Saponin derivatives with improved therapeutic window
20230357310 · 2023-11-09
Assignee
Inventors
Cpc classification
A61K45/06
HUMAN NECESSITIES
International classification
C07J63/00
CHEMISTRY; METALLURGY
Abstract
The invention relates to a saponin derivative based on a saponin comprising a triterpene aglycone and a first saccharide chain and/or a second saccharide chain, and comprising: an aglycone core structure comprising an aldehyde group which has been derivatised; and/or the first saccharide chain wherein the first saccharide chain comprises a carboxyl group, which has been derivatised; and/or the second saccharide chain wherein the second saccharide chain comprises at least one acetoxy group which has been derivatised. The invention also relates to a first pharmaceutical composition comprising the saponin derivative of the invention. In addition, the invention relates to a pharmaceutical combination comprising the first pharmaceutical composition of the invention and a second pharmaceutical composition comprising any one or more of an antibody-toxin conjugate, a receptor-ligand—toxin conjugate, an antibody-drug conjugate, a receptor-ligand—drug conjugate, an antibody-oligonucleotide conjugate or a receptor-ligand—oligonucleotide conjugate. The invention also relates to the first pharmaceutical composition or the pharmaceutical combination of the invention, for use as a medicament, or use in the treatment or prophylaxis of a cancer, an infectious disease, viral infection, hypercholesterolemia, primary hyperoxaluria, haemophilia A, haemophilia B, alpha-1 antitrypsin related liver disease, acute hepatic porphyria, transthyretin-mediated amyloidosis, or an auto-immune disease. Furthermore, the invention relates to an in vitro or ex vivo method for transferring a molecule from outside a cell to inside said cell, comprising contacting said cell with the molecule and with a saponin derivative of the invention.
Claims
1-30. (canceled)
31. A saponin derivative based on a saponin comprising a triterpene aglycone core structure and a first saccharide chain and a second saccharide chain linked to the aglycone core structure, wherein: i. the saponin derivative comprises an aglycone core structure comprising an aldehyde group which has been derivatised; or ii. the first saccharide chain comprises a carboxyl group, preferably a carboxyl group of a glucuronic acid moiety, which has been derivatised; or iii. the second saccharide chain comprises at least one acetoxy (Me(CO)O—) group which has been derivatised; or iv. the saponin derivative comprises any combination of derivatisations i., ii. and iii., preferably any combinations of two derivatisations i., ii. and iii.; and wherein the saponin derivative is a SO1861 derivative.
32. The saponin derivative according to claim 31, wherein the saponin derivative comprises both of said first saccharide chain which has been derivatised and said second saccharide chain which has been derivatised, preferably, the saponin derivative comprises both of said first saccharide chain which has been derivatised and said second saccharide chain which has been derivatised and an aglycone core structure comprising an aldehyde group which has been derivatised.
33. The saponin derivative according to claim 31, wherein at least one of the following derivatisations is present, preferably one or two of the following derivatisations is present, more preferably one: i. the aldehyde group at position C23 of the quillaic acid has been derivatised by; reduction to an alcohol; transformation into a hydrazone bond, preferably through reaction with a hydrazide; ii. the carboxyl group of the glucuronic acid moiety has been derivatised by transformation into an amide bond, preferably through reaction with an amine; and iii. the acetoxy group, has been derivatised by transformation into a hydroxyl group (HO—) by deacetylation.
34. The saponin derivative according to claim 31, wherein the saponin derivative has a molecular weight of less than 2,500 g/mol, preferably less than 2,300 g/mol, more preferably less than 2,150 g/mol.
35. The saponin derivative according to claim 31, wherein at least one of the following derivatisations is present, preferably one or two of the following derivatisations is present: i. the aldehyde group at position C.sub.23 of the quillaic acid has been derivatised by; reduction to an alcohol; transformation into a hydrazone bond through reaction with N-ε-maleimidocaproic acid hydrazide (EMCH), therewith providing SO1861-Ald-EMCH, wherein the maleimide group of the EMCH is optionally derivatised by formation of a thioether bond with mercaptoethanol; transformation into a hydrazone bond through reaction with N-[β-maleimidopropionic acid] hydrazide (BMPH) wherein the maleimide group of the BMPH is optionally derivatised by formation of a thioether bond with mercaptoethanol; or transformation into a hydrazone bond through reaction with N-[κ-maleimidoundecanoic acid] hydrazide (KMUH) wherein the maleimide group of the KMUH is optionally derivatised by formation of a thioether bond with mercaptoethanol; ii. the carboxyl group of a glucuronic acid moiety of the first saccharide chain has been derivatised by transformation into an amide bond through reaction with 2-amino-2-methyl-1,3-propanediol (AMPD) or N-(2-aminoethyl)maleimide (AEM), therewith providing a SO1861-Glu-AMPD or a SO1861-Glu-AEM; and iii. the acetoxy group of the second saccharide moiety has been derivatised by transformation into a hydroxyl group (HO—) by deacetylation.
36. The saponin derivative according to claim 31, wherein the saponin derivative is a SO1861 derivative comprising a single derivatisation, wherein the single derivatisation is transformation of a carboxyl group of a glucuronic acid moiety of SO1861 by binding 1-[Bis(dimethylamino)methylene]-1H-1,2,3-triazolo[4,5-b]pyridinium 3-oxid hexafluorophosphate (HATU) to the carboxyl group of the glucuronic acid moiety of SO1861 or by binding (benzotriazol-1-yloxy)tris(dimethylamino)phosphonium hexafluorophosphate (BOP) to the carboxyl group of the glucuronic moiety of SO1861, or wherein the saponin derivative is a SO1861 derivative represented by Molecule 2, which represents a SO1861 derivative comprising an aldehyde group at indicated position C.sub.23 of the quillaic acid aglycone core structure which has been derivatised by transformation into a hydrazone bond through reaction with N-ε-maleimidocaproic acid hydrazide (EMCH): ##STR00017## or wherein the saponin derivative is a SO1861 derivative represented by Molecule 3, which represents a SO1861 derivative comprising an aldehyde group at indicated position C.sub.23 of the quillaic acid aglycone core structure which has been derivatised by transformation into a hydrazone bond through reaction with N-ε-maleimidocaproic acid hydrazide (EMCH) wherein the maleimide group of the EMCH is derivatised with mercaptoethanol therewith forming a thioether bond: ##STR00018##
37. The saponin derivative according to claim 31, wherein i. the saponin derivative comprises an aglycone core structure wherein the aglycone core structure comprises an aldehyde group which has been derivatised by: reduction to an alcohol; transformation into a hydrazone bond through reaction with N-ε-maleimidocaproic acid hydrazide (EMCH) wherein the maleimide group of the EMCH is optionally derivatised by formation of a thioether bond with mercaptoethanol; transformation into a hydrazone bond through reaction with N-[β-maleimidopropionic acid] hydrazide (BMPH) wherein the maleimide group of the BMPH is optionally derivatised by formation of a thioether bond with mercaptoethanol; or transformation into a hydrazone bond through reaction with N-[κ-maleimidoundecanoic acid] hydrazide (KMUH) wherein the maleimide group of the KMUH is optionally derivatised by formation of a thioether bond with mercaptoethanol; ii. the first saccharide chain comprises a carboxyl group, preferably a carboxyl group of a glucuronic acid moiety, which has been derivatised by transformation into an amide bond through reaction with 2-amino-2-methyl-1,3-propanediol (AMPD) or N-(2-aminoethyl)maleimide (AEM); iii. the second saccharide chain comprises an acetoxy group (Me(CO)O—) which has been derivatised by transformation into a hydroxyl group (HO—) by deacetylation; or iv. the saponin derivative comprises any combination of two or three derivatisations and iii., preferably any combination of two derivatisations i., ii. and iii.; preferably, the saponin derivative comprises an aglycone core structure wherein the aglycone core structure comprises an aldehyde group which has been derivatised by transformation into a hydrazone bond through reaction with EMCH wherein the maleimide group of the EMCH is optionally derivatised by formation of a thioether bond with mercaptoethanol.
38. The saponin derivative according to claim 37, wherein the saponin derivative comprises an aglycone core structure wherein the aglycone core structure comprises an aldehyde group and wherein the first saccharide chain comprises a carboxyl group, preferably a carboxyl group of a glucuronic acid moiety, which has been derivatised by transformation into an amide bond through reaction with N-(2-aminoethyl)maleimide (AEM).
39. The saponin derivative according to claim 38, with the proviso that when the aldehyde group in the aglycone core structure is derivatised by transformation into a hydrazone bond through reaction with N-ε-maleimidocaproic acid hydrazide (EMCH), at least one of the glucuronic acid and the acetoxy group (Me(CO)O—) is also derivatised, and with the proviso that when the glucuronic acid moiety of SO1861 is derivatised by reaction of 1-[Bis(dimethylamino)methylene]-1H-1,2,3-triazolo[4,5-b]pyridinium 3-oxid hexafluorophosphate (HATU) with the carboxyl group of the glucuronic acid moiety of SO1861, at least one of the aldehyde group and the acetoxy group (Me(CO)O—) is also modified.
40. The saponin derivative of claim 39, with the proviso that when the aldehyde group in the aglycone core structure of the saponin derivative is derivatised through reaction with EMCH, at least one of the glucuronic acid and the acetoxy group (Me(CO)O—) is also derivatised, and with the proviso that when the carboxyl group of the glucuronic acid moiety of SO1861 is derivatised by bound HATU, at least one of the aldehyde group and the acetoxy group (Me(CO)O—) is also derivatised.
41. First pharmaceutical composition comprising the saponin derivative according to claim 31 and optionally a pharmaceutically acceptable excipient and/or diluent.
42. First pharmaceutical composition of claim 41, wherein the saponin derivative is the saponin derivative represented by Molecule 2: ##STR00019## or SO1861 derivative comprising a single derivatisation, wherein the single derivatisation is transformation of the carboxyl group of the glucuronic acid moiety of SO1861 by reaction of 1-[Bis(dimethylamino)methylene]-1H-1,2,3-triazolo[4,5-b]pyridinium 3-oxid hexafluorophosphate (HATU) with the carboxyl group of the glucuronic acid moiety of SO1861, or the saponin derivative is the saponin derivative represented by Molecule 3: ##STR00020##
43. Pharmaceutical combination comprising: the first pharmaceutical composition of claim 41; and a second pharmaceutical composition comprising any one or more of an antibody-toxin conjugate, a receptor-ligand—toxin conjugate, an antibody-drug conjugate, a receptor-ligand—drug conjugate, an antibody-oligonucleotide conjugate or a receptor-ligand—oligonucleotide conjugate, and optionally comprising a pharmaceutically acceptable excipient and/or diluent.
