Enhanced sleeping beauty transposons, kits and methods of transposition

Abstract

The present invention relates to enhanced Sleeping Beauty-type transposons and methods of transposition. In particular the invention relates to a polynucleotide comprising a cargo nucleic acid flanked by a left and a right inverted repeat/direct repeat (IR/DR), wherein IR/DRs, having specific sequences, are recognized by a Sleeping Beauty transposase protein and the polynucleotide is capable of integrating into the DNA of a cell. The invention also relates to a kit for transposing a nucleic acid comprising said polynucleotide as well as to further components such as co-factors of transposition capable of depleting a component of the FACT (facilitates chromatin transcription) complex, namely, SSRP1 and/or SUPT16H/SPT16, or an inhibitor of cathepsin selected from the group comprising H, S, V, and L; or a cofactor capable of depleting or inhibiting HSP90; or a factor temporally arresting cells cell cycle in cell cycle phase G0/G1, G1/S, or G2/M; or a factor inhibiting the ubiquitination of PCNA, or cells wherein these components have been knocked down or inhibited, or the cell cyle arrested in any of said stages. Alternatively or additionally, the kit may comprise as a co-factor of transposition an agent capable of increasing concentration and/or signaling of ATR or a cell wherein concentrationand/or signaling of ATR are increased. The invention further provides methods using said transposon polynucleotide as well as host cells and pharmaceutical compositions. It also relates to use of said co-factors of transposition or specific cells for enhancing transposition efficiencies, e.g., for preparing genetically modified nucleic acids or cells.

Claims

1. A polynucleotide or the complementary polynucleotide thereof comprising a transposon comprising a cargo nucleic acid flanked by a left and a right inverted repeat/direct repeat (IR/DR), wherein (i) the transposon is capable of being mobilized by a Sleeping Beauty transposase protein; (ii) the left IR/DR comprises an outer left DR motif and an inner left DR motif, wherein the outer left DR motif comprises the nucleotide sequence of SEQ ID NO:1 and the inner left DR motif comprises the nucleotide sequence of SEQ ID NO: 2; and (iii) the right IR/DR comprises an outer right DR motif and an inner right DR motif, wherein the outer right DR motif comprises a reverse complement of the nucleotide sequence of SEQ ID NO:1 and the inner right DR motif comprises a reverse complement of the nucleotide sequence of SEQ ID NO: 2.

2. The polynucleotide of claim 1, wherein the outer left DR motif comprises the nucleotide sequence of SEQ ID NO: 3 and/or the outer right DR motif comprises a reverse complement of the nucleotide sequence of SEQ ID NO: 4.

3. The polynucleotide of claim 1, wherein the inner left DR motif comprises the nucleotide sequence of SEQ ID NO: 5 and/or the inner right DR motif comprises a reverse complement of the nucleotide sequence of SEQ ID NO: 6.

4. The polynucleotide of claim 1, wherein the left IR/DR comprises a half direct repeat (HDR) region capable of functioning as an enhancer comprising the nucleotide sequence of SEQ ID NO:7 between the outer DR and inner DR, wherein, optionally, the right IR/DR also comprises reverse complement of said HDR region.

5. The polynucleotide of claim 1, wherein the left IR/DR comprises the nucleotide sequence selected from the group consisting of SEQ ID NO: 8 and SEQ ID NO:9.

6. The polynucleotide of claim 1, wherein the right IR/DR comprises the reverse complement nucleotide sequence selected from the group consisting of SEQ ID NO: 10, SEQ ID NO:11, SEQ ID NO: 12 and SEQ ID NO: 13.

7. The polynucleotide of claim 1, wherein the cargo nucleic acid comprises an open reading frame operably linked to a promotor.

8. The polynucleotide of claim 7, wherein the open reading frame encodes a T-cell receptor construct.

9. An isolated cell comprising the polynucleotide of claim 7, wherein the isolated cell is a T-cell capable of adoptive T-cell transfer.

10. A pharmaceutical composition comprising the isolated cell of claim 9.

11. The polynucleotide of claim 1, wherein the Sleeping Beauty transposase is hyperactive transposase SB100X.

12. The polynucleotide of claim 1, wherein the polynucleotide is a vector selected from the group consisting of (i) a viral vector selected from the group comprising an adenoviral, adeno-associated viral, lentiviral, retroviral, herpes simplex viral, baculovirus, Epstein-Barr viral, and poxvirus vector; and (ii) a non-viral vector selected from the group comprising a plasmid, a minicircle, a pFAR vector or a virosome.

13. An isolated cell comprising the polynucleotide of claim 1.

14. A pharmaceutical composition comprising the isolated cell of claim 13.

15. A kit for transposing a nucleic acid, wherein the kit comprises (i) the polynucleotide of claim 1; (ii) (a) a Sleeping Beauty transposase protein or (b) a nucleic acid encoding a Sleeping Beauty transposase protein.

16. The kit of claim 15, wherein the Sleeping Beauty transposase is hyperactive transposase SB100X.

17. The kit of claim 15, further comprising (iii) at least one cofactor selected from the group consisting of (A) a cofactor capable of depleting a component of the FACT complex selected from the group consisting of SSRP1 and SUPT16H/SPT16; (B) an inhibitor of cathepsin selected from the group comprising H, S, V, and L; (C) a cofactor capable of depleting or inhibiting HSP90; (D) a factor temporally arresting cells cell cycle in cell cycle phase G0/G1, G1/S, or G2/M; (E) a factor inhibiting the ubiquitination of PCNA, and (F) an agent capable of increasing concentration and/or signaling of ATR, wherein said cofactor is selected from the group comprising a small molecule, siRNA and miRNA.

