APTAMERS THAT TARGET CXCL9
20230358760 · 2023-11-09
Assignee
- RHEINISCHE FRIEDRICH-WILHELMS-UNIVERSITÄT BONN (Bonn, DE)
- LEIBNIZ UNIVERSITÄT HANNOVER (Hannover, DE)
Inventors
Cpc classification
G01N33/6863
PHYSICS
G01N33/5308
PHYSICS
G01N2800/245
PHYSICS
C12N15/115
CHEMISTRY; METALLURGY
International classification
Abstract
The present invention relates to an aptamer comprising a nucleotide sequence SEQ ID NO: 1, preferably comprising or consisting of a nucleotide sequence SEQ ID NO: 4-6. The invention further relates to a composition comprising the aptamer, and the use of the aptamer as a medicament or a diagnostic reagent, particularly for use in the detection or diagnosing of a rejection of a renal allograft.
Claims
1. An aptamer comprising a nucleotide sequence 5′-N.sub.1N.sub.2GN.sub.3CCN.sub.1AN.sub.4N.sub.5N.sub.1N.sub.6N.sub.7N.sub.8N.sub.1-3′ (SEQ ID NO: 1) or pharmaceutically acceptable salts thereof, wherein: N.sub.1 represents T or 5-ethynyl-2′-deoxyuridine (EdU) which is modified with a side chain selected from the group consisting of an indole, benzofurane, naphthalene, phenol, benzothiophene, guanidine and benzyl, N.sub.2 represents a sequence of 9 or 11 contiguous nucleotides comprising at least 5 guanidine nucleotides, N.sub.3 represents A or C, N.sub.4 represents A or a deletion, N.sub.5 represents C or G, N.sub.6 represents C or a deletion, N.sub.7 represents C or G, N.sub.8 represents G or N.sub.1.
2. The aptamer according to claim 1, wherein the aptamer comprises a nucleotide sequence 5′-CACGACGCAAGGGACCACAGGGAGGGAGGGN.sub.1GGGC AAAGGGCCCN.sub.1AAGN.sub.1CCGN.sub.1AACAAAAACACAGCACGACACCGCAGAGGCA-3′ (SEQ ID NO: 4) or pharmaceutically acceptable salts thereof, wherein N.sub.1 represents T or EdU which is modified with a side chain selected from the group consisting of an indole, phenol, guanidine and benzyl.
3. The aptamer according to according to claim 1, wherein the aptamer comprises a nucleotide sequence 5′-CACGACGCAAGGGACCACAGGGAGGGA GGGTGGGCAAAGGGCCCTAAGTCCGTAACAAAAACACAGCACGACACCGCAGAGG CA-3′ (SEQ ID NO: 6) or a nucleotide sequence SEQ ID NO: 4, wherein N.sub.1 represents EdU which is modified with an indole, or pharmaceutically acceptable salts thereof.
4. The aptamer according to claim 1, wherein the aptamer comprises a nucleotide sequence 5′-CACGACGCAAGGGACCACAGGAGAGACN.sub.1CACGGG CGGGCGACCN′.sub.1ACN′.sub.1GN′.sub.1N′.sub.1CAGCCCAGACCGACAGCACGACACCGCAGAGGCA-3′ (SEQ ID NO: 5) or pharmaceutically acceptable salts thereof, wherein N.sub.1 represents T or EdU which is modified with an aromatic group selected from the group consisting of an indole, benzofurane, naphthalene, phenol and benzothiophene and N′.sub.1 represents EdU which is modified with an aromatic group selected from the group consisting of an indole, benzofurane, naphthalene, phenol and benzothiophene.
5. The aptamer according to claim 4, wherein the aromatic group is selected from the group consisting of an indole, benzofurane and naphthalene.
6. An aptamer comprising a nucleotide sequence selected from the group consisting of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9 and pharmaceutically acceptable salts thereof, wherein the aptamer is used as a medicament or a diagnostic reagent.
7. The aptamer according to claim 6, wherein the aptamer is used in the detection or diagnosing of a rejection of a renal allograft.
8. The aptamer according to claim 6, wherein the aptamer is in a complex with an antibody against chemokines CXCL9 or CXCL11.
9. A diagnostic composition comprising the aptamer of claim 6 as the diagnostic reagent, wherein the aptamer comprises a nucleotide sequence selected from the group consisting of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9 and pharmaceutically acceptable salts thereof.
10. A diagnostic test comprising the aptamer of claim 6 as the diagnostic reagent.
11. (canceled)
12. A pharmaceutical composition comprising the aptamer of claim 6 as an active ingredient, wherein the aptamer comprises a nucleotide sequence selected from the group consisting of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9 and pharmaceutically acceptable salts thereof.
13. A method of manufacture of a medicament or a diagnostic reagent, comprising providing the aptamer of claim 6.
14. An in vitro method of detecting or diagnosing a rejection of a renal allograft, the method comprising the steps of: 1) selecting an aptamer comprising a nucleotide sequence selected from the group consisting of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9 and pharmaceutically acceptable salts thereof 2) detecting the binding of the aptamer to CXCL9 or CXCL11 in a sample obtained from a subject.
15. The method of claim 14, wherein the sample is selected from urine or serum of a renal allograft patient.
16. The diagnostic test of claim 10, wherein the test is used for the detection or diagnosing of a rejection of a renal allograft.