Description
BRIEF DESCRIPTION OF THE DRAWINGS
[0059]
[0060]
[0061]
[0062]
[0063]
[0064]
[0065]
[0066]
[0067]
[0068]
[0069]
[0070]
[0071]
[0072]
[0073]
[0074]
[0075]
[0076]
[0077]
[0078]
[0079]
[0080]
[0081]
[0082]
[0083]
[0084]
[0085]
[0086]
[0087]
[0088]
[0089]
[0090]
[0091]
[0092]
[0093]
[0094]
[0095]
[0096]
[0097]
[0098]
[0099]
[0100]
[0101]
[0102]
[0103]
[0104]
[0105]
[0106]
[0107]
[0108]
[0109]
[0110]
[0111]
[0112]
[0113]
[0114]
[0115]
[0116]
[0117]
[0118]
[0119]
[0120]
[0121]
[0122]
[0123]
[0124]
[0125]
[0126]
[0127]
[0128]
[0129]
[0130]
[0131]
[0132]
[0133]
[0134]
[0135]
[0136]
[0137]
[0138]
[0139]
[0140]
[0141]
DETAILED DESCRIPTION
[0142] The present invention will be described with respect to particular embodiments but the invention is not limited thereto but only by the claims.
[0143] Surprisingly, the inventors have found that modified saponins, i.e. saponin derivatives, having the groups: [0144] a branched tri-saccharide moiety bound at C-3 of the aglycone of the saponin and containing a modified glucuronic acid; and/or [0145] a modified aldehyde at C-4 of the aglycone of the saponin; and/or [0146] a polysaccharide moiety bound at C-28 position of the aglycone of the saponin, and containing a modified acetyl group in said polysaccharide moiety;
have a reduced toxicity when cell viability is considered of cells contacted with the saponin derivatives;
have activity when potentiation of e.g. toxin cytotoxicity or BNA mediated gene silencing is considered (without wishing to be bound by any theory: relating to similar or improved endosomal escape enhancing activity of the modified saponin), if one or two of said aforementioned groups in the modified saponin are derivatised (i.e. one or two of: the aldehyde group in the aglycone, a carboxyl group of a glucuronic acid in the polysaccharide chain bound at C-3 of the aglycone, and an acetyl group in the polysaccharide chain bound at C-28 of the aglycone); and/or have reduced hemolytic activity, when compared with the toxicity, activity and haemolytic activity of unmodified saponin. Therewith, the inventors provide saponin derivatives with an improved therapeutic window, since for the saponin derivatives, the cytotoxicity is lower than cytotoxicity determined for their naturally occurring counterparts, the haemolytic activity is lower than haemolytic activity determined for the naturally occurring counterparts of the saponin derivatives, and for the single derivatised saponins and for the double-derivatised saponins, the ratio between IC50 values for cell toxicity and e.g. toxin potentiation or gene silencing is similar or increased, and/or since the ratio between IC50 values for saponin haemolytic activity and e.g. toxin potentiation or gene silencing is similar or increased. Reference is made to Tables A2 for an overview of exemplified saponin derivatives, in combination with
[0147] A first aspect of the invention relates to a saponin derivative based on a saponin comprising a triterpene aglycone core structure (also referred to as ‘aglycone’) and at least one of a first saccharide chain and a second saccharide chain linked to the aglycone core structure, wherein: [0148] i. the saponin derivative comprises an aglycone core structure comprising an aldehyde group which has been derivatised; or [0149] ii. the saponin derivative comprises the first saccharide chain wherein the first saccharide chain comprises a carboxyl group, preferably a carboxyl group of a glucuronic acid moiety, which has been derivatised; or [0150] iii. the saponin derivative comprises the second saccharide chain wherein the second saccharide chain comprises at least one acetoxy (Me(CO)O—) group which has been derivatised; or [0151] iv. the saponin derivative comprises any combination of derivatisations i., ii. and iii., preferably any combinations of two derivatisations i., ii. and iii.;
wherein the first saccharide chain and the second saccharide chain are independently selected from a monosaccharide, a linear oligosaccharide and a branched oligosaccharide.
[0152] An embodiment is the saponin derivative according to the invention, wherein the saponin derivative is a monodesmosidic triterpene glycoside or a bidesmosidic triterpene glycoside, more preferably a bidesmosidic triterpene glycoside.
[0153] Surprisingly, modification (derivatisation) of any one, two or three of the aldehyde group at C-23 of the aglycone of the saponin, the carboxyl group in the saccharide moiety at C-3 of the aglycone, i.e. in a glucuronic acid moiety, and the acetyl group in a saccharide unit in the (oligo-)saccharide moiety bound at C-28 of the aglycone of the saponin, results in a decrease in cytotoxicity when such saponin derivatives are contacted with cells, i.e. various types of cells. The decrease in cytotoxicity has been established by the inventors for the series of varying saponin derivatives listed in Table A2, Table A3 and
[0154] Without wishing to be bound by any theory, it is assumed that the aldehyde group at the C-3 atom of the aglycone of the saponin relates and/or contributes to the endosomal escape enhancing activity of bidesmosidic triterpene glycoside type of saponins, i.e. for example the increased toxicity of (protein) toxins when contacted with cells in the presence of such saponins, compared to the toxicity of such toxins when the same dose is contacted to the same cells in the absence of such saponins, both in vitro and in vivo. Indeed, the inventors established that saponin derivatives with a derivatised carboxyl group in the glucuronic acid unit, and/or a derivatised acetyl group in the polysaccharide chain, and comprising the free aldehyde group in the aglycone, have endosomal escape enhancing activity. These derivatives have decreased haemolytic activity and decreased cytotoxicity. For example, the saponin derivatives as molecules 3A, 8, 11, 18, 19 and 28 (Table A2, Table A3, Table A5, Table A6,
[0155] Surprisingly, also saponin derivatives with a derivatised aldehyde group in the aglycone, such that the saponin derivative does not comprise the free aldehyde group, still display the characteristic endosomal escape enhancing activity when the cytotoxicity of an effector molecule provided to (tumor) cells in the form of a ligand-toxin conjugate, e.g. an ADC, and with the prerequisite that none or only one of the acetyl group in the polysaccharide chain at C-28 and the carboxyl group in the polysaccharide chain at C-23 is derivatised. For example, the saponin derivatives with a modified aldehyde group and with none or a single further derivatisation, indicated as molecules 6, 9, 10, 14, 15, 20, 27 and 29 in Table A2, Table A3 and
[0156] The inventors have also found that certain modifications lead to an increased critical micelle concentration (CMC) when compared with the corresponding unmodified saponin. For example, the saponin derivatives indicated as molecules 2, 6, 8, 10, 15, 27 and 28, preferably the saponin derivatives indicated as molecules 2, 6, 8, 10, and 15 have an increased CMC when compared to their corresponding underivatised saponin and are hence explicitly envisaged embodiments of the invention. Without wishing to be bound by any theory, it is believed that an increased CMC is advantageous for several reasons. For example, an increased CMC may facilitate the use of the modified saponins in subsequent conjugation reactions since free molecules are generally more susceptible to conjugation reactions than molecules ordered in a micellar structure. Furthermore, in case the saponin derivatives need to exert a biological function (e.g. in an in vivo treatment or ex vivo method or in vitro method), for example in case the saponin derivatives are used as such or even in case they are released in-situ after cleavage from a carrier or another entity, an increased CMC when compared to unmodified saponin is advantageous since the free saponin molecules will be more readily available to interact with their biological target than in case these saponin derivatives are ordered in a micellar structure. An increased CMC may also be useful to facilitate the large scale production and concentration of the saponin derivatives since at concentrations beyond (above) the critical micellar concentration, saponins form micelles which hinder isolation (e.g. using preparative HPLC). Surprisingly, for the saponin derivatives according to the invention the observed increased CMC was not associated with increased cytotoxicity or hemolytic activity. The relationship between CMC and cytotoxicity is not predictable and complex, as can for example be seen from the data in Table 2 of de Groot et al. (“Saponin interactions with model membrane systems—Langmuir monolayer studies, nemolysis and formation of ISCOMs”, Planta medica 82.18 (2016): 1496-1512.), which shows that, taking α-Hederin as the reference point, an increase in CMC may be associated with an increase in general cytotoxicity (as is the case for Digitonin) but may just as well be associated with a decrease in cytotoxicity (as is the case for Glycyrrhizin and Hederacoside C). Furthermore, for the saponin derivatives indicated as molecules 2, 6, 10, and 15 the increased CMC is also associated with an increased Ratio: IC50 hemolysis/IC50 activity, compared to the corresponding free saponin, such that these saponin derivatives are particularly preferred embodiments of the invention.
[0157] The inventors thus provide saponin derivatives with an improved therapeutic window when cytotoxicity is considered and/or when haemolytic activity is considered, and when the potentiation of e.g. toxins is considered and/or an increased CMC compared to the corresponding underivatised saponin. Such saponin derivatives of the invention are in particular suitable for application in a therapeutic regimen involving e.g. an ADC or an AOC for the prophylaxis or treatment of e.g. a cancer. The safety of such saponin derivatives is improved when cytotoxicity and/or haemolytic activity is considered, especially when such saponin derivatives are administered to a patient in need of e.g. treatment with an ADC or with and AOC.
[0158] An embodiment is the saponin derivative according to the invention, wherein the saponin derivative comprises the first saccharide chain wherein the first saccharide chain comprises a carboxyl group, preferably a carboxyl group of a glucuronic acid moiety, which has been derivatised, and/or wherein the saponin derivative comprises the second saccharide chain wherein the second saccharide chain comprises at least one acetoxy (Me(CO)O—) group which has been derivatised (here also referred to as derivatised acetate group), preferably the saponin derivative comprises both of said first saccharide chain which has been derivatised and said second saccharide chain which has been derivatised, more preferably, the saponin derivative comprises both of said first saccharide chain which has been derivatised and said second saccharide chain which has been derivatised and the saponin derivative comprises an aglycone core structure comprising an aldehyde group or an aldehyde group which has been derivatised, most preferably, the saponin derivative comprises both of said first saccharide chain which has been derivatised and said second saccharide chain which has been derivatised and the saponin derivative comprises an aglycone core structure comprising an aldehyde group. Equally preferred are all other possible combinations of two of such derivatisations, leaving one of these three chemical groups in the saponin unaltered when the naturally occurring saponin is considered. Furthermore, the one, two or three, preferably one or two, of the chemical groups in the saponin are derivatised according to any one or more of the listed derivatisations in Table A2 and Table A3.
