Epstein-Barr virus-like particles with broadened antigenic spectrum

Abstract

The present invention relates to a preparation comprising Epstein-Barr virus-like particles (EB-VLPs), said EB-VLPs being essentially free of Epstein Barr virus (EBV) DNA, wherein said EB-VLPs comprise a vaccination polypeptide comprising at least one peptide of an EBV tegument polypeptide and at least one immunogenic peptide; and to polynucleotides, host cells, and methods related thereto.

Claims

1. A preparation comprising Epstein-Barr virus-like particles (EB-VLPs), said EB-VLPs being essentially free of Epstein Barr virus (EBV) DNA, wherein said EB-VLPs comprise a vaccination polypeptide, said vaccination polypeptide comprising at least one peptide of an EBV tegument polypeptide and at least one immunogenic peptide, wherein said at least one immunogenic peptide is an immunogenic peptide not derived from a tegument polypeptide of EBV, and wherein said at least one immunogenic peptide comprises at least one T-cell epitope.

2. The preparation of claim 1, wherein said at least one immunogenic peptide is an immunogenic peptide of a pathogenic microorganism.

3. The preparation of claim 1, wherein said at least one immunogenic peptide is an immunogenic peptide of a latent EBV polypeptide.

4. The preparation of claim 3, wherein said latent EBV polypeptide is selected from the list consisting of EBNA-1, EBNA-LP, EBNA-2, EBNA-3A, EBNA-3B, EBNA-3C, LMP-1, and LMP-2A.

5. The preparation of claim 1, wherein said EBV tegument polypeptide is the EBV BNRF1 polypeptide.

6. The preparation of claim 5, wherein said immunogenic peptide is inserted into said BNRF1 polypeptide at any one of positions 1 to 172 of the BNRF1 polypeptide of Genbank Accession Number P03179.1 and/or replaces amino acids within said positions.

7. The preparation of claim 1, wherein said vaccination polypeptide comprises the amino acid sequence of SEQ ID NO:1, 2, or 3.

8. A polynucleotide encoding the vaccination polypeptide as specified in claim 1.

9. The polynucleotide of claim 8, wherein said polynucleotide further encodes an EBV genome.

10. A method for stimulating T-cells of a subject comprising contacting said subject with a preparation according to claim 1, thereby stimulating T-cells of said subject.

11. The method of claim 10, wherein said method is a method of vaccination of said subject.

12. The preparation of claim 1, wherein said at least one immunogenic peptide is an immunogenic peptide of a virus.

13. The preparation of claim 1, wherein said at least one immunogenic peptide is an immunogenic peptide of a herpes virus.

14. The preparation of claim 3, wherein said latent EBV polypeptide comprises EBNA-1.

15. The preparation of claim 1, wherein said vaccination polypeptide consists of the amino acid sequence of SEQ ID NO:1, 2, or 3.

Description

FIGURE LEGENDS

(1) FIG. 1: The antigenic spectrum of EBV virions is enlarged through the construction of BNRF1-latent protein gene fusions. (A) EBV virions that encode a BNRF1-EBNA3C fusion protein stimulate BNRF1- and -EBNA3C specific CD4+ T cells. Autologous LCLs were pulsed with various amounts (1×10.sup.4 to 1×10.sup.6 genome equivalents (geq)) of wtEBV or EBVE3C and then co-cultured with CD4+ T cells that were specific for BNRF1 VSD or EBNA3C 5H11 epitopes. In parallel, LCLs were pulsed with control peptides (μg to ng quantities) prior to co-culture with CD4+ T cells. T-cell activation was determined by measuring secreted IFN-γ by ELISA. (B) A neutralizing antibody that recognizes gp350 impairs the antigenicity of wtEBV and EBV-E3C. The neutralizing antibody 72A1 was titrated (50, 5 and 0 μg/mL) and incubated with 1×10.sup.6 geq of wtEBV and EBV-E3C. Thereafter, supernatants were used in T-cell activation assays. The data displayed in each chart represents triplicate values and error bars represent standard deviation. Furthermore, each graph is a representative experiment of at least three.

(2) FIG. 2: Modified VLPs/LPs that lack gp1.10 are antigenic and stimulate multiple EBV-specific T cells. VLPs/LPs-E3C-E1 retain their antigenic character in the absence of gp110. Autologous LCLs were pulsed with control peptides, VLPs/LPs-E3C-E1 (1×10.sup.6 particles) or EBV-E3C-E1 (1×10.sup.6 geq) and cultured with T cells that were specific for gp350 1D6, BNRF1 VSD, EBNA3C 5H11 or EBNA1 3E10 epitopes. T-cell activity was determined by quantifying IFN-γ release with ELBA, The data illustrated in the graphs are average of triplicate values and error bars represent standard deviation. Furthermore, each graph is a representative experiment of at least three.

