Functional oligodendrocytes derived from pluripotent stem cells and methods of making and using the same
11814648 · 2023-11-14
Assignee
Inventors
Cpc classification
C12N2501/385
CHEMISTRY; METALLURGY
C12N2506/45
CHEMISTRY; METALLURGY
C12N2533/90
CHEMISTRY; METALLURGY
C12N5/0622
CHEMISTRY; METALLURGY
A61K35/30
HUMAN NECESSITIES
C12N2501/999
CHEMISTRY; METALLURGY
A61P25/28
HUMAN NECESSITIES
International classification
Abstract
Described is the efficient and robust generation of oligodendrocyte progenitor cells (OPCs) and oligodendrocytes from pluripotent stem cells (PSCs). The protocols provided recapitulate the major steps of oligodendrocyte differentiation, from neural stem cells to OLIG2.sup.+ progenitors, and then to O4.sup.+ OPCs, in a significantly shorter time than the 120-150 days required by previous protocols. Furthermore, O4.sup.+ OPCs are able to differentiate into MBP.sup.+ mature oligodendrocytes in vitro, and to myelinate axons in vivo when injected into immuno-compromised Shiverer mice, providing proof of concept that transplantation of PSC-derived cells for remyelination is technically feasible.
Claims
1. A method of generating oligodendrocytes, the method comprising: a) culturing PSCs in an adherent culture as a monolayer in a medium comprising a low concentration of RA, (i) with dual SMAD inhibition comprising inhibition of both activin/nodal/TGFβ signaling and BMP signaling from day 0 to day 8, and (ii) with SHH or an agonist of Smoothened from day 8 to day 12, to produce OLIG2+ cells; b) enriching for OLIG2+ cells by culturing the cells of step (a) in suspension (i) from day 12 to day 20 in a medium comprising SHH or an agonist of Smoothened and a low concentration of RA, and (ii) from day 20 to day 30 in a medium comprising PDGF, HGF, IGF-1, and NT3; and c) culturing the cells of step (b) in an adherent culture in a medium comprising AA and lacking PDGF, HGF, IGF-1, and NT3 from day 30 to day 60; thereby generating oligodendrocytes.
2. The method of claim 1, wherein the PSCs are embryonic stem cells.
3. The method of claim 1, wherein the PSCs are induced pluripotent stem cells (iPSCs).
4. The method of claim 3, wherein the iPSCs are derived from a patient with multiple sclerosis.
5. The method of claim 1, wherein the PSCs are mammalian cells.
6. The method of claim 1, wherein the PSCs are cultured in a medium comprising an inhibitor of rho-associated protein kinase (ROCK).
7. The method of claim 1, wherein dual SMAD inhibition is by SB431542 and LDN193189.
8. The method of claim 1, wherein the cells are PAX6+ by day 8.
9. The method of claim 1, wherein the agonist of Smoothened is SAG.
10. The method of claim 1, wherein the concentration of RA is about 100 nM.
11. The method of claim 1, wherein the cells of (c) are cultured on a surface comprising an extracellular matrix protein and a positively charged poly-amino acid.
12. The method of claim 11, wherein the extracellular matrix protein is laminin.
13. The method of claim 11, wherein the poly-amino acid is poly-ornithine.
14. The method of claim 1, wherein at least 50% of the cells are OLIG2+ by day 12.
15. The method of claim 1, wherein at least 60% of the cells are OLIG2+ by day 12.
16. The method of claim 1, wherein at least 70% of the cells are OLIG2+ by day 12.
17. The method of claim 1, wherein at least 20% of the cells are MBP+ at day 60.
18. The method of claim 1, wherein at least 25% of the cells are MBP+ at day 60.
19. The method of claim 1, wherein at least 30% of the cells are MBP+ at day 60.
Description
BRIEF DESCRIPTION OF THE FIGURES
(1)
(2)
(3)
(4)
(5)
(6)
(7)
(8)
(9)
(10)
(11)
(12)
(13)
(14)
(15)
(16)
(17)
DETAILED DESCRIPTION OF THE INVENTION
(18) We developed a robust, fast, and reproducible differentiation protocol to generate human oligodendrocytes from PSCs using a chemically defined, growth factor-rich medium. Our protocol mimics oligodendrocyte differentiation during development. Within 8 days PSCs differentiate into PAX6.sup.+ neural stem cells, which give rise to OLIG2.sup.+ progenitors by day 12. OLIG2.sup.+ cells become committed to the oligodendrocyte lineage by co-expressing NKX2.2 around day 18, and then differentiate to early OPCs by up-regulating SOX10 and PDGFRα around day 40. Late OPCs expressing the sulfated glycolipid antigen recognized by O4 antibody (O4.sup.+) appear around day 50, and reach 40-70% of the cell population by 75 days of differentiation. O4.sup.+ oligodendrocyte progenitor cells can be isolated by cell sorting for myelination studies, or can be terminally differentiated to mature MBP.sup.+ oligodendrocytes. The timeline of our oligodendrocyte differentiation protocol is shown in
(19) The signaling pathways we manipulate to generate oligodendrocytes were selected based on knowledge gained from studies of rodent spinal cord embryonic development. Hu et al. (2009a). In vitro, RA and SHH signaling mimic the pMN environment, inducing differentiation of the PSCs to OLIG2 progenitor cells. In our cultures, SHH signaling is activated through a Smoothened agonist instead of the human recombinant SHH protein. We found that combining RA and SHH signaling with activin/nodal/TGFβ inhibition (through SB431542) and BMP4 inhibition (through LDN193189), generated the highest yield of OLIG2.sup.+ progenitors. Due to the synergistic action of SB431542 and LDN193189, more than 70% of the cells express OLIG2 at day 12. This is a key difference between our protocol and that of Wang et al. (2013). Inhibition of both activin/nodal/TGFβ signaling and BMP signaling is also referred to as “dual SMAD inhibition.”