18. The kit of claim 15, further comprising (iii) a cell wherein one or more components comprising: (AA) a component of the FACT complex selected from the group consisting of SSRP1 and SUPT16H/SPT16 is knocked down; or (BB) cathepsin is knocked down; or (CC) HSP90, is knocked down; or (DD) the cell cycle is temporally arrested in cell cycle phase G0/G1, G1/S, or G2/M; or (EE) the ubiquitination of PCNA is inhibited; or (FF) concentration or signaling of ATR is increased.

19. A method of producing a recombinant nucleic acid, comprising contacting a target nucleic acid comprising a recognition sequence for a Sleeping Beauty transposase with the components of the kit of claim 15; wherein the recombinant nucleic acid is produced by integration of the transposon into the target nucleic acid.

20. The method of claim 19, wherein the Sleeping Beauty transposase is hyperactive transposase SB100X.

21. A method of producing a transfected cell, wherein the method comprises introducing into a cell the components of the kit of claim 15, thereby producing said transfected cell.

22. The method of claim 21, wherein the Sleeping Beauty transposase is hyperactive transposase SB100X.

23. A method for preparing a recombinant polynucleotide or a recombinant cell comprising a recombinant polynucleotide by transposition of a transposon, wherein the transposon is the polynucleotide of claim 1, comprising introducing a cofactor selected from the group consisting of (A) a cofactor capable of depleting a component of the facilitates chromatin transcription (FACT) complex selected from the group consisting of SSRP1 and SUPT16H/SPT16; (B) an inhibitor of cathepsin selected from the group comprising H, S, V, and L; (C) a cofactor capable of depleting or inhibiting HSP90; (D) a factor temporally arresting cells cell cycle in cell cycle phase G0/G1, G1/S, or G2/M; (E) a factor inhibiting the ubiquitination of a Proliferating Cell Nuclear Antigen (PCNA); and (F) an agent capable of increasing concentration and/or signaling of ataxia telangiectasia and Rad3 related (ATR), wherein the cofactor is selected from the group comprising a small molecule, an antibody, siRNA and miRNA, or comprising inducing transposition in a cell or a cell wherein one or more of: (AA) said component of the FACT complex; or (BB) said cathepsin; or (CC) said HSP90 is knocked down; or (DD) the cell cycle is temporally arrested in cell cycle phase G0/G1, G1/S, or G2/M; or (EE) the ubiquitination of PCNA is inhibited; or (FF) concentration or signaling of ATR is increased.

Description

FIGURE LEGENDS

(1) FIG. 1 Structure of Mariner/Tc1 and Sleeping Beauty transposable elements.

(2) A. In mariners, the transposase coding sequence (gray cylinder) is flanked by simple terminal inverted repeats (IRs), containing a single recognition motif per IRs. B. In Sleeping Beauty, the IR/DR elements possess longer terminal IRs (arrows), with two recognition signal sequences per IRs, repeated twice in a directly repeated form (DRs). The left IR additionally carries a motif (HDR) that is functioning as an enhancer in transposition.

(3) FIG. 2 Selection of optimal binding sites for the SB transposase by CASTing.

(4) A. Flow chart of the CASTing strategy. B. Oligonucleotides selected by six CASTing cycles were sequenced and tested in electromobility shift assay (EMSA) using the full (PAIRED) DNA-binding domain of the SB transposase, N123 (Ivics Z, et al., 1997. Cell, 91: 501-10). Binding affinities were compared to the 14DR motif of the SB left IR. Cpx—DNA-protein complex, free—position of the free DNA probes. (Right panel). C. The complexes shown FIG. B were quantified, and relative substrate-binding affinity values were calculated. D. Sequence alignment of optimal binding sites selected by the CASTing strategy. Binding region for RED is in italic, the nucleotides for AT-hook binding are boxed and binding region for PAI is in capital. Sequences were aligned to the wild-type motifs of either 12DR (left panel) or 14DR (right panel) of the left IR of the SB transposon. The identity scores are shown below. Identical nucleotides are in coloured background (black—above 50%; gray—below 50%). 20% and 70% of the wild-type motifs were recovered by the CASTing experiment of the RED and PAI wild-type motif, respectively. Selected, optimal binding sites, used in EMSA (FIG. 3A) are labelled with a star.

