BIFUNCTIONAL LENTIVIRAL VECTORS ALLOWING THE BS-GLOBIN SILENCING AND EXPRESSION OF AN ANTI-SICKLING HBB AND USES THEREOF FOR GENE THERAPY OF SICKLE CELL DISEASE

Abstract

Gene therapy of SCO is based on the transplantation of genetically modified HSCs. Several LV approaches based on gene addition consist in transducing patient HSCs with a lentiviral vector expressing an anti-sickling β-like globin chain such as use of β.sup.AS3 HBB anti-sickling variants. Here, the inventors have improved the design of the LV-AS3 vector to treat SCO patients. These LVs allow the simultaneous expression of the potent anti-sickling β.sup.AS3-globin and an artificial miR (amiR) silencing the β.sup.S-globin. The reduction of β.sup.S-globin levels will increase the incorporation of β.sup.AS3-globin in Hb tetramers, which should increase the proportion of corrected RBCs in SCO patients. The inventors selected the best-performing miRs, and modified the therapeutic β.sup.AS3-globin transgene by inserting silent mutations to avoid the recognition by the amiR and the silencing of the transgene.

Claims

1. A nucleic acid molecule having the sequence as set forth in SEQ ID NO:1 wherein a sequence encoding for an artificial microRNA (amiR) suitable for reducing the expression of the β.sup.S-globin is inserted between the nucleotide at position 85 and the nucleotide at position 86 in SEQ ID NO:1 and/or ii) between the nucleotide at position 146 and the nucleotide at position 147 in SEQ ID NO:1.

2. The nucleic acid molecule of claim 1 wherein the amiR comprises or consists of a shRNA that is embedded into a miRNA backbone and wherein the shRNA adopts a stem-loop structure wherein the stem region is a region formed by a guide strand and a passenger strand.

3. The nucleic acid molecule of claim 2 wherein the miRNA backbone is derived from miR-223.

4. The nucleic acid molecule of claim 2 wherein the sequence encoding for the guide strand comprises or consists of a nucleic acid sequence selected from SEQ ID NO:3 to SEQ ID NO:22.

5. The nucleic acid molecule of claim 4 wherein the sequence encoding for the guide strand comprises or consists of a nucleic acid sequence that is complementary to the nucleic acid sequence as set forth in SEQ ID NO:23 or SEQ ID NO:24.

6. The nucleic acid molecule of claim 4 wherein the sequence encoding for the guide strand comprises or consists of the nucleic acid sequence of SEQ ID NO:15 or SEQ ID NO:18.

7. The nucleic acid molecule of claim 2 wherein the loop segment is encoded by the sequence as set forth in SEQ ID NO:25.

8. The nucleic acid molecule of claim 2 wherein the sequence encoding for the shRNA is selected from SEQ ID NO:26 to SEQ ID NO:45.

9. The nucleic acid molecule of claim 2 wherein the sequence encoding for the shRNA is SEQ ID NO:38 or SEQ ID NO:41.

10. The nucleic acid molecule of claim 2 wherein the sequence encoding for the amiR is a sequence selected from SEQ ID NO:46 to SEQ ID NO:65.

11. The nucleic acid molecule of claim 2 wherein the sequence encoding for the amiR is SEQ ID NO:58 or SEQ ID NO:61.

12. The nucleic acid molecule of claim 2 that has a sequence selected from SEQ ID NO:66 to SEQ ID NO:85.

13. The nucleic acid molecule of claim 2 that has the sequence of SEQ ID NO:78 or SEQ ID NO:81.

14. A transgene encoding for an anti-sickling human hemoglobin subunit beta (HBB), wherein said transgene comprises the nucleic acid molecule of claim 1.

15. The transgene of claim 14 that comprises a least one silent mutation so that the expression of a βAS3 polypeptide is not reduced or silenced by amiR when the transgene is expressed.

16. The transgene of claim 14 which comprises the sequence as set forth in SEQ ID NO:86 or SEQ ID NO:87.

17. A lentiviral vector comprising the transgene of claim 14.

18. A method of obtaining a population of host cells transduced with the transgene of claim 14, which comprises the step of transducing a population of host cells in vitro, ex vivo or in vivo with a lentiviral vector comprising the transgene.

19. The method of claim 18 wherein the host cells are selected from the group consisting of hematopoietic stem/progenitor cells, hematopoietic progenitor cells, hematopoietic stem cells (HSCs), pluripotent cells and induced pluripotent stem cells (iPS).

20. A method of treating sickle cell disease in a subject in need thereof, the method comprising transplanting a therapeutically effective amount of a population of host cells obtained by the method of claim 18.

Description

FIGURES

[0073] FIG. 1: Design of a new LV expressing the β.sup.AS3-globin and a miR targeting the β.sup.S-globin. (A) Structure of the LV-AS3 vector. (B) Structure of the newly generated LV-AS3/miR #HBB. In (B) the sequence of the miR #HBB is detailed. The sequence highlighted in grey corresponds to the guide strand of the amiR. (C) Schematic view of the miR #HBB target regions within the HBB mRNA. (D) Alignments of miR #7mod (in bold) and miR #10 (underlined) guide strands on HBB exon 2 (reverse complement). Δ, deleted HIV-1 U3 region; SD and SA, HIV splicing donor and acceptor sites; Ψ, HIV-1 packaging signal; RRE, HIV-1 Rev responsive element; Ex, exons of the human HBB; β-p, promoter of HBB; HS2, 3, DNase I hypersensitive site 2, and 3 of human HBB LCR; arrows indicate the mutations introduced in exon 1 (generating amino acid substitutions G16D and E22A) and exon 2 (generating amino acid substitution T87Q).

[0074] FIG. 2: Screening of 17 LV-AS3/miR #HBBs in K562 cells. K562 cells were transduced with control (Ctrl; pool of LV-AS3 and -AS3/miR #nt) or miR #HBB-containing LVs (AS3/miR #HBB, miRs from #1 to #11 and their modified [mod] version for miRs #1 and #3 to 7). β.sup.AS3 mRNA expression was measured by RT-qPCR in K562 cells and normalized to HBA (α-globin). The levels of β.sup.AS3 relative expression per VCN are shown in this histogram (mean +/−SD). The control corresponds to the mean of the results obtained with AS3 and AS3/miR #nt lentiviral vectors and was set to 100%.

[0075] FIG. 3: miR-mediated β- and β.sup.AS3-globin down-regulation. (A) β.sup.AS3-globin mRNA expression normalized to HBA (α-globin) per VCN. (B) β-globin mRNA expression normalized to HBA. (C-D) Western Blot analysis of (β+β.sup.AS3) globins chains (C) and quantification relative to α-globin (D) Analyses were performed in mature erythroblasts derived from HUDEP-2 cells transduced with either LV-AS3/miR #HBB or LV-AS3/miR #nt control vector at a high MOI of 10 or a low MOI of 2. Results are represented as % of the control and shown as mean +/−SD. VCN is indicated below each graphs.