(20) There are several other important differences between our methods and previously published protocols. For example, we began neural induction with dual SMAD inhibition in adherent, as opposed to suspension, cultures. Wang et al. (2013); Hu et al. (2009b); Nistor et al. (2005). Using this approach, we started with only 10,000 cells/cm.sup.2 at day 0, and yet achieved a great expansion of neural progenitors, and ultimately an abundant generation of OPCs. In addition, the optimal concentration of RA in our hands is found to be about 100 nM, which is one hundred times lower than the concentration used by other groups. Gil, J. E. et al., FEBS Letters 583:561-567 (2009); Izrael et al. (2007); Nistor et al. (2005). Further, induction with RA alone, without exogenous SHH, surprisingly generated a large population of OLIG2.sup.+ cells. We confirmed that an agonist of Smoothened is an efficient replacement for SHH and indeed showed superior efficacy in our hands (Stacpoole et al. 2013). Moreover, our invention, remarkably, is the first to show OLIG2 induction through RA in the absence of fibroblast growth factor (FGF) signaling. The combination of RA and FGF signaling is known to promote OLIG2 expression during chicken development and has been used for in vitro differentiation of both human ESCs and iPSCs. Pouya, A. et al., PLoS One 6:e27925 (2011); Nistor et al. (2005); Novitch, B. G. et al., Neuron 40:81-95 (2003). A recent study suggested that basic FGF (bFGF) is essential to the specification of oligodendrocytes of ventral forebrain origin, while it inhibits neuronal differentiation during the specification of oligodendrocytes from the spinal cord. Stacpoole et al. (2013). Nonetheless, we have achieved a high yield of OPCs in the absence of any exogenous FGF during our in vitro differentiation. Finally, the transition from adherent cultures to suspension cultures of cell spheres at day 12 proved to be a critical step to enrich the population of OLIG2.sup.+ cells and to restrict differentiation of our cultures to the oligodendrocyte lineage.
(21) We also provide the first evidence that myelinating oligodendrocytes can be derived via reprogramming of PPMS-patient skin fibroblasts. The only previous report on MS-derived iPSCs showed that oligodendrocytes could be differentiated in vitro from an integrating, retrovirally reprogrammed iPSC line from a single, 35 years old, RRMS patient. Song, B., et al., Stem Cell Res. 8:259-273 (2012). We demonstrate in vivo myelination by OPCs derived from 4 integration-free iPSC lines from PPMS patients of both sexes and of ages of 50-62 years. Thus, the present invention differs from recent work using iPSC-derived OPCs in that our iPSC lines are derived from PPMS patients. Further, the cells used for in vivo transplantation have been sorted using the late OPC marker O4, to maximally restrict the differentiation potential. Despite these differences, PPMS-derived O4.sup.+-sorted OPCs exhibited similar engraftment efficiency, similar mitotic fraction and similar proportion of host ensheathed axons while generating fewer GFAP.sup.+ astrocytes compared to unsorted iPSC-derived OPCs reported previously. Taken together, our data show that PPMS-derived OPCs performed in vivo at least as efficiently as healthy iPSC-derived cells (Wang et al., 2013), and establish that our iPSC derivation and OPC induction protocols can generate myelinogenic oligodendrocytes from single-patient sample, which can be used in autologous cell-replacement therapies for MS.
(22) A particular embodiment of the invention is a method of generating OLIG2+ OPCs by first preparing PSC colonies. PSCs are seeded (plated) at low density and grown in an adherent culture for about 1-2 days. “Low density” means about 8,000 to about 11,000 cells/cm.sup.2. Cells are preferably seeded at about 9,500 to about 10,500 cells/cm.sup.2, more preferably at about 10,000 cells/cm.sup.2. After 1-2 days, the PSCs form colonies, which are preferably about 75 μm to about 300 μm in diameter, more preferably about 100 μm to about 250 μm in diameter.
(23) The term “PSCs” has its usual meaning in the art, i.e., self-replicating cells that have the ability to develop into endoderm, ectoderm, and mesoderm cells. Preferably, PSCs are hPSCs. PSCs include ESCs and iPSCs, preferably hESCs and hiPSCs. PSCs can be seeded on a surface comprising a matrix, such as a gel or basement membrane matrix. A preferable matrix is the protein mixture secreted by Engelbreth-Holm-Swarm (EHS) mouse sarcoma cells, sold under trade names including MATRIGEL®, CULTREX®, and GELTREX®. Other suitable matrices include, without limitation, collagen, fibronectin, gelatin, laminin, poly-lysine, vitronectin, and combinations thereof.
(24) The medium in which PSCs are cultured preferably comprises an inhibitor of rho-associated protein kinase (ROCK), for example, GSK269962, GSK429286, H-1152, HA-1077, RKI-1447, thiazovivin, Y-27632, or derivatives thereof.
(25) The PSC colonies are then cultured in a monolayer to confluence in a medium comprising a low concentration of RA, at least one inhibitor of TGFβ signaling, and at least one inhibitor of BMP signaling, wherein the first day of culturing in this medium is day 0. A “low concentration of RA” is about 10 nM to about 250 nM. The concentration of RA is preferably about 10 nM to about 100 nM, or about 25 nM to about 100 nM, or about 20 nM, 30 nM, 40 nM, 50 nM, 60 nM, 70 nM, 80 nM, 90 nM, and preferably, about 100 nM or less. Inhibitors of TGFβ signaling include, for example, GW788388, LDN193189, LY2109761, LY2157299, and LY364947. A preferred inhibitor of TGFβ signaling is the small molecule SB431542. Inhibitors of BMP signaling include, for example, DMH1, dorsomorphin, K02288, and Noggin. A preferred inhibitor of BMP signaling is the small molecule LDN193189.
(26) Cells reach confluence and express PAX6 at about day 8, at which point the confluent cells are cultured in a medium comprising SHH or an agonist of Smoothened, and a low concentration of RA. Agonists of Smoothened include, for example, SAG and purmorphamine. The SHH can be recombinant human SHH. Preferably, the medium lacks SHH. The transition from PSCs to OLIG2.sup.+ progenitors is associated with massive proliferation causing the cultures to become overconfluent, resulting in the cells forming three-dimensional structures, ideally by about day 12. “Overconfluent” means that the cells begin piling up on one another, such that not all cells are in complete contact with the culture surface, and some cells are not in contact with the culture surface at all, but are only in contact with other cells. Preferably, at least about 50%, 60%, or 70% of the overconfluent cells are OLIG2+ by about day 12.