(5) WT 12DR: SEQ ID NO: 14 14DR: SEQ ID NO: 15

(6) CAST-1 12DR: SEQ ID NO: 16 14DR: SEQ ID NO: 17

(7) CAST-2 12DR: SEQ ID NO: 18 14DR: SEQ ID NO: 19

(8) CAST-3 12DR: SEQ ID NO: 20 14DR: SEQ ID NO: 21

(9) CAST-4 12DR: SEQ ID NO: 22 14DR: SEQ ID NO: 23

(10) CAST-5 12DR: SEQ ID NO: 24 14DR: SEQ ID NO: 25

(11) CAST-6 12DR: SEQ ID NO: 26 14DR: SEQ ID NO: 27

(12) CAST-7 12DR: SEQ ID NO: 28 14DR: SEQ ID NO: 29

(13) CAST-8 12DR: SEQ ID NO: 30 14DR: SEQ ID NO: 31

(14) CAST-9 12DR: SEQ ID NO: 32 14DR: SEQ ID NO: 33

(15) CAST-10 12DR: SEQ ID NO: 34 14DR: SEQ ID NO: 35

(16) CAST-11 12DR: SEQ ID NO: 36 14DR: SEQ ID NO: 37

(17) CAST-12 12DR: SEQ ID NO: 38 14DR: SEQ ID NO: 39

(18) CAST-20 12DR: SEQ ID NO: 40 14DR: SEQ ID NO: 31

(19) FIG. 3 Distinction between 12 vs 14 DRs is mediated by the RED subdomain of the DNA-binding domain of the SB transposase. A. Alignment of the 14 (outer) DR (SEQ ID NO:32) and 12 (inner) DR (SEQ ID NO:33) of the left inverted repeat (IR). The nucleotides involved in DNA-protein interaction, identified by footprinting (Ivics Z, et al., 1997. Cell, 91: 501-10), are shown in uppercase, while the nonidentical nucleotides are in italics. The nucleotides recognized by PAI (empty circle) or RED (black circle) subdomain, and the AT-hook (framed) are indicated (Izsvak Z, et al., 2002. Chem, 277: 34581-8.) The nucleotides resemble to the “heptamer” and “nonamer” motifs of the RAG1 are highlighted in black boxes (Hesse, J E et al., 1989. Genes Development, 3: 1053-61). The length of the spacer between motifs is 12, or 14 in the inner and outer DR, respectively. B. DNA binding properties of RED (N58-123, black circle), PAI (N1-57, empty circle) or the full N-terminal DNA binding domain (PAI+RED) were tested by EMSA. Panels 3Ba and 3Bb: labelled oligonucleotides corresponding to the 12DR (black), the 14DR (gray) or the 12+AA DR (dotted, black) were used as DNA substrates. The schematic of the predicted nucleoprotein complexes are depicted. Complexes formed with the full N-terminal DNA binding domain (PAIRED, N123) were used as size markers (˜2×RED). The complexes were separated on 4% (panel 3Ba) or 6% (panels § Bb and 3Bc) native gels. C. Oligomerization properties of the RED subdomain in the presence of a chemical crosslinker, 2 mM BS3. The complexes were separated by 15% SDS-PAGE, followed by Western blotting, using polyclonal antibody against SB transposase. Expected molecular masses of the complexes (histidine tags inclusive) are as follows: -M (REDmonomer) 8.5 kDa; -D (REDdimer) 17 kDa; -T (REDtetramer) 34 kDa.

(20) FIG. 4 Enhanced binding affinity at the inner DR improves Sleeping Beauty transposition. On the left, schematics of various neo-marked, mutated transposon constructs are depicted. On the right, the respective transpositional activities are shown in comparison to wild type transposon (construct 1), set as 100%. A. Composite DRs were created by changing either the PAI (black box) or the RED (grey box) recognition motifs into a high-affinity binding site (CAST-5) selected by the CASTing experiment (marked by stars at the PAI and stripped at the RED recognition motifs). B. The CAST-5 sequence (SEQ ID NO: 24 or 25) was used to replace only the PAI recognition motif, while the rest of the DR was wild type.

(21) FIG. 5 Transposition assay in stable knockdown cell lines, generated by RNA interference.

(22) A. Enrichment of cells having the knockdown construct. Hek293T cells were untransfected, transduced with a retroviral vector MPSV-LTR—Intron—truncated hNGFR—WPRE—miRNA—LTR as further detailed in the experimental part, wherein the miRNA was as follows: construct that is not targeting any host gene is used as negative control (scramble), or miRNA constructs having 21 nucleotides (nt) specifically targeting either ssrp1 or supt1 6H. Surface NGFR expression of transduced Hek293T cells was monitored by flow cytometry (after transduction), x axis. y axis: no stain. For enriching cell population expressing miRNAs, cells were FACS sorted and analyzed again (after sorting). The data shows increased expression of NGFR when miRNA depleting components of the FACT complex is present.

(23) B. Knockdown efficiency of the miRNA was monitored by qPCR from miRNA enriched cell population. Numbers shown in parenthesis above the bars represent the % of knockdown.

(24) C. Transposition assay in knockdown cell lines. Petri dishes with stained colonies of puromycin-resistant Hek293T cells that have been transfected with either pCMV-SB10 & pT2B-Puro or pCMV-LacZ & pT2B-Puro or pCMV-SB100x & pT2B-Puro.

(25) D. Transposition assay in HEK293T cells using transient transfection with siRNA. The siRNA target either ssrp1 or supt1 6H. scrambled riRNA not targeting any gene is used as negative control. Petri dishes with stained colonies of puromycin-resistant Hek293T cells that have been transfected either with pCMV-SB10 & pT2B-Puro or pCMV-LacZ & pT2B-Puro or pCMV-SB100x & pT2B-Puro.

(26) FIG. 6 A. Effect of E64D (an inhibitor of cathepsins, cystein proteases and calpain) on SB transposition. Transposition assay, (20 μM, right side; control, left side). RNAi approach against cathepsin(s) is expected to yield a similar improvement. B. Differential expression of host genes in the presence oft the transposase (HeLa, Affymetrix). Down-regulated host genes (right side), upregulated host genes (left side). Cathepsins (CTs) degrade polypeptides and are distinguished by substrate specificities (CTSH, CTSF, CTS2).