17. The method of manufacture of claim 13, wherein the aptamer is used in the detection or diagnosing of a rejection of a renal allograft.
18. A method of detecting or diagnosing a rejection of a renal allograft comprising providing the diagnostic composition of claim 9 and using the diagnostic composition to detect or diagnose the rejection of the renal allograft.
19. The aptamer of claim 3, wherein the aptamer consists of a nucleotide sequence of SEQ ID NO: 6 or a nucleotide sequence SEQ ID NO: 4, wherein N1 represents EdU which is modified with an indole, or pharmaceutically acceptable salts thereof.
20. The aptamer of claim 6, wherein the aptamer consists of a nucleotide sequence selected from the group consisting of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9 and pharmaceutically acceptable salts thereof, wherein the aptamer is used as a medicament or a diagnostic reagent.
Description
[0041] The figures show:
[0042]
[0043]
[0044]
[0045]
[0046]
[0047]
[0048]
[0049]
[0050]
[0051]
[0052]
[0053]
[0054]
REAGENTS AND MATERIALS
Chemicals
[0055] All chemicals, unless otherwise stated, where purchased from Sigma-Aldrich (Munich, Germany). 5-Ethynyl-dUTP (EdU) and tris(3-hydroxypropyltriazolmethyl)amine (THPTA) were purchased from BaseClick (Neuried, Germany). M280 streptavidin magnetic beads, salmon sperm DNA, EZ-Link Sulfo-NHS-LC-Biotin and λ-exonuclease were obtained from Thermo Fisher Scientific (Darmstadt, Germany). Preparations of azides (indole, phenole, guanidine) was done according to the protocol described in Suzuki et al., “Rapid discovery of highly potent and selective inhibitors of histone deacetylase 8 using click chemistry to generate candidate libraries”, J Med Chem, 2012. 55 (22): p. 9562-75. Benzyl azide was purchased from Sigma Aldrich.
Proteins and Enzymes
[0056] Proteins and enzymes were purchased from the suppliers as given in the following table 1:
TABLE-US-00001 TABLE 1 Proteins and enzymes: Protein Supplier Human CXCL9 Origene BSA AppliChem Human CXCL10 Cell guidance system Human CXCL11 Cell guidance system Human CXCL1 Cell guidance system Human sCD25 Antikorper online Native human CRP BioRad Human CCL17 BioLegend Human CCL22 BioLegend Human CCL3 Peprotech HSA Sigma-Aldrich Human CXCL9/MIG Biotinylated Antibody R&D System PWO DNA Polymerase Genaxxon 2 exonuclease Thermo Fisher Scientific
Oligonucleotides
[0057] HPLC purified oligonucleotides were purchased from Ella Biotech (Planegg, Germany). Sequences of the oligonucleotides are given in the following table 2:
TABLE-US-00002 TABLE 2 Sequences of oligonucleotides: Oligo Name Sequence FT2-0.35 CACGACGCAAGGGACCACAGG-N42- CAGCACGACACCGCAGAGGCA (SEQ ID NO: 10) N = A:G:C:EdU (1:1:1:0.35) Click N42-A (SEQ ID NO: 17) competitor N = A:G:C:EdU (1:1:1:1) FT2-Fw-Cy5 Cy5-CACGACGCAAGGGACCACAGG (SEQ ID NO: 11) FT2-Fw-Bio Bio-CACGACGCAAGGGACCACAGG (SEQ ID NO: 12) FT2-Rev-P Phos-TGCCTCTGCGGTGTCGTGCTG (SEQ ID NO: 13) G123 CACGACGCAAGGGACCACAGGGAGGGAGGGNGGG CAAAGGGCCCNAAGNCCGNAACAAAAACACAGCA AGAGGCA (SEQ ID NO: 4) CGACACCGC N = T/EdU G123.sc CACGACGCAAGGGACCACAGGAGGAGAGNAGGCGA NACACGACGNAGCGCAGANAGGACCAAGCAGCACG ACACCGCAGAGGCA (SEQ ID NO: 14) N = T/EdU I29 CACGACGCAAGGGACCACAGGAGAGACNCACGGGCG GGCGACCNACNGNNCAGCCCAGACCGACAGCACGAC ACCGCAGAGGCA (SEQ ID NO: 5) N = EdU I29.sc CACGACGCAAGGGACCACAGGGCACGNGCGAGGCGC NACANCACCGGNGCAAGCACCGNGCAACAGCACGAC ACCGCAGAGGCA (SEQ ID NO: 15) N = EdU
Methods
Biotinylation:
[0058] 500 μl CXCL9 (39 nmol) were mixed with 15.7 μl sulfo-NHS-LC-Biotin (156 nmol) and incubated for 30 min on ice followed by incubation for 25 min at RT. Afterwards biotinylated protein was purified using zeba spin desalting columns (Thermo Fisher Scientific) according to manufacturer instructions.