(27) If the OLIG2+ cells are to be further differentiated to O4+ cells, the overconfluent cells are lifted from the culture surface, which allows the formation of cell aggregates or spheres. OLIG2.sup.− cells do not form aggregates, thus this process enriches for the OLIG2.sup.+ population, and OLIG2.sup.− cells are eliminated gradually during subsequent media changes. For purposes of the present invention, the terms “aggregate” and “sphere” are used interchangeably and refer to a multicellular three-dimensional structure, preferably, but not necessarily, of at least about 100 cells.
(28) Lifting can be performed mechanically, with a cell scraper or other suitable implement, or chemically. Chemical lifting can be achieved using a proteolytic enzyme, for example, collagenase, trypsin, trypsin-like proteinase, recombinant enzymes, such as that sold under the trade name TRYPLE naturally derived enzymes, such as that sold under the trade name ACCUTASE®, and combinations thereof. Chemical lifting can also be done using a chelator, such as EDTA, or a compound such as urea. Mechanical lifting or detachment offers the advantage of minimal cell death, however it produces aggregates of variable size, thus suitable spheres need to be selected through a manual picking process. Good spheres are defined as those having a round-shape, golden/brown color, with darker core and with a diameter between about 300 μm and about 800 μm. Detaching the cells using chemical methods, such as enzymatic digestion predominantly produces spheres that are appropriate for further culture. Therefore manual picking of spheres is not required, and the detachment steps can be adapted for automation and used in high throughput studies. However, enzymatic digestion increases cell death, resulting in a lower number of spheres.
(29) We further provide a method of generating O4+ OPCs from OLIG2+ OPCs. Three-dimensional aggregates of OLIG2+ OPCs are cultured in suspension in a medium comprising a Smoothened agonist and a low concentration of RA for about 8 days. The OLIG2+ OPCs can be generated a method of the invention, for example, as described above, or by other methods known in the art. After about 8 days in the medium comprising the Smoothened agonist and RA, the medium is changed to one comprising PDGF, HGF, IGF-1, and NT3, and optionally, insulin (preferably about 10 μg/ml to about 50 μg/ml, more preferably about 25 μg/ml), T3 (preferably about 20 ng/ml to about 100 ng/ml, more preferably about 60 ng/ml), biotin (preferably about 50 ng/ml to about 150 ng/ml, more preferably about 100 ng/ml), and/or cAMP (preferably about 100 nM to about 5 μM, more preferably about 1 μM). The medium preferably lacks bFGF and epidermal growth factor (EGF). If OLIG2+ cells are generated by the method of the invention, culture in suspension preferably begins on about day 12, and culture in the medium comprising PDGF, HGF, IGF-1, and NT3 preferably begins on about day 20.
(30) After about 10 days in suspension in the medium comprising PDGF, HGF, IGF-1, and NT3, the cell aggregates are plated in an adherent culture at a density of about 2 spheres/cm.sup.2. (This is preferably at about day 30 where the method started on day 0 with PSCs cultured in a medium comprising RA, at least one inhibitor of TGFβ signaling, and at least one inhibitor of BMP signaling.) The surface on which the cell aggregates are plated and cultured can comprise an extracellular matrix protein (e.g., collagen, fibronectin, laminin) and/or a positively charged poly-amino acid (e.g., poly-arginine, poly-lysine, poly-ornithine). Preferably the surface comprises laminin and/or poly-ornithine.
(31) Upon plating the cell aggregates, the medium comprising PDGF, HGF, IGF-1, and NT3 can be continued (Option A), or a medium comprising AA and lacking growth factors (e.g., PDGF, HGF, IGF-1, NT3, bFGF, and/or EGF) can be used (Option B). The medium comprising AA can optionally comprise insulin, T3, biotin, and/or cAMP. Cells cultured in the medium comprising PDGF, HGF, IGF-1, and NT3 are optimally O4+ by about 45 days after plating. Preferably, at least about 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, or 80% of these cells are O4+ by about 45 days after plating (day 75). Cells cultured in the medium comprising AA are optimally O4+ by about 25 days after plating. Preferably, at least about 20%, 25%, 30%, 35%, or 40% of these cells are O4+ by about 25 days after plating (day 55). Preferably, at least about 30%, 35%, 40%, 45%, 50%, 55%, or 60% of these cells are O4+ by about 33 days after plating (day 63). Preferably, at least about 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, or 75% of these cells are O4+ by about 45 days after plating (day 75).
(32) Mature oligodendrocytes expressing myelin basic protein can be generated by culturing the O4+ OPCs in the absence of PDGF, HGF, IGF-1, and NT3 for about three weeks, until cells are MBP+. Preferably, at least about 20%, 25%, 30%, 35%, 40%, or 45% of the O4+ OPCs are MBP+ after about 20 days in culture in the medium lacking PDGF, HGF, IGF-1, and NT3. This occurs on about day 95 for “Option A” cells, and on about day 60 for “Option B” cells. Culturing “Option B” cells until at least about day 75 results in a higher efficiency of MBP+ expressing cells.
(33) The invention also encompasses OPCs, oligodendrocytes, and myelin-producing cells generated by the methods of the invention, and non-human mammals comprising them, preferably mice and/or rats. A myelin-producing cell is any cell that produces myelin, including without limitation, oligodendrocytes. In some embodiments, myelin-producing cells are differentiated from PSCs, and in such embodiments, the PSCs can be iPSCs. The iPSCs can be derived from a somatic cell of a subject. In one aspect, the subject has a demyelinating or dysmylelinating disease or disorder.
(34) In one aspect, the invention provides a method for generating viral and integration-free iPSCs from patients with MS, particularly PPMS. Our differentiation protocol can be used for the efficient differentiation of such iPSCs to OPCs and functional oligodendrocytes, as demonstrated by in vivo myelination in the shiverer mouse.