(27) FIG. 7 A. Caffeine treatment inhibits SB transposition. HeLa cells were exposed to the ATR signalling inhibitor caffeine (4 mM) treatment at the time of transfection with transposon (250 ng of pT2B-Puro) and transposase (25 ng of pCMV-SB100x) or D3 transposase (25 ng of catalytically inactive pCMV-SB100x) plasmids. Cells were harvested 24 hours after treatment and subjected for colony forming assay, cell cycle analysis and western blot. (i) Bar graph showing the results of colony forming assay. (ii) Western blot showing the expression levels of SB transposase in un-treated and caffeine treated cells. Expression levels of tubulin are shown as loading controls. * P>0.05 (considered not significant); *** P<0.001 (one-way ANOVA, Tukey-Kramer Multiple Comparisons post-test).

(28) B. ATR compromised cells are defective in SB transposition. SB transposition was monitored in stable cell lines expressing either ATR or ATRkd (a dominant negative kinase-inactive allele of ATR) in an inducible manner. Bar graph showing the results of colony forming assay from ATR wildtype and ATRkd cells. Transposition was severely affected in ATR disabled cells.

EXAMPLES

Example 1

(29) Results

(30) PAI Subdomain of the SB Transposase Mediates Primary Substrate Contact

(31) The DRs of the IR/DR have a composite structure, recognized by a composite DNA-binding domain. The DNA-binding domains of the SB transposase consist of two helix-turn-helix (HTH) motifs, referred as PAI and RED, based on their resemblance to the PAIRED domain, present in the PAX family of transcription factors (Izsvak Z, et al., 2002J Biol Chem, 277: 34581-8.; Czerny T, et al., 1993. Genes Dev., 7: 2048-61.). Both subdomains are involved in sequence-specific DNA-binding: PAI binds the 3′- and RED interacts with the 5′-part of the bipartite transposase binding sites represented by the DRs (Izsvak Z, et al., 2002. J Biol Chem, 277: 34581-8). In addition to DNA binding, PAI was previously shown to have a protein-protein interaction interface (Izsvak Z, et al., 2002. J Biol Chem, 277: 34581-8.). Notably, the four DRs of SB are not identical, as the DRs at the transposon ends (outer DRs) are longer by 2 bps (14DRs vs 12DRs in FIG. 1A).

(32) Although the binding site occupied by the PAIRED domain of SB has been determined (Ivics Z, et al., 1997. Cell, 91: 501-10), the footprinting experiment is not informative regarding the dynamic of substrate recognition. Are the binding motifs of PAI and RED recognised at the same time? To answer, the inventors have used the CASTing approach that was originally developed to identify optimal binding sites for DNA-binding proteins (Wright et al., 1991. Mol Cell Biol. 11:4104-10) (FIG. 2A). CASTing selects preferentially bound sequences out of complex libraries based on sequential enrichment of DNA sequences by affinity purification and PCR amplification. The CASTing approach as used to (i) identify high affinity binding sites, and (ii) map sequence motifs that are preferentially involved in primary substrate recognition by the composite DNA binding domain. Based on footprinting data of SB transposase binding (Ivics Z, et al., 1997. Cell, 91: 501-10), a 35-bp random oligonucleotide library was exposed to the full-length transposase upon binding conditions. Oligonucleotides selected after six CASTing cycles were sequenced and tested in electromobility shift assay (EMSA) using the full (PAIRED) DNA-binding domain of the transposase. The CASTing method selected sequences were bound up to eight-fold stronger when compared to the wild-type 14DR sequence (FIGS. 2B and 2C). Curiously, the CASTing-selected, high-affinity binding sites had only limited similarity to the wild-type DRs, and the identity concentrated mainly to the PAI recognition motif (FIG. 2D). Thus, while the PAI subdomain seems to specify primary substrate recognition (Izsvak Z, et al., 2002. J Biol Chem, 277: 34581-8; Carpentier C E, et al., 2014. Prot Sci. 23:23-33), RED is marginally involved in this process. The sequences captured by the CASTing strategy suggest that the PAI and RED DNA-interactions have distinct functions, and protein-DNA interaction by RED might take place at a later step, of the reaction. Furthermore, the CASTing-selected DRs are neither 12DR nor 14DR types, suggesting that there is no significant distinction between inner 12DR vs outer 14DR (FIG. 2D) during the ‘first contact’ between the transposon and transposase.

(33) The RED Subdomain of the SB Transposase Mediates the Distinction Between 12DR vs 14DR

(34) The sequence recognized by either RED or PAI differs between 12 and 14DRs (FIG. 3A). Notably, RED binding overlaps with the two base pairs difference in length of 12 vs 14DRs (Izsvak Z, et al., 2002. Chem, 277: 34581-8.) (FIG. 3A), suggesting that RED might be involved in distinguishing between DRs located distantly (12DR) or proximally (14DR) to the end of the transposon. To test this assumption, double-stranded oligonucleotides representing the 12- and 14DRs were subjected to EMSA, using either the PAI (1-57 aa) or the RED (58-123 aa) subdomains of the SB transposase. As shown on FIG. 3B (lanes 3, 5 and 6), PAI equally bound to both DRs (FIG. 3B, lanes 2, 7, 8 and 13). In contrast, RED had a clear preference for 12DR (FIG. 3B, lanes 3, 5 and 6), and no significant binding was detected using the 14DR substrate (FIG. 3B, lane 12). Thus, RED can clearly distinguish between 12 vs 14DRs that might occur by recognizing sequence variation or difference in length. In order to distinguish between these possibilities, the EMSA was repeated with a 12DR-like oligonucleotide filled with 2 nucleotides having the same length as 14DR. Incorporation of two nucleotides into the 12DR abolished specific DNA binding (FIG. 3B, bottom, lanes 6 and 7) by RED, but left binding by PAI unaffected (FIG. 3B, bottom, lane 8). These results clearly indicated that RED distinguishes between inner and outer DRs by length and not sequence. The above data support the hypothesis that selective recognition of the inner (12DRs) vs outer (14DRs) transposase binding sites is guided by length difference between the 12- and 14DRs, recognized by the RED subdomain of the SB transposase. Curiously, RED does recognise 14DR located at the end of the inverted repeat in this experimental setup.