[0076] FIG. 4: miR-mediated β.sup.S-globin down-regulation in primary BFU-E from SCD patients. (A) Frequency of BFU-E and CFU-GM in mock- and LV-transduced HSPCs. Results are represented as % of colonies obtained from 500 plated HSPCs and shown as mean +/−SD. (B) β.sup.AS3-globin and β-globin (HBB) mRNA expression normalized to HBA (α-globin). (n=6 controls, Ctrl). (C) Analysis of HbS, HbAS3 and HbF by CE-HPLC. We calculated the percentage of each Hb type over the total Hb tetramers (n=2). HSPCs were transduced using a MOI of 2 or 50. VCN in BFU-E is indicated below each graph.

[0077] FIG. 5: miR #7mod-mediated β.sup.S-globin down-regulation in erythroid precursors from SCD patients. Data were obtained in erythroid precursors differentiated from SCD HSPCs (3 donors) that were either mock-transduced or transduced with either LV-AS3mod/miR #7mod (AS3modmiR #7mod) or control LVs (Ctrl, LV-AS3, LV-AS3mod, or LV-AS3mod/miR #nt) vectors. VCN is indicated below each graph. (A) β.sup.S-globin mRNA expression normalized to HBA (α-globin). ****P<0.0001, Mann-Whitney test. (B) β.sup.AS3-globin mRNA expression normalized to HBA (α-globin). ns, Mann-Whitney test.

[0078] FIG. 6: LV-AS3mod/miR #7mod decreases HbS levels and improves the SCD cell phenotype in mature RBCs from SCD patients. Data were obtained in RBCs differentiated from SCD HSPCs (2 donors) that were either mock-transduced or transduced with either LV-AS3mod/miR #7mod (AS3modmiR #7mod) or with control LVs (Ctrl, LV-AS3, LV-AS3mod, or LV-AS3mod/miR #nt) vectors. VCN is indicated below each graph. (A-B) HbS and HbAS3 expression in mature RBCs measured by CE-HPLC. **P<0.01, Mann-Whitney test. (C) Proportion of HbS-positive RBCs measured by flow cytometry analysis using an antibody recognizing specifically HbS. ***P<0.001, Mann-Whitney test. (D) Frequency of sickling RBCs after 1-hour incubation at low oxygen tension (0% O2). **P<0.01, Mann-Whitney test.

[0079] FIG. 7: Enucleation and RBC differentiation were not altered upon β.sup.S-globin silencing induced by LV-AS3mod/miR #7mod. Data were obtained in RBCs differentiated (day 6, 13 or 20 of differentiation) from SCD HSPCs (2 donors) that were either mock-transduced (Mock) or transduced with either LV-AS3mod/miR #7mod (AS3modmiR #7mod, VCN=1.9±0.6) or with control LVs (Ctrl, LV-AS3, LV-AS3mod, or LV-AS3mod/miR#nt, VCN=2.0±0.7) vectors. (A) Frequency of enucleated RBCs measured by flow cytometry at day 13 and 20 of erythroid differentiation. (B) Frequencies of (right) CD36.sup.+, (middle) CD71.sup.+, (left) and CD235a.sup.+ RBCs measured by flow cytometry along the differentiation (day 6, 13 and 20). During erythroid differentiation, cells progressively lose CD36 and CD71 expression (C) Frequencies of CD49.sup.+, Band3.sup.+ and CD49.sup.+Band3.sup.+ cells among the CD235a.sup.+ RBCs measured by flow cytometry along the differentiation (day 6, 13 and 20). During erythroid differentiation, CD235a.sup.+ cells lose progressively lose the CD49 marker and express band 3.

EXAMPLE

Material & Methods

Molecular Cloning

[0080] We digested PUC-57 plasmids containing our inserts of interest (AS3mod/miR#7mod, AS3mod/miR #10, AS3mod/miR #nt, AS3mod) and the target plasmid allowing LV production (P_GLOBE) using SwaI and ClaI restrictions enzymes (NEB) at 37° C. overnight. SwaI and ClaI were heat inactivated at 65° C. for 20 min. Digested plasmids were then loaded on a 1% agarose gel and migrated 1 h at 100 V. The fragments of interest were then extracted from the gel and purified with the gel purification Qiagen quick kit. P_GLOBE fragments were dephosphorylated with alkaline phosphatase 1 h at 37° C. and the reaction was stopped by adding EGTA at a final concentration of 18 mM. We then ligated the inserts in the P_GLOBE plasmid using T4 ligase at room temperature for 15 min. To perform the ligation step, we used a 1/6 vector/insert ratio.

[0081] XL-10 Gold Ultracompetent Cells were transformed with the new constructs according to Stratagene protocol. Transformed bacteria were then seeded on LB agar-Ampicillin plates and grown at 37° C. overnight. Individual colonies were amplified in LB-Ampicillin overnight at 30° C. under shaking to purify plasmids (PureLink HiPure Miniprep Kit, Invitrogen) and identify the correct plasmid. The selected colonies were amplified in LB-Ampicillin at 30° C. overnight under shaking to purify plasmids (PureLink HiPure Maxiprep Kit, Invitrogen) and produce LV.

Lentiviral Vector Production and Titration

[0082] Third-generation LVs were produced by calcium phosphate transient transfection of HEK293T cells with the transfer vector, the packaging plasmid pHDMH gpm2 (encoding gag/pol), the Rev-encoding plasmid pBA Rev, and the vesicular stomatitis virus glycoprotein G (VSV-G) envelope-encoding plasmid pHDM-G. The viral infectious titer, expressed as transduction units per ml (TU/ml) was measured in HCT116 cells after transduction using 6 vector volumes (5 μl, 1 μl, 0.5 μl and 0.1 μl, 0.05 μl ). Four days after transduction, genomic DNA was extracted and the vector copy number (VCN) per cell was measured by ddPCR. The LV titer was then calculated as follows: Titer (TU/ml)=volume of vector used/(number of cells at infection*VCN).