(35) The invention also provides a model system for a neurological disease, preferably a demyelinating or dysmyelinating disease or disorder. In one aspect, the model system comprises a myelin-producing cell differentiated from an iPSC derived from a subject having a demyelinating or dysmyelinating condition. The model system can further comprise a non-human mammal into which the myelin-producing cell has been transplanted. In one embodiment, the non-human mammal is a mouse or a rat. Model systems provided by the invention can be used to study demyelinating or dysmyelinating diseases or disorders, including understanding underlying mechanisms and defining therapeutic targets.
(36) The invention also provides methods for treating and/or preventing a neurological disease or disorder in a subject by generating OPCs or oligodendrocytes according to a method of the invention; and administering an effective amount of the cells to the subject. Once transplanted, the oligodendrocytes, or OPCs that have differentiated to oligodendrocytes in vivo, promote myelinogenesis in the nervous system of the subject. Thus, the invention provides a use of the OPCs or oligodendrocytes of the invention in the treatment and/or prevention of a neurological disease or disorder in a subject. The neurological disease or disorder can be a demyelinating or dysmyelinating disease, or a neurodegenerative disease. The neurological disease or disorder can affect the central nervous system, the peripheral nervous system, or both. In some embodiments, the demyelinating or dysmyleinating disease is an inflammatory demyelinating disease (such as multiple sclerosis, optic neuritis, Devic disease, acute-disseminated encephalomyelitis and transverse myelitis), viral demyelination, demyelination caused by acquired metabolic disorders, leukodystrophies (including hypomyelinating diseases, such as Pelizaeus-Merzbacher Disease and hereditary spastic paraplegia), X-linked disorders of proteo-lipid protein production, metabolic demyelinations and lysosomal storage disorders (such as metachromatic leukodystrophy-MLD, Tay-Sachs, Sandhoff's and Krabbe's diseases), vanishing white matter disease, and periventricular leukomalacia. MS and particularly PPMS are also conditions that can be treated or prevented by the methods of the invention. In a preferred embodiment, the OPCs or oligodendrocytes generated by a method of the invention are derived from iPSCs generated from a somatic cell of the subject.
(37) Alongside its potential for autologous cell transplantation, iPSC technology is emerging as a tool for developing new drugs and gaining insight into disease pathogenesis. Han, S. S. W. et al., Neuron. 70:626-644 (2011). The methods and cells of the invention will aid the development of high-throughput in vitro screens for compounds that promote myelination. Lee, S. et al., Nat Protoc. 8:771-782 (2013). To that end, we provide a method of identifying a compound that promotes myelination, the method comprising generating myelin-producing cell by a method of the invention; contacting the myelin-producing cell with a candidate compound; and determining whether the candidate compound promotes neuron myelination. In one embodiment, the compound is a candidate therapeutic agent for treating a neurological disease or disorder, such as a demyelinating or dysmyelinating condition, and the method includes determining whether the candidate therapeutic agent has a beneficial effect on neuron myelination, wherein such beneficial effect is indicative of a candidate therapeutic agent for treating a demyelinating or dysmyelinating disease or disorder. The beneficial effect can be, for example, prevention of neuron demyelination, reduction of neuron demyelination, increased neuron conductance, and/or enhanced neuron myelination. Preferably, the method is conducted in a high-throughput format.
(38) The cells, systems, and methods of the invention can also be useful for studying neurological diseases. In particular, the PPMS iPSC lines described here provide a new resource to investigate the process of neurodegeneration, particularly in MS (
(39) As used in this specification and the appended claims, the singular forms “a,” “an,” and “the” include plural referents, unless the context clearly dictates otherwise. The terms “a” (or “an”), as well as the terms “one or more,” and “at least one” can be used interchangeably.
(40) Furthermore, “and/or” is to be taken as specific disclosure of each of the two specified features or components with or without the other. Thus, the term “and/or” as used in a phrase such as “A and/or B” is intended to include A and B, A or B, A (alone), and B (alone). Likewise, the term “and/or” as used in a phrase such as “A, B, and/or C” is intended to include A, B, and C; A, B, or C; A or B; A or C; B or C; A and B; A and C; B and C; A (alone); B (alone); and C (alone).
(41) Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention is related. For example, The Dictionary of Cell and Molecular Biology (5th ed. J. M. Lackie ed., 2013), the Oxford Dictionary of Biochemistry and Molecular Biology (2d ed. R. Cammack et al. eds., 2008), and The Concise Dictionary of Biomedicine and Molecular Biology, P-S. Juo (2d ed. 2002) can provide one of skill with general definitions of some terms used herein.
(42) Units, prefixes, and symbols are denoted in their Systeme International de Unites (SI) accepted form. Numeric ranges are inclusive of the numbers defining the range. The headings provided herein are not limitations of the various aspects or embodiments of the invention, which can be had by reference to the specification as a whole. Accordingly, the terms defined immediately below are more fully defined by reference to the specification in its entirety.
(43) Wherever embodiments are described with the language “comprising,” otherwise analogous embodiments described in terms of “consisting of” and/or “consisting essentially of” are included.
(44) By “subject” or “individual” or “patient” is meant any subject, particularly a mammalian subject, for whom diagnosis, prognosis, or therapy is desired. Mammalian subjects include humans, domestic animals, farm animals, sports animals, and zoo animals including, e.g., humans, non-human primates, dogs, cats, guinea pigs, rabbits, rats, mice, horses, cattle, pigs, and so on.
(45) Terms such as “treating” or “treatment” or “to treat” or “alleviating” or “to alleviate” refer to therapeutic measures that cure, slow down, lessen symptoms of, and/or halt progression of a diagnosed pathologic condition or disorder. Thus, those in need of treatment include those already with the disorder. In certain embodiments, a subject is successfully “treated” for a neurological disease or disorder, particularly a demyelinating or dysmyelinating disease or disorder, according to the methods provided herein if the patient shows, e.g., total, partial, or transient alleviation or elimination of symptoms associated with the disease or disorder.