(3) FIG. 3: VLPs/LPs containing EBNA1 fragments expand T cells that efficiently target EBV infected B cells. (A) Expression of BNRF1-EBNA1 fusion proteins by induced 293/VLPs/LPs-EBNA1RI, 293/VLPs/LPs-EBNA1RII and 293/VLPs/LPs-EBNA1RI:II producer cells. Western blot analysis was performed with α-BNRF1 and α-actin antibodies. (B) VLPs/LPs containing EBNA1 predominantly expand CD4+ T cells. VLPs/LPs-EBNA1RI and VLPs/LPs-EBNA1RII were combined in a 1:1 ratio (VLPs/LPs-EBNA1RI+RII) and used to stimulate PBMCs from eight unhaplotyped EBV-positive donors. The PBMCs from the same donors were stimulated in parallel with gp350-AgAb. Ex vivo cultures were stained for CD3, CD4 and CD8 after two stimulation cycles and analyzed with flow cytometry. The percentage of CD4+, CD8+ and total T cells (CD3+) in ex vivo cultures are shown. (C) VLPs/LPs-EBNA1RI+RII-specific T cells efficiently target EBV-infected B cells during the first 5 days of infection; a summary of flow cytometry results from four donors. PBMCs from four donors were stimulated as described in (B) and then co-cultured with B cells that were infected overnight with B95-8, Additionally, infected B cells were cultured in medium only or with CD19-depleted (CD19-) PBMCs, respectively serving as negative and positive controls for T-cell-mediated targeting of EBV-infected B cells. Ex vivo cultures were analysed five days post-infection with flow cytometry. For flow cytometry, cells were stained for CD19 and the percentage of CD19+GFP+ double-positive B cells were quantified, Since the recombinant B95-8 strain encodes GFP, it enabled infected B cells to be identified through GFP expression. The percentage of CD19+GFP+ B cells in ex vivo cultures are expressed relative to that that of the medium only control.

(4) FIG. 4: VLPs/LPs-EBNA1RI-1-RII-specific T cells prevent the outgrowth of B95-8- and M81-infected B cells. T cells that recognize gp350 or VLPs/LPs-EBNA1RI+RII were expanded from the PBMCs of eight unhaplotyped EBV-positive donors as described in FIG. 3. Autologous primary B cells were infected overnight with B95-8 or M81 and then co-cultured with the stimulated PBMCs. In parallel, the infected B cells were cultured in medium only or with CD19− PBMCs. After 15 days, ex vivo cultures were stained for CD19 and CD23 and then analysed by flow cytometry. The Fig. shows summary of data obtained from eight donors. The percentage of CD19+CD23+ B cells in all cultures are expressed relative to the percentage of CD19+CD23+ B cells in the presence of gp350-specific T cells. Statistical analysis was performed using a two-tailed student T-test. Only P values lower than 0.05 are shown,

(5) FIG. 5: VLPs/LPs containing EBNA1 enable the expansion of cytolytic gp3506 and EBNA1-specific CD4+ T cells. (A) The ex vivo expanded CD4+ T cells are specific for EBNA1 or gp350. Autologous LCLs were pulsed with EBNA1-AgAb, gp350-AgAb, EBNA1 3G2 epitope or gp350 1D6 epitope and then co-cultured with the CD4+ T cells. The release IFN-γ was quantified by ELISA. Each data point is the average of three values and error bars represents standard deviation. Each experiment is a representative of at least three. (B) EBNA1- and gp350-specific CD4+ T cells release granzyme B. Autologous LCLs were pulsed with EBNA1-AgAb, gp350-AgAb or relevant peptides (EBNA1 3G2 and gp350 1D6) and then cocultured with the CD4+ T cells. The release of granzyme B was quantified with an ELISA. The data displayed in each chart represent triplicate values and error bars represent standard deviation, Each graph is a representative experiment of at least three. (C) EBNA1- and gp350-specific CD4+ T cells lyse target cells pulsed with VLPs/LPs-EBNA1RI+RII. Autologous LCLs were pulsed overnight with VLPs/LPs-EBNA1RI+RII, EBNA1 3G2, gp350 1D6 or EBNA3C 5H11 (negative control) peptides. Thereafter, the pulsed LCLs were incubated with calcein AM and then cocultured with increasing amounts of the EBNA1- or gp350-specific CD4+ T cells. Effector to target (E.T) ratios of 1 to 30 were used. The release of calcein from targeted cells was measured at 535 nm after excitation with 485 nm light. Each data point is the average of three values and error bars represents error bars. Furthermore, each experiment is a representative of two experiments.

(6) FIG. 6: Vaccination of humanized mice with VLPs/LPs-EBNA1RI+RII confers protective immunity. (A) Incidence of EBV infection based on EBER staining of spleens. B) Incidence of EBV-infection based on real-time qPCR analysis of peripheral blood. Statistical analysis was performed on the results shown using a one-tailed Chisquare test. Only P values lower than 0.05 are shown.

(7) FIG. 7: Construction of EBV BAC DNA encoding a BNRF1-latent protein fusion. (A) Galk recombination was carried out with a 150 bp fragment encoding the EBNA3C (E3C) 5H11 epitope. EcoRI and BamHI restriction sites before and after recombination are shown, as are the size of fragments generated by these enzymes. (B) Restriction digestion with EcoRI and BamHI confirmed that EBV-E3C BAC DNA from 293 producer cells generated the same restriction fragments as EBV-E3C BAC DNA constructed in E. coli., White arrows emphasize DNA fragments that are different between wtEBV DNA (B95-8) and DNA modified with galK recombination. Construction and verification of the other constructs was performed analogously.