Vector Copy Number Quantification by ddPCR

[0083] Genomic DNA was extracted from HCT116 cells 4 days after transduction, K562 cells, HUDEP-2 cells and BFU-E 14 days after transduction, using the PureLink Genomic DNA Mini Kit (Invitrogen). DNA was digested using DraI restriction enzyme (NEB) at 37° C. for 30 min and then mixed with the ddPCR reaction mix composed of 2× ddPCR SuperMix for probes (no dUTP) (Bio-Rad), forward (for) and reverse (rev) primers (at a final concentration of 900 nM) and probes (at a final concentration of 250 nM). We used probes and primers specific for: (i) albumin (VIC-labeled ALB probe with a QSY quencher, 5′-CCTGTCATGCCCACACAAATCTCTCC-3′ (SEQ ID NO:88) ; FOR ALB primer, 5′-GCTGTCATCTCTTGTGGGCTGT-3′(SEQ ID NO:89); REV ALB primer, 5′-ACTCATGGGAGCTGCTGGTTC-3′SEQ ID NO:90), and for (ii) the LV (FAM-labeled LV probe with a MGB quencher, 5′-CGCACGGCAAGAGGCGAGG-3′(SEQ ID NO:91); FOR LV primer 5′-TCCCCCGCTTAATACTGACG-3′(SEQ ID NO:92); REV LV primer 5′-CAGGACTCGGCTTGCTGAAG-3′ (SEQ ID NO:93)). The albumin gene was chosen as reference locus to calculate the VCN per diploid genome, as it is present in 2 copies per genome in every human cells. Droplets were generated using a QX200 droplet generator (Bio-Rad) with droplet generation oil for probes (Bio-Rad) onto a DG8 cartridge (Bio-Rad) and transferred on a semi-skirted 96 well plate (Eppendorf AG). After sealing with a pierce-able foil heat seal using a PX1 PCR plate sealer (Bio-Rad), the plate was loaded on a SimpliAmp Thermal Cycler (ThermoFisher Scientific) for PCR amplification using the following conditions: 95° C. for 10 min, followed by 40 cycles at 94° C. for 30 sec and 60° C. for 1 min, and by a final step at 98° C. for 10 min. The plate was analyzed using the QX200 droplet reader (Bio-Rad) (channel 1: FAM, channel 2: VIC) and analyzed using the QuantaSoft analysis software (Bio-Rad), which quantifies positive and negative droplets and calculate the starting DNA concentration using a Poisson algorithm. The average VCN per cell were calculated as (LV copies*2)/(albumin copies).

K562 Cell Culture and Transduction K562 were maintained in RPMI 1640 medium (Lonza) containing glutamine and supplemented with 10% fetal bovine serum (Lonza), HEPES (LifeTechnologies), sodium pyruvate (LifeTechnologies) and penicillin and streptomycin (LifeTechnologies). K562 were transduced at a cell concentration of 5×10.sup.5 cells/ml in the culture medium supplemented with 4 ug/m1 polybrene (Sigma). After 24 h, cells were washed and cultured in fresh culture medium.

HUDEP-2 Cell Culture, Differentiation and Transduction

[0084] HUDEP-2 cells (HUDEP-2) were cultured and differentiated as previously described (Antoniani et al., 2018; Canver et al., 2015; Kurita et al., 2013). HUDEP-2 cells were expanded in a basal medium composed of StemSpan SFEM (Stem Cell Technologies) supplemented with 10.sup.−6 M dexamethasone (Sigma), 100 ng/ml human stem cell factor (hSCF) (Peprotech), 3 IU/m1 erythropoietin (EPO) Eprex (Janssen-Cilag, France), 100 U/ml L-glutamine (Life Technologies), 2 mM penicillin/streptomycin and 1 μg/ml doxycycline (Sigma). HUDEP-2 cells were transduced at a cell concentration of 10.sup.6 cells/ml in basal medium supplemented with 4 ug/ml protamine sulfate (Choay). After 24 h, cells were washed and cultured in fresh basal medium. Cells were differentiated for 9 days in Iscove's Modified Dulbecco's Medium (IMDM) (Life Technologies) supplemented with 330 μm/ml holo-transferrin (Sigma), 10 μg/ml recombinant human insulin (Sigma), 2 IU/ml heparin (Sigma), 5% human AB serum (Eurobio AbCys), 3 IU/mL erythropoietin, 100 ng/mL human SCF, 1 μg/ml doxycycline, 100 U/ml L-glutamine, and 2 mM penicillin/streptomycin.

HSPC Purification and Transduction

[0085] Human adult HSPCs were obtained from healthy donors (HD). Written informed consent was obtained from all subjects. All experiments were performed in accordance with the Declaration of Helsinki. The study was approved by the regional investigational review board (reference, DC 2014-2272, CPP Ile-de-France II “Hôpital Necker-Enfants malades”). HSPCs were purified by immunomagnetic selection (Miltenyi Biotec) after immunostaining using the CD34 MicroBead Kit (Miltenyi Biotec).

[0086] CD34.sup.+ cells were thawed and cultured for 24 h at a concentration of 10.sup.6 cells/mL in pre-activation medium composed of X-VIVO 20 supplemented with penicillin/streptomycin (Gibco) and recombinant human cytokines: 300 ng/mL SCF, 300 ng/mL Flt-3L, 100 ng/mL TPO, 20 ng/mL interleukin-3 (IL-3) (Peprotech) and 10 mM SR1 (StemCell). After pre-activation, cells (3.10.sup.6 cells/mL) were cultured in pre-activation medium supplemented with 10 μM PGE2 (Cayman Chemical) on RetroNectin coated plates (10 μg/cm2, Takara Bio) for at least 2 h. Cells (3.10.sup.6cells/mL) were then transduced for 24 h on RetroNectin coated plates in the pre-activation medium supplemented with 10 μM PGE2, protamine sulfate (4 μg/mL, Protamine Choay) and Lentiboost (1 mg/ml, SirionBiotech).

CFC Assay

[0087] The number of hematopoietic progenitors was evaluated by clonal colony-forming cell (CFC) assay. HSPCs were plated at a concentration of 5×10.sup.2 cells/mL in methylcellulose-containing medium (GFH4435, Stem Cell Technologies) under conditions supporting erythroid and granulo-monocytic differentiation. BFU-E and CFU-GM colonies were scored after 14 days. BFU-Es and CFU-GMs were randomly picked and collected as bulk populations (containing at least 25 colonies) to evaluate transduction efficiency and globin expression.

[0088] In Vitro Erythroid Differentiation

[0089] Mature RBCs from mock- and LV-transduced CD34.sup.+ HSPCs were generated using a three-step protocol (Weber et al., 2018). Briefly, from day 0 to 6, cells were grown in a basal erythroid medium (BEM) supplemented with SCF, IL3, erythropoietin (EPO) (Eprex, Janssen-Cilag) and hydrocortisone (Sigma). From day 6 to 20, they were cultured on a layer of murine stromal MS-5 cells in BEM supplemented with EPO from day 6 to day 9 and without cytokines from day 9 to day 20. From day 13 to 20, human AB serum was added to the BEM.