(46) “Prevent” or “prevention” refers to prophylactic or preventative measures that prevent and/or slow the development of a targeted pathologic condition or disorder. Thus, those in need of prevention include those prone or susceptible to the disease or disorder. In certain embodiments, a neurological disease or disorder, particularly a demyelinating or dysmyelinating disease or disorder, is successfully prevented according to the methods provided herein if the patient develops, transiently or permanently, e.g., fewer or less severe symptoms associated with the disease or disorder, or a later onset of symptoms associated with the disease or disorder, than a patient who has not been subject to the methods of the invention.
(47) The invention is further described in the following non-limiting Examples.
EXAMPLES
Example 1
Differentiation of Oligodendrocytes from hESC Lines
(48) We used an OLIG2-GFP knock-in hESC reporter line (Liu et al., 2011) to track OLIG2.sup.+ progenitors by live fluorescent imaging. First, we induced PAX6.sup.+ cells using dual inhibition of SMAD signaling in adherent cultures. Chambers, S. M. et al., Nat Biotechnol. 27:275-80 (2009). Next, to mimic the embryonic spinal cord environment, we applied different concentrations of RA and/or SHH at various times and quantified OLIG2-GFP expression through flow cytometry (
(49) We then replaced the recombinant human SHH protein with SAG, which increased the yield further to 70.1% OLIG2.sup.+ progenitors (
(50) Next, we validated the initial steps towards the generation of OLIG2.sup.+ progenitors by differentiating a second hESC line (RUES1), and comparing the transcript levels of PAX6, OLIG2, and NKX2.2 by qRT-PCR. The upregulation of these transcription factors followed a similar temporal pattern to that of the OLIG2-GFP line, with PAX6 induction around day 7, OLIG2 peak around day 13, and sustainably high levels of NKX2.2 after day 10 (
(51) To promote maturation toward the O4.sup.+ stage, PDGF-AA, HGF, IGF1, and NT3 were added to the culture medium from day 20 onward. OLIG2.sup.+ progenitors upregulated NKX2.2, then SOX10, and finally matured to late OPCs identified by O4 live staining, and by their highly ramified processes (
(52) We also used an alternative strategy to generate approximately 30% O4.sup.+ cells after only 55 days of culture, significantly reducing the length and costs of differentiation. The mitogens PDGF, NT3, IGF-1 and HGF were withdrawn from the medium as early as at day 30, when the selected spheres were seeded. This resulted in the appearance of O4.sup.+ cells at day 55. The cultures were continued to increase the frequency of O4.sup.+ cells to levels comparable to the longer protocol (
(53) As shown in Table 1, O4 efficiencies ranged from 28% to 80% with nine different PSC lines, and the average was greater than 60% in four lines. Cells were stained with O4 antibody and analyzed by flow cytometry. One hESC line (RUES′) and eight hiPSC lines were tested. Technical replicates were performed using different batches of each line, at different passages. Results are also expressed as mean percentages ±SEM.
(54) TABLE-US-00001 TABLE 1 Percentages of O4.sup.+ OPCs after ~75 Days of Differentiation Cell line N O4.sup.+(%) Mean ± SEM (%) 102 4 40, 71, 72, 74 61.8 ± 7.6 104 4 55, 61, 61, 68 61.3 ± 2.7 107 1 48 109 3 55, 60, 70 61.7 ± 4.2 110 3 29, 37, 73 46.2 ± 13.7 111 2 46, 47 46.4 ± 0.4 130 4 43, 47, 58, 76 56.1 ± 7.2 197 1 28 RUES1 5 36, 54, 68, 78, 80 62.9 ± 8.2 N = Number of Technical Repeats
(55) In both strategies, the withdrawal of the mitogens drives the terminal differentiation of OPCs to oligodendrocytes expressing MBP, although MBP.sup.+ cells do not align with axon fibers under these culture conditions (
(56) As described above, at various stages of the protocol, cultures were checked for the expression of appropriate markers by either qRT-PCR or immunofluorescence. When performing immunofluorescent analysis of the cultures at day 8 for PAX6 (
(57) Finally, O4.sup.+ cells can either be isolated via FACS or further differentiated to MBP.sup.+ oligodendrocytes (
Example 2
Differentiation of Oligodendrocytes from PPMS-iPSC Lines
(58) To show that our protocol can be applied to iPSC lines, we obtained skin biopsies from four PPMS patients. Fibroblast cultures were established from the biopsies, and iPSCs were generated using daily transfections with a cocktail of modified mRNAs, (Warren et al., Cell Stem Cell. 7:618-30 (2010)), together with a cluster of miRNAs to improve the reprogramming efficiency for the most refractory lines (Stemgent). From day 12 to day 15 of reprogramming, TRA-1-60.sup.+ colonies (
(59) Expression profiling for seven pluripotency genes confirmed that all four iPSC lines exhibited a profile comparable to a reference hESC line and divergent from the parental fibroblasts (
(60) Next, we assessed whether the protocol was reproducible with our PPMS-iPSC lines. All iPSC lines tested were found to perform similarly to the RUES1 line (
Example 3
Axon Myelinate Mouse Brain by PPMS-Derived Late OPCS
(61) To verify that OPCs obtained through our protocol were functionally myelinogenic, we injected day 75 FACS-purified O4.sup.+ cells (10.sup.5 cells/animal) into the forebrain of neonatal, immunocompromised shiverer mice (
(62) Transmission electron microscopy on 16 week-old corpus callosum revealed mature compact myelin with the presence of alternating major dense and intraperiod lines (
(63) At 12 weeks, transplanted hNA.sup.+ cells remained as NG2.sup.+ OPCs in the corpus callosum (
Example 4
Detailed Experimental Procedures for Examples 1-3
(64) Cell Lines
(65) Three hESC lines and 4 hiPSC lines were used. RUES1 and HUES 45 are both NIH-approved hESC lines; OLIG2-GFP reporter line is derived from BG01 hESC line (University of Texas Health Science Center at Houston). Four iPSC lines were derived in our laboratory from skin biopsies of PPMS patients through the mRNA/miRNA method (Stemgent).