Bead Preparation:
[0059] 10 mg of M280-streptavidin magnetic dynabeads were washed three times with 1000 μl PBS and resuspended in 1000 μl PBS. 500 μl were used as empty beads and 50 μl of biotinylated CXCL9 (66 μM) was added to the remaining beads. After incubation at 25° C. and 1000 rpm the supernatant was discarded, and the beads were washed three times with 500 μL PBS. Supernatant of empty and CXCL9 beads was discarded and beads were resuspended with 1× SB1 (138 mM NaCl, 5 mM KCl, 1.5 mM KH.sub.2PO.sub.4, 8.1 mM Na.sub.2HPO.sub.4, 170 mM urea, 7 mM ammonium acetate, 1 mM MgCl.sub.2, 1 mM CaCl.sub.2), 1.2 mg/mL BSA, 0.1 mg/mL salmon sperm DNA, pH 6.5) and stored at 4° C.
Click Reaction:
[0060] The click reaction was done as described by Pfeiffer et al., “Identification and characterization of nucleobase-modified aptamers by click-SELEX”, Nat Protoc, 2018. 13 (5): p. 1153-1180. Shortly, freshly prepared sodium ascorbate (25 mM), CuSO.sub.4 (1 mM) and THPTA (4 mM) in 100 μL ddH.sub.2O are incubated for 10-15 min (catalyst solution). Afterwards, EdU-DNA, was clicked in a solution containing 1 mM azide in DMSO (10% final), 1× phosphate buffer and 1× catalyst solution in a total of 100 μL ddH.sub.2O. The mixture was incubated 15 min at 37° C. and 650 rpm. Afterwards the samples were purified using Nucleospin Gel and PCR clean-up kit from Macherey-Nagel (Duren, Germany) according to the manufacturer's instructions.
Polymerase Chain Reaction (PCR):
[0061] PCR was performed in a veriti 96 well thermo cycler (Applied Biosystem). All PCRs contained 0.5 μM of both forward and reverse primer, 250 μM d*NTP mix (with EdU instead of T), PWO DNA polymerase (Genaxxon) and the supplied buffer (containing 2 mM MgS04). The samples were prepared on ice and the following cycling program was used Step 1: 2 min 95° C., Step 2 (denaturing): 30 s 92° C., Step 3 (annealing): 30 s 62° C., Step 4 (extension): 1 min 72° C., Step 5: 2 min 72° C., hold 10° C.; Step 2-4 were repeated).
Split and Combine Click-SELEX:
[0062] For the first selection round, 125 pmol FT2-0.35 library were independently click modified with In-, Bn-, Phe and Gua-dU. Modified DNA was pooled together and incubated with 50 μl CXCL9-magnetic beads in 1× SB1 for 30 min at 25° C. and 1000 rpm. After washing with 1×SB1 the beads were incubated for 5 min at 95° C., supernatant was used as template for PCR in a total volume of 800 μL. Purified dsDNA was incubated with 3.5 μl λ-exonuclease (10 U/μl, ThermoFisher) in 1× λ-exonuclease buffer for 20 min at 37° C. and 650 rpm. Samples were purified using Nucleospin Gel and PCR clean-up kit from Macherey-Nagel according to the manufacturer's instructions. Finally, purified ssDNA was aliquoted to four samples which are, together with 125 pmol click competitor, individually click modified.
[0063] To increase the selection pressure several steps were modified: (1) addition of click competitor starting at cycle 2 (125 pmol for each azide), (2) increase in washing time and volume, (3) addition and increase of dextran sulfate from cycle 7, (4) decrease in incubation time, (5) reducing the number of magnetic beads (cycle 3-6), (6) reduction of biotinylated CXCL9 for immobilisation (⅕.sup.th to 1/1000.sup.th original CXCL9 concentration used for bead preparation).
Flow Cytometry
[0064] The binding interaction of Cy5 labelled DNA to protein immobilized or captured on magnetic beads was investigated with a FACSCanto II (BD Bioscience). In total a minimum of 30′000 events was recorded and the Cy5-fluorescence in the APC-A channel was analysed.
Binding Interaction of Selection Cycles and Single Sequences
[0065] 500 nM of Cy5 labelled DNA and 1.5 μL CXCL9 beads in 10 μL SB1 were incubated for 30 min, 25° C. and 1000 rpm. Afterwards, the beads were washed shortly in 100 μL 1× SB1 and resuspended in 100 μL 1× SB1 for flow cytometer analysis.
Competition Assay
[0066] 100 nM Cy5 labelled DNA and 1 μM unlabelled DNA were incubated with 1 μL CXCL9 magnetic beads in 10 μL 1× SB1. After incubation (30 min, 25° C., 1000 rpm) the beads were washed 1× short and 1×3 min with 100 μL SB1 and resuspended in 100 μl 1×SB1 for flow cytometer analysis.
Pull Down Native CXCL9
[0067] 50 μg M280 streptavidin magnetic beads were washed 3 times with 40 μL PBS. 0.24 μg of biotinylated human CXCL9 antibody (R&D System) was incubated with 50 μg beads in 20 μL PBS for 40 min, 25° C. and 1000 rpm. The beads were washed three times with 40 μL PBS, resuspended in 10 μL PBS+1% BSA and used directly. Recombinant CXCL9 was diluted in control supernatant w/o CXCL9 to 11 ng/ml. 100 μl cell supernatant containing endogenous CXCL9 (11 ng/ml), control supernatant with and without CXCL9 were incubated with 1 μL of antibody beads for 30 min, 25° C. and 1000 rpm. After, beads were washed 1× short and 1×3 min with 100 μl PBS+1% BSA. 40 μL 150 nM Cy5-DNA in 1× SB1 were incubated with beads for 30 min, 25° C., 1000 rpm. Without washing, the bead complex is analysed by flow cytometry. Binding of 150 nM Cy-5 DNA to antibody beads was used as background and was thus subtracted from samples.
