile aqueous solution or dispersion), sterile powder, tablet, troche, lozenge, pill, capsule, dispersible powder or granule, solution, suspension, emulsion, syrup, elixir, slurry, and the like.
(15) The medicament according to the present invention may be administered by a parenteral route selected from the group consisting of: intraperitoneal injection, subcutaneous injection, intramuscular injection and intravenous injection.
(16) According to the present invention, the medicament may further comprise a pharmaceutically acceptable carrier which is widely used in pharmaceutically manufacturing techniques. For example, the pharmaceutically acceptable carrier can comprise one or more reagents selected from the group consisting of solvent, emulsifier, suspending agent, decomposer, disintegrating agent, dispersing agent, binding agent, excipient, stabilizing agent, chelating agent, diluent, gelling agent, preservative, lubricant, absorption delaying agent, liposome, and the like. The selection and quantity of these reagents fall within the scope of the professional literacy and routine techniques of those skilled in the art.
(17) According to the present invention, the pharmaceutically acceptable carrier comprises a solvent selected from the group consisting of water, normal saline, phosphate buffered saline (PBS), sugar-containing solution, aqueous solution containing alcohol, and combinations thereof.
(18) According to the present invention, the food product can be used as a food additive, added by the conventional method in the preparation of the raw material, or added during the preparation of food, and prepared with any edible material into food products for human and non-human animals.
(19) According to the present invention, types of food products include, but not limited to, beverages, fermented foods, bakery products, health foods, and dietary supplements.
Example 1
Evaluation of the Effect of Lactobacillus plantarum Strain TCI227 on Reducing Inflammatory Response Caused by Uric Acid Crystals
(20) It was investigated in this example whether the Lactobacillus plantarum strain TCI227 which was deposited in Deutsche Sammlung von Mikroorganismen and Zellkulturen (Address: Inhoffenstr. 7 B D-38124 Braunschweig, Germany) on Sep. 19, 2019, under an accession number DSM 33287, and deposited in Biosource Collection and Research Center (BCRC) of Food Industry Research and Development Institute (FIRDI) on Apr. 15, 2019, under an accession number BCRC 910884 can regulate the gene expression related to inflammation to reduce the inflammatory response caused by uric acid crystals.
(21) First, the inactivated cells of the Lactobacillus plantarum strain TCI227 were prepared, and the preparation process was as follows: the Lactobacillus plantarum strain TCI227 of the present invention in the frozen bacterial culture preservation tube was activated by a single culture of the MRS medium. 1% of the activated bacterial solution was cultured in a new medium and cultured at 37° C. for 16 hours, and centrifuged at 10,000 rpm for 5 minutes. The medium was removed and washed with PBS, and this action was repeated 3 times. PBS was used to resuspend the bacteria as 1 OD suspension. The suspension was sterilized at 121° C. for 15 minutes to obtain TCI227 inactivated cells.
(22) Mouse chondrocytes (ATDC5, purchased from the American Type Culture Collection (ATCC)) were cultured in Dulbecco's Modified Eagle's Medium (DMEM) and Ham's F12 medium (1:1) (supplemented with 2 mM glutamine and 5% fetal bovine serum (FBS)(Gibco)) in 6-well plates, and the cell concentration in 2 mL of the medium was 1×10.sup.5 cells/well. After 24 hours of culture, new medium was replaced.
(23) Thereafter, the cells were divided into three groups including one blank control group, one pathological control group, and one experimental group. Among them, the experimental group was treated by diluting the inactivated cells of Lactobacillus plantarum strain TCI227 into a dilution having a concentration of 5×10.sup.8 cells/mL, and a 5×10.sup.8 cells/mL dilution and 0.125 mg/mL uric acid crystals (monosodium urate, MSU) were added to the cells in the experimental group. The pathological control group was treated by adding 0.125 mg/mL uric acid crystals to the cells in the pathological control group, and the cells in the blank control group were added with medium. Each group of cells was cultured in an incubator for 24 hours, and then each group of cell cultures was collected and used for gene expression analysis.
(24) In this example, genes for analyzing inflammation include the interleukin-1β (IL-1β) gene, the tumor necrosis factor-α (TNF-α) gene, the matrix metallopeptidase la (MMP1a) gene, and the TIMP metallopeptidase inhibitor 1 (TIMP1) gene.
(25) RNA extraction was performed using an RNA extraction kit (Genemark). 2,000 ng of the RNA in each group thus obtained was taken and the extracted RNA was reverse transcribed into cDNA by SuperScript® III reverse transcriptase (Invitrogen). The cDNA was used as a template, primer pairs for amplification of target genes, including IL-1β, TNF-α, MMP1a, and TIMP1 were used, and their nucleotide sequences are shown in Table 1. The quantification of target genes was measured by quantitative real-time PCR using KAPA SYBR FAST qPCR kit (2×) (KAPA Biosystems) carried out in Step One Plus Real-Time PCR system (ABI). The melting curves of the PCR product were analyzed during the quantitative real-time PCR.
(26) TABLE-US-00001 TABLE 1 PCR SEQ product Target ID Primer size gene NO.# name Sequence (5′.fwdarw.3′) (bp) IL-1β 1 IL1B-F TTGGGCCTCAAAGGAAAGAA 200 2 IL1B-R TGTGAGGTGCTGATGTACCAGTT TNF-α 3 TNFA-F CCCAAGGCGCCACATCT 200 4 TNFA-R CACCCCGAAGTTCAGTAGACAGA MMP1α 5 MMP1a-F GGGCAAAAACATGCAAGCTAA 200 6 MMP1a-R GTGTTTTGGTACGAGGATTGTTGT TIMP1 7 TIMP1-F GCCTAAGGAACGGAAATTTGC 200 8 TIMP1-R AGCCCACGAGGACCTGATC
(27) The results of this example are shown in
(28)
(29)
(30)
Example 2
Evaluation of Effect of Lactobacillus Plantarum Strain TCI227 on Treating Gout in Human Trials
(31) In this example, it was investigated whether the Lactobacillus plantarum strain TCI227 of the present invention can treat gout by human trials. First, three gout patients were recruited. The condition of the subjects was high uric acid and a medical history of gout. Each gout patient was orally administered with the Lactobacillus plantarum strain TCI227 (in capsule form, at a dose of 1×10.sup.10 cells/day). One capsule was taken daily and the blood uric acid value was examined before administration, 4 weeks and 8 weeks after administration. The experimental result is shown in
(32)
(33) In addition, skeletal muscle ultrasound observation was performed on the gout patients before and after 8 weeks of taking the Lactobacillus plantarum strain TCI227, and the result is shown in
(34) In summary, the Lactobacillus plantarum strain has the effect on reducing the inflammatory reaction caused by uric acid crystals, lowering uric acid value, reducing the degree of joint swelling, and regulating expressions of IL-1β gene, MMP1a gene, and TIMP1 gene of chondrocytes.
(35) Although the present invention has been described with reference to the preferred embodiments, it will be apparent to those skilled in the art that a variety of modifications and changes in form and detail may be made without departing from the scope of the present invention defined by the appended claims.