[0159] An embodiment is the saponin derivative according to the invention, wherein the saponin derivative comprises an aglycone core structure selected from the group consisting of: [0160] 2alpha-hydroxy oleanolic acid; [0161] 16alpha-hydroxy oleanolic acid; [0162] hederagenin (23-hydroxy oleanolic acid); [0163] 16alpha,23-dihydroxy oleanolic acid; [0164] gypsogenin; [0165] quillaic acid; [0166] protoaescigenin-21(2-methylbut-2-enoate)-22-acetate; [0167] 23-oxo-barringtogenol C-21,22-bis(2-methylbut-2-enoate); [0168] 23-oxo-barringtogenol C-21(2-methylbut-2-enoate)-16,22-diacetate; [0169] digitogenin; [0170] 3,16,28-trihydroxy oleanan-12-en; [0171] gypsogenic acid, [0172] and [0173] derivatives thereof,
preferably the saponin derivative comprises an aglycone core structure selected from quillaic acid and gypsogenin or derivatives thereof, more preferably the saponin derivative aglycone core structure is quillaic acid or a derivative thereof. Since the inventors now found that improved saponin derivatives can be provided with regard to decreased cytotoxicity and lower haemolysis of cells contacted with such derivatives, based on saponins of the triterpene glycoside type, basically any saponin with such endosomal escape enhancing activity as tested by the inventors, such as saponins having the aglycone of the afore embodiment and listed in Table A1, can be improved accordingly. Lowering toxicity and lowering haemolytic activity while preserving activity to a sufficiently high extent when potentiation of toxins and for example BNAs is considered, is an important achievement by the inventors, when the widening of the therapeutic window of the saponin derivatives alone or in combination with e.g. an ADC or an AOC is considered. A sufficiently high dose of derivatised saponin can be applied in e.g. tumor therapy for a cancer patient in need thereof, while the (risk for) cytotoxic side-effects and the (risk for) undesired haemolytic activity exerted or induced by the saponin derivative is decreased when compared with the application of the natural saponin counterpart. Improvements of the therapeutic window of the saponin derivatives of the invention are for example apparent for the exemplified saponin derivatives in Table A5 and Table A6: the ratio between the IC50 for either cytotoxicity, or haemolytic activity and the IC50 for endosomal escape enhancing activity are listed, as well as the haemolytic activity, cytotoxicity and the activity.
[0174] An embodiment is the saponin derivative according to the invention, wherein the saponin derivative comprises an aglycone core structure selected from the group consisting of quillaic acid, gypsogenin, and derivatives thereof, preferably the saponin derivative comprises an aglycone core structure selected from the group consisting of quillaic acid and derivatives thereof, wherein the first saccharide chain, when present, is linked to the C.sub.3 atom (also denoted as ‘C-3’ atom) or the C.sub.28 atom (also denoted as ‘C-28’ atom) of the aglycone core structure, preferably to the 03 atom, and/or wherein the second saccharide chain, when present, is linked to the C.sub.28 atom of the aglycone core structure. Preferred are those saponin derivatives which are based on a saponin having both saccharide chains bound to the aglycone, but in general any saponin that displays endosomal escape enhancing activity is suitable for derivatisation according to the invention, for the purpose to provide single, double or triple, preferably single or double derivatised saponins with lower cytotoxicity, lower haemolytic activity and sufficiently high endosomal escape enhancing activity.
[0175] An embodiment is the saponin derivative according to the invention, wherein the first saccharide chain, if present, is selected from (list S1): [0176] GlcA-, [0177] Glc-, [0178] Gal-, [0179] Rha-(1.fwdarw.2)-Ara-, [0180] Gal-(1.fwdarw.2)-[Xyl-(1.fwdarw.3)]-GlcA-, [0181] Glc-(1.fwdarw.2)-[Glc-(1.fwdarw.4)]-GlcA-, [0182] Glc-(1.fwdarw.2)-Ara-(1.fwdarw.3)-[Gal-(1.fwdarw.2)]-GlcA-, [0183] Xyl-(1.fwdarw.2)-Ara-(1.fwdarw.3)-[Gal-(1.fwdarw.2)]-GlcA-, [0184] Glc-(1.fwdarw.3)-Gal-(1.fwdarw.2)-[Xyl-(1.fwdarw.3)]-Glc-(1.fwdarw.4)-Gal-, [0185] Rha-(1.fwdarw.2)-Gal-(1.fwdarw.3)-[Glc-(1.fwdarw.2)]-GlcA-, [0186] Ara-(1.fwdarw.4)-Rha-(1.fwdarw.2)-Glc-(1.fwdarw.2)-Rha-(1.fwdarw.2)-GlcA-, [0187] Ara-(1.fwdarw.4)-Fuc-(1.fwdarw.2)-Glc-(1.fwdarw.2)-Rha-(1.fwdarw.2)-GlcA-, [0188] Ara-(1.fwdarw.4)-Rha-(1.fwdarw.2)-Gal-(1.fwdarw.2)-Rha-(1.fwdarw.2)-GlcA-, [0189] Ara-(1.fwdarw.4)-Fuc-(1.fwdarw.2)-Gal-(1.fwdarw.2)-Rha-(1.fwdarw.2)-GlcA-, [0190] Ara-(1.fwdarw.4)-Rha-(1.fwdarw.2)-Glc-(1.fwdarw.2)-Fuc-(1.fwdarw.2)-GlcA-, [0191] Ara-(1.fwdarw.4)-Fuc-(1.fwdarw.2)-Glc-(1.fwdarw.2)-Fuc-(1.fwdarw.2)-GlcA-, [0192] Ara-(1.fwdarw.4)-Rha-(1.fwdarw.2)-Gal-(1.fwdarw.2)-Fuc-(1.fwdarw.2)-GlcA-, [0193] Ara-(1.fwdarw.4)-Fuc-(1.fwdarw.2)-Gal-(1.fwdarw.2)-Fuc-(1.fwdarw.2)-GlcA-, [0194] Xyl-(1.fwdarw.4)-Rha-(1.fwdarw.2)-Glc-(1.fwdarw.2)-Rha-(1.fwdarw.2)-GlcA-, [0195] Xyl-(1.fwdarw.4)-Fuc-(1.fwdarw.2)-Glc-(1.fwdarw.2)-Rha-(1.fwdarw.2)-GlcA-, [0196] Xyl-(1.fwdarw.4)-Rha-(1.fwdarw.2)-Gal-(1.fwdarw.2)-Rha-(1.fwdarw.2)-GlcA-, [0197] Xyl-(1.fwdarw.4)-Fuc-(1.fwdarw.2)-Gal-(1.fwdarw.2)-Rha-(1.fwdarw.2)-GlcA-, [0198] Xyl-(1.fwdarw.4)-Rha-(1.fwdarw.2)-Glc-(1.fwdarw.2)-Fuc-(1.fwdarw.2)-GlcA-, [0199] Xyl-(1.fwdarw.4)-Fuc-(1.fwdarw.2)-Glc-(1.fwdarw.2)-Fuc-(1.fwdarw.2)-GlcA-, [0200] Xyl-(1.fwdarw.4)-Rha-(1.fwdarw.2)-Gal-(1.fwdarw.2)-Fuc-(1.fwdarw.2)-GlcA-, [0201] Xyl-(1.fwdarw.4)-Fuc-(1.fwdarw.2)-Gal-(1.fwdarw.2)-Fuc-(1.fwdarw.2)-GlcA-, and [0202] derivatives thereof, [0203] and/or wherein the second saccharide chain, if present, is selected from (list S2): [0204] Glc-, [0205] Gal-, [0206] Rha-(1.fwdarw.2)-[Xyl-(1.fwdarw.4)]-Rha-, [0207] Rha-(1.fwdarw.2)-[Ara-(1.fwdarw.3)-Xyl-(1.fwdarw.4)]-Rha-, [0208] Ara-, [0209] Xyl-, [0210] Xyl-(1.fwdarw.4)-Rha-(1.fwdarw.2)-[R1-(.fwdarw.4)]-Fuc- wherein R1 is 4E-Methoxycinnamic acid, [0211] Xyl-(1.fwdarw.4)-Rha-(1.fwdarw.2)-[R2-(.fwdarw.4)]-Fuc- wherein R2 is 4Z-Methoxycinnamic acid, [0212] Xyl-(1.fwdarw.4)-[Gal-(1.fwdarw.3)]-Rha-(1.fwdarw.2)-4-OAc-Fuc-, [0213] Xyl-(1.fwdarw.4)-[Glc-(1.fwdarw.3)]-Rha-(1.fwdarw.2)-3,4-d i-OAc-Fuc-, [0214] Xyl-(1.fwdarw.4)-[Glc-(1.fwdarw.3)]-Rha-(1.fwdarw.2)-[R3-(.fwdarw.4)]-3-OAc-Fuc- wherein R3 is 4E-Methoxycinnamic acid, [0215] Glc-(1.fwdarw.3)-Xyl-(1.fwdarw.4)-[Glc-(1.fwdarw.3)]-Rha-(1.fwdarw.2)-4-OAc-Fuc-, [0216] Glc-(1.fwdarw.3)-Xyl-(1.fwdarw.4)-Rha-(1.fwdarw.2)-4-OAc-Fuc-, [0217] (Ara- or Xyl-)(1.fwdarw.3)-(Ara- or Xyl-)(1.fwdarw.4)-(Rha- or Fuc-)(1.fwdarw.2)-[4-OAc-(Rha- or Fuc-)(1.fwdarw.4)]-(Rha- or Fuc-), [0218] Xyl-(1.fwdarw.3)-Xyl-(1.fwdarw.4)-Rha-(1.fwdarw.2)-[Qui-(1.fwdarw.4)]-Fuc-, [0219] Api-(1.fwdarw.3)-Xyl-(1.fwdarw.4)-[Glc-(1.fwdarw.3)]-Rha-(1.fwdarw.2)-Fuc-, [0220] Xyl-(1.fwdarw.4)-[Gal-(1.fwdarw.3)]-Rha-(1.fwdarw.2)-Fuc-, [0221] Xyl-(1.fwdarw.4)-[Glc-(1.fwdarw.3)]-Rha-(1.fwdarw.2)-Fuc-, [0222] Ara/Xyl-(1.fwdarw.4)-Rha/Fuc-(1.fwdarw.4)-[Glc/Gal-(1.fwdarw.2)]-Fuc-, [0223] Api-(1.fwdarw.3)-Xyl-(1.fwdarw.4)-[Glc-(1.fwdarw.3)]-Rha-(1.fwdarw.2)-[R4-(.fwdarw.4)]-Fuc- wherein R4 is 5-O-[5-O-Ara/Api-3,5-dihydroxy-6-methyl-octanoyl]-3,5-dihydroxy-6-methyl-octanoic acid), [0224] Api-(1.fwdarw.3)-Xyl-(1.fwdarw.4)-Rha-(1.fwdarw.2)-[R5-(.fwdarw.4)]-Fuc- wherein R5 is 5-O-[5-O-Ara/Api-3,5-dihydroxy-6-methyl-octanoyl]-3,5-dihydroxy-6-methyl-octanoic acid), [0225] Api-(1.fwdarw.3)-Xyl-(1.fwdarw.4)-Rha-(1.fwdarw.2)-[Rha-(1.fwdarw.3)]-4-OAc-Fuc-, [0226] Api-(1.fwdarw.3)-Xyl-(1.fwdarw.4)-[Glc-(1.fwdarw.3)]-Rha-(1.fwdarw.2)-[Rha-(1.fwdarw.3)]-4-OAc-Fuc-, [0227] 6-OAc-Glc-(1.fwdarw.3)-Xyl-(1.fwdarw.4)-Rha-(1.fwdarw.2)-[3-OAc-Rha-(1.fwdarw.3)]-Fuc-, [0228] Glc-(1.fwdarw.3)-Xyl-(1.fwdarw.4)-Rha-(1.fwdarw.2)-[3-OAc-Rha-(1.fwdarw.3)]-Fuc-, [0229] Xyl-(1.fwdarw.3)-Xyl-(1.fwdarw.4)-Rha-(1.fwdarw.2)-[Qui-(1.fwdarw.4)]-Fuc-, [0230] Glc-(1.fwdarw.3)-[Xyl-(1.fwdarw.4)]-Rha-(1.fwdarw.2)-[Qui-(1.fwdarw.4)]-Fuc-, [0231] Glc-(1.fwdarw.3)-Xyl-(1.fwdarw.4)-Rha-(1.fwdarw.2)-[Xyl-(1.fwdarw.3)-4-OAc-Qui-(1.fwdarw.4)]-Fuc-, [0232] Xyl-(1.fwdarw.3)-Xyl-(1.fwdarw.4)-Rha-(1.fwdarw.2)-[3,4-di-OAc-Qui-(1.fwdarw.4)]-Fuc-, [0233] Glc-(1.fwdarw.3)-[Xyl-(1.fwdarw.4)]-Rha-(1.fwdarw.2)-Fuc-, [0234] 