(8) The following Examples shall merely illustrate the invention. They shall not be construed, whatsoever, to limit the scope of the invention.

EXAMPLE 1: MATERIALS AND METHODS

(9) Ethics statement. Peripheral blood mononuclear cells (PBMCs) were isolated from healthy donors (ethical approval granted by the Ethikkommission of the Medizinische Fakultät Heidelberg (S-603/2015)) or from anonymous buffy, coats purchased from the Institut für Klinische Transfusionsmedizin und Zelltherapie (IKTZ) in. Heidelberg and did not require ethical approval. Animal experiments were approved (approval number G156-12) by the federal veterinary office at the Regierungspräsidium Karlsruhe (Germany) and were performed in strict accordance with German animal protection law (TierSchG). Mice were handled in accordance with good animal practice, as defined by the Federation of European Laboratory Animal Science Associations (FELASA) and the Society for Laboratory Animal Science (GVSOLAS), and were housed in the class II containment laboratory of the German Cancer Research Center.

(10) Cell Lines and Primary Cells

(11) Cell lines included EBV-positive Raji cells, EBV-negative Elijah B cells (kindly provided by Prof A. B. Rickinson), HEK293 cells, T cells specific for EBNA1 3E10, EBNA3C 5H11, gp350 1D6 and BNRF1 VSD epitopes and autologous LCLs (kindly provided by Prof. J. Mautner; produced essentially as described in Adhikary et al., 2007. PloS One. 2:e583 (BNRF1 VSD), Adhikary et al., J Virol 82:3903-3911(gp350 1D6), Yu et al., 2015, Blood 125: 1601-1610 (EBNA3C 5H11), Linnerbauer et al., PLoS Pathog 10: e10004068 (EBNA1 3E10). Peripheral blood mononuclear cells (PBMCs) were isolated using Ficoll-Paque Plus and primary B cells were isolated using Dynabeads CD19 Pan B (Invitrogen) and DETACHaBEAD CD19 kit (Invitrogen). RPMI containing 10% fetal calf serum was used to culture 293, Raji and Elijah cells. T-cell clones and lines were cultured as previously described by Adhikary et al. (2007), PLoS One 2: e583.

(12) Construction and Production of AgAbs

(13) AgAbs were constructed using sequences coding EBNA1 (390-622 aa) and gp350 (1-470 aa). Latent protein-coding sequences were PCR amplified and introduced downstream of an α-CD20 HC gene contained within the pRK5 expression vector (Yu et al. (2015), Blood 125: 1601). The α-CD20 antibody and AgAbs were produced by transfecting the appropriate heavy chains and the α-CD20 light chain into 293 cells using polyethyenimine (PEI). The following day the PEI-containing medium was removed and replaced with serum-free FreeStyle™ 293-expression medium and cells were incubated for three days. Supernatants were centrifuged at 400×g for 10 minutes and filtered through a 0.22 μm filter.

(14) Recombinant BAC DNA and Stable Producer Cell Lines

(15) Recombinant BAC DNA was constructed using galK recombination (Warming et al. (2005), Nucleic Acids Res 33: e36). In the present study, wtEBV (B95-8) or VLPs/LPs (B95-8ΔBFLF1/BFRF1a/BALF4) (Shumilov et al. (2017), Nat Commun 8: 14257) BAC DNA were modified to encode latent protein fragments. Only VLPs/LPs lacking BALF4, encoding the glycoprotein gp110, were utilized in the present study due to their enhanced safety. The primers used for the construction of BAC mutants, as well as a description of all BAC mutants, are shown in Table 1. The first step in galK recombination was the insertion of the galK cassette into the BNRF1 ORF of wtEBV or VLPs/LPs BAC DNA. Subsequently, the galK cassette was replaced with DNA fragments encoding latent protein moieties. Outgrowing colonies were analysed with restriction digestion and sequencing to confirm the integrity of BNRF1-latent protein fusions. Stable producer cells were generated with the recombinant BAC DNA as previously described Ganz et al. (2000), J Virol 74: 10142-40152).

(16) Production of Virus and VLPs/LPs

(17) An expression plasmid encoding BZLF1 (p509) was transfected into producer cells to induce virus or VLPs/LPs production. For the production of EBV (B95-8 or M81) for ex vivo and in vitro studies, the pRA plasmid encoding gp1.10 was cotransfected with p509 for increased infectivity. The liposome-based transfectant Metafectene (Biontex) was used to carry out transfections overnight. Subsequently, Metafectene-containing medium was removed and replaced with fresh medium. Transfected cells were incubated for three days before supernatants were harvested. Supernatants were centrifuged at 400×g for 10 minutes and filtered through a 0.44 μM filter. VLPs/LPs used for ex vivo T-cell expansions and animal experiments were produced in serum-free FreeStyle™ 293-expression medium (Gibco™). In all other cases, virus and VLPs/LPs were produced on RPMI supplemented with 10% FCS. Lastly, virus and VLPs/LPs used in animal experiments were concentrated at 18 000×g for 3 hours and resuspended in PBS.