Binding in Different Buffer Conditions
[0068] CXCL9 beads were 100 nM Cy5 labelled DNA and 1.5 μl CXCL9 beads were incubated in 40 μL either 1× SB1 (without ammonium acetate and urea) or in 1× SB1 w/o K.sup.+ (10 mM H.sub.3PO.sub.4+NaOH, 1.2 mg/ml BSA, 0.1 mg/ml salmon sperm DNA) for 30 min at 25° C. and 1000 rpm. Beads are directly analysed without washing steps. pH of SB1 was adjusted accordingly for binding at different pH values.
Next-Generation Sequencing (NGS):
[0069] NGS samples were prepared as described in Tolle et al. “Preparation of SELEX Samples for Next-Generation Sequencing”, Methods Mol Biol, 2016. 1380: p. 77-84 and were measured on a Illumina HiSeq1500 platform. Shortly, PCR with index primers was done using canonical nucleotides, and thus replacing the site of modification with a T. PCR product was purified using Nucleospin Gel and PCR clean-up kit from Macherey-Nagel (Duren, Germany) according to the manufacturer's instructions. 83 ng of each purified DNA waa pooled, and adapter sequence was added by enzymatic ligation using TruSeq DNA PCR-Free Sample Preparation Kit LT (Illumina). After DNA agarose purification and Nucleospin Gel and PCR clean-up kit from Macherey-Nagel (Duren, Germany) clean up, the DNA was eluted in resuspension buffer (TruSeq DNA PCR-Free Sample Preparation Kit LT (Illumina)).
[0070] Prior sequencing the DNA was validated and quantified using KAPA library quantification kit (Sigma-Aldrich). Illumina sequencing was performed with 75 bp single end sequencing. Analysis of raw data was done using AptaNext software (Laura Lledo Byrant).
(Enzyme Linked Oligonucleotide Assay) ELONA
[0071] 20 μl of 1 μg/ml protein in bicarbonate/carbonate buffer pH 9.6 was coated overnight at 4° C. on 96 well half area plates (Greiner Bio). After washing three times with 100 μL WB1 (PBS+0.05% Tween 20), wells were blocked with 1% BSA in PBS for 2 h at RT with slight agitation. Empty wells were also blocked for later subtraction of background binding. Wells were washed once with 100 μL WB2 (138 mM NaCl, 5 mM KCl, 1.5 mM KH.sub.2PO.sub.4, 8.1 mM Na.sub.2HPO.sub.4, 170 mM urea, 7 mM ammonium acetate, 1 mM MgCl.sub.2, 1 mM CaCl.sub.2), pH 6.5).
[0072] DNA was diluted to respective concentration in SB1 and 20 μL is transferred onto the wells in duplicates (protein and BSA wells). After incubation of 30 min at RT and slight agitation, the wells were washed two times with 100 μL WB1 and are incubated with 20 μL of streptavidin-horseradish peroxidase (SA-HRP) solution (1:1000 in PBS, GE Healtcare). After 30 min incubation at RT the wells were washed again twice with 100 μL WB1. Finally, the complex was incubated with 1-Step ABTS (ThermoFisher) for 15-40 min at RT, slight agitation. Absorbance at 405 nm was read out with a Tecan Nanoquant plate reader. Binding of DNA to BSA background was subtracted from binding of DNA to protein sample.
[0073] The equilibrium dissociation constant was calculated with non-linear regression assuming one site specific binding model with GraphPad Prism 6.01 (Graph Pad Software, La Jolla, USA)
Example 1
Selection of Aptamers Using Multimodal Split and Combine Click-SELEX
[0074] For use in the multimodal click-SELEX method, the non-natural nucleotide EdU, which was incorporated into the DNA library, was modified with copper (I) alkine-azide cycloaddition using the CuAAC or “click” reaction as described above with different functionalisations, 3-ethyl-1H-indole (In), 1-methyl-benzene (Bn), 4-ethyl-phenol (Phe) and N-ethyl-guanidine (Gua). The starting library was modified via CuAAC with the four azides individually, pooled subsequently and used for the next SELEX cycle including selection with washing steps, elution of the DNA/protein complex and subsequent PCR. Here the modified DNA can be used as a template for the polymerase. Thus, the modification is removed and alkyne bearing DNA is amplified. This ds DNA is digested to ssDNA by λ-exonuclease (SSD) and the ssDNA is used for the click-modification. For the assignment of the sequences (single azide selection steps) to the respective modification needed for binding, the ssDNA is split into five samples, one remained unmodified, whereas the other four are click modified. This DNA is than individually used for the next two selection cycles.
[0075] The Split and combine click-SELEX reactions were performed as described above. Cycles 1-11 were done as multimodal selection and cycle 12 and 13 as single azide selections. Starting from the first cycle 1 to 11, 125 pmol of the respective click competitor was used (500 pmol in total) in cycles 12 and 13 500 pmol of the respective click competitor was added. Starting from cycle 2, DNA was incubated first with 50 μL empty beads as counter selection step. The selection details of the selection cycles are summarised in Table 3 below.