RT-qPCR Analysis

[0090] RNA was extracted from K562 cells, HUDEP-2 cells after 9 days of differentiation or from primary BFU-E using the RNeasy micro kit (QIAGEN). Reverse transcription of mRNA was performed using the SuperScript III First-Strand Synthesis System for RT-PCR (Invitrogen) with oligo(dT).sub.20 primers. qPCR was performed using the SYBR green detection system (BioRad). We used the following primers: βAS3 FOR, 5′-AAGGGCACCTTTGCCCAG-3′ (SEQ ID NO: 94); βAS3 REV, 5′-GCCACCACTTTCTGATAGGCAG-3′ (SEQ ID NO: 95); HBB FOR, 5′-AAGGGCACCTTTGCCACA-3′ (SEQ ID NO: 96); HBB REV, 5′-GCCACCACTTTCTGATAGGCAG-3′ (SEQ ID NO:97); HBA FOR, 5′-CGGTCAACTTCAAGCTCCTAA-3′ (SEQ ID NO:98); HBA REV, 5′-ACAGAAGCCAGGAACTTGTC-3′(SEQ ID NO: 99). The samples were analyzed with the ViiA 7 Real-Time PCR System and software (Applied Biosystems).

HPLC

[0091] Hemoglobin tetramers from BFU-E and RBCs were separated by cation exchange (CE)-HPLC using a 2 cation-exchange column (PolyCAT A, PolyLC, Columbia). Samples were eluted with a gradient mixture of solution A (20 mM bis Tris, 2 mM KCN, pH, 6.5) and solution B (20 mM bis Tris, 2 mM KCN, 250 mM NaCl, pH, 6.8). The absorbance was measured at 415 nm.

Western Blot

[0092] HUDEP-2 cells after 9 days of differentiation or primary BFU-E were lysed for 30 min at 4° C. using a lysis buffer containing: 10 mM Tris, 1 mM EDTA, 0.5 mM EGTA, 1% Triton X-100, 0.1% SDS, 0.1% Na-deoxicholate, 140 mM NaCl (Sigma-Aldrich) and protease inhibitor cocktail (Roche-Diagnostics). Cell lysates were sonicated twice (50% amplitude, 10 sec per cycle, pulse 9 sec on/1 sec off) and underwent 3 cycles of freezing/thawing (3 min at −80° C./3 min at 37° C.). After centrifugation, the supernatant was collected and protein concentration was measured using the Pierce™ BCA Protein Assay Kit (ThermoScientific). After electrophoresis and protein transfer, β- and α-globins were detected using the antibodies sc-21757 and sc-31110 (SantaCruz), respectively. The bands corresponding to β- and α-globins were quantified using the Chemidoc and the Image lab Software (BioRad).

Flow Cytometry

[0093] In primary cell cultures, the expression of erythroid markers was monitored by flow cytometry using anti-CD36, anti-CD49d, anti-CD71, anti-CD235a (BD Horizon) and anti-CD233 (band 3) (IBGRL) antibodies and 7-AAD for cell death assessment. The proportion of enucleated RBCs was measured using the nuclear dye DRAQS (eBioscience). The proportion of HbS-positive RBCs were measured with an antibody recognizing HbS. Briefly, RBCs were stained with a monoclonal mouse anti-human CD235a antibody (BD Biosciences), then fixed 0.05% glutaraldehyde for 10 min at RT, permeabilized with 0.1% Triton X-100 for 10 min at RT and stained with the HbS antibody. Flow cytometry analyses were performed using the Gallios analyzer and Kaluza software (Beckman-Coulter).

Sickling Assay

[0094] At day 19 of the terminal erythroid differentiation, RBCs were collected and incubated in hypoxic conditions to evaluate their sickling properties. Briefly, RBCs were resuspended in ID-CellStab stabilization solution for red cells (BIORAD) and gradually exposed to an oxygen-deprived atmosphere: 10% O2 for 20 min, 5% O2 for 20 min, 0% O2 until control cells were all sickled (between 20 and 80 min). Images were captured using the Axio Observer microscope and the Zen software (Zeiss) at a magnification of 40× at 20% O2 and at each time point under hypoxia (10%, 5%, 0% at 20, 40, 60 and 80 min). Images were analyzed with ImageJ to determine the percentage of sickled RBCs per field of acquisition in the total RBC population.

Results

A New LV-Based Strategy to Treat SCD

[0095] Strategies based on gene addition of therapeutic β-like globin using a LV showed good results in SCD patients who received a drug product with a VCN>1 and when the VCN in vivo was around 2. Unfortunately obtaining a VCN>1 is not always achievable even with optimized protocols and poses some concerns on the low but still possible genotoxicity due to the integration of a high number of vector copies in hematopoietic cells. In addition, Weber et al showed that despite a high transduction efficiency obtained with the LV-AS3 vector (FIG. 1A) the SCD RBC phenotype derived is only partially corrected in in vitro sickling assay. This is probably due to HbS levels that remain high in these cells. Therefore, gene addition strategies using a LV still require improvements to fully correct the SCD phenotype and to show a benefit in patients for which a VCN>1 cannot be obtained.

[0096] Here, we have improved the design of the LV-AS3 vector to treat SCD patients. We developed new LVs combining two strategies: gene addition and silencing. These LVs allow the simultaneous expression of the potent anti-sickling β.sup.AS3-globin and an artificial miR (amiR) silencing the β.sup.S-globin (FIG. 1B). The reduction of β.sup.S-globin levels will increase the incorporation of β.sup.AS3-globin in Hb tetramers, which should increase the proportion of corrected RBCs in SCD patients. We opted for a miR-based strategy instead of other RNA interference system such as short hairpin RNAs (shRNAs) to reduce the potential toxicity. shRNAs mimic the structure of the pre-miR and can be functional in human cells but they might interfere with the miR processing machinery within the cell due to their high expression levels. miR-based gene therapies are considered safer as miRs are naturally present in human cells. We selected the best-performing miRs, and modified the therapeutic β.sup.AS3-globin transgene by inserting silent mutations to avoid the recognition by the amiR and the silencing of the transgene.

[0097] As there is no miR targeting the β.sup.S-globin available in the literature, we adapted sequences from siRNAs and shRNAs targeting the β.sup.S-globin already published or newly designed using a software developed by Adams et al (Adams et al., 2017). These RNA interference sequences were adapted and inserted in the pri-miR-223 backbone to create an amiR (Amendola et al., 2009; Brendel et al., 2020; Guda et al., 2015) (FIG. 1B). We choose the miR-223 backbone because it is a hematopoietic-specific miR and has been improved to allow robust and efficient miR processing. In the final stage of miR maturation, the miR-223 backbone favors the incorporation of the guide strand (the strand that recognize the target mRNA) within the RISC complex over the passenger strand, thus increasing the silencing of the target gene. Indeed, Amendola et al., in their study, developed a LV platform able to deliver amiR derived from the miR-223. In particular, they inserted one or more amiR within an intron of a transgene and obtained a significant silencing of different target genes in several cell types including human primary cells (Amendola et al., 2009). Based on this study and on results obtained in the lab, the different amiRs targeting the β.sup.S-globin (miR #HBB) have been inserted within the intron 2 of the transgene. Therefore, the β.sup.AS3 transgene and the miR #HBB are co-expressed under the control of the β-globin LCR/promoter limiting their expression to the erythroid lineage, thus avoiding potential toxicity in other cell types (FIGS. 1B and 1C). Moreover, the miR #HBBs generated from shRNA sequences have been modified by removing 4 nucleotides at the 5′ end of the guide strand and adding a GCGC (SEQ ID NO:86) motif at the 3′ end. These modifications have been shown to further enhance the selection of the guide strand over the passenger strand in the RISC complex for thermodynamic reasons and therefore would potentially increase β.sup.S-globin silencing (Guda et al., 2015). Therefore, we designed 2 versions of the miR #HBBs adapted from shRNAs: the modified (miR #HBBmod, N15-17-GCGC (SEQ ID NO:100)) and the unmodified (miR #HBB, NNNN-N15-17) miRs (Table 1).