6-OAc-Glc-(1.fwdarw.3)-[Xyl-(1.fwdarw.4)]-Rha-(1.fwdarw.2)-Fuc-, [0235] Glc-(1.fwdarw.3)-[Xyl-(1.fwdarw.3)-Xyl-(1.fwdarw.4)]-Rha-(1.fwdarw.2)-Fuc-, [0236] Xyl-(1.fwdarw.3)-Xyl-(1.fwdarw.4)-Rha-(1.fwdarw.2)-[Xyl-(1.fwdarw.3)-4-OAc-Qui-(1.fwdarw.4)]-Fuc-, [0237] Api/Xyl-(1.fwdarw.3)-Xyl-(1.fwdarw.4)-[Glc-(1.fwdarw.3)]-Rha-(1.fwdarw.2)-[Rha-(1.fwdarw.3)]-4OAc-Fuc-, [0238] Api-(1.fwdarw.3)-Xyl-(1.fwdarw.4)-[Glc-(1.fwdarw.3)]-Rha-(1.fwdarw.2)-[Rha-(1.fwdarw.3)]-4OAc-Fuc-, [0239] Api/Xyl-(1.fwdarw.3)-Xyl-(1.fwdarw.4)-[Glc-(1.fwdarw.3)]-Rha-(1.fwdarw.2)-[R6-(.fwdarw.4)]-Fuc- wherein R6 is 5-O-[5-O-Rha-(1.fwdarw.2)-Ara/Api-3,5-dihydroxy-6-methyl-octanoyl]-3,5-dihydroxy-6-methyl-octanoic acid), [0240] Api/Xyl-(1.fwdarw.3)-Xyl-(1.fwdarw.4)-[Glc-(1.fwdarw.3)]-Rha-(1.fwdarw.2)-[R7-(.fwdarw.4)]-Fuc- wherein R7 is 5-O-[5-O-Ara/Api-3,5-dihydroxy-6-methyl-octanoyl]-3,5-dihydroxy-6-methyl-octanoic acid), [0241] Api/Xyl-(1.fwdarw.3)-Xyl-(1.fwdarw.4)-[Glc-(1.fwdarw.3)]-Rha-(1.fwdarw.2)-[R8-(.fwdarw.4)]-Fuc- wherein R8 is 5-O-[5-O-Ara/Api-3,5-dihydroxy-6-methyl-octanoyl]-3,5-dihydroxy-6-methyl-octanoic acid), [0242] Api-(1.fwdarw.3)-Xyl-(1.fwdarw.4)-Rha-(1.fwdarw.2)-[R9-(.fwdarw.4)]-Fuc- wherein R9 is 5-O-[5-O-Ara/Api-3,5-dihydroxy-6-methyl-octanoyl]-3,5-dihydroxy-6-methyl-octanoic acid), [0243] Xyl-(1.fwdarw.3)-Xyl-(1.fwdarw.4)-Rha-(1.fwdarw.2)-[R10-(.fwdarw.4)]-Fuc- wherein R10 is 5-O-[5-O-Ara/Api-3,5-dihydroxy-6-methyl-octanoyl]-3,5-dihydroxy-6-methyl-octanoic acid), [0244] Api-(1.fwdarw.3)-Xyl-(1.fwdarw.4)-Rha-(1.fwdarw.2)-[R11-(.fwdarw.3)]-Fuc- wherein R11 is 5-O-[5-O-Ara/Api-3,5-dihydroxy-6-methyl-octanoyl]-3,5-dihydroxy-6-methyl-octanoic acid), [0245] Xyl-(1.fwdarw.3)-Xyl-(1.fwdarw.4)-Rha-(1.fwdarw.2)-[R12-(.fwdarw.3)]-Fuc- wherein R12 is 5-O-[5-O-Ara/Api-3,5-dihydroxy-6-methyl-octanoyl]-3,5-dihydroxy-6-methyl-octanoic acid) Glc-(1.fwdarw.3)-[Glc-(1.fwdarw.6)]-Gal-, and [0246] derivatives thereof.
[0247] Typically, saponins that enhance cytotoxicity of toxins, when cells are contacted with the saponin and the toxin, have one or two of such mono- or polysaccharide chains bound to the aglycone. Preferred are those saponins selected for derivatisation that comprise two saccharide chains. An overview of particularly preferred saponins for subjecting such saponins to single, double or triple derivatisation, preferably single or double derivatisation when endosomal escape enhancing activity should be preserved to sufficiently high extent, is provided in Table A1. Of course, structural variants of such saponins are equally suitable for derivatisation according to the invention, if such saponins display endosomal escape enhancing activity towards e.g. a toxin, a BNA, etc.
[0248] An embodiment is the saponin derivative according to the invention, wherein the saponin derivative comprises the first saccharide chain and comprises the second saccharide chain, wherein the first saccharide chain comprises more than one saccharide moiety and the second saccharide chain comprises more than one saccharide moiety, and wherein the aglycone core structure is quillaic acid or gypsogenin, wherein one, two or three, preferably one or two, of: [0249] i. an aldehyde group in the aglycone core structure has been derivatised, [0250] ii. the first saccharide chain comprises a carboxyl group of a glucuronic acid moiety which has been derivatised, and [0251] iii. the second saccharide chain comprises at least one acetoxy (Me(CO)O—) group which has been derivatised.
The following Summary illustrates suitable derivatisations:
TABLE-US-00001 Functional Group Derivatisation Aldehyde hydrazone formation with hydrazides (chemoselective, imine formation with amines reversible) chemoselective reversible oxime formation with hydroxylamines Acetoxy deacetylation resulting in alcohol (chemoselective) Carboxylic acid amide formation with amines or ester (chemoselective) formation with alcohols (after activation)
According to the invention, a saponin can comprise three derivatisations and still display sufficiently high endosomal escape enhancing activity. In particular when the decrease in cytotoxicity and/or haemolytic activity is larger than the (potential or apparent) decrease of the ability to potentiate the effect and activity of an effector molecule inside a cell, such as a toxin or a BNA in a tumor cell contacted with the effector molecule and the derivatised saponin. Thus, the invention provides derivatised saponin comprising a single, two or three derivatisations, when the aldehyde group of the aglycone is considered, when the carboxyl group in the glucuronic acid unit in the polysaccharide at C-3 is considered, if present, and when the acetyl group in the polysaccharide chain at C-28 is considered, if present. Preferred is a saponin derivative having one or two modifications. Suitable for improving endosomal escape of an effector molecule such as a toxin or a BNA are for example saponin derivatives with a free aldehyde group and with one or two derivatisations in saccharide chains. As said before, also saponin derivatives with a derivatised aldehyde group are equally suitable. Such saponin derivatives that do not have the free aldehyde group in the aglycone upon the derivatisation, still display sufficient and efficient endosomal escape enhancing activity. Without wishing to be bound by any theory, as a result of the acidic conditions in the endosome and in the lysosome of (mammalian) cells such as human cells, an aldehyde group may again be formed inside the cell upon pH driven cleavage of the moiety initially bound to the aldehyde group of the saponin for providing the saponin derivative with derivatised aglycone at position C-23. An example of a saponin derivative with a modified aldehyde group which may be formed again in the endosome or lysosome, is a saponin derivative comprising a hydrazone bond which is formed between the carbonyl group of the aldehyde and for example a hydrazide moiety in a chemical group bound to the aglycone, such as N-ε-maleimidocaproic acid hydrazide (EMCH), or EMCH with mercaptoethanol bound to the maleimide group, forming a thio-ether bond. Examples of such saponin derivatives are provided in
[0252] An embodiment is the saponin derivative according to the invention, wherein the saponin derivative is a derivative of a saponin selected from the group of saponins consisting of: Quillaja bark saponin, dipsacoside B, saikosaponin A, saikosaponin D, macranthoidin A, esculentoside A, phytolaccagenin, aescinate, AS6.2, NP-005236, AMA-1, AMR, alpha-Hederin, NP-012672, NP-017777, NP-017778, NP-017774, NP-018110, NP-017772, NP-018109, NP-017888, NP-017889, NP-018108, SA1641, AE X55, NP-017674, NP-017810, AG1, NP-003881, NP-017676, NP-017677, NP-017706, NP-017705, NP-017773, NP-017775, SA1657, AG2, SO1861, GE1741, SO1542, SO1584, SO1658, SO1674, SO1832, SO1904, SO1862, QS-7, QS1861, QS-7 api, QS1862, QS-17, QS-18, QS-21 A-apio, QS-21 A-xylo, QS-21 B-apio, QS-21 B-xylo, beta-Aescin, Aescin Ia, Teaseed saponin I, Teaseedsaponin J, Assamsaponin F, Digitonin, Primula acid 1 and AS64R, stereoisomers thereof and combinations thereof, preferably the saponin derivative is selected from the group consisting of a QS-21 derivative, a SO1861 derivative, a SA1641 derivative and a GE1741 derivative, more preferably the saponin derivative is selected from the group consisting of a QS-21 derivative and a SO1861 derivative, most preferably the saponin derivative is SO1861 derivative. These saponins are essentially saponins displaying endosomal escape enhancing activity as established by the inventors, or that are structurally highly similar to saponins for which the endosomal escape enhancing activity has been established. Structural outline of these saponins is summarized in Table A1.