(35) In Addition to 12/14DR Distinction, RED is Involved in Protein-Protein Interactions

(36) Although the PAI and RED subdomains are of similar size (57 and 66 amino acids, respectively), their nucleoprotein complexes migrate differently in EMSA (FIG. 3B). Based on mobility, PAI seems to bind both the 12- and 14DRs as a monomer. In contrast, using similar concentrations, the dominant nucleoprotein complex formed between RED and 12DR migrates slower, consistent with the complex containing two molecules of RED (FIG. 3B, lanes 3, 5 and 6). Notably, the complex formed by a RED monomer could be detected at a reduced protein concentration (20-fold less) in the binding reaction (FIG. 3B, lane 3). This observation suggests that RED readily forms dimers upon binding to the 12DR, suggesting that similarly to PAI, RED might be involved in both protein-DNA and protein-protein interactions. To test whether RED has a protein-protein interaction surface, the RED peptide was subjected to chemical crosslinking followed by Western blotting. Bands corresponding to dimeric, tetrameric and even higher order multimeric structures of RED were identified, both in the presence (FIG. 3C) or the absence of DNA substrate (not shown). These results indicate that similarly to PAI (Izsvak Z, et al., 2002. J Biol Chem, 277: 34581-8.), the RED subdomain is able to homodimerize. In sum, although both the PAI (Izsvak Z, et al., 2002. J Biol Chem, 277: 34581-8.) and RED subdomains have protein-protein interaction surfaces, only RED but not PAI forms dimers upon binding a single DNA substrate.

(37) IR/DR Governs an ‘Ordered Assembly’ Process

(38) Altering the affinity of the binding sites might challenge the ordered assembly process occurring during transposition of a SB transposon. Thus, a series of transposon versions were constructed where 12DR and/or 14DR motifs were replaced by CASTing selected, high affinity binding sites (FIG. 4A), and the various constructs were subjected to transposition assays. Surprisingly, replacing wild type motifs with the high-affinity CAST-5 sequence did not improve transposition frequencies. On the contrary, replacing either 12DRs or 14DRs to CAST-5 motif resulted in a 65% and 3% of wild type activities, respectively (FIG. 4A). Similarly, changing all the four DRs to CAST-5 affected transposition negatively (2.2%), suggesting that an enhanced DNA-binding affinity at either DR position might compromise SB transposition. Alternatively, the negative effect of CAST-5 on transposition could, at least partially, be accounted to its preferential selection for PAI binding, while compromising its RED function. Indeed, the CAST sequences are predicted to be sub-optimal for RED interaction, including the ability to distinguish between inner vs outer positions (FIG. 2). To distinguish between the two scenarios, we generated CAST-5/wt hybrids, where CAST-5 was replacing PAI only, otherwise kept the DRs wild type (wt). Again, we tested the impact of the hybrid motifs on transposition in various combinations. The high-affinity, CAST-5/wt hybrid motifs were still affecting transposition negatively at the outer and the combined inner/outer positions (FIG. 4B). However, the CAST-5/wt motif clearly improved transposition (130%), when replacing 12DRs at the inner positions (FIG. 4B).

(39) The ‘high affinity’ experiments revealed the following features of SB transposition. First, although RED-14DR interaction could not be detected by EMSA, it was essential for transposition, assumingly at a later phase of the transposition reaction. Second, enhancing binding activity at the outer or at all the four DRs affects the transposition negatively, indicating that the DNA-binding affinity of the DRs at the inner vs outer positions cannot be freely changed. The substrate recognition seems to occur in well-defined steps at different phases of the reaction, directed by the IR/DR structure. During this process, PAI and RED subdomains are expected to perform multiple tasks involving DNA-protein and protein-protein interaction.

(40) Finally, transposition could be improved by enhancing binding affinity of PAI at the inner positions (12DRs). Notably, the enhancement is not directly proportional with the optimised binding affinity, indicating that the IR/DR structure governs a delicately regulated process that does not tolerate drastic changes. Nevertheless, the attempt to decipher the role of the IR/DR structure in combination of molecular evolutionary approaches could be translated to significantly improve the transposition reaction of Sleeping Beauty.

(41) Depletion of Components of the FACT Complex Increases Transposition Efficiency

(42) A significant enrichment in transposition (involving SB10) was observed upon knockdown of SPT16 in stable knockdown HEK293T cells generated by RNA interference. (cf. FIG. 5, left column). Similarly, approximately, 50% enrichment was seen with SB100X (FIG. 5, right column. Knockdown of SUPT16H also led to increased transposition, while corresponding scrambled RNAi did not lead to any significant effect on transposition. Depletion of SUPT16H leads to the strongest effects.

(43) A transposition assay in HEK293T cells that are transiently transfected with commercially available siRNAs for depletion of SPT16 or SUPT16H confirmed the results obtained using stable knockdown cell lines (FIG. 6).