TABLE-US-00010 TABLE 1 miR sequences targeting the HBB gene miR sequences (5′-3′) ID Origine Guide strand miR types miR#1 Samakoglu et al., 2006 CTCCTCAGGAGTCAGATGC shRNA miR#1 mod TCAGGAGTCAGGTGCGCGC miR#2 Dykxhoorn et al., 2006 AGACTTCTCCTCAGGAGTCA SiRNA miR#3 portals.broadinstitute.org TCAGTGTGGCAAAGGTGCCCT shRNA miR#3mod TGTGGCAAAGGTGCCCTGCGC miR#4 portals.broadinstitute.org ATAACAGCATCAGGAGTGGAC shRNA miR#4mod CAGCATCAGGAGTGGACGCGC miR#5 portals.broadinstitute.org TTCATCCACGTTCACCTTGCC shRNA miR#5mod TCCACGTTCACCTTGCCGCGC miR#6 portals.broadinstitute.org CAAAGAACCTCTGGGTCCAAG shRNA miR#6mod GAACCTCTGGGTCCAAGGCGC miR#7 portals.broadinstitute.org CTTTCTTGCCATGAGCCTTCA shRNA miR#7mod CTTGCCATGAGCCTTCAGCGC miR#8 Adams et al., 2017 website TGAAGTTCTCAGGATCCACGT miR miR#9 Adams et al., 2017 website TTCTTTGCCAAAGTGATGGGC miR miR#10 Thermofisher AAAGGCACCGAGCACTTTCTT SiRNA miR#11 Dykxhoorn et al., 2006 CCAGGGCCTCACCACCAAC SiRNA miR#12 Samakoglu et al., 2006 CTCCACAGGAGTCAGATGC shRNA miR#12mod ACAGGAGTCAGGTGCGCGC miR#13 Dykxhoorn et al., 2006 AGACTTCTCCACAGGAGTCA SiRNA GCGC: motif added in miRmod to improve the knock-down CC: motif added to improve knock-down efficiency of the miR in bold: matching sequence between the original miR (miR_xx) and the modified version (miR_xxmod) in italic: the miR is modified to target the βS-mRNA only
miR#HBB Screening in K562 Cells

[0098] We have generated 17 LVs (LVs-AS3/miR #HBB) co-expressing the potent anti-sickling β.sup.AS3-globin and each of the 17 newly designed miR #HBBs (miR #1 to #11, miR #lmod and miR#3mod to #7mod). In order to determine the best performing amiR, we transduced K562 erythroleukemic cells (that do not express endogenous β-globin) with the 17 LVs-AS3/miR #HBB using a multiplicity of infection (MOI) of 15 and 3. For this amiR screening, the β.sup.AS3 transgene sequence was not modified and could be targeted by the 17 different amiRs. Indeed, there were no mismatches between the miR#HBBs and their target sequences within the β.sup.AS3 transgene. Therefore, we assessed the silencing effect of the amiRs on the β.sup.AS3 transgene. The ratio between the amiR and the β.sup.AS3 mRNA should be independent from the VCN as they derive from the same primary transcript. Similarly, the percentage decrease of the β.sup.AS3 expression upon miR-mediated silencing should be stable regardless the VCN. Therefore, in this experiment, we compared β.sup.AS3 expression normalized per VCN in cells transduced with LVs-AS3/miR #HBB to cells transduced with control LVs, which either express the β.sup.AS3-globin alone (LV-AS3) or co-express the β.sup.AS3-globin with a non-targeting (nt) amiR that does not recognize any human sequence (LV-AS3/miR #nt). K562 cells transduced with AS3/miR #7, #7mod, #9 and ∩10 LVs showed a decrease of more than 50% in β.sup.AS3 mRNA expression compared to cells transduced with control LVs (FIG. 2). However, the cells transduced with LV-AS3/miR #9 have a very low VCN (<0.5) in comparison with other LVs, which could reflect a low gene transfer efficiency that hampers its use as a therapeutic vector for SCD. In cells transduced with LVs AS3/miR #1 and #5mod, we observed a reduction in β.sup.AS3 expression of around 30% compared to control cells (FIG. 2). Based on these results we decided to select miR #1, #5mod, miR #7, #7mod and #10 to further characterize these miR #HBBs in HUDEP-2 cells.

Validation of efficient LV-AS3/miR#HBBs in HUDEP-2 cells

[0099] In K562 cells, 5 efficient LV-AS3/miR #HBBs (miR #1, #5mod, #7, #7mod and #10) were able to downregulate the expression of the β.sup.AS3 transgene. To confirm that these LVs downregulate the endogenous β-globin gene, we tested the LV-AS3/miR #HBB expressing the selected miR #HBBs in HUDEP-2, an erythroid progenitor cell line. These cells can be differentiated to mature erythroid precursors expressing the endogenous α and β-globin chains at both mRNA and protein levels. Contrary to the β.sup.AS3 transgene for which the expression and the miR-mediated silencing are VCN-independent (as discussed for the experiment in K562 cells), the endogenous β-globin and miR #HBB are not expressed at the same molar ratio. Indeed, the decrease of HBB expression should be VCN-dependent, and, more precisely, proportional to the VCN.

[0100] HUDEP-2 cells were transduced with control (AS3/miR #nt) and miR #HBB LVs at a high MOI of 10 or a low MOI of 2 and differentiated to evaluate miR efficiency in down-regulating HBB and β.sup.AS3 expression. We observed a strong reduction of the β.sup.AS3 transcripts per VCN (from ˜60% to 85%) in cells transduced with the LVs expressing miR #7, #7mod and #10, confirming the results obtained in K562 cells with these miR #HBBs (FIG. 3A). As expected, the decrease of the endogenous β-globin expression was correlated with the VCN. Indeed, for miR #7, #7mod and #10, we observed a reduction of the β-globin expression ranging from 60% to 85% and from 30% to 70% at a high and low VCN, respectively (FIG. 3B). The miR #1 and #5mod showed almost no effects on β.sup.AS3 and β-globin expression although we observed a modest β.sup.AS3-downregulation in K562 cells. Moreover, we obtained a comparable VCN in cells transduced with control- and therapeutic-LVs at the same MOIs, showing that the introduction of the miR #HBB did not impact gene transfer efficiency. Finally, we analyzed by Western Blot the total β like-globin (β+β.sup.AS3) expression and observed 35% silencing of the (β+β.sup.AS3)-globins at both VCN for miR #7mod and 25% and 10% at high and low VCN, respectively, for miR #10 (FIGS. 3C, 3D). However, we did not observe silencing of the (β+β.sup.AS3)-globins with miR #7 (FIGS. 3C, 3D). Therefore, in this experiment, the modified version of miR #7 (miR #7mod) outperformed miR #7 in terms of β-like globin silencing at both the RNA and protein levels.