[0253] An embodiment is the saponin derivative according to the invention, wherein the saponin derivative is a derivative of the quillaic acid saponin or gypsogenin saponin which is represented by Molecule 1:
##STR00003##
wherein [0254] the first saccharide chain A.sub.1 represents hydrogen, a monosaccharide or a linear or branched oligosaccharide, preferably A.sub.1 represents a saccharide chain as defined here above for certain embodiments of the invention (list S1), more preferably A.sub.1 represents a saccharide chain as defined here above for certain embodiments of the invention (list S1) and A.sub.1 comprises or consists of a glucuronic acid moiety; [0255] the second saccharide chain A.sub.2 represents hydrogen, a monosaccharide or a linear or branched oligosaccharide, preferably A.sub.2 represents a saccharide chain as defined here above for certain embodiments of the invention (list S2), more preferably A.sub.2 represents a saccharide chain as defined here above for certain embodiments of the invention (list S2) and A.sub.2 comprises at least one acetoxy (Me(CO)O—) group, such as one, two, three or four acetoxy groups, preferably one, wherein at least one of A.sub.1 and A.sub.2 is not hydrogen, preferably both A.sub.1 and A.sub.2 are an oligosaccharide chain; [0256] and R is hydrogen in gypsogenin or hydroxyl in quillaic acid;
wherein the saponin derivative corresponds to the saponin represented by Molecule 1 wherein at least one of the following derivatisations is present: [0257] i. the aldehyde group at position C.sub.23 of the quillaic acid or gypsogenin has been derivatised; [0258] ii. the carboxyl group of a glucuronic acid moiety of A.sub.1, when A.sub.1 represents a saccharide chain as defined here above for certain embodiments of the invention (list S1) and A.sub.1 comprises or consists of a glucuronic acid moiety, has been derivatised; and [0259] iii. one or more, preferably all, of acetoxy group(s) of one saccharide moiety or of two or more saccharide moieties of A.sub.2, when A.sub.2 represents a saccharide chain as defined here above for certain embodiments of the invention (list S2) and A.sub.2 comprises at least one acetoxy group, has/have been derivatised.
[0260] An embodiment is the saponin derivative according to the invention, wherein A.sub.1 represents a saccharide chain as defined here above for certain embodiments of the invention (list S1) and comprises or consists of a glucuronic acid moiety and wherein the carboxyl group of a glucuronic acid moiety of A.sub.1 has been derivatised and/or wherein A.sub.2 represents a saccharide chain as defined here above for certain embodiments of the invention (list S2) and A.sub.2 comprises at least one acetoxy group and wherein at least one acetoxy group of A.sub.2 has been derivatised.
[0261] An embodiment is the saponin derivative according to the invention, wherein the saponin represented by Molecule 1 is a bidesmosidic triterpene saponin.
[0262] An embodiment is the saponin derivative according to the invention, wherein the saponin derivative corresponds to the saponin represented by Molecule 1 wherein at least one of the following derivatisations is present, preferably one or two of the following derivatisations is present, more preferably one: [0263] i. the aldehyde group at position C.sub.23 of the quillaic acid or gypsogenin has been derivatised by; [0264] reduction to an alcohol; [0265] transformation into a hydrazone bond, preferably through reaction with a hydrazide; [0266] ii. the carboxyl group of a glucuronic acid moiety of A.sub.1, when A.sub.1 represents a saccharide chain as defined here above for certain embodiments of the invention (list S1) and A.sub.1 comprises or consists of a glucuronic acid moiety, has been derivatised by transformation into an amide bond, preferably through reaction with an amine; and [0267] iii. one or more, preferably all, of acetoxy group(s) of one saccharide moiety or of two or more saccharide moieties of A.sub.2, when A.sub.2 represents a saccharide chain as defined here above for certain embodiments of the invention (list S2) and A.sub.2 comprises at least one acetoxy group, has/have been derivatised by transformation into a hydroxyl group (HO—) by deacetylation.
[0268] An embodiment is the saponin derivative according to the invention, wherein the saponin derivative corresponds to the saponin represented by Molecule 1 wherein at least one of the following derivatisations is present, preferably one or two of the following derivatisations is present, more preferably one: [0269] i. the aldehyde group at position C.sub.23 of the quillaic acid or gypsogenin has been derivatised by; [0270] reduction to an alcohol; [0271] transformation into a hydrazone bond through reaction with N-ε-maleimidocaproic acid hydrazide (EMCH), therewith providing a saponin-Ald-EMCH such as a SO1861-Ald-EMCH or a QS-21-Ald-EMCH, wherein the maleimide group of the EMCH is optionally derivatised by formation of a thio-ether bond with mercaptoethanol; [0272] transformation into a hydrazone bond through reaction with N-[β-maleimidopropionic acid] hydrazide (BMPH) wherein the maleimide group of the BMPH is optionally derivatised by formation of a thio-ether bond with mercaptoethanol; or [0273] transformation into a hydrazone bond through reaction with N-[κ-maleimidoundecanoic acid] hydrazide (KMUH) wherein the maleimide group of the KMUH is optionally derivatised by formation of a thio-ether bond with mercaptoethanol; [0274] ii. the carboxyl group of a glucuronic acid moiety of A.sub.1, when A.sub.1 represents a saccharide chain as defined here above for certain embodiments of the invention (list S1) and A.sub.1 comprises or consists of a glucuronic acid moiety, has been derivatised by transformation into an amide bond through reaction with 2-amino-2-methyl-1,3-propanediol (AMPD) or N-(2-aminoethyl)maleimide (AEM), therewith providing a saponin-Glu-AMPD such as a QS-21-Glu-AMPD or a SO1861-Glu-AMPD or a saponin-Glu-AEM such as a QS-21-Glu-AEM or a SO1861-Glu-AEM; and [0275] iii. one or more, preferably all, of acetoxy group(s) of one saccharide moiety or of two or more saccharide moieties of A.sub.2, when A.sub.2 represents a saccharide chain as defined here above for certain embodiments of the invention (list S2) and A.sub.2 comprises at least one acetoxy group, has/have been derivatised by transformation into a hydroxyl group (HO—) by deacetylation.
[0276] An embodiment is the saponin derivative according to the invention, wherein is Gal-(1.fwdarw.2)-[Xyl-(1.fwdarw.3)]-GlcA and/or A.sub.2 is Glc-(1.fwdarw.3)-Xyl-(1.fwdarw.4)-Rha-(1.fwdarw.2)-[Xyl-(1.fwdarw.3)-4-OAc-Qui-(1.fwdarw.4)]-Fuc, preferably the saponin represented by Molecule 1 is 3-O-beta-D-galactopyranosyl-(1.fwdarw.2)-[beta-D-xylopyranosyl-(1.fwdarw.3)]-beta-D-glucuronopyranosyl quillaic acid 28-O-beta-D-glucopyranosyl-(1.fwdarw.3)-beta-D-xylopyranosyl-(1.fwdarw.4)-alpha-L-rhamnopyranosyl-(1.fwdarw.2)-[beta-D-xylopyranosyl-(1.fwdarw.3)-4OAc-beta-D-quinovopyranosyl-(1.fwdarw.4)]-beta-D-fucopyranoside, more preferably SO1861, GE1741, SA1641 and/or QS-21, most preferably SO1861.
[0277] An embodiment is the saponin derivative according to the invention, wherein the saponin derivative is selected from the group consisting of derivatives of: SO1861, SA1657, GE1741, SA1641, QS-21, QS-21A, QS-21 A-api, QS-21 A-xyl, QS-21B, QS-21 B-api, QS-21 B-xyl, QS-7-xyl, QS-7-api, QS-17-api, QS-17-xyl, QS1861, QS1862, Quillaja saponin, Saponinum album, QS-18, Quil-A, Gyp1, gypsoside A, AG1, AG2, SO1542, SO1584, SO1658, SO1674, SO1832, SO1862, SO1904, stereoisomers thereof and combinations thereof, preferably the saponin derivative is selected from the group consisting of a SO1861 derivative, a GE1741 derivative, a SA1641 derivative, a QS-21 derivative, and a combination thereof, more preferably the saponin derivative is a SO1861 derivative or a QS21 derivative, most preferably, the saponin derivative is a SO1861 derivative.
[0278] An embodiment is the saponin derivative according to the invention, wherein the saponin derivative is a SO1861 derivative comprising a single derivatisation, wherein the single derivatisation is transformation of a carboxyl group of a glucuronic acid moiety of SO1861, such as by binding 1-[Bis(dimethylamino)methylene]-1H-1,2,3-triazolo[4,5-b]pyridinium 3-oxid hexafluorophosphate (HATU) to the carboxyl group of the glucuronic acid moiety of SO1861 (See
##STR00004##
or wherein the saponin derivative is a SO1861 derivative represented by Molecule 3, which represents a SO1861 derivative comprising an aldehyde group at indicated position C.sub.23 of the quillaic acid aglycone core structure which has been derivatised by transformation into a hydrazone bond through reaction with N-ε-maleimidocaproic acid hydrazide (EMCH) wherein the maleimide group of the EMCH is derivatised with mercaptoethanol therewith forming a thio-ether bond:
##STR00005##
The saponin represented by Molecule 2 is suitable for application as a precursor for a conjugation reaction with a further molecule comprising a free sulfhydryl group. The maleimide group of the saponin derivative displayed as Molecule 2 can form a thio-ether bond with such a free sulfhydryl group. For example, the saponin derivative of Molecule 2 can be covalently coupled to a peptide or a protein which comprises a free sulfhydryl group such as a cysteine with a free sulfhydryl group. Such a protein is for example an antibody or a binding fragment or binding domain thereof, such as Fab, scFv, single domain antibody, such as V.sub.HH, for example camelid V.sub.H. Application of the saponin derivative of Molecule 2 in a coupling reaction with e.g. an antibody that comprises a free sulfhydryl group, provides a conjugate for targeted delivery of the saponin to and inside a cell, when the antibody (or the binding domain or fragment thereof) is an antibody for specific binding to a target cell surface molecule such as a receptor, e.g. as present on a tumor cell. Preferably, the saponin derivative is coupled to an antibody or V.sub.HH capable of binding to a tumor-cell specific surface molecule such as a receptor, e.g. HER2, EGFR, CD71.
[0279] An embodiment is the saponin derivative according to the invention, with the proviso that the saponin derivative is not a SO1861 derivative comprising a single derivatisation, wherein the single derivatisation is transformation of the carboxyl group of a glucuronic acid moiety of SO1861 by reaction of 1-[Bis(dimethylamino)methylene]-1H-1,2,3-triazolo[4,5-b]pyridinium 3-oxid hexafluorophosphate (HATU) with the carboxyl group of the glucuronic acid moiety of SO1861, or wherein the saponin derivative is a SO1861 derivative represented by Molecule 2, which represents a SO1861 derivative comprising an aldehyde group at indicated position C.sub.23 of the quillaic acid aglycone core structure which has been derivatised by transformation into a hydrazone bond through reaction with N-ε-maleimidocaproic acid hydrazide (EMCH):
##STR00006##
[0280] An embodiment is the saponin derivative according to the invention, wherein [0281] i. the saponin derivative comprises an aglycone core structure wherein the aglycone core structure comprises an aldehyde group which has been derivatised by: [0282] reduction to an alcohol; [0283] transformation into a hydrazone bond through reaction with N-ε-maleimidocaproic acid hydrazide (EMCH) wherein the maleimide group of the EMCH is optionally derivatised by formation of a thio-ether bond with mercaptoethanol; [0284] transformation into a hydrazone bond through reaction with N-[β-maleimidopropionic acid] hydrazide (BMPH) wherein the maleimide group of the BMPH is optionally derivatised by formation of a thio-ether bond with mercaptoethanol; or [0285] transformation into a hydrazone bond through reaction with N-[κ-maleimidoundecanoic acid] hydrazide (KMUH) wherein the maleimide group of the KMUH is optionally derivatised by formation of a thio-ether bond with mercaptoethanol; [0286] ii. the first saccharide chain comprises a carboxyl group, preferably a carboxyl group of a glucuronic acid moiety, which has been derivatised by transformation into an amide bond through reaction with 2-amino-2-methyl-1,3-propanediol (AMPD) or N-(2-aminoethyl)maleimide (AEM); [0287] iii. the second saccharide chain comprises an acetoxy group (Me(CO)O—) which has been derivatised by transformation into a hydroxyl group (HO—) by deacetylation; or [0288] iv. the saponin derivative comprises any combination of two or three derivatisations i., ii. and iii., preferably any combination of two derivatisations i., ii. and iii.;
preferably, the saponin derivative comprises an aglycone core structure wherein the aglycone core structure comprises an aldehyde group which has been derivatised by transformation into a hydrazone bond through reaction with EMCH wherein the maleimide group of the EMCH is optionally derivatised by formation of a thio-ether bond with mercaptoethanol.