(44) Materials and Methods

(45) Plasmid Constructs

(46) Prokaryotic vectors pET-21a/N57, pET-21a/58-123 and pET-21a/N123 expressing hexahistidine-tagged subdomains of the SB DNA-binding domain, PAI, RED and N123 respectively, has been described previously (Izsvak Z, et al., 2002. J Biol Chem, 277: 34581-8.). For expression of the SB transposase in HeLa cells a pCMV-SB10 (Ivics et al., 1997, Cell 91:501-510). and pCMV-SBD3 (D3), a catalytic mutant (E278D) of SB, has been used. As donor plasmids in in vivo assays the following constructs have been used: pT/neo described previously (Ivics et al., 1997, Cell 91:501-510).

(47) Protein Expression and Purification

(48) Expression and purification of His-tagged PAI and RED subdomains were conducted as described in (Izsvak Z, et al., 2002. J Biol Chem, 277: 34581-8.).

(49) Electromobility Shift Assay (EMSA)

(50) Double-stranded oligonucleotides corresponding to either 12 or 14DRs were end-labeled using [α-.sup.32P]dCTP and Klenow fragment. The DNA probe containing the left IR was a EcoRI fragment of the pT/neo, end-labeled with [α-.sup.32P]dATP. Following the Klenow reaction, the labeled DNA was purified on MicroSpin G-25 Columns as described by the manufacturer. Binding reactions were performed in 20 mM HEPES (pH 7.5), 0.1 mM EDTA, 1 mM DTT in a total volume of 10 μl 20,000-50,000 cpm labeled DNA probe and various concentrations of the proteins (as noted in the Figures) were added and incubated 10 min on ice. After addition of 3 μl of loading dye (containing 50% glycerol and bromophenol blue) the samples were loaded onto a 4% or 6% polyacrylamide gel. The electrophoresis was carried out in Tris-glycine buffer pH 8.3 at 25 mA for 2-3 hours. The gels were dried for 45 minutes using the gel dryer from BIO-RAD. After overnight exposure the gels were scanned with Fujifilm FLA-3000 and analysed with AIDA program.

(51) TABLE-US-00005 Sequence of probes used in the experiments: 14DR: S (SEQ ID NO: 79) 5′-ACATACACTTAAGTGTATGTAAACTTCCGACTTCAACTTGG-3′ AS (SEQ ID NO: 80) 5′-GACTCCAAGTTGAAGTCGGAAGTTTACATACACTTAAGTGTATGT-3′ 12DR: S (SEQ ID NO: 81) 5′-ACATACATTAGTGTATGTAAACTTCTGACCCACTGTTGG-3′ AS (SEQ ID NO: 82) 5′-GACTCCAACAGTGGGTCAGAAGTTTACATACACTAATGTATGT-3′ CAST-2 S (SEQ ID NO: 34) 5′-acatacaccctggtgtatgtaaagatcggacggccggttgg-3′ AS (SEQ ID NO: 35) 5′-gactccaaccggccgtccgatattacatacaccagggtgtatgt-3′ CAST-5 S (SEQ ID NO: 36) 5′-acatacaggcgcgtgtatgtacacttggggtcgtcacttgg-3′ AS  (SEQ ID NO: 37) 5′-gactccaagtgacgaccccaagtgtacatacacgcgcctgtatgt-3′ CAST-9 S (SEQ ID NO: 38) 5′-acatacagcaccatgtacttaaatctctgacctgggcttgg-3′ AS (SEQ ID NO: 39) 5′-gactccaagcccaggtcagagatttaagtacatggtgctgtatgt-3′ CAST-20 S (SEQ ID NO: 40) 5′-acatacacgtaagtgtacatactgtgtacacaaagacttgg-3′ AS (SEQ ID NO: 41) 5′-gactccaagtctttgtgtacacagtatgtacacttacgtgtatgt-3′

(52) Chemical Crosslinking

(53) Reactions were performed using the bis(sulfosuccinimidyl) substrate (BS.sup.3, Pierce Biotechnology, USA) according to manufacturer's recommendations. Proteins (3 μM) were incubated on ice in 20 mM HEPES (pH 7.5), 5 mM MgCl.sub.2, 100 mM NaCl and 2.5 mM BS.sup.3 in a final volume of 15 μl for 2 hours. The reactions were stopped by adding Tris-HCl pH 7.5 to a final concentration of 50 mM and incubating 10 min at room temperature. Then the Laemli buffer (125 mM Tris-HCI pH 6.8, 5% SDS, 10% β-mercaptoethanol, 25% glycerol and bromophenol blue) was added and samples were loaded on 15% SDS-PAGE and analyzed by Western blotting using polyclonal anti-SB antibody (R&D Systems, USA) and anti-goat IgG (Pierce Biotechnology, USA).