Modification of the Transgene Sequence and Design of the Novel AS3mod/miR Lentiviral Vectors

[0101] Based on our results, we selected miR #7mod and miR #10 as our best performing miRs in terms of β-globin silencing. However, the very high sequence similarity between the β.sup.S-globin and the transgene require the modification of the targeted sequence in the transgene to avoid its silencing by the miR. To this aim, we introduced silent mutations in the β.sup.AS3 transgene sequence in order to maintain the same amino acid sequence. When possible, we chose codons amongst the most used ones in the HBB gene to avoid potential alterations in the translation of the β.sup.AS3 transcript. In the miR #7mod or miR #10 target regions, we have introduced several mutations to reduce by 33% the complementarity between the miRs and the β.sup.AS3 transcript.

[0102] Then, we designed 3 types of LVs containing the modified β.sup.AS3 sequences: [0103] The 2 LVs of interest co-expressing the β.sup.AS3 transgene (modified in the miR #7mod or miR #10 target sequence; AS3mod) and miR #7mod or miR #10 (LV-AS3mod/miR #7mod and LV-AS3mod/miR #10). [0104] Control LVs co-expressing the β.sup.AS3 transgene (modified in the miR #7mod or miR #10 target sequence) and a control no-targeting miR (LV-AS3mod/miR #nt). [0105] Control LVs expressing only the β.sup.AS3 transgene (modified in the miR #7mod or miR #10 target sequence) (LV-AS3mod).
Notably, vector titers were comparable for the control and miR-expressing LVs: neither the transgene modification nor the miR insertion impacted the viral titer.
Validation of LV-AS3/miR #HBB in Primary Hematopoietic Stem/Progenitor Cells from SCD Patients

[0106] We transduced primary adult hematopoietic stem/progenitor cells (HSPCs) derived from SCD donors with LV-AS3mod/miR #7mod harboring an amiR against HBB. As control LVs, we used LV-AS3mod/miR #nt, LV-AS3mod and the LV-AS3 vector harboring the unmodified AS3 transgene (LV-AS3; (Weber et al., 2018)). Mock- and transduced HSPCs were plated in clonogenic cultures (colony forming cell [CFC] assay) allowing the growth of erythroid (BFU-E) and granulomonocytic (CFU-GM) progenitors. The number and the proportion of BFU-E and CFU-GM was similar amongst the different samples (FIG. 4A), indicating no impairment in erythroid and granulomonocytic cell growth and differentiation. VCN in BFU-E ranged around 2 in all the samples (FIG. 4A).

[0107] To evaluate the potential therapeutic effect of this strategy, we measured HBB and β.sup.AS3-globin mRNA expression in mock- and LV-transduced erythroid cells (BFU-E) derived from SCD HSPCs. Interestingly, we observed a robust knock-down of HBB expression in samples transduced with LV-AS3mod/miR #7mod, while β.sup.AS3-globin mRNA expression was not affected (FIG. 4B). These results were confirmed at protein level by HPLC analysis showing a reduced HbS expression and increased incorporation of the β.sup.AS3 therapeutic chain into the hemoglobin tetramers (FIG. 4C). Notably, the modification of the AS3 transgene did not affect its expression (LV-AS3mod vs LV-AS3 samples; FIG. 4C).

[0108] To evaluate the reversion of the SCD cell phenotype, HSPCs from three SCD patients were either mock-transduced or transduced with LV-AS3mod/miR #7mod or LV-control (ctrl, LV-AS3, LV-AS3mod, or LV-AS3mod/miR #nt) vectors and terminally differentiated into mature enucleated RBCs. Efficient HSPC transduction by AS3mod/miR #7mod LV led to a substantial decrease of β.sup.S-globin transcripts in HSPC-derived erythroid cells compared to LV-ctrl transduced cells (RTqPCR) at a mean VCN/cell of 2 (FIG. 5A). Notably, the miR specifically down-regulated β.sup.S-globin, without affecting β.sup.AS3 expression (FIG. 5B). In AS3mod/miR #7mod- vs control LV-transduced cells, HPLC analysis showed that β.sup.S-globin downregulation led to a significant decrease of HbS, which represented 58% and 71% of the total Hb, respectively; FIG. 6A). This was associated with a significant increase of the therapeutic Hb in AS3mod/miR #7mod LV- compared to ctrl LV-transduced erythroid cells (38% and 27% of the total Hb, respectively; FIG. 6B). Importantly, we observed a substantial reduction of the proportion of HbS-positive cells in AS3mod/miR #7mod- compared to control LV-transduced samples (from 96% to 70%; FIG. 6C). The increased incorporation of β.sup.AS3 in Hb tetramers and the decrease in β.sup.S-globin led to a better correction of the sickling phenotype in mature RBCs derived from HSPCs transduced with AS3mod/miR #7mod LV- compared to control LV (55% and 84% of sickling cells, respectively; FIG. 6D). Importantly, erythroid differentiation was not affected by β.sup.S-globin down-regulation (FIGS. 7A-7C). Overall, these results validate the therapeutic potential of these novel bifunctional LVs.

Summary and Conclusion

[0109] In this study, we sought to develop an effective strategy for SCD gene therapy. This new strategy is based on previous work that led to the development of LVs expressing a potent anti-sickling therapeutic globin under the control of the β-globin promoter and key regulatory elements of the β-globin LCR. Some of these vectors have recently been tested in clinical trials and although they have shown encouraging results, they do not always provide a benefit in patients with SCD. One of the major reasons is because the transduction efficiency is not equivalent between the patients' HSCs and in some cases, the VCN of the drug product is <1. In these patients, the outcome is a low level of therapeutic β-globin expression as well as the persistence of an elevated proportion of HbS in RBCs, resulting in a limited efficacy of the treatment. On the other hand, it was observed in SCD patients coinheriting a SCD mutation and a thalassemic trait (β.sup.0/β.sup.S), which decreases β-globin production, that for the same VCN, this type of vector was more effective due to lower HbS levels than in β.sup.S/β.sup.S patients (Magrin et al., 2019; Ribeil et al., 2017) .