(18) Real-Time qPCR

(19) Virus titers were determined by real-time qPCR as previously described (Pavlova et al. (2013), J Viral 87: 2011). In brief, virus containing supernatants were treated with DNase I (5 units) and proteinase K (1 mg/mL). Next, real-time qPCR analysis was carried out using primers and probe specific for the EBV BALF5 gene. To determine the presence of EBV in peripheral blood, genomic DNA from vaccinated and challenged animals was compared to unchallenged animals. Quantification of VLPs/LPs with flow cytometry wtEBV, previously quantified with real-time qPCR, was titrated (1, 0.75, 0.5, and 0.25×107 geq) and bound to Elijah B cells at 4° C. Cells were washed, stained with α-gp350 (clone 72A1) and α-mouse IgG-Cy3 antibodies and analysed with flow cytometry. MFI values were determined for different amounts of virus. A standard curve was generated for EBV genomes vs MFI. Concurrently, supernatants containing VLPs/LPs were incubated with Elijah B cells and stained as above. MEI values obtained for VLPs/LPs were extrapolated off the standard curve to quantify VLPs/LPs. T-cell activation assays IFN-γ in cell culture supernatants was determined as previously described (Yu et al. loc. cit.). Autologous LCLs were pulsed overnight with antigen and co-cultured for a minimum of 18 hours with T cells at an E:T ratio of 1:1. Supernatants were analyzed by ELISA (Mabtech). In blocking studies with neutralising antibody (72A1 clone), virus containing supernatants were preincubated with antibody for 1 hour at 37° C. before being used in T-cell activation assays. Short-term ex vivo stimulation of PBMCs with VLPs/LPs-EBNA1RI+RII or gp350-AgAb Bulk PBMCs from EBV-positive donors were pulsed with VLPs/LPs-EBNA1 (1×10.sup.6 particles) or gp350-AgAb (20 ng). After two days, cultures were supplemented with IL-2 (10 U/mL) and thereafter maintained in medium containing IL-2. Cells were restimulated 10 days later using IL-2 (10 U/mL) and the same amount of VLPs/LPs-EBNA1 or gp350-AgAb. One week later, cells were analyzed for the presence of CD4, CD8 and CD3 expressing cells or where co-cultured with primary B cells that were infected overnight with EBV. Targeting of recently infected B cells by VLPs/LPs-EBNA1-stimulated PBMCs Bulk PBMCs from four EBV-positive donors were stimulated for two rounds with VLPs/LPs-EBNA1 (1×10.sup.6 particles) or gp350-AgAb (20 ng) in the presence of IL-2 (10 U/mL). Autologous primary B cells were infected overnight with B95.8 (MOI=3) and then co-cultured with the stimulated PBMCs, CD19− depleted PBMCs or medium only. Ex vivo cultures were analyzed with flow cytometry and immunofluorescence 5 days post-infection to observe EBV-positive cells. Cells were stained with α-CD19-APC (HIB19 clone) prior to flow cytometry and α-CD20 (1.26 clone), α-EBNA2 (PE2 clone) and DAPI prior to immunofluorescence.

(20) Restriction of B Cell Outgrowth by VLPs/LPs-EBNA1-Stimulated PBMCs

(21) Bulk PBMCs from eight EBV-positive donors were stimulated for two rounds with VLPs/LPs-EBNA1 (1×10.sup.6 particles) or gp350-AgAb (20 ng) in the presence of IL-2 (10 U/mL). B cells were infected with B95-8 or M81, respectively using an MOI of 3 or 30 to account for their different transforming abilities, Ex vivo cultures stained with α-CD19-APC (H1B19 clone) and α-CD23-PE-Cy7 (EBVCS2 clone) antibodies and analysed by flow cytometry. Expansion of EBNA1 and gp350-specific CD4+ T cells from VLPs/LPs-EBNA1-stimulated. PBMCs PBMCs from an EBV-positive donor were stimulated for one round with VLPs/LPs-EBNA1RI+RII (1×10.sup.6 particles) in the absence of IL-2. After two weeks, cells were restimulated using irradiated (40 Gy) autologous PBMCs, pulsed with the same dose of VLPs/LPs-EBNA1RI+RII, in the presence of IL-2. After another two weeks, EBNA1- or gp350-specific T cells were expanded by stimulating cells biweekly with AgAbs (10-50 rig) that contained EBNA1 or gp350. Autologous LCLs, generated using B95-8ΔZR, were used as antigen presenting cells after the fifth round of stimulation. T cells were maintained in AIM V medium supplemented with 10% pooled human serum, IL-2 (10 U/mL), 10 mM HEPES, 2 mM L-glutamine, 50 μg/mL gentamicin and 0.4 mg/mL ciprofloxacin.

(22) Generation, Vaccination and Challenge of Humanized NSG-A2 Mice

(23) NSG-A2 mice (NOD.Cg-PrkdcscidIl2rgtm1WjlTg (HLA-A2.1) 1Enge/SzJ) were humanized with CD34+ hematopoictic progenitor cells (HPCs) as previously described (Lin et al. (2015), PLoS Pathog 11: e1005344). Newborn mice were irradiated (1 Gy) and injected intrahepatically with CD34+ HPCs isolated from human fetal liver tissue (Advanced Bioscience Resources, USA). After 12 weeks, the presence of human CD45+ cells in the peripheral blood of mice was determined to confirm successful humanization. In total, 20 humanized NSG-A2 (huNSG-A2) mice were randomly grouped according to similarity of humanization ratios and injected intraperitoneally in a single blind fashion with PBS, VLPs/LPs (1×10.sup.6 particles) or VLPs/LPs-EBNA1 (1×10.sup.6 particles). In all cases, 50 μg poly (I:C) was used as adjuvant. Animals were boosted one month later with the same treatments. One and a half months after the boost, animals were injected intraperitoneally with 1×10.sup.5 GRUB of B95-8. Mice were sacrificed eight weeks post-infection and their blood and tissues analysed for evidence of EBV infection. All the VLPs/LPs and virus used in animal experiments were obtained by centrifuging supernatants at 18 000×g for 3 hours and resuspending in PBS.