(54) CASTing Experiment

(55) The CASTing was performed based on the method described in Wright, Binder et al. (1991). Oligonucleotides with random 35 bp long core SB-DOL: 5′-GCG GGA TCC ACT CCA GGC CGG ATG CT (N).sub.35 CAC CAG GGT GTA AGG CGG ATC CCG C -3′ (SEQ ID NO: 42) were synthesized and made double-stranded in a PCR reaction with primers complementary to the sequences flanking the core. The nucleoprotein complexes formed during 1 h incubation of 2 μg of the oligonucleotides with 0.15 μg of the purified His-tagged SB transposase (SBFT-6H) (Izsvak Z, et al., 2002. J Biol Chem, 277: 34581-8.) were recovered using the Ni-NTA resin (QIAGEN). The bound oligonucleotides were enriched by extensive washing steps. The selected oligonucleotides were extracted and amplified by primers A, 5′-GCG GGA TCC GCC TTA CAC CCT GGT G -3′ (SEQ ID NO: 43) and B, 5′-GCG GGA TCC ACT CCA GGC CGG ATG CT -3′ (SEQ ID NO: 44), and subjected to additional rounds of the CASTing cycle to increase the specificity of the method. The oligonucleotides obtained from 6.sup.th round were sequenced and tested in binding and transposition assays.

(56) Cell Culture

(57) HeLa cells were grown in DMEM (GIBCO BRL, Germany) supplemented with 10% Fecal Calf Serum Gold (FCS Gold) (PAA, Germany) and 1% antimycotic antibiotic (Invitrogen, Germany). One day prior transfection cells were seeded onto six-well plates. Cells were transfected with Qiagen purified DNA (Qiaprep spin miniprep kit, Qiagen) using jetPEI RGD transfection reagent (Polyplus Transfection, France). Two days posttransfection cells were harvested for excision assay and/or were plated out on 10 cm plates for selection using 1 mg/ml G418 (Biochrom, Germany). After 3 weeks of selection, colonies were stained and counted as described in Ivics et al., Cell 1997.

(58) Sleeping Beauty Transposon Excision Assay

(59) In order to determine the excision efficiency during sleeping beauty transposon transposition from plasmids to genome, we cloned a Sleeping Beauty transposon-based reporter called pCMV(CAT)-GFP/T2neo. In detail, firstly, the open reading frame of GFP controlled by the CMV promoter was cloned into the pcDNA3.1 vector. Then, the sleeping beauty transposon containing a selection gene neo (driven by the SV40 promoter) was cloned into the ‘TA’ site in GFP ORF.

(60) To evaluate the effects of internal sequence of the sleeping beauty transposon on excision efficiency, 977-bp and 1654-bp sequences (containing partial SV40-neo) were cut out from the original excision reporter, respectively, to clone two alternative excision reporters with shorter internal sequences (1260 bp and 583 bp respectively).

(61) The three transposon constructs were purified using the Qiagen plasmid midi kit. The purified plasmid DNA was transfected into HeLa cells with the transposase-expressing plasmid pCMV(CAT)SB100X (Mátés L, et al. Molecular evolution of a novel hyperactive Sleeping Beauty transposase enables robust stable gene transfer in vertebrates. Nat Genet. 2009 June; 41(6):753-61.) using jetPEI (Polyplus transfection, for mammalian cells) according to instructions of manufacture. Three days later, the number of GFP-positive cells was estimated by FACS.

(62) Cloning

(63) Mutated SB transposon ends were created by PCR-mediated mutagenesis. Primer sequences and cloning strategies are summarized in Table 1.

(64) TABLE-US-00006 TABLE 4 SEQ Template ID of Cloning NO: Primer sequences the PCR strategy Construct 57 5′-tacagtgacgaccccaagtgtacatacacgcgccccaaatacat-3′ pT/neo Ligate to 2 58 5′-tacagtgacgaccccaagtgtacatacacgcgccttggagtcatta-3′ SmaI site of pUC19 Construct 59 5′-gtacatacacgcgcttagtatttggtagcattgccttta-3′ pT/neo Ligate the 2 3 60 5′-gtacatacacgcgcttgactgtgcctttaaacagcttgg-3′ fragments 61 5′-acttggggtcgtcaccaattgtgatacagtgaattataagtg-3′ pT/neo 62 5′-acttggggtcgtcaccgaatgtgatgaaagaaataaaagc-3′ Construct 63 5′-gtacatacacgcgcttagtatttggtagcattgccttta-3′ pT/neo Ligate the 2 4 64 5′-gtacatacacgcgcttgactgtgcctttaaacagcttgg-3′ fragments 65 5′-acttggggtcgtcaccaattgtgatacagtgaattataagtg-3′ Con- 66 5′-acttggggtcgtcaccgaatgtgatgaaagaaataaaagc-3′ struct2 Construct 67 5′-acttccgacttcaactgtaggggatcctctagagtcgacctg-3′ pT/neo Ligate the 2 5 68 5′-acttccgacttcaactgtagggtaccgagctcgaattcactg-3′ fragments 69 5′-gtacatacacgcgccccaaatacatttaaactcactttttc-3′ pT/neo 70 5′-gtacatacacgcgccttggagtcattaaaactcgtttttc-3′ Construct 71 5′-acttctgacccactgggaatgtgatgaaagaaataaaagc-3′ pT/neo Ligate the 2 6 72 5′-acttctgacccactggaattgtgatacagtgaattataagtg-3′ fragments 73 5′-gtacatacacgcgcttagtatttggtagcattgccttta-3′ pT/neo 74 5′-gtacatacacgcgcttgactgtgcctttaaacagcttgg-3′ Construct 75 5′-gtacatacacgcgcttagtatttggtagcattgccttta-3′ pT/neo Ligate the 2 7 76 5′-gtacatacacgcgcttgactgtgcctttaaacagcttgg-3′ fragments 77 5′-acttctgacccactgggaatgtgatgaaagaaataaaagc-3′ Con- 78 5′-acttctgacccactggaattgtgatacagtgaattataagtg-3′ struct5

(65) Depletion of Components of the FACT Complex Increases Transposition Efficiency

(66) miRNA constructs were generated using the target micro-RNAs described in Table 5. For establishing stable knockdown cell lines, Hek293T cells were transduced with said micro RNA constructs.