[0110] With the objective of proposing an effective LV to treat SCD patients, we are seeking to improve the LV-AS3 vector, which expresses the potent anti-sickling β.sup.AS3-globin by adding an RNA interfering function. To do so, a miR #HBB has been inserted in intron 2 of the β.sup.AS3 transgene in order to decrease the expression of the β.sup.S-globin. The reduction of β.sup.S-globin levels will increase the incorporation of β.sup.AS3-globin in Hb tetramers, which should allow this new vector (LV-AS3/miR #HBB) to correct the SCD phenotype of patients who express high levels of β.sup.S-globin. Reducing β.sup.S-globin levels will increase the incorporation of β.sup.AS3-globin into Hb tetramers, which should allow LV-AS3/miR #HBB to outperform the current vectors in the correction of the SCD phenotype.

[0111] Among the 17 LVs-AS3/miR #HBB tested in K562 and HUDEP-2 cells, we have identified LV-AS3/miR#7mod and LV-AS3/miR #10 as the most efficient LVs to decrease β.sup.S-globin expression. Before testing these two LVs in patient HSPCs, we modified the sequence of the transgene by introducing silent mutations at the miR #7mod and miR #10 target sequences. Thus, the complementarity between miR #7mod and miR #10 and their target sequence in the transgene is reduced by 33%, which should be enough to avoid targeting and downregulation of the therapeutic β.sup.AS3 transgene.

[0112] Finally, SCD patient HSPCs were transduced with LV-AS3mod/mir #7mod and control LVs. Erythroid cells derived from patient HSPCs transduced with LV-AS3mod/miR #7mod showed a high level of HbAS3 production associated with a reduction of β.sup.S-globin chains, which allowed our bifunctional LVs to outperform the current therapeutic vectors in terms of correction of the sickling cell phenotype.

REFERENCES

[0113] Throughout this application, various references describe the state of the art to which this invention pertains. The disclosures of these references are hereby incorporated by reference into the present disclosure. [0114] Adams, F. F., Heckl, D., Hoffmann, T., Talbot, S. R., Kloos, A., Thol, F., Heuser, M., Zuber, J., Schambach, A., Schwarzer, A., 2017. An optimized lentiviral vector system for conditional RNAi and efficient cloning of microRNA embedded short hairpin RNA libraries. Biomaterials 139, 102-115. https://doi.org/10.1016/j.biomaterials.2017.05.032 [0115] Akinsheye, I., Alsultan, A., Solovieff, N., Ngo, D., Baldwin, C. T., Sebastiani, P., Chui, D. H. K., Steinberg, M. H., 2011. Fetal hemoglobin in sickle cell anemia. Blood 118, 19-27. https://doi.org/10.1182/blood-2011-03-325258

[0116] Amendola, M., Passerini, L., Pucci, F., Gentner, B., Bacchetta, R., Naldini, L., 2009. Regulated and Multiple miRNA and siRNA Delivery Into Primary Cells by a Lentiviral Platform. Molecular Therapy 17, 1039-1052. https://doi.org/10.1038/mt.2009.48 [0117] Antoniani, C., Meneghini, V., Lattanzi, A., Felix, T., Romano, O., Magrin, E., Weber, L., Pavani, G., El Hoss, S., Kurita, R., Nakamura, Y., Cradick, T. J., Lundberg, A. S., Porteus, M.,