EXAMPLE 2: ENLARGING THE ANTIGENIC SPECTRUM OF EBV VIRIONS TO INCLUDE LATENT PROTEINS

(24) To generate immunogenic particles with an enlarged antigenic spectrum, we fused antigens to BNRF1. However, since wild-type EBV (wtEB) can be accurately and sensitively quantified through qPCR, we first modified BNRF1 of wtEBV to test incorporation. The BNRF1 of wtEBV was modified to contain a fragment from the highly antigenic latent protein EBNA3C (FIG. 7). Bacterial artificial chromosome (BAC) DNA from wtEBV was modified to contain EBNA3C and then stably introduced into 293 cells to generate a virus producer cell line (293/EBV-E3C). The integrity of the EBV-E3C BAC DNA within producer cells was confirmed with restriction analysis (S1 Fig). Transfection of the lytic transactivator BZLF1 gene into 293/EBV-E3C and 293/wtEBV yielded a similar percentage of cells that expressed the late lytic protein gp350 (FIG. 7). This indicates that modification of BNRF1 to include a latent antigen does not influence lytic replication, Next, we compared the antigenicity of EBV-E3C and wtEBV viruses in T-cell activation assays (FIG. 1A). Autologous lymphoblastoid cell lines (LCLs) were pulsed with the two viruses or peptide controls and then cocultured with BNRF1- (Adhikary et al. (2007) loc. cit.) or EBNA3C- (Yu et al. (2015) loc. cit.) specific CD4+ T cells. This confirmed that virions were able to simulate EBNA3C- and BNRF1-specific CD4+ T cells when their BNRF1 was modified to contain an EBNA3C fragment. Conversely, wtEBV that contained unmodified BNRF1 was only able to stimulate the BNRF1-specific CD4+ T cells (FIG. 1A). In all cases, the dose of the virus applied correlated to the response generated by the T cells, with as little as 1×10.sup.4 virions (genome equivalents (geq)) being able to generate responses from the BNRF1- and EBNA3C specific T cells. Importantly, BNRF1-specific CD4+ T cells recognized modified and unmodified EBV to the same extent. This indicates that BNRF1-latent antigen fusion proteins enlarged the antigenic spectrum of EBV without influencing the antigenicity of BNRF1. Next, we tested whether the enlarged antigenic spectrum of EBV-E3C was exclusively due to BNRF1-latent antigen fusions contained within virions. To this end, virus supernatants were preincubated with anti-gp350 neutralising antibody prior to being used in T-cell recognition assays (FIG. 1B). This showed that the neutralising antibody was able to abolish the antigenicity of EBV-E3C. Altogether, these results confirm that BNRF1-latent antigen fusion proteins are successfully packaged into virions and enlarge their antigenic spectrum.

EXAMPLE 3: ANTIGENIC DIVERSIFICATION OF VLP/LPS LACKING GP110

(25) Next, we confirmed the antigenicity of BNRF1-latent antigen fusion proteins in gp110-negative VLPs/LPs. Since gp110 has been shown to preclude viral and host membrane fusion. (Neuhierl et al. (2009), J Viral. 83: 4616), and abrogate toxicity, we exclusively used gp110-negative VLPs/LPs in the present study, We concurrently modified VLPs/LPs and wtEBV to encode EBNA3C and EBNA1 fragments, respectively generating 293NLPs/LPs-E3C-E1 and 293/EBV-E3C-E1 producer cells. EBNA1, like EBNA3C, is a highly immunogenic latent protein that is frequently recognized by the population. The DNA-free VLPs/LPs-E3C-E1 were quantified using flow cytometry and then compared to an equivalent amount of EBV-E3C-E1 that was quantified with qPCR. This confirmed that flow cytometry enabled the reliable quantification DNA-free VLPs/LPs. Next, VLPs/LPs-E3C-E1 were analyzed in T-cell activation assays alongside EBV-E3C-E1 (FIG. 2). This showed that the VLPs/LPs, like EBV virions, were able to stimulate BNRF1-, gp350-, EBNA3C- and EBNA1-specific CD4+ T cells when they were modified to contain EBNA3C and EBNA1 fragments. Furthermore, the modified VLPs/LPs stimulated the various lytic protein- and latent protein-specific T cells to the same extent as modified EBV. This confirmed that VLPs/LPs could be used as a platform to generate immunogenic particles that comprise lytic and latent antigens. Furthermore, the lack of gp110 does not negatively influence the antigenicity of the VLPs/LPs, indicating that their safety can be increased without compromising their antigenicity.