(66) hPSC Culture Conditions
(67) hESC and hiPSC lines were cultured and expanded with HUESM (HUman Embryonic Stem Medium) medium and 10 ng/ml bFGF (Stemcell Technologies) onto mouse embryonic fibroblast (MEF) layer. For oligodendrocyte differentiation, cells were adapted to cultures onto MATRIGEL®-coated dishes and mTeSR1 medium (Stemcell Technologies). HUESM is composed by Knockout-DMEM, 20% Knock-out serum, glutamax 2 mM, NEAA 0.1 mM, 1× P/S and β-mercaptoethanol 0.1 mM, all purchased from Life Technologies (Grand Island, N.Y.). At all stages of differentiation cells are cultured in 5% CO.sub.2 incubators.
(68) Detailed Differentiation Protocol
(69) PSCs were plated on MATRIGEL® (BD Biosciences; San Jose, Calif.) at a density of 10×10.sup.3 cells/cm.sup.2 in mTeSR1 medium (Stemcell Technologies; Vancouver, BC, Canada) containing 10 μM ROCK inhibitor, Y-27632 (Stemgent; Cambridge, Mass.) for 24 hours. This density of plated hPSCs was optimized to give a confluent well by day 8 and multilayered structures at day 12 of differentiation. This set up does not require significant PSC expansion, as only one well (80% confluent) of a 6-well plate contains enough cells to differentiate and isolate at least 2×10.sup.6 oligodendrocytes. Cells were incubated for 1-2 days, until hPSC colonies reached a diameter of 100-250 μm.
(70) At the day of differentiation induction (day 0), medium was switched to Neural Induction Medium, which is mTeSR Custom Medium (Stemcell Technologies) containing the small molecules SB431542 10 μM (Stemgent) and LDN193189 250 nM (Stemgent), as well as 100 nM all-trans-RA (Sigma-Aldrich; St. Louis, Mo.). mTeSR Custom Medium has the same composition as the commercially available mTeSR-1 medium but without five factors that sustain pluripotency, namely lithium chloride, GABA, pipecolic acid, bFGF, and TGFβ1 (Stemcell Technologies). Instead of mTeSR Custom Medium, we could also use DMEM/F12 with the addition of about 25 μg/ml insulin. Media changes were performed daily until day 8, with fresh RA, SB431542, and LDN193189 added to the medium every day.
(71) By day 8 cells should be confluent and PAX6 expression should be at its peak (
(72) By day 12, overconfluent cells were piling up and 3D structures were clearly visible (
(73) Aggregates were re-plated into Ultra-low attachment plates in N.sub.2B.sub.27 Medium containing 1 μM SAG, changing it every other day. At day 20, medium was switched to PDGF Medium, and ⅔ media changes were performed every other day. During media changes, gentle pipetting was used to break apart any aggregates sticking to one another. At day 30, spheres were plated onto plates coated with poly-L-ornithine hydrobromide (50 μg/ml; Sigma-Aldrich) and Laminin (20 μg/ml; Life Technologies) at a density of 2 spheres/cm.sup.2 (about 20 spheres per well in a 6-well plate). This density was optimized to allow cells to migrate out from the sphere, proliferate and spread to the entire dish by the end of the protocol without the need for passaging. We used a p200 pipette to pick aggregates that were round, golden/brown with a dark center, having a diameter between 300 and 800 μm (
(74) At this stage, plated spheres were cultured in a medium containing mitogens (Option A) or in a medium without any mitogens (Option B). Option A was optimized to obtain the highest yield of O4.sup.+ cells, while Option B was developed to provide a shorter and less costly version of the protocol.
(75) Option A
(76) Spheres were plated on pO/L plates, as described above, in PDGF Medium at day 30, changing ⅔ of the PDGF Medium every other day until day 75 of differentiation. The appearance of O4.sup.+ cells was assessed by live O4 staining from day 55 onwards (
(77) Option B
(78) Spheres were plated on pO/L plates, as described above, in Glial Medium at day 30, changing ⅔ of the Glial Medium every other day until day 55 of differentiation. At day 55, O4.sup.+ cells were visualized by live O4 staining (
(79) For both Option A and Option B protocols, aggregates at day 30, and cells at the end of the differentiation could be cryopreserved with a viability >70%. Aggregates' viability is based on the number of thawed spheres that re-attach onto pO/L coated dishes after thawing. The sorted O4.sup.+ cells could be frozen immediately after sorting. The expected post-thaw viability of the sorted O4.sup.+ cells is 70-80%.
(80) Table 2 provides a list of media compositions used in the protocol.
(81) TABLE-US-00002 TABLE 2 Detailed Composition of Culture Media Media Components Provider Final Conc. N.sub.2 Medium DMEM/F12 Life Technologies Glutamax (100×) Life 1× Technologies Non-Essential Life 1× Amino Acids (100×) Technologies β-Mercapto- Life 1× ethanol (1000×) Technologies Penicillin- Life 1× Streptomycin (100×) Technologies N.sub.2 Supplement (100×) Life 1× Technologies N.sub.2B.sub.27 N.sub.2 Medium Life 1× B.sub.27 Supplement (50×) Technologies PDGF Medium N.sub.2B.sub.27 Medium R&D Systems 10 ng/ml PDGF IGF-1 R&D Systems 10 ng/ml HGF R&D Systems 5 ng/ml NT3 EMD Millipore 10 ng/ml Insulin Sigma-Aldrich 25 μg/ml Biotin Sigma-Aldrich 100 ng/ml cAMP Sigma-Aldrich 1 μM T3 Sigma-Aldrich 60 ng/ml Glial Medium N.sub.2B.sub.27 Medium Sigma-Aldrich 20 μg/ml Ascorbic Acid HEPES Sigma-Aldrich 10 mM Insulin Sigma-Aldrich 25 μg/ml Biotin Sigma-Aldrich 100 ng/ml cAMP Sigma-Aldrich 1 μM T3 Sigma-Aldrich 60 ng/ml
Derivation of Skin Fibroblasts from Punch Biopsies
(82) Skin biopsies were obtained from MS patients and healthy individuals (
(83) Skin biopsies of 3 mm were collected in Biopsy Collection Medium, consisting of RPMI 1460 (Life Technologies) and 1× Antibiotic-Antimycotic (Life Technologies). Biopsies were sliced into smaller pieces (<1 mm) and plated onto a TC-treated 35 mm dish for 5 minutes to dry and finally they were incubated in Biopsy Plating Medium, composed by Knockout DMEM, 2 mM GLUTAMAX™, 0.1 mM NEAA, 0.1 mM β-Mercaptoethanol, 10% Fetal Bovine Serum (FBS), 1× Penicillin-Streptomycin (P/S; all from Life Technologies) and 1% Nucleosides (EMD Millipore), for 5 days or until the first fibroblasts grew out of the biopsy. Alternatively, biopsies were digested with 1000 U/ml Collagenase 1A (Sigma-Aldrich) for 1.5 hours at 37° C., washed, collected and plated onto 1% gelatin-coated 35 mm dish in Biopsy Plating Medium for 5 days. Fibroblasts were then expanded in Culture Medium, consisting of DMEM (Life Technologies), 2 mM GLUTAMAX™, 0.1 mM NEAA, 0.1 mM β-Mercaptoethanol, 10% FBS and 1× P/S changing medium every other day.