[0118] Amendola, M., El Nemer, W., Cavazzana, M., Mavilio, F., Miccio, A., 2018. Induction of fetal hemoglobin synthesis by CRISPR/Cas9-mediated editing of the human β-globin locus. Blood 131, 1960-1973. https://doi.org/10.1182/blood-2017-10-811505 [0119] Brendel, C., Guda, S., Renella, R., Bauer, D. E., Canver, M. C., Kim, Y.-J., Heeney, M. M., Klatt, D., Fogel, J., Milsom, M. D., Orkin, S. H., Gregory, R. I., Williams, D. A., 2016. Lineage-specific BCL11A knockdown circumvents toxicities and reverses sickle phenotype. J Clin Invest 126, 3868-3878. https://doi.org/10.1172/JCI87885 [0120] Brendel, C., Negre, O., Rothe, M., Guda, S., Parsons, G., Harris, C., McGuinness, M., Abriss, D., Tsytsykova, A., Klatt, D., Bentler, M., Pellin, D., Christiansen, L., Schambach, A., Manis, J., Trebeden-Negre, H., Bonner, M., Esrick, E., Veres, G., Armant, M., Williams, D. A., 2020. Preclinical Evaluation of a Novel Lentiviral Vector Driving Lineage-Specific BCL11A Knockdown for Sickle Cell Gene Therapy. Molecular Therapy-Methods & Clinical Development 17, 589-600. https://doi.org/10.1016/j.omtm.2020.03.015 [0121] Calin, G. A., Dumitru, C. D., Shimizu, M., Bichi, R., Zupo, S., Noch, E., Aldler, H., Rattan, S., Keating, M., Rai, K., Rassenti, L., Kipps, T., Negrini, M., Bullrich, F., Croce, C. M., 2002. Frequent deletions and down-regulation of micro-RNA genes miR15 and miR16 at 13q14 in chronic lymphocytic leukemia. Proc. Natl. Acad. Sci. U.S.A. 99, 15524-15529. https://doi.org/10.1073/pnas.242606799 [0122] Canver, M. C., Smith, E. C., Sher, F., Pinello, L., Sanjana, N. E., Shalem, O., Chen, D. D., Schupp, P. G., Vinjamur, D. S., Garcia, S. P., Luc, S., Kurita, R., Nakamura, Y., Fujiwara, Y., Maeda, T., Yuan, G.-C., Feng, Z., Orkin, S. H., Bauer, D. E., 2015. BCL11A enhancer dissection by Cas9-mediated in situ saturating mutagenesis. Nature 527, 192-197. https://doi.org/10.1038/nature15521 [0123] Cavazzana, M., Antoniani, C., Miccio, A., 2017. Gene Therapy for β-Hemoglobinopathies. Molecular Therapy 25, 1142-1154. https://doi.org/10.1016/j.ymthe.2017.03.024 [0124] Chakraborty, C., Sharma, A. R., Sharma, G., Doss, C. G. P., Lee, S.-S., 2017. Therapeutic miRNA and siRNA: Moving from Bench to Clinic as Next Generation Medicine. Molecular Therapy-Nucleic Acids 8, 132-143. https://doi.org/10.1016/j.omtn.2017.06.005 [0125] Esrick, E.B., Achebe, M., Armant, M., Bartolucci, P., Ciuculescu, M. F., Daley, H., Dansereau, C., Di Caprio, G., Goncalves, B., Hebert, N., Heeney, M. M., Higgins, J. M., Lehmann, L. E., Manis, J. P., Negre, 0., Nikiforow, S., Schonbrun, E., Wood, D. K., Williams, D. A., 2019. Validation of BCL11A As Therapeutic Target in Sickle Cell Disease: Results from the Adult Cohort of a Pilot/Feasibility Gene Therapy Trial Inducing Sustained Expression of Fetal Hemoglobin Using Post-Transcriptional Gene Silencing. Blood 134, LBA-5-LBA-5. https://doi. org/10.1182/blood-2019-132745 [0126] Franco, R. S., Yasin, Z., Palascak, M. B., Ciraolo, P., Joiner, C. H., Rucknagel, D. L., 2006. The effect of fetal hemoglobin on the survival characteristics of sickle cells. Blood 108, 1073-1076. https://doi.org/10.1182/blood-2005-09-008318 [0127] Guda, S., Brendel, C., Renella, R., Du, P., Bauer, D. E., Canver, M. C., Grenier, J. K., Grimson, A. W., Kamran, S. C., Thornton, J., de Boer, H., Root, D. E., Milsom, M. D., Orkin, S. H., Gregory, R.I., Williams, D.A., 2015. miRNA-embedded shRNAs for Lineage-specific BCL11A Knockdown and Hemoglobin F Induction. Molecular Therapy 23, 1465-1474. https://doi.org/10.1038/mt.2015.113 [0128] Kurita, R., Suda, N., Sudo, K., Miharada, K., Hiroyama, T., Miyoshi, H., Tani, K., Nakamura, Y., 2013. Establishment of Immortalized Human Erythroid Progenitor Cell Lines Able to Produce Enucleated Red Blood Cells. PLOS ONE 8, e59890. https://doi.org/10.1371/journal.pone.0059890 [0129] Lin, S.-L., Ying, S.-Y., 2018. Gene Silencing In Vitro and In Vivo Using Intronic MicroRNAs, in: Ying, S.-Y. (Ed.), MicroRNA Protocols, Methods in Molecular Biology. Springer New York, New York, NY, pp. 107-126. https://doi.org/10.1007/978-1-4939-7601-0_9 [0130] Luc, S., Huang, J., McEldoon, J. L., Somuncular, E., Li, D., Rhodes, C., Mamoor, S., Hou, S., Xu, J., Orkin, S. H., 2016. Bc111a-deficiency leads to hematopoietic stem cell defects with an aging-like phenotype. Cell Rep 16, 3181-3194. https://doi.org/10.1016/j.celrep.2016.08.064 [0131] Magrin, E., Miccio, A., Cavazzana, M., 2019. Lentiviral and genome-editing strategies for the treatment of β-hemoglobinopathies. Blood 134, 1203-1213. https://doi.org/10.1182/blood.2019000949 [0132] Marktel, S., Scaramuzza, S., Cicalese, M. P., Giglio, F., Galimberti, S., Lidonnici, M. R., Calbi, V., Assanelli, A., Bernardo, M. E., Rossi, C., Calabria, A., Milani, R., Gattillo, S., Benedicenti, F., Spinozzi, G., Aprile, A., Bergami, A., Casiraghi, M., Consiglieri, G., Masera, N., D'Angelo, E., Mirra, N., Origa, R., Tartaglione, I., Perrotta, S., Winter, R., Coppola, M., Viarengo, G., Santoleri, L., Graziadei, G., Gabaldo, M., Valsecchi, M. G., Montini, E., Naldini, L., Cappellini, M. D., Ciceri, F., Aiuti, A., Ferrari, G., 2019. Intrabone hematopoietic stem cell gene therapy for adult and pediatric patients affected by transfusion-dependent β-thalassemia. Nat Med 25, 234-241. https://doi.org/10.1038/s41591-018-0301-6 [0133] O'Brien, J., Hayder, H., Zayed, Y., Peng, C., 2018. Overview of MicroRNA Biogenesis, Mechanisms of Actions, and Circulation. Front. Endocrinol. 9, 402. https://doi.org/10.3389/fendo.2018.00402 [0134] Poletti, V., Charrier, S., Corre, G., Gjata, B., Vignaud, A., Zhang, F., Rothe, M., Schambach, A., Gaspar, H. B., Thrasher, A. J., Mavilio, F., 2018. Preclinical Development of a Lentiviral Vector for Gene Therapy of X-Linked Severe Combined Immunodeficiency. Molecular Therapy—Methods & Clinical Development 9, 257-269. https://doi.org/10.1016/j.omtm.2018.03.002 [0135] Powars, D. R., Weiss, J. N., Chan, L. S., Schroeder, W. A., 1984. Is there a threshold level of fetal hemoglobin that ameliorates morbidity in sickle cell anemia? Blood 63,921-926. [0136] Ribeil, J. -A., Hacein-Bey-Abina, S., Payen, E., Magnani, A., Semeraro, M., Magrin, E., Caccavelli, L., Neven, B., Bourget, P., El Nemer, W., Bartolucci, P., Weber, L., Puy, H., Meritet, J. -F., Grevent, D., Beuzard, Y., Chrétien, S., Lefebvre, T., Ross, R. W., Negre, O., Veres, G., Sandler, L., Soni, S., de Montalembert, M., Blanche, S., Leboulch, P., Cavazzana, M., 2017. Gene Therapy in a Patient with Sickle Cell Disease [WWW Document]. http://dx.doi.org/10.1056/NEJMoa1609677. https://doi.org/10.1056/NEJMoa1609677 [0137] Sankaran, V. G., Menne, T. F., Xu, J., Akie, T. E., Lettre, G., Handel, B. V., Mikkola, H. K. A., Hirschhorn, J. N., Cantor, A. B., Orkin, S. H., 2008. Human Fetal Hemoglobin Expression Is Regulated by the Developmental Stage-Specific Repressor BCL11A. Science 322,1839-1842. https://doi.org/10.1126/science.1165409 [0138] Sundd, P., Gladwin, M. T., Novelli, E. M., 2018. Pathophysiology of Sickle Cell Disease 32. Weber, L., Poletti, V., Magrin, E., Antoniani, C., Martin, S., Bayard, C., Sadek, H., Felix, T., Meneghini, V., Antoniou, M. N., El-Nemer, W., Mavilio, F., Cavazzana, M., Andre-Schmutz, I., Miccio, A., 2018. An Optimized Lentiviral Vector Efficiently Corrects the Human Sickle Cell Disease Phenotype. Molecular Therapy-Methods & Clinical Development 10,268-280. https://doi.org/10.1016/j.omtm.2018.07.012 [0139] Yu, Y., Wang, J., Khaled, W., Burke, S., Li, P., Chen, X., Yang, W., Jenkins, N. A., Copeland, N. G., Zhang, S., Liu, P., 2012. Bc111a is essential for lymphoid development and negatively regulates p53. J Exp Med 209,2467-2483. https://doi.org/10.1084/jem.20121846