(67) microRNA (miRNA) based vector was used for stable knockdown cell clines of ssrp1 and supt16H, comprising the components

(68) MPSV-LTR—Intron—truncated hNGFR—WPRE—miRNA—LTR

(69) Myeloproliferative sarcoma virus (MPSV); Long terminal repeat (LTR) of mouse; Truncated human nerve growth factor receptor (NGFR); Woodchuck hepatitis virus (WHP) posttranscriptional regulatory element (wPRE); Core sequence of mouse miR155 with target (ssrp1 or supt16H) sense and antisense sequences.

(70) The expression of the micro RNA was monitored by staining the cells with anti-NGFR antibody. For enriching the cell population with micro RNAs, cells were FACS sorted and cultured. For analysing the knockdown efficiency, enriched cell population was subjected for RNA isolation followed by cDNA synthesis. The expression level of the target genes was monitored by qPCR with gene specific primes (as listed in Table 6).

(71) Pre-designed, commercial, synthetic, siRNAs (siGENOME, SMARTpool) were procured (from Dharmacon, GE healthcare). siRNAs targeting either supt16H gene (cat. No. M-009517-00-0005) and ssrp1 (cat. No. M-011783-01-0005) were transfected into Hek293T using jetPEITM transfection system. As a negative control siRNA targeting firefly luciferase gene (cat. No. D-001206-14-05) was used. 24 h later, cells were transfected with respective plasmids for transposition. Two days post transfection; the transfected cells were trypsinized, counted and subjected for puromycin selection. After one week of selection, colonies were fixed with 10% formaldehyde in PBS for 15 min, stained with methylene blue in PBS for 30 min, washed extensively with deionized water, air dried, and photographed.

(72) A transposition assay was performed as published previously (Ivics Z, et al., 1997. Cell, 91: 501-10), Results are shown in FIGS. 5 and 6.

(73) TABLE-US-00007 TABLE 5 miRNA sequences for knockdown Name Sequence Application Scramble (as) 5′ TAG GTC CTC TTC ATC TTG TTG miRNA not targeting any 3′ (SEQ ID NO: 83) gene (ss) 3′ ATC CAC GAG AAG TAG AAC AAC 5′ (SEQ ID NO: 84) ssrp1 (as) 5′ TTT ACC AGT GCT TTC ATG AGG miRNA targeting ssrp1 3′ (SEQ ID NO: 85) gene (ss) 3′ AAA TGG TCA CGA AAG TAC TGG 5′ (SEQ ID NO: 86) supt16H (as) 5′ ATC AAA GTG CGA ACA AGG TTG miRNA targeting supt16H 3′ (SEQ ID NO: 87) gene (ss) 3′ TAG TTT CAC GCT TGT TCC AAC 5′ (SEQ ID NO: 88)

(74) TABLE-US-00008 TABLE 6 Primers Name Primer Sequence Application Supt16H Forward primer 5′ CATTGGTGACACAGTGCTTGTGG qPCR 3′ (SEQ ID NO: 89) Reverse primer 5′ CCAAAAGGTCCTCTGCCTCATC 3′ (SEQ ID NO: 90) Ssrp1 Forward primer 5′ TCACAGTGCCAGGCAACTTCCA qPCR 3′ (SEQ ID NO: 91) Reverse primer 5′ ACAGGTGGCTTGTGGACGTAGA 3′ (SEQ ID NO: 92)

Example 2

(75) It has been previously shown that both DNA-PKcs and ATM activities are required for efficient SB transposition (Izsvák et al., 2004, Mol Cell 13(2):279-90). Similarly to DNA-PKcs and ATM, ATR also belongs to the phosphatidylinositol 3 kinase-like kinase (PIKK) family, involved in checkpoint signalling and repair. ATR specifically gets activated by DNA damage during replication (Lupardus et al., 2002, Genes Dev 16(18):2327-32). Caffeine is an inhibitor of ATM, ATR and mTOR (also a PIKK member), but not of DNA-PKCs (Sarkaria et al., 1999, Cancer Res. 59(17):4375-82). The inventors examined SB transposition using a standard transposition assay, under caffeine treatment (4 mM).

(76) The frequency of transposition was decreased by approximately 50% upon caffeine treatment relative to the control (FIG. 7A). In order to decipher if ATR signalling is specifically required for efficient SB transposition, stable TET-inducible cell lines, where ATR function can be regulated were used. SB transposition was monitored in stable cell lines expressing either ATR (wildtype) or ATRkd (a dominant negative kinase-inactive allele of ATR) in an inducible manner (Cliby et al., 1998, EMBO J. 17(1):159-69). Expression of ATRkd, a catalytically dead version of ATR has as a dominant negative effect that disables ATR activity (Cliby et al., 1998). In ATR-disabled cells, ATR is not able to initiate the signalling cascade that would resolve replication arrest. ATR and ATRkd were induced, and the two lines were subjected to the genomic transposition assay. The results show that transposition dropped by ˜75% in ATR disabled cells, indicating that ATR is essential for SB transposition (FIG. 7B). Furthermore, in spite of stalled replication forks accumulation in ATRkd induced cells, induction of transposition was not observed, suggesting that intact ATR signalling may be required for triggering transposition.