TABLE-US-00003 TABLE 3 Overview of CXCL9 multimodal selection salmon sperm dextran CXCL9 wash DNA BSA DNA sulfate beads incubation volume PCR cycle [pmol] [mg/mL] [mg/mL] [mg/ml] [pmol] [min] wash time [μL] cycles 1 4 × 125 0.2 0.1 328 30 1x short 100 8 2x 3 min 2 31 0.2 0.1 328 30 1x short 100 10 2x 3 min 3 18 0.6 0.1 164 25 1x short 150 12 2x 5 min 4 18 0.6 0.25 164 20 1x short 200 11 3x 5 min 5 10 0.6 0.25 82 15 1x short 250 12 3x 7.5 min 6 15 1.2 0.1 41 10 1x short 300 15 3x 10 min 7 14 1.2 0.1 0.01 6.6 5 1x short 300 12 5x 10 min 8 9 1.2 0.1 0.1 1.3 5 1x short 500 15 15x 5 min 9 1.2 0.1 1 0.33 5 1x short 400 14 15x 5 min 10 11 1.2 0.1 1 0.007 5 1x short 500 14 15x 5 min 11 13 1.2 0.1 1 0.007 5 1x short 600 14 15x 5 min 12 10 1.2 0.1 1 0.007 5 1x short 600 18 E 15x 5 min 12 4 1.2 0.1 1 0.007 5 1x short 600 12 In 15x 5 min 12 5 1.2 0.1 1 0.007 5 1x short 600 14 Bn 15x 5 min 12 5 1.2 0.1 1 0.007 5 1x short 600 12 Phe 15x 5 min 12 4 1.2 0.1 1 0.007 5 1x short 600 18 Gua 15x 5 min 13 12 1.2 0.1 1 0.007 5 1x short 600 16 E 15x 5 min 13 10 1.2 0.1 1 0.007 5 1x short 600 11 In 15x 5 min 13 7 1.2 0.1 1 0.007 5 1x short 600 12 Bn 15x 5 min 13 12 1.2 0.1 1 0.007 5 1x short 600 11 Phe 15x 5 min 13 8 1.2 0.1 1 0.007 5 1x short 600 18 Gua 15x 5 min
[0076] Interaction analysis was performed using flow cytometry as described above of the starting library binding to CXCL9 immobilised on beads and after 11 or 13 selection cycles. For this, 500 nM Cy-5 labelled DNA from the starting library (SL) as well as from selection cycle 11 and selection cycle 13 were incubated with CXCL9 immobilised on magnetic beads. DNA was either unmodified (E) or click modified with indole (In), benzyl (Bn), phenol (Phe) or guanidine (Gua) azide.
[0077] The
[0078] After 13 selection cycles, each of the obtained DNA libraries from selection cycles 0, 4, 7, 9, 11 and 13 was analysed by next-generation sequencing (NGS) as described above.
Example 2
Determination of Binding of the Aptamers of SEQ ID NO: 4 and 6 to CXCL9 Using Flow Cytometry
[0079] The interaction analysis with CXCL9 was performed using flow cytometry as described above. 500 nM Cy-5 labelled DNA from the starting library (SL) as well as from selection cycle 11 (c11) and the aptamer of SEQ ID NO: 4 and SEQ ID NO: 6 (G123) were incubated with CXCL9 immobilised on magnetic beads. The DNA used was either conventional DNA (DNA, SEQ ID NO: 6), unmodified E-dU (E) or click modified with indole (In), benzyl (Bn), phenol (Phe) or guanidine (Gua) azide.
Example 3
Determination of Affinity of the Aptamers of SEQ ID NO: 4 and 5 to CXCL9 Using ELONA
[0080] Affinity determination and the influence of modifications on the binding of the aptamer 129 to CXCL9 was further analysed using enzyme linked oligonucleotide assay (ELONA). Biotin labelled DNA was detected by colorimetric change using streptavidin-horseradish peroxidase (SA-HRP) as described above using 100 nM aptamer.
[0081] The influence of 10 different modifications on affinity of aptamer SEQ ID NO: 5 (I29) was determined: indole (In), benzyl (Bn), phenol (Phe), guanidine (Gua), imidazole (Imi), methylpropane (MePro), benzothiophene (Thio), benzofurane (BnFu), naphthalene (Naph) and ethylamine (Am) or azide without modification (E).
[0082] In parallel, the influence of indole (In) modification and azide without modification (E) on the affinity of aptamer SEQ ID NO: 4 (G123) was determined using ELONA and compared to the affinity of unmodified DNA (DNA). The following table 4 summarises the binding of G123 and I29 and the affinity constants determined with ELONA (n=2, mean±SD). In the table, “+” represents successful binding, while “−” means no detection of binding, “n.d.” denotes not determined.
TABLE-US-00004 TABLE 4 Binding and affinity constants of aptamer SEQ ID NO: 4 (G123) and aptamer SEQ ID NO: 5 (129) with different modifications Sequence Modification Binding KD [nM] G123 DNA + 92 ± 14 E + n.d. In + 39 ± 5 Bn + n.d. Phe + n.d. Gua + n.d. I29 E − In + 12 ± 2 Phe + 177 ± 28 BnFu + 17 ± 4 Naph + 21 ± 4 Thio + n.d. Gua − Imi − MePro − Am −
[0083] These results show that two highly affine aptamers were selected, where the aptamer of SEQ ID NO: 5 (I29) binds if modified with aromatic groups such as indole, while the aptamer of SEQ ID NO: 4 (G123) binds as DNA (SEQ ID NO: 6) but also with different modifications.