[0289] An embodiment is the saponin derivative according to the invention, wherein the saponin derivative comprises an aglycone core structure wherein the aglycone core structure comprises an aldehyde group and wherein the first saccharide chain comprises a carboxyl group, preferably a carboxyl group of a glucuronic acid moiety, which has been derivatised by transformation into an amide bond through reaction with N-(2-aminoethyl)maleimide (AEM).
[0290] An embodiment is the saponin derivative according to the invention, with the proviso that when the aldehyde group in the aglycone core structure is derivatised by transformation into a hydrazone bond through reaction with N-ε-maleimidocaproic acid hydrazide (EMCH) and the saponin is SO1861, at least one of the glucuronic acid and the acetoxy group (Me(CO)O—) is also derivatised, and with the proviso that when the saponin is SO1861 and the carboxyl group of the glucuronic acid moiety of SO1861 is derivatised by reaction of 1-[Bis(dimethylamino)methylene]-1H-1,2,3-triazolo[4,5-b]pyridinium 3-oxid hexafluorophosphate (HATU) with the carboxyl group of the glucuronic acid moiety of SO1861, at least one of the aldehyde group and the acetoxy group (Me(CO)O—) is also modified.
[0291] An embodiment is the saponin derivative according to the invention, with the proviso that when the aldehyde group in the aglycone core structure of the saponin derivative is derivatised through reaction with EMCH and the saponin is SO1861, at least one of the glucuronic acid and the acetoxy group (Me(CO)O—) is also derivatised, and with the proviso that when the saponin is SO1861 and the carboxyl group of the glucuronic acid moiety of SO1861 is derivatised by bound HATU, at least one of the aldehyde group and the acetoxy group (Me(CO)O—) is also derivatised.
[0292] An embodiment, referred to herein as embodiment D1, is the saponin derivative according to the invention, characterized in that the saponin derivative is not SA1641 wherein the aglycone core structure comprises an aldehyde group which has been derivatised by transformation, such as via reductive amination, into an amine by reaction with a compound of formula (A1):
##STR00007##
That is to say, the embodiment, referred to herein as embodiment D1, is the saponin derivative according to the invention, characterized in that it is not a result of a reaction between SA1641 and a compound of formula (A1). Thus, the embodiment D1 is the saponin derivative according to the invention, characterized in that it is not a result of the coupling via reductive amination of at least one SA1641 molecule to a compound of formula (A1).
[0293] An embodiment, referred to herein as embodiment D2, is the saponin derivative according to the invention, characterized in that the saponin derivative is not a saponin, in particular SO1861, wherein the aglycone core structure comprises an aldehyde group which has been derivatised by transformation into a hydrazone bond through reaction with N-ε-maleimidocaproic acid hydrazide (EMCH) wherein the maleimide group of the EMCH is optionally derivatised by formation of a thio-ether bond with a thiol, and wherein no other derivatisations are present on the saponin, preferably characterized in that the saponin derivative is not a saponin, in particular SO1861, wherein the aglycone core structure comprises an aldehyde group which has been derivatised by transformation into a hydrazone bond through reaction with N-ε-maleimidocaproic acid hydrazide (EMCH) wherein the maleimide group of the EMCH is optionally derivatised by formation of a thio-ether bond with a thiol.
[0294] An embodiment, referred to herein as embodiment D3, is the saponin derivative according to the invention, characterized in that the saponin derivative is not a saponin, in particular SO1861, wherein the aglycone core structure comprises an aldehyde group which has been derivatised by transformation into a hydrazone bond through reaction with N-ε-maleimidocaproic acid hydrazide (EMCH) wherein the maleimide group of the EMCH is derivatised by formation of a thio-ether bond with a thiol selected from one, preferably all of: [0295] mercaptoethanol, [0296] a poly(amidoamine) dendrimer having an ethylenediamine core which has been derivatised with at least 2-iminothiolane, [0297] a conjugate of cyanin-3 and a poly(amidoamine) dendrimer having an ethylenediamine core which has further been derivatised with at least 2-iminothiolane, [0298] a G4 dendron which has been derivatised with at least 2-iminothiolane, [0299] a conjugate of cyanin-5 and a G4 dendron which has further been derivatised with at least 2-iminothiolane, [0300] bovine serum albumin (BSA), and [0301] a peptide with the sequence SESDDAMFCDAMDESDSK [SEQ ID NO: 1]
[0302] and wherein no other derivatisations are present on the saponin. As will be understood by the person skilled in the art, the expression “G4 dendron” should be interpreted to mean a compound of formula (A2):
##STR00008##
[0303] An embodiment, referred to herein as embodiment D4, is the saponin derivative according to the invention, characterized in that the saponin derivative is not a saponin, in particular SO1861, wherein a carboxyl group has been derivatised by transformation into an amide by reaction with an optionally further derivatised conjugate of cyanin-3 and a poly(amidoamine) dendrimer having an ethylenediamine core, and wherein no other derivatisations are present on the saponin, preferably characterized in that the saponin derivative is not a saponin, in particular SO1861, wherein a carboxyl group has been derivatised by transformation into an amide by reaction with an optionally further derivatised conjugate of cyanin-3 and a poly(amidoamine) dendrimer having an ethylenediamine core.
[0304] An embodiment, referred to herein as embodiment D5, is the saponin derivative according to the invention, characterized in that the saponin derivative is not a saponin, in particular SO1861, wherein the aglycone core structure comprises an aldehyde group which has been derivatised by transformation, such as via reductive amination, into an amine by reaction with a conjugate of cyanin-3 and a poly(amidoamine) dendrimer having an ethylenediamine core, and wherein no other derivatisations are present on the saponin, preferably characterized in that the saponin derivative is not a saponin, in particular SO1861, wherein the aglycone core structure comprises an aldehyde group which has been derivatised by transformation, such as via reductive amination, into an amine by reaction with a conjugate of cyanin-3 and a poly(amidoamine) dendrimer having an ethylenediamine core.
[0305] An embodiment, referred to herein as embodiment D6, is the saponin derivative according to the invention, characterized in that the saponin derivative does not comprise a toxin, a micro RNA, or a polynucleotide encoding a protein, preferably in that the saponin derivative does not comprise a pharmaceutically active substance, such as a toxin, a drug, a polypeptide and/or a polynucleotide, more preferably characterized in that the saponin derivative does not comprise an effector molecule.
[0306] An embodiment, referred to herein as embodiment D7, is the saponin derivative according to the invention, characterized in that the saponin derivative does not comprise a polymeric or oligomeric structure, selected from the group consisting of [0307] poly- or oligo(amines), such as polyethylenimine and poly(amidoamine), [0308] polyethylene glycol, [0309] poly- or oligo(esters), such as poly(lactids), [0310] poly(lactams), [0311] polylactide-co-glycolide copolymers, [0312] poly- or oligosaccharides, such as cyclodextrin and polydextrose, [0313] poly- or oligo(amino acids), such as proteins and peptides, and [0314] nucleic acids and analogues thereof, such as DNA, RNA, LNA (locked nucleic acid) and PNA (peptide nucleic acid); [0315] preferably characterized in that the saponin derivative does not comprise a polymeric or oligomeric structure which is a structurally ordered formation such as a polymer, oligomer, dendrimer, dendronized polymer, or dendronized oligomer or it is an assembled polymeric structure such as a hydrogel, microgel, nanogel, stabilized polymeric micelle or liposome, more preferably characterized in that the saponin derivative does not comprise a polymeric or oligomeric structure.
[0316] An embodiment, referred to herein as embodiment D8, is the saponin derivative according to the invention, characterized in that the saponin derivative does not comprise a molecular structure built up chiefly or completely from at least 2 equal or similar units bonded together.
[0317] An embodiment, referred to herein as embodiment D9, is the saponin derivative according to the invention, characterized in that the saponin derivative is not the compound of formula (A3), which is a reaction product of SO1861 and N-[(Dimethylamino)-1H-1,2,3-triazolo-[4,5-b]pyridin-1-ylmethylene]-N-methylmethanaminium hexafluorophosphate N-oxide (HATU):
##STR00009##
preferably characterized in that the saponin derivative is not an activated ester. See
[0318] An embodiment, referred to herein as embodiment D10, is the saponin derivative according to the invention, characterized in that the saponin derivative is not a saponin, in particular SO1861 wherein a carboxyl group has been derivatised by transformation into an amide bond or an ester bond, and wherein no other derivatisations are present on the saponin, preferably characterized in that the saponin derivative is not a saponin, in particular SO1861 wherein a carboxyl group has been derivatised by transformation into an amide bond or an ester bond.
[0319] An embodiment, referred to herein as embodiment D11, is the saponin derivative according to the invention, characterized in that the saponin derivative does not comprise a dianthin moiety.
[0320] A preferred embodiment, referred to herein as embodiment D12, is the saponin derivative according to the invention, characterized in that the saponin derivative comprises a single saponin moiety.
[0321] A preferred embodiment, referred to herein as embodiment D13, is the saponin derivative according to the invention, characterized in that the saponin derivative has a molecular weight of less than 2500 g/mol, preferably less than 2300 g/mol, more preferably less than 2150 g/mol.
[0322] A preferred embodiment, referred to herein as embodiment D14, is the saponin derivative according to the invention, characterized in that the saponin derivatisation has a molecular weight of less than 400 g/mol, preferably less than 300 g/mol, more preferably less than 270 g/mol. The molecular weight of the saponin derivatisation corresponds to the molecular weight of the saponin derivative exclusive of the aglycone core and the one (for monodesmosidic saponins) or two (for bidesmosidic saponins) glycon (sugar) chains. The skilled person will understand that in case the saponin derivative has a lower molecular weight than its corresponding underivatised saponin (e.g. as is the case for SO1861-Ac—OH which corresponds to SO1861 derivatised by deacetylation), the saponin derivatisation does not bring any increase in molecular weight and thus complies with the requirement that that the saponin derivatisation has a molecular weight of less than 400 g/mol, preferably less than 300 g/mol, more preferably less than 270 g/mol of embodiment D14.