EXAMPLE 4: MODIFIED VLPS/LPS EXPAND T CELLS THAT EFFICIENTLY TARGET RECENTLY INFECTED B CELLS

(26) Since EBV-specific T cells play a crucial role in controlling EBV-infection, we tested whether modified VLPs/LPs could expand EBV-specific T cells with protective value. To this end, epitope-rich regions from EBNA1, arbitrarily named region I, region II and region I:II, were used to generate VLPs/LPs producer cells that encode EBNA1. Analysis of the producer cells with western blot showed that the 293/VLP/LP-EBNA1RI:II producer cell was unable to express the large BNRF1-EBNA1 fusion, whilst the 293/VLP/LP-EBNA1RI and 293/VLP/LP-EBNA1RII producer cells successfully their expressed their BNRF1-EBNA1 fusions (FIG. 3A). Hence VLPs/LPs-EBNA1RI:II were excluded form from analysis. VLPs/LPs-EBNA1RI and VLPs/LPs-EBNA1RII were combined (VLPs/LPs-EBNA1RI+RII) and used to stimulate bulk PBMCs from unhaplotyped EBV-positive donors (FIG. 3B). As a control, PBMCs from the same donors were also expanded with an antigen-armed antibody (AgAb) that contained the major EBV glycoprotein gp350. AgAbs were originally developed as a targeted therapy for B cell malignancies, but were repurposed in the present study to expand EBV-specific T cells of interest. Stimulation of PBMCs from EBV-positive donors with VLPs/LPs-EBNA1RI+RII or gp350-AgAb expanded similar numbers of CD4+, CD8+ and total T cells from the PBMCs of EBV-positive donors (FIG. 3B). Next, T cells expanded from the PBMCs of four EBV-positive donors were cocultured with B95-8-infected primary B cells. After 5 days, ex vivo cultures were analysed by flow cytometry to determine the presence of EBV-infected B cells (FIG. 3C). Since the recombinant B95-8 strain encodes GFP, it enabled infected B cells to be detected by identifying CD19+GFP+ double-positive cells. This showed that ex vivo cultures contained less CD19+GFP+ double-positive cells in the presence of gp350- and VLPs/LPs-EBNA1RI+RII-specific T cells compared to the control samples. This implies that both gp350- and VLPs/LPs-EBNA1RI+RII-specific T cells are capable of targeting EBV-infected B cells during the early phase of infection. However, results from four donors show that T cells specific for VLPs/LPs-EBNA1RI+RII were substantially more adept at targeting recently infected B cells than gp350-specific T cells (FIG. 3C). Ex vivo cultures contained very few EBNA2-positive B cells in the presence VLPs/LPs-EBNA1RI+RII-specific T cells. Taken together, these results indicate that modified VLPs/LPs are likely to generate superior protective T-cell responses compared to vaccines composed exclusively of gp350.

EXAMPLE 5: MODIFIED VLPS/LPS EXPAND T CELLS THAT RESTRICT THE OUTGROWTH OF B95-8- AND M81-INFECTED B CELLS

(27) Having shown that VLP/LPs-EBNA1RI+RII-specific T cells efficiently targeted B95-8 infected. B cells, we tested whether they could prevent the outgrowth of infected B cells over a longer period. Additionally, we tested whether VLP/LPs-EBNA1RI+RII-specific T cells could prevent the outgrowth of B cells infected with the prototypic B95-8 strain or the distantly related M81 strain (Tsai et al. (2013), Cell Rep 5: 458.470) from. Hong Kong. We stimulated PBMCs from eight EBV-positive donors as before (see FIG. 3) and then cocultured them with B95-8- and M81-inflected. B cells. As a positive and negative control, infected B cells were respectively cultured with CD19-PBMCs or in medium only. After 15 days, ex vivo cultures were analysed with flow cytometry to detect outgrowing B cells (FIG. 4). Since proliferating B cells express CD23, outgrowing B cells were identified by detecting CD19+CD23+ double-positive cells. EBV-infected. B cells were found to consist of CD19+CD23−, CD19+CD23low and CD19+CD23high populations when they were cultured in medium only, with the majority of B cells being of the CD19+CD23high variety. Comparatively, in the presence of CD19− PBMCs, gp350-specific T cells and VLPs/LPs-EBNA1RI+RII-specific T cells, the number of CD19+CD23+ cells were considerably reduced. This indicated that proliferating B-cells were restricted in these cultures. Interestingly, whilst gp350-specific T cells were shown to be more efficient than. CD19− PBMCs at targeting infected B cells during the early phase of infection (see FIG. 3), the CD19− PBMCs of some donors were considerably more adept at restricting B-cell outgrowth than gp350-specific T cells (FIG. 4). This suggest that the PBMCs from some donors contained EBV-specific T cells, other than gp350-specific T cells, that were able to restrict B-cell outgrowth. However, it is evident that proliferating B cells were restricted to a greater degree in ex vivo cultures that contained VLPs/LPs-EBNA1RI+RII-specific T cells. Moreover, this was observed for B95-8- and M81-infected. B cells and for all donors (FIG. 4). This confirms that VLPs/LPs equipped with EBNA1 expand EBV-specific T cells that efficiently restrict B cells infected with B95-8 and M81 EBV.