Example 4
Determination of Specificity of Binding of Aptamers of SEQ ID NO: 4 and 5 to CXCL9 and CXCL11
[0084] Binding of aptamers of SEQ ID NO: 4 (G123) and SEQ ID NO: 5 (I29) to different proteins was determined using ELONA. Biotin labelled DNA (conc=2×KD) of unmodified aptamer G123 (DNA, SEQ ID NO: 6), indole-modified aptamer G123 (G123 In) and indole-modified aptamer 129 (I29 In) was detected by colorimetric change using streptavidin-horseradish peroxidase as described above. The pro-inflammatory chemokines CXCL9, CXCL10, CXCL11, and CXCL1 were used, as well as soluble interleukin-2 receptor (sCD25), C-reactive protein (CRP), C—C motif chemokine ligand 17 (CCL17), C—C motif chemokine ligand 22 (CCL22), C—C motif chemokine ligand 3(CCL3) and human serum albumin (HAS).
[0085] The following table 5 summarises the binding of unmodified aptamer G123 (DNA, SEQ ID NO: 6), indole-modified aptamer G123 (G123 In) and indole-modified aptamer 129 (I29 In). In the table, “+” represents successful binding, while “−” means no detection of binding.
TABLE-US-00005 TABLE 5 Binding of G123 and I29 to different proteins. G123 DNA G123 In 129 In Protein binding binding binding CXCL9 + + + CXCL10 − − − CXCL11 + + + CXCL1 − − − sCD25 − − − CRP − − − CCL17 − − − CCL22 − − − CCL3 − − − HSA − − −
[0086] As can be seen from table 5, next to pro-inflammatory chemokine CXCL9 also CXCL11 is recognized by the aptamer G123, either unmodified or indole-modified, and indole-modified aptamer 129. The binding results shows that both aptamer of SEQ ID NO: 5 (I29) and SEQ ID NO: 4 (G123) are highly selective aptamers, showing affinity to CXCL9, but no binding to CXCL10, although all three chemokines bind to the same receptor (CXCR3).
[0087] The following table 6 summarises the affinity constants of the binding of unmodified aptamer G123 (DNA, SEQ ID NO: 6), indole-modified aptamer G123 (G123 In) and indole-modified aptamer 129 (I29 In) to pro-inflammatory chemokines CXCL9 and CXCL11 determined with ELONA (n=2, mean±SD).
TABLE-US-00006 TABLE 6 Affinity constants of G123 to CXCL11 and CXCL9 Sequence KD CXCL11 [nM] KD CXCL9 [nM] G123 DNA 249 ± 44 92 ± 14 G123 In 73 ± 15 39 ± 5 I29 In 17 ± 2 12 ± 2
[0088] The affinity constants show that two highly affine aptamers for pro-inflammatory chemokines CXCL9 and CXCL11 could be identified.
Example 5
Analysis of Binding Motif
5.1 Analysis of Importance of Thymidines for Binding to CXCL9
[0089] The influence of substitutions of the nucleosides at positions 28, 44, 47, 49 and 50 of the aptamer of SEQ ID NO: 5 was analysed in view of their importance for binding of the aptamers to CXCL9. For this, in the aptamer sequence of SEQ ID NO: 5 (I29) the Ed-U modifications were substituted with conventional Ts and binding to CXCL9 was determined using enzyme linked oligonucleotide assay (ELONA) where Biotin labelled DNA (100 nM) of 129 variants was detected by colorimetric change using streptavidin-horseradish peroxidase (SA-HRP) at 405 nm.
[0090]
5.2 G-Quadruplex Characterisation
[0091] For further characterisation, a G-quadruplex characterisation of the sequence of the aptamer of SEQ ID NO: 4 (G123) was performed using flow cytometer binding assay. 100 nM Cy-5 labelled G123 was incubated with CXCL9 magnetic beads. DNA was either conventional DNA (DNA, SEQ ID NO: 6) or click modified with indole (In), benzyl (Bn), phenol (Phe) or guanidine (Gua) azide. Incubation was done in different buffer conditions, i.e. with kalium kation (K.sup.+) in the binding buffer, without kalium kation (w/o K.sup.+), or K.sup.+ and NH.sub.4OAc (w/o K.sup.+& NH.sub.4OAc).
[0092]
Example 6
Determination of Binding to CXCL9 Epitope Using Competition Assays
[0093] The binding of indole-modified aptamer of SEQ ID NO: 5 (I29 In), unmodified aptamer of SEQ ID NO: 6 (G123 DNA), and indole-modified aptamer of SEQ ID NO: 4 (G123 In) to pro-inflammatory chemokine CXCL9 was determined in competition assay. 100 nM Cy-5 labelled DNA was incubated simultaneous with 1 μM unlabelled DNA and thus competed for binding. After incubation the remaining Cy5 labelled DNA on CXCL9-magnetic beads was analysed with flow cytometry as described above. As control, Cy5-labeled DNA without competitor was analysed and was used to normalize data.