[0323] As will be understood by the skilled person, embodiments D1-D14 may be combined amongst each other, as well as with the other embodiments described in the present application. For example, in embodiments of the invention the following combinations of embodiments D1-D14 are provided: [0324] D12 and one or more of D1-D11, D13; [0325] D13 and one or more of D1-D12; [0326] D12, D13 and one or more of D1-D11; [0327] D1, D2, D10 and D12; [0328] D1, D3, D7, D9 and preferably D13; or [0329] D3, D9, D12 and D13.
It will be understood by the skilled person that these combinations of embodiments D1-D14 may again be combined with other embodiments according to the invention for example, and preferably, with embodiment D14.
[0330] A particularly preferred embodiment corresponds to a combination of embodiments D3, D9, D12 and one or both of D13 and D14. In other words, a particularly preferred embodiment is the saponin derivative according to the invention wherein the saponin derivative comprises a single saponin moiety, wherein the saponin derivative has a molecular weight of less than 2500 g/mol, preferably less than 2300 g/mol, more preferably less than 2150 g/mol, and wherein the saponin derivative [0331] is not a saponin, in particular SO1861, wherein the aglycone core structure comprises an aldehyde group which has been derivatised by transformation into a hydrazone bond through reaction with N-ε-maleimidocaproic acid hydrazide (EMCH) wherein the maleimide group of the EMCH is optionally derivatised by formation of a thio-ether bond with mercaptoethanol, and wherein preferably no other derivatisations are present on the saponin; and [0332] is not an activated ester which is the reaction product of SO1861 and N-[(Dimethylamino)-1H-1,2,3-triazolo-[4,5-b]pyridin-1-ylmethylene]-N-methylmethanaminium hexafluorophosphate N-oxide (HATU).
[0333] A second aspect of the invention relates to a first pharmaceutical composition comprising the saponin derivative according to the invention and optionally a pharmaceutically acceptable excipient and/or diluent.
[0334] An embodiment is the first pharmaceutical composition according to the invention comprising a saponin derivative according to the invention, preferably a pharmaceutically acceptable diluent, and further comprising: [0335] a pharmaceutically acceptable salt, preferably a pharmaceutically acceptable inorganic salt, such as an ammonium, calcium, copper, iron, magnesium, manganese, potassium, sodium, strontium or zinc salt, preferably NaCl; and/or [0336] a pharmaceutically acceptable buffer system, such as a phosphate, a borate, a citrate, a carbonate, a histidine, a lactate, a tromethamine, a gluconate, an aspartate, a glutamate, a tartarate, a succinate, a malate, a fumarate, an acetate and/or a ketoglutarate containing buffer system.
[0337] An embodiment is the first pharmaceutical composition according to the invention comprising a saponin derivative according to the invention and a pharmaceutically acceptable diluent, preferably water, wherein the composition is liquid at a temperature of 25° C. and has a pH within the range of 2-11, preferably within the range of 4-9, more preferably within the range of 6-8.
[0338] An embodiment is the first pharmaceutical composition according to the invention comprising a saponin derivative according to the invention and a pharmaceutically acceptable diluent, preferably water, wherein the composition is liquid at a temperature of 25° C. and wherein the concentration of the saponin derivative is within the range of 10-12 to 1 mol/l, preferably within the range of 10.sup.−9 to 0.1 mol/l, more preferably within the range of 10.sup.−6 to 0.1 mol/l.
[0339] Typically, such a first pharmaceutical composition is suitable for use in combination with e.g. an ADC or an AOC. For example, the first pharmaceutical composition is administered to a patient in need of administration of the ADC or AOC, before the ADC or AOC is administered, together with the ADC or AOC, or (shortly) after administration of the ADC or the AOC to the patient in need of such ADC or AOC therapy. For example, the first pharmaceutical composition is mixed with a pharmaceutical composition comprising the ADC or the AOC, and a suitable dose of the mixture obtained is administered to a patient in need of ADC or AOC therapy. According to the invention, the saponin derivative comprised by the first pharmaceutical composition enhances the efficacy and potency of the effector molecule comprised by such an ADC or AOC, when the saponin derivative and the ADC or AOC co-localize inside a target cell such as a tumor cell. Under influence of the saponin derivative, the effector molecule is released into the cytosol of the target cell to a higher extent, compared to contacting the same cells with the same dose of ADC or AOC in the absence of the saponin derivative. Thus, similar efficacy can be obtained at lower ADC or AOC dose when the effector molecule co-localizes inside a target cell together with the saponin derivative of the first pharmaceutical composition, compared to the dose required to achieve the same efficacy in the absence of the saponin derivative inside the cell where the ADC or the AOC comprising the effector molecule is delivered.
[0340] An embodiment is the first pharmaceutical composition of the invention, wherein the saponin derivative is the saponin derivative represented by Molecule 2:
##STR00010##
or SO1861 derivative comprising a single derivatisation, wherein the single derivatisation is transformation of the carboxyl group of the glucuronic acid moiety of SO1861 by reaction of 1-[Bis(dimethylamino)methylene]-1H-1,2,3-triazolo[4,5-b]pyridinium 3-oxid hexafluorophosphate (HATU) with the carboxyl group of the glucuronic acid moiety of SO1861, or the saponin derivative is the saponin derivative represented by Molecule 3:
##STR00011##
[0341] A third aspect of the invention relates to a pharmaceutical combination comprising: [0342] the first pharmaceutical composition of the invention; and [0343] a second pharmaceutical composition comprising any one or more of an antibody-toxin conjugate, a receptor-ligand—toxin conjugate, an antibody-drug conjugate, a receptor-ligand—drug conjugate, an antibody-oligonucleotide conjugate or a receptor-ligand—oligonucleotide conjugate, and optionally comprising a pharmaceutically acceptable excipient and/or diluent.
[0344] A fourth aspect of the invention relates to a third pharmaceutical composition comprising the saponin derivative of the invention and further comprising any one or more of: an antibody-toxin conjugate, a receptor-ligand—toxin conjugate, an antibody-drug conjugate, a receptor-ligand—drug conjugate, an antibody-nucleic acid conjugate or a receptor-ligand—nucleic acid conjugate, and optionally comprising a pharmaceutically acceptable excipient and/or diluent.
[0345] An embodiment is the pharmaceutical combination of the invention or the third pharmaceutical composition of the invention, wherein the second pharmaceutical composition or the third pharmaceutical composition comprises any one or more of an antibody-drug conjugate, a receptor-ligand—drug conjugate, an antibody-oligonucleotide conjugate or a receptor-ligand—oligonucleotide conjugate, wherein the drug is for example a toxin such as saporin and dianthin, and wherein the oligonucleotide is for example an siRNA or a BNA, for example for gene silencing of apolipoprotein B or HSP27.
[0346] An embodiment is the pharmaceutical combination of the invention or the third pharmaceutical composition of the invention, wherein the saponin derivative is a saponin derivative selected from the group consisting of derivatives of: SO1861, SA1657, GE1741, SA1641, QS-21, QS-21A, QS-21 A-api, QS-21 A-xyl, QS-21B, QS-21 B-api, QS-21 B-xyl, QS-7-xyl, QS-7-api, QS-17-api, QS-17-xyl, QS1861, QS1862, Quillaja saponin, Saponinum album, QS-18, Quil-A, Gyp1, gypsoside A, AG1, AG2, SO1542, SO1584, SO1658, SO1674, SO1832, SO1862, SO1904, stereoisomers thereof and combinations thereof, preferably the saponin derivative is selected from the group consisting of a SO1861 derivative, a GE1741 derivative, a SA1641 derivative, a QS-21 derivative, and a combination thereof, more preferably the saponin derivative is a SO1861 derivative or a QS21 derivative, more preferably, the saponin derivative is a SO1861 derivative, even more preferably the saponin derivative represented by Molecule 2 or Molecule 3.
[0347] An embodiment is the third pharmaceutical composition according to the invention comprising a saponin derivative according to the invention, preferably a pharmaceutically acceptable diluent, and further comprising: [0348] a pharmaceutically acceptable salt, preferably a pharmaceutically acceptable inorganic salt, such as an ammonium, calcium, copper, iron, magnesium, manganese, potassium, sodium, strontium or zinc salt, preferably NaCl; and/or [0349] a pharmaceutically acceptable buffer system, such as a phosphate, a borate, a citrate, a carbonate, a histidine, a lactate, a tromethamine, a gluconate, an aspartate, a glutamate, a tartarate, a succinate, a malate, a fumarate, an acetate and/or a ketoglutarate containing buffer system.
[0350] An embodiment is the third pharmaceutical composition according to the invention comprising a saponin derivative according to the invention and a pharmaceutically acceptable diluent, preferably water, wherein the composition is liquid at a temperature of 25° C. and has a pH within the range of 2-11, preferably within the range of 4-9, more preferably within the range of 6-8.
[0351] An embodiment is the third pharmaceutical composition according to the invention comprising a saponin derivative according to the invention and a pharmaceutically acceptable diluent, preferably water, wherein the composition is liquid at a temperature of 25° C. and wherein the concentration of the saponin derivative is within the range of 10-12 to 1 mol/l, preferably within the range of 10.sup.−9 to 0.1 mol/l, more preferably within the range of 10.sup.−6 to 0.1 mol/l.
A fifth aspect of the invention relates to the first pharmaceutical composition of the invention, the pharmaceutical combination of the invention, or the third pharmaceutical composition of the invention, for use as a medicament. In preferred embodiments there is provided the first pharmaceutical composition of the invention wherein the saponin derivative comprises, preferably consists of SO1861-Ald-EMCH, SO1861-Ald-EMCH-mercaptoethanol, SO1861-L-N.sub.3 or SO1861-Glu-HATU, the pharmaceutical combination of the invention wherein the saponin derivative comprises, preferably consists of SO1861-Ald-EMCH, SO1861-Ald-EMCH-mercaptoethanol, SO1861-L-N.sub.3 or SO1861-Glu-HATU, or the third pharmaceutical composition of the invention wherein the saponin derivative comprises, preferably consists of SO1861-Ald-EMCH, SO1861-Ald-EMCH-mercaptoethanol, SO1861-L-N.sub.3 or SO1861-Glu-HATU, for use as a medicament.
[0352] In another aspect of the invention there is provided the saponin derivative as described herein, preferably SO1861-Ald-EMCH, SO1861-Ald-EMCH-mercaptoethanol, SO1861-L-N.sub.3 or SO1861-Glu-HATU for use as a medicament.