EXAMPLE 6: MODIFIED VLPS/LPS STIMULATE CYTOLYTIC T CELLS THAT RECOGNIZE LYTIC AND LATENT CYCLE ANTIGENS

(28) Having shown that VLPs/LPs-EBNA1RI+RII-specific T cells target and control EBV-infected cells, it indicated that they were cytolytic in character. To conclusively confirm that VLPs/LPs-EBNA1RI+RII stimulate cytolytic T cells, we expanded EBNA1- and gp350-specific T cells from VLPs/LPs-EBNA1RI+RII-stimulated PBMCs and analyzed them for their cytotoxic potential. Bulk PBMCs from an unhaplotyped EBV-positive donor was stimulated with VLPs/LPs-EBNA1RI+RII for a couple of rounds, after which gp350-AgAb or EBNA1-AgAb were used to expand gp350- and EBNA1-specific CD4+ T cells (FIG. 5A). The expanded CD4+ T cell were confirmed to be specific for either EBNA1 or gp350. The ex vivo expanded CD4+ T cells specifically responded to EBNA1-AgAb or gp350-AgAb and to EBNA1 3G2 or gp350 1D6 epitope peptides. Next, we determined whether the EBNA1- and gp350-specific CD4+ T cells were capable of expressing CD107a, a surrogate marker for the release of cytolytic granules. Autologous LCLs were pulsed with α-CD20, EBNA1-AgAb or gp350-AgAb then cocultured with the EBNA1- and gp350-specific CD4+ T cells. This showed that both CD4+ T-cell lines upregulated CD107a in response to the relevant antigen. However, approximately 50% of gp350-specific CD4+ T cells expressed CD107a, whilst only 10% of EBNA1-specific CD4+ T cells expressed. CD1.07a. Next, we tested the ability of EBNA1- and gp350-specific CD4+ T cells to release the mediator of cytolysis granzyme B (FIG. 5B). Both the EBNA1- and gp350-specific CD4+ T cells released granzyme Bin response to the relevant AgAb and epitope peptide, Lastly, we tested whether the EBNA1- and gp350-specific CD4+ T cells were capable of directly lysing autologous LCLs pulsed with antigen (FIG. 5C). This showed that the both the EBNA1- and gp350-specific CD4+ T cells specifically lysed LCLs pulsed with epitope peptides and VLPs/LPs that contained. EBNA1. Taken together, these results confirm that VLPs/LPs-EBNA1RI+RII have the ability to stimulate cytolytic CD44+ T cells specific for lytic and latent antigens. These results are consistent with previous studies that showed EBNA1- and gp350-specific T cells to be cytolytic.

EXAMPLE 7: VACCINATION WITH EBV VLPS/LPS CONTAINING EBNA1 PROTECTS ICE FROM WTEBV INFECTION

(29) Having shown that modified VLPs/LPs were antigenic in vitro and ex vivo, we assesses whether VLPs/LPs-EBNA1RI+RII had protective abilities in vivo. To this end, mice reconstituted with human immune system components, susceptible to EBV infection and capable of exerting EBV-specific immune control, were used to interrogate VLPs/LPs-EBNA1RI+RII. Humanized NSG A2 (huNSG-A2) mice were randomly grouped and injected intraperitoneally with PBS, unmodified VLPs/LPs (1×10.sup.6 particles) or VLPs/LPs-EBNA1RI+RII (1×10.sup.6 particles), using poly (I:C) as an adjuvant. Four weeks later, mice were boosted using the same dose. Animals were challenged with B95-8 (1×10.sup.5 GRUs) six weeks after the last boost and euthanized eight weeks later. From the literature we knew that this titer would enable infection without gross development of tumors. The spleens of challenged animals were analysed by histology. This showed that all animals contained human CD20- and CD3-positive cells in their spleens. However, there was no correlation between the abundance of CD20- and CD3-positive cells and the different treatments. In situ hybridization revealed the presence of interspersed cells that expressed EBV-encoded RNAs (EBERs) in the spleens of mice from the PBS and unmodified VLPs/LPs groups. In total, 60% of mice from the PBS group were found to contain EBER+ cells, while 37.5% of the mice from the VLPs/LPs group contained EBER+ cells (FIG. 6A). Statistical analysis showed that this observation was statistically insignificant (P>0.05). None of the spleen samples from the VLPs/LPs-EBNA1RI+RII group were found to contain EBER+ cells. This result was confirmed to be statistically significant from the PBS (P=0.009) and VLPs/LPs (P=0.035) groups. Next, qPCR was used to detect the presence of EBV in the peripheral blood of challenged animals (FIG. 6B). This showed that 100% of mice from the PBS group contained EBV DNA in their peripheral blood, compared to 62% of the VLPs/LPs group and 14% of the VLPs/LPs-ERNA1RI+RII group. Once more, statistical analysis revealed that the observed difference between the PBS and VLPs/LPs group was not significant (P>0.05). However, statistical analysis showed that the difference between the VLPs/LPs-EBNA1RI+RII group and the PBS (P=0.0017) and VLPs/LPs (P=0.0286) groups was significant. These results indicate that the inclusion of EBNA1 within VLPs/LPs significantly improved vaccine-induced immunity, which bodes well for future investigations that involve VLPs/LPs containing antigenic fragments from multiple immunodominant latent proteins.