[0094]
[0095] This shows that the aptamers probably bind to the same epitope on CXCL9. In a diagnostic test for detecting the chemokine CXCL9, the aptamers may be used in a sandwich-complex with antibodies to CXCL9, which bind to different epitopes. Sandwich-complexes containing both aptamers G123 and I29 seem less useful as both aptamers compete for the binding epitope.
Example 7
Determination of Binding Conditions to CXCL9 in Buffer and Urine
7.1 Binding of Aptamers to CXCL9 in Buffers of Different pH Values
[0096] Binding of aptamers to CXCL9 in buffer of different pH values was characterised using flow cytometer binding assay. 100 nM Cy-5 labelled aptamers were incubated with CXCL9 magnetic beads in buffers of pH values of 5.2, 6.5, 7.3, 8.3 and 9.0. The aptamer sequences tested were either conventional aptamer of SEQ ID NO: 6 (G123 DNA), or the aptamer of SEQ ID NO: 4 click-modified with indole azide (G123), or the aptamer of SEQ ID NO: 5 click-modified with indole azide (I29).
[0097]
9 7.2 Binding of Aptamers to CXCL9 in Human Urine
[0098] The binding of the conventional aptamer of SEQ ID NO: 6 (G123 DNA), the aptamer of SEQ ID NO: 4 click-modified with indole azide (G123 In-dU), and the aptamer of SEQ ID NO: 5 click-modified with indole azide (I29 In-dU) to CXCL9 was further analysed in SELEX buffer of pH 6.5 and in untreated human urine from a healthy donor using ELONA binding assay of biotin labelled aptamers.
[0099] This shows that the aptamers are usable in human urine for diagnostic tests to detect the chemokines CXCL9 and CXCL11 in urine of kidney allograft patients.
Example 8
Determination of the Binding of Aptamers to Endogenous CXCL9
[0100] The binding of the aptamers was further analysed in cell supernatant from human peripheral blood mononuclear cells. Cell supernatant was generated from isolated PBMC's (peripheral blood mononuclear cells) from blood donors that were differentiated for 7 days to macrophages. Macrophages were stimulated with Interferon-gamma (10 ng/ml) and LPS (lipopolysaccharide, 1 μg/ml) for 24-48 h in RPMI 1640 Medium+5% humane AB Serum+1% Penicillin/Streptomycin+25 ng/ml m-CSF. Cell supernatant was collected and directly stored at −80° C.
[0101] The assay was performed as sandwich assay. CXCL9 specific antibody was immobilized on magnetic beads. This antibody-protein-beads complex were incubated with recombinant CXCL9 in control cell supernatant (rec) and native CXCL9 (native) or control supernatant without CXCL9 (ctrl) in cell supernatant and analysed with flow cytometry. The CXCL9 concentration used in this assay was 0.9 nM (11 ng/ml) which is lower than the CXCL9 concentration in urine of patients with renal rejection that was reported to be 14 nM (178 ng/ml). After washing, 150 nM Cy-5 labeled DNA was used to detect the resulting complex as depicted in
[0102] The binding of 150 nM of the respective Cy-5 labeled aptamers of SEQ ID NO: 5 click-modified with indole azide (I29 In-dU), the unmodified, conventional aptamer of SEQ ID NO: 6 (G132 DNA) and the aptamer of SEQ ID NO: 4 click-modified with indole azide (G123 In-dU) was tested.
[0103]
Example 9
[0104] Design and Testing of an Antibody-Aptamer-Hybrid Lateral Flow Assay for the Detection of CXCL9 in Antibody-Mediated Rejection (AMR) after Kidney Transplantation
[0105] Based on the binding of the aptamers to endogenous CXCL9 an aptamer-antibody-hybrid lateral flow assay (hybrid-LFA) for detection of CXCL9 in urine was developed. The CXCL9-specific hybrid-LFA was developed based upon a specific rat antibody immobilized on a nitrocellulose-membrane and the coupling of the CXCL9-binding aptamer G123 to gold nanoparticles.
[0106] The
9.1 Materials and Further Components of the Lateral Flow Assay
[0107] Nitrocellulose membrane Unisart® CN95 was kindly provided by Sartorius Stedim Biotech (Goettingen, Germany). Gold nanoparticles (AuNP) were kindly provided by Fassisi GmbH (Goettingen, Germany). Commercial CXCL9 (Cat #TP720369) was acquired from OriGene (MD, USA). Trehalose was purchased from Fluka BioChemika (Steinheim, Germany). Sucrose and bovine serum albumin (BSA) were obtained from Sigma-Aldrich GmbH (Munich, Germany). Tween20 was purchased from PanReac AppliChem (Darmstadt, Germany). Phosphate buffered saline (PBS, pH 7.4) was prepared. Blocking buffer was based upon PBS supplemented with 10% fetal calf serum (FCS) (Sigma-Aldrich Chemie GmbH, Taufkirchen, Germany). Binding buffer (BB, pH 6.5) was PBS-based with its content adjusted to urine milieu, supplemented with 0.25% BSA (Sigma-Aldrich GmbH), 0.1 mg.Math.ml.sup.−1 salmon sperm DNA (Thermo Fisher, MA, USA).