[0353] A sixth aspect of the invention relates to the first pharmaceutical composition of the invention, the pharmaceutical combination of the invention, or the third pharmaceutical composition of the invention, for use in the treatment or prophylaxis of a cancer, an infectious disease, viral infection, hypercholesterolemia, primary hyperoxaluria, haemophilia A, haemophilia B, alpha-1 antitrypsin related liver disease, acute hepatic porphyria, transthyretin-mediated amyloidosis, or an auto-immune disease. In preferred embodiments there is provided the first pharmaceutical composition of the invention wherein the saponin derivative comprises, preferably consists of SO1861-Ald-EMCH, SO1861-Ald-EMCH-mercaptoethanol, SO1861-L-N.sub.3 or SO1861-Glu-HATU, the pharmaceutical combination of the invention wherein the saponin derivative comprises, preferably consists of SO1861-Ald-EMCH, SO1861-Ald-EMCH-mercaptoethanol, SO1861-L-N.sub.3 or SO1861-Glu-HATU, or the third pharmaceutical composition of the invention wherein the saponin derivative comprises, preferably consists of SO1861-Ald-EMCH, SO1861-Ald-EMCH-mercaptoethanol, SO1861-L-N.sub.3 or SO1861-Glu-HATU, for use in the treatment or prophylaxis of a cancer, an infectious disease, viral infection, hypercholesterolemia, primary hyperoxaluria, haemophilia A, haemophilia B, alpha-1 antitrypsin related liver disease, acute hepatic porphyria, transthyretin-mediated amyloidosis, or an auto-immune disease.
[0354] A seventh aspect of the invention relates to an in vitro or ex vivo method for transferring a molecule from outside a cell to inside said cell, preferably into the cytosol of said cell, comprising the steps of: [0355] a) providing a cell; [0356] b) providing the molecule for transferring from outside the cell into the cell provided in step a); [0357] c) providing a saponin derivative according to the invention; [0358] d) contacting the cell of step a) in vitro or ex vivo with the molecule of step b) and the saponin derivative of step c), therewith establishing the transfer of the molecule from outside the cell into said cell.
[0359] An embodiment is the method of the invention, wherein the cell is a human cell such as a T-cell, an NK-cell, a tumor cell, and/or wherein the molecule of step b) is any one of: an antibody-drug conjugate, a receptor-ligand—drug conjugate, an antibody-oligonucleotide conjugate or a receptor-ligand-oligonucleotide conjugate, wherein the drug is for example a toxin and wherein the oligonucleotide is for example an siRNA or a BNA, and/or wherein the saponin derivative is selected from the group consisting of derivatives of: SO1861, SA1657, GE1741, SA1641, QS-21, QS-21A, QS-21 A-api, QS-21 A-xyl, QS-21B, QS-21 B-api, QS-21 B-xyl, QS-7-xyl, QS-7-api, QS-17-api, QS-17-xyl, QS1861, QS1862, Quillaja saponin, Saponinum album, QS-18, Quil-A, Gyp1, gypsoside A, AG1, AG2, SO1542, SO1584, SO1658, SO1674, SO1832, SO1862, SO1904, stereoisomers thereof and combinations thereof, preferably the saponin derivative is selected from the group consisting of a SO1861 derivative, a GE1741 derivative, a SA1641 derivative, a QS-21 derivative, and a combination thereof, more preferably the saponin derivative is a SO1861 derivative or a QS21 derivative, most preferably, the saponin derivative is a SO1861 derivative; or wherein the saponin derivative is a SO1861 derivative comprising a single derivatisation, wherein the single derivatisation is transformation of a carboxyl group of a glucuronic acid moiety of SO1861 into an amide bound through reaction with an amine, such as by binding 1-[Bis(dimethylamino)methylene]-1H-1,2,3-triazolo[4,5-b]pyridinium 3-oxid hexafluorophosphate (HATU) to the carboxyl group of the glucuronic acid moiety of SO1861 or by binding (benzotriazol-1-yloxy)tris(dimethylamino)phosphonium hexafluorophosphate (BOP) to the carboxyl group of the glucuronic moiety of SO1861, or wherein the saponin derivative is a SO1861 derivative represented by Molecule 2, which represents a SO1861 derivative comprising an aldehyde group at indicated position C.sub.23 of the quillaic acid aglycone core structure which has been derivatised by transformation into a hydrazone bond through reaction with N-ε-maleimidocaproic acid hydrazide (EMCH):
##STR00012##
or wherein the saponin derivative is a SO1861 derivative represented by Molecule 3, which represents a SO1861 derivative comprising an aldehyde group at indicated position C.sub.23 of the quillaic acid aglycone core structure which has been derivatised by transformation into a hydrazone bond through reaction with N-ε-maleimidocaproic acid hydrazide (EMCH) wherein the maleimide group of the EMCH is derivatised with mercaptoethanol therewith forming a thio-ether bond:
##STR00013##
or the saponin derivative is a derivative with the proviso that the saponin derivative is not a SO1861 derivative comprising a single derivatisation, wherein the single derivatisation is transformation of the carboxyl group of a glucuronic acid moiety of SO1861 by reaction of 1-[Bis(dimethylamino)methylene]-1H-1,2,3-triazolo[4,5-b]pyridinium 3-oxid hexafluorophosphate (HATU) with the carboxyl group of the glucuronic acid moiety of SO1861, or wherein the saponin derivative is a SO1861 derivative represented by Molecule 2, which represents a SO1861 derivative comprising an aldehyde group at indicated position C.sub.23 of the quillaic acid aglycone core structure which has been derivatised by transformation into a hydrazone bond through reaction with N-ε-maleimidocaproic acid hydrazide (EMCH):
##STR00014##
or wherein the saponin derivative is a derivative wherein [0360] i. the saponin derivative comprises an aglycone core structure wherein the aglycone core structure comprises an aldehyde group which has been derivatised by: [0361] reduction to an alcohol; [0362] transformation into a hydrazone bond through reaction with N-ε-maleimidocaproic acid hydrazide (EMCH) wherein the maleimide group of the EMCH is optionally derivatised by formation of a thio-ether bond with mercaptoethanol; [0363] transformation into a hydrazone bond through reaction with N-[β-maleimidopropionic acid] hydrazide (BMPH) wherein the maleimide group of the BMPH is optionally derivatised by formation of a thio-ether bond with mercaptoethanol; or [0364] transformation into a hydrazone bond through reaction with N-[κ-maleimidoundecanoic acid] hydrazide (KMUH) wherein the maleimide group of the KMUH is optionally derivatised by formation of a thio-ether bond with mercaptoethanol; [0365] ii. the first saccharide chain comprises a carboxyl group, preferably a carboxyl group of a glucuronic acid moiety, which has been derivatised by transformation into an amide bond through reaction with 2-amino-2-methyl-1,3-propanediol (AMPD) or N-(2-aminoethyl)maleimide (AEM); [0366] iii. the second saccharide chain comprises an acetoxy group (Me(CO)O—) which has been derivatised by transformation into a hydroxyl group (HO—) by deacetylation; or [0367] iv. the saponin derivative comprises any combination of two or three derivatisations i., ii. and iii., preferably any combination of two derivatisations i., ii. and iii.;
preferably, the saponin derivative comprises an aglycone core structure wherein the aglycone core structure comprises an aldehyde group which has been derivatised by transformation into a hydrazone bond through reaction with EMCH wherein the maleimide group of the EMCH is optionally derivatised by formation of a thio-ether bond with mercaptoethanol; or wherein the saponin derivative comprises an aglycone core structure wherein the aglycone core structure comprises an aldehyde group and wherein the first saccharide chain comprises a carboxyl group, preferably a carboxyl group of a glucuronic acid moiety, which has been derivatised by transformation into an amide bond through reaction with N-(2-aminoethyl)maleimide (AEM); or wherein the saponin derivative is a derivative with the proviso that when the aldehyde group in the aglycone core structure is derivatised by transformation into a hydrazone bond through reaction with N-ε-maleimidocaproic acid hydrazide (EMCH) and the saponin is SO1861, at least one of the glucuronic acid and the acetoxy group (Me(CO)O—) is also derivatised, and with the proviso that when the saponin is SO1861 and the carboxyl group of the glucuronic acid moiety of SO1861 is derivatised by reaction of 1-[Bis(dimethylamino)methylene]-1H-1,2,3-triazolo[4,5-b]pyridinium 3-oxid hexafluorophosphate (HATU) with the carboxyl group of the glucuronic acid moiety of SO1861, at least one of the aldehyde group and the acetoxy group (Me(CO)O—) is also modified; or wherein the saponin is a derivative with the proviso that when the aldehyde group in the aglycone core structure of the saponin derivative is derivatised through reaction with EMCH and the saponin is SO1861, at least one of the glucuronic acid and the acetoxy group (Me(CO)O—) is also derivatised, and with the proviso that when the saponin is SO1861 and the carboxyl group of the glucuronic acid moiety of SO1861 is derivatised by bound HATU, at least one of the aldehyde group and the acetoxy group (Me(CO)O—) is also derivatised.
[0368] In particular embodiments the in vitro or ex vivo method for transferring a molecule from outside a cell to inside said cell, preferably into the cytosol of said cell as described herein is provided wherein the saponin derivative comprises, preferably consists of SO1861-Ald-EMCH, SO1861-Ald-EMCH-mercaptoethanol, SO1861-L-N.sub.3 or SO1861-Glu-HATU.
[0369] While the invention has been described in terms of several embodiments, it is contemplated that alternatives, modifications, permutations and equivalents thereof will become apparent to one having ordinary skill in the art upon reading the specification and upon study of the drawings. The invention is not limited in any way to the illustrated embodiments. Changes can be made without departing from the scope which is defined by the appended claims.
[0370] The present invention has been described above with reference to a number of exemplary embodiments. Modifications are possible, and are included in the scope of protection as defined in the appended claims. The invention is further illustrated by the following examples, which should not be interpreted as limiting the present invention in any way.
TABLE-US-00002 TABLE A1 Saponins displaying (late) endosomal/lysosomal escape enhancing activity, and saponins comprising a structure reminiscent to such saponins displaying (late) endosomal/lysosomal escape enhancing activity Carbohydrate Carbohydrate Aglycone substituent at the substituent at the Saponin Name core C-3beta-OH group C-28-OH group NP-005236 2alpha- GlcA- Glc/Gal- Hydroxyoleanolic acid AMA-1 16alpha- Glc- Rha-(1.fwdarw.2)-[Xyl-(1.fwdarw.4)]-Rha- Hydroxyoleanolic acid AMR 16alpha- Glc- Rha-(1.fwdarw.2)-[Ara-(1.fwdarw.3)-Xyl-(1.fwdarw.4)]-Rha- Hydroxyoleanolic acid alpha-Hederin Hederagenin (23- Rha-(1.fwdarw.2)-Ara- — Hydroxyoleanolic acid) NP-012672 16alpha,23- Ara/Xyl-(1.fwdarw.4)-Rha/Fuc- Ara/Xyl- Dihydroxyoleanolic (1.fwdarw.2)-Glc/Gal-(1.fwdarw.2)- acid Rha/Fuc-(1.fwdarw.2)-GlcA- NP-017777 Gypsogenin Gal-(1.fwdarw.2)-[Xyl-(1.fwdarw.3)]-GlcA- Xyl-(1.fwdarw.4)-Rha-(1.fwdarw.2)-[R-(.fwdarw.4)]-Fuc- (R = 4E- Methoxycinnamic acid) NP-017778 Gypsogenin Gal-(1.fwdarw.2)-[Xyl-(1.fwdarw.3)]-GlcA- Xyl-(1.fwdarw.4)-Rha-(1.fwdarw.2)-[R-(.fwdarw.4)]-