LITERATURE

(30) Adhikary et al. (2007), PLoS One 2: e583 Adhikary et al. (2008), J Virol 82:3903 Bernardeau et al., (2011), J Immunol Methods, 371(1-2):97 Bordner (2010), PLoS ONE 5(12): e14383 Greenstone et. al. (1998), Proc. Natl. Acad. Sci. USA 95:1800 Fearon et al. (2000), Annu Rev Immunol 18:393 Janz et al. (2000), J Virol 74: 10142-10152 Johannsen et al. (2004), Proc Natl Acad Sci USA 101: 16286 Kieff and Rickinson. (2006), hi D. M. Knipe and P. M. Howley (ed.), Fields virology, 5th ed. Lippincott-Raven, Philadelphia, Pa.: 2603 Kieff and Rickinson, (2006), In D. M. Knipe and P. M. Howley (ed.), Fields virology, 5th ed. Lippincott-Raven, Philadelphia, Pa.: 2655 Linnerbauer et al. (2014), PLoS Pathog 10: e10004068 Küppers, R. (2003), Nat. Rev. Immunol. 3:801-812 Laichalk and Thorley-Lawson. (2005), J. Virol. 79:1296 Lin et al. (2015), PLoS Pathog 11: e1005344 Long et al. (2011), Curr Opin Immunol 23(2):258 Mandic and Vujkov. (2004), Ann. Oncol. 15:197 Neuhierl et al. (2009), J Virol 83: 4616 Nielsen et al., (2004), Bioinformatics, 20 (9), 1388 Pavlova et al. (2013), J Virol 87: 2011 Rees et al. (2009), Transplantation 88(8):1025 Rooney et al., (1998), Blood 92:1549-1555 Ruiss et al. ((2011), J Virol 85(24):13105) Shumilov et al. (2017), Nat Commun 8: 14257 Tsai et al. (2013), Cell Rep 5: 458-470 Warming et al. (2005), Nucleic Acids Res 33: e36 WO 2013/098364 Yu et al. (2015), Blood 125: 1601

(31) TABLE-US-00001 Primer Sequence Clone SEQ ID NO: EBNA1for TAGCGGCCGCACAGTCACATCATCCGGGTCTC EBNA1-AgAb 12 EBNA1rev TTTCATAGATCTTAATGGTGATGGTGATGATGCGCGGCAGCCC 13 CTTCC gp350 for CGTAGCGGCCGCAATGGAGGCAGCCTTGCTTG gp350-AgAb 14 gp350 rev TTTCATAGATCTTAATGGTGATGGTGATGATGGGTGGATACAG 15 TGGGGCCTG GalKfwd GAGCAGGGTGAACACTTGGGCACGGAGAGTGCCCTGGAGGC EBV-galK 16 CTCAGGCAACCTGTTGACAATTAATCATCGGCA Galkrev ATGTGGAAGGCCTTGCCATCCAGTCTGGTCCGTAGGCATACA 17 CATAGTTGTCAGCACTGTCCTGCTCCTT GalKfwd2 GAGCAGGGTGAACACTTGGGCACGGAGAGTGCCCTGGAGGC VLPs/LPs-galK 18 CTCAGGCAACCTGTTGACAAATTAATCATCGGCA GalKrev2 ATGTGGAAGGCCTTGCCATCCAGTCTGGTCCGTAGGCATACA 19 CATAGTTGTCAGCACTGTCCTGCTCCTT E3Cfwd GAGCAGGGTGAACACTTGGGCACGGAGAGTGCCCTGGAGGC EBV-E3C 20 CTCAGGCAATGCACCACCTAATGAAAATCCATATCAC E3Crev ATGTGGAAGGCCTTGCCATCCAGTCTGGTCCGTAGGCATACA 21 CATAGTTGCCTGACGCAGGTTTACGGC E1-E3fwd AGCAGGGTGAACACTTGGGCACGGAGAGTGCCCTGGAGGCCT EBV-E3C-E1 22 CAGGCAACAATGCACCACCTAATGAAAATCC E1-E3Crev CATGTGGAAGGCCTTGCCATCCAGTCTGGTCCGTAGGCATAC 23 ACATAGTTTCCAGGGGCCATTCCAAAG E1-E3fwd2 AGCAGGGTGAACACTTGGGCACGGAGAGTGCCCTGGAGGCCT VLPs/LPs-E3C-E1 24 CAGGCAAGAATGCACCACCTAATGAAAATCC E1-E3Crev2 CATGTGGAAGGCCTTGCCATCCAGTCTGGTCCGTAGGCATAC 25 ACATAGTTTCCAGGGGCCATTCCAAAG E1RIfwd TAATCCCTCAGGCCAGTCATCATCCGGGTCTCCAC VLPs/LPs-EBNA1RI 26 E1RIrev TTAGATCCTGAGGCACTACCTCCATATACGAACACACCGGC 27 E1RIIfwd GGCACTACCGACGAAGGAACTTGGGTCG VLPs/LPs-EBNA1RII 28 E1RIIrev GGCCGCGGCAGCCCCTTCCAC 29 E1RI:IIfwd GGCACTACCGACGAAGGAACTTGGGTCG VLPs/LPs-EBNA1RI:RII 30 E1RI:IIrev GGCCGCGGCAGCCCCTTCCAC 31