9.2 Antibody
[0108] An antibody exhibiting a high affinity for CXCL9 was generated by Helmholtz Zentrum Muenchen (HZI, Germany) based upon standardized immunization of rats with commercial CXCL9 (OriGene, MD, America) and using the mouse myeloma cell line P3X63-Ag8.653. 9.3 Preparation of gold nanoparticle-aptamer conjugates (AuNP-G123) The unmodified aptamer of SEQ ID NO: 6 (G123) was modified with a disulfide linker at the 5′-terminus and extended with a hexaethylene glycol spacer (C6-SS-HEG-5′-G123-3). The preparation of the gold nanoparticle-aptamer conjugates (AuNP-G123) was performed according to an adjusted protocol as described of Phung et al. (Phung et al. “Development of an Aptamer-Based Lateral Flow Assay for the Detection of C-Reactive Protein Using Microarray Technology as a Prescreening Platform” ACS combinatorial science 2020; 22: 617-629).
[0109] After conjugation of aptamers the AuNP surface exhibited an increased diameter of nanoparticles without signs of agglomeration. The altered size of nanoparticles was verified using dynamic light scattering (DLS, Particle Analyzer Litesizer™ 500, Anton Paar, Graz, Austria) and UV-Vis (Epoch Mikroplatten-Spektralphotometer, BioTek Instruments, Winooski, USA). The AuNP-G123 was compared to unmodified AuNPs exhibiting enlargement of particles due to the density distribution of particle diameter and the right shift of the wavelength. Functionality of AuNP-G123 was verified via lateral flow assay and non-specific binding partners were applied for a comparison (human serum albumin (HSA), sCD25, CRP were used as negative controls).
9.4 Preparation of Test Strips for the Lateral Flow Assay
[0110] The hybrid-lateral flow assay was composed of a sample pad (Åhlstrom-Munksjö, Helsinki, Finland) and an absorbent pad (Åhlstrom-Munksjö, Helsinki, Finland, grade 222) glued to a backing card (GE-Whatman, 7.5 cm) with 2 mm overlap to the centered nitrocellulose membrane. Sample pads were incubated for 2 h with 100 mM Tris (pH 8.0) supplemented with 1% BSA, 1% sucrose and 0.05% Tween 20 and dried at ambient temperature overnight before they were applied on the backing cards. Solutions for test (A, 1 mg.Math.ml.sup.−1) and control zone were generally automatically applied onto the nitrocellulose membrane (Fassisi GmbH, Goettingen, Germany, 1 μL.Math.cm.sup.−1), in some cases by hand (0.2 μL). Beforehand, streptavidin (20 μM in PBS, Roth, Germany) and the same volume of biotinylated oligonucleotide solution (20 μM in PBS) was mixed and incubated for 2 h at 500 rpm to prepare the solution for the control zone. Test und control zones were dried for 2 h at 50° C., cut into strips of 4 mm and placed in an airtight bag under exclusion of light.
9.5 Sample Preparation and Test Runs
[0111] 100 μL of each sample (technical sample, spiked sample or patient sample) were placed at ambient temperature in a well of a 96-well plate. 1 μL AuNP-G123 was applied onto the conjugate pad. Concentrations of purified CXCL9 were diluted in binding buffer (technical sample) or in binding buffer combined with pooled patient negative urine samples (spiked samples) derived of four kidney transplant recipients with non-rejection proven by biopsy. All patient samples were diluted in binding buffer (ratio 1:1). Lateral flow assay strips were placed in a sample well and scanned (Epson V370) after 15, 30 and 45 minutes before quantitative analysis by eye as well as by ImageJ-estimation of scans (ImageJ 1.46r, NIH, USA).
9.6 LFA Evaluation with Technical and Spiked Samples
[0112] To exclude non-specific LFA performance, a scrambled oligonucleotide exhibiting the same composition of bases as G123 but arranged in a different primary structure as well as unmodified AuNPs were used.
[0113] For determination of the limit of detection (LOD) of the LFA according to red color signals in the test zone, the system was exposed to technical samples using a serial dilution of purified CXCL9 in binding buffer (0-300 pg.Math.ml.sup.−1) and different running times (15 to 45 minutes). An LOD of 10 pg.Math.ml.sup.−1 was determined with a running time of 45 minutes. Spiked samples were prepared by using a 1:1 ratio of pooled urine samples of patients with unsuspicious finding proven by biopsy and binding buffer since pretests showed best results. As compared to the test performance with technical samples, here an LOD of 60 pg.Math.ml.sup.−1 CXCL9 was determined.
9.7 Detection of CXCL9 in Patients with Antibody-Mediated Rejection (AMR)
[0114] Detection of CXCL9 was performed in 48 human urine samples from kidney transplant recipients, transplanted between 1986 and 2017, with antibody-mediated rejection (AMR) (23 patients) and non-rejection (25).
[0115] As illustrated in
[0116] Hybrid-lateral flow assay performance was assessed according to receiver operating characteristic (ROC) analysis. ROC analyses were performed to display the area under the curve (AUC) as well as the sensitivity and specificity of the LFA as compared to the estimated glomerular filtration rate at the day of biopsy. As illustrated in
[0117] In summary, the hybrid-lateral flow assay provided a sensitivity and specificity of 71% and an AUC of 0.79 for CXCL9. This provides an improvement in early diagnosis-making in AMR after kidney transplantation, especially in kidney transplant recipients with undetermined status of donor-specific HLA-antibodies.