(84) Reprogramming of Skin Fibroblasts
(85) Skin fibroblasts at passage 3 to 5 were reprogrammed using the Stemgent mRNA/miRNA kit, which results in the generation of integration-free, virus free human iPSCs, through modified RNAs for OCT4, SOX2, KLF4, cMYC and LIN28 (
(86) Teratoma Assay
(87) Experiments were performed according to a protocol approved by the Columbia Institutional Animal Care and Use Committee (IACUC).
(88) iPSC colonies were dissociated using Collagenase (Sigma-Aldrich) for 15 minutes at 37° C., washed, collected, and re-suspended in 200 μl HUESM. Cells were then mixed with 200 μl Matrigel™ (BD Biosciences) on ice, and were injected subcutaneously into immunodeficient mice (Jackson Laboratory; Bar Harbor, Me.). Teratomas were allowed to grow for 9-12 weeks, isolated by dissection, and fixed in 4% PFA overnight at 4° C. Fixed tissues were embedded in paraffin, sectioned at 10 μm thickness, and stained with hematoxylin and eosin (H&E).
(89) Spontaneous Differentiation In Vitro
(90) iPSCs were dissociated with ACCUTASE® (Life Technologies) for 5 minutes at 37° C. and seeded into Ultra-Low attachment 6-well plates in HUESM without bFGF, changing media every other day. After 3 weeks of culture, embryoid bodies (EBs) were plated onto 1% gelatin-coated TC-treated dishes for another 2 weeks. EBs and their outgrowth were fixed in 4% PFA for 8 minutes at RT and immunostained for the appropriate markers.
(91) RNA Isolation and qRT-PCR
(92) RNA isolation was performed using the RNeasy Plus Mini Kit with QIAshredder (Qiagen; Hilden, Germany). Briefly, cells were pelleted, washed with PBS, and re-suspended in lysis buffer. Samples were then stored at −80° C. until processed further according to manufacturer's instructions. RNA was eluted in 30 μl RNase free ddH.sub.2O and quantified with a NanoDrop 8000 spectrophotometer (Thermo Scientific; Somerset, N.J.).
(93) For qRT-PCR, cDNA was synthesized using the GoScript™ Reverse Transcription System (Promega; Madison, Wis.) with 0.5 μg of RNA and random primers. 20 ng of cDNA were then loaded to a 96-well reaction plate together with 10 μl GoTaq® qPCR Master Mix and 1 μl of each primer (10 nM) in a 20 μl reaction and the plate was ran in Stratagene Mx300P qPCR System (Agilent Technologies; Santa Clara, Calif.). Table 3 lists primer sequences.
(94) TABLE-US-00003 TABLE 3 Sequences of Primers Used for qRT-PCR SEQ SEQ ID. Target ID. NO. Gene Forward Primer NO. Reverse Primer 1 PAX6 TTTGCCCGAGAAAGACTAGC 2 CATTTGGCCCTTCGATTAGA 3 OLIG2 TGCGCAAGCTTTCCAAGA T 4 CAGCGAGTTGGT GAGCATGA 5 NKX2.2 GACAACTGGTGGCAGATTTCGCTT 6 AGCCACAAAGAAAGGAGTTGGACC 7 PTCH1 ATCTGCACCGGCCCAGCTACT 8 CCACCGCGAAGGCCCCAAATA 9 SHH AAACACCGGAGCGGACAGGC 10 GGTCGCGGTCAGACGTGGTG
Nanostring Analysis for Pluripotency
(95) RNA was isolated from undifferentiated iPSCs and hESC HUES45 as previously described. RNA (100 ng/sample) was loaded for the hybridization with the specific Reporter Code Set and Capture Probe Set (NanoString Technologies; Seattle, Wash.) according to manufacturer's instructions. Data were normalized to the following housekeeping genes: ACTB, POLR2A, ALAS1. Data were expressed as fold changes to the expression of the hESC line (HUES45=1). See
(96) Karyotyping
(97) All iPSC-lines were subjected to cytogenetic analysis by Cell Line Genetics to confirm a normal karyotype.
(98) Immunostaining and Imaging
(99) Cells were washed 3× in PBS-T (PBS containing 0.1% Triton-X100) for 10 minutes, incubated for 2 hours in blocking serum (PBS-T with 5% goat or donkey serum) and primary antibodies were applied overnight at 4° C. (Table 4). The next day, cells were washed 3× in PBS-T for 15 minutes, incubated with secondary antibodies for 2 hours at room-temperature (RT), washed 3× for 10 minutes in PBS-T, counterstained with DAPI for 15 minutes at RT and washed 2× in PBS. Invitrogen™ Alexa Fluor secondary antibodies, goat or donkey anti-mouse, rat, rabbit, goat and chicken 488, 555, 568, and 647 were used at 1:500 dilution (Life Technologies).
(100) Images were acquired using an Olympus IX71 inverted microscope, equipped with Olympus DP30BW black and white digital camera for fluorescence and DP72 digital color camera for H&E staining. Fluorescent colors were digitally applied using the Olympus software DP Manager or with ImageJ. For counting, at least three non-overlapping fields were imported to ImageJ, thresholded and scored manually.
(101) Flow Cytometry
(102) Cells were enzymatically harvested by ACCUTASE® treatment for 25 min at 37° C. to obtain a single cell suspension. Cells were then re-suspended in 100 μl of their respective medium containing the appropriate amount of either primary antibody or fluorescence-conjugated antibodies and were incubated on ice for 30 minutes shielded from light. When secondary antibodies were used, primary antibodies were washed with PBS and secondary antibodies were applied for 30 minutes on ice. Stained or GFP expressing cells were washed with PBS and sorted immediately on a 5 laser BD Biosciences ARIA-IIu™ Cell Sorter using the 100 μm ceramic nozzle, and 20 psi. DAPI was used for dead cell exclusion. Flow cytometry data were analyzed using BD FACSDiva™ software.
(103) Transplantation into Shiverer (shi/shi)×Rag2.sup.−/− Mice
(104) All experiments using shiverer/rag2 mice (University of Rochester; Windrem, M. S. et al., Cell Stem Cell. 2:553-565 (2008)) were performed according to protocols approved by the University at Buffalo Institutional Animal Care and Use Committee (IACUC). FACS-sorted O4.sup.+ OPCs that had been previously cryopreserved were thawed and allowed to recover for 1-2 days prior to surgery by plating on pO/L dishes in PDGF Medium. Cells were prepared for injection by re-suspending cells at 1×10.sup.5 cells per μl.
(105) Injections were performed as previously described. Sim, F. J. et al. (2011). Pups were anesthetized using hypothermia and 5×10.sup.4 cells were injected in each site, bilaterally at a depth of 1.1 mm into the corpus callosum of postnatal day 2-3 pups. Cells were injected through pulled glass pipettes, inserted directly through the skull into the presumptive target sites. Animals were sacrificed and perfused with saline followed by 4% paraformaldehyde at 12-16 weeks. Cryopreserved coronal sections of mouse forebrain (16 μm) were cut and sampled every 160 μm. Sim, F. J. et al. (2011). Human cells were identified with mouse antihuman nuclei (hNA) and myelin basic protein-expressing oligodendrocytes were labeled with MBP. Human astrocytes and OPCs were stained with human-specific antibodies against hGFAP and hNG2 respectively. Mouse neurofilament (NF) was stained by 1:1 mixture of SMI311 and SMI312. Invitrogen™ Alexa Fluor secondary antibodies, goat anti-mouse 488, 594, and 647 were used at 1:500 dilution (Life Technologies). For transmission electron microscopy, tissue was processed as described previously. Sim, F. J. et al., Molec. Cell. Neurosci. 20:669-682 (2002). Table 4 provides a list of primary antibodies used.
(106) TABLE-US-00004 TABLE 4 Primary Antibodies Antigen Dil. Host Provider OCT4 1:250 Rabbit Stemgent TRA-1-60 1:250 Mouse Millipore SOX2 1:250 Rabbit Stemgent TRA-1-81 1:250 Mouse Millipore NANOG 1:100 Rabbit Cell Signal. SSEA4 1:250 Mouse Abcam AFP 1:300 Rabbit Dako αSMA 1:300 Mouse Sigma βIII-Tubulin 1:500 Chicken Neuromics PAX6 1:250 Rabbit Covance OLIG2 1:500 Rabbit Millipore NKX2.2 1:75 Mouse DSHB SOX10 1:100 Goat R&D Sys. NG2 1:200 Mouse BD Biosci. PDGFRα-PE 1:5 Mouse BD Biosci. O4 1:30 Mouse Goldman lab MBP 1:200 Rat Millipore MAP2 1:5000 Chicken Abcam GFAP 1:750 Rabbit Dako hNA clone 235-1 1:100 Mouse Millipore GFAP (in vivo) 1:800 Mouse Covance NG2 (in vivo) 1:800 Mouse Millipore SMBI311, SMBI312 1:800 Mouse Covance (mNeurofilament)
REFERENCES
(107) In addition to the documents cited in other sections of this disclosure, the following references may provide additional context. All of the references cited in this disclosure are hereby incorporated by reference in their entireties. In addition, any manufacturer's instructions or catalogues for any products cited or mentioned herein are incorporated by reference. Documents incorporated by reference into this text, or any teachings therein, can be used in the practice of the present invention. Documents incorporated by reference into this text are not admitted to be prior art. Antel, J. et al., Acta Neuropathol. 123:627-638 (2012). Boulting, G. L. et al., Nat. Biotechnol. 29:279-286 (2011). Hauser, S. L. et al., Ann Neurol. 74:317-327 (2013). Hu, Z. et al., Differentiation 78:177-184 (2009). Miller, R. H. et al., J. Neurosci. Res. 76:9-19 (2004). Patani, R. et al., Nature Communications 2:214 (2011). Rice, C. M. et al., J. Neurol. Neurosurg. Ps. 84:1100-1106 (2013). Tomassy, G. S. et al., Frontiers Cell. Neurosci. 8:201 (2014). Yamada M. et al., Nature 510:533-536 (2014).
(108) The foregoing description of the specific embodiments will fully reveal the general nature of the invention such that others can, without undue experimentation, apply knowledge that is within the ordinary skill of those in the art to readily modify and/or adapt such specific embodiments for various applications without departing from the general concept of the present invention. Therefore, such adaptations and modifications are intended to be within the meaning and range of equivalents of the disclosed embodiments, based on the teaching and guidance presented herein. It is to be understood that the phraseology or terminology herein is for the purpose of description and not of limitation, such that the terminology or phraseology of the present specification is to be interpreted by the skilled artisan in light of the teachings and guidance. The present invention is further described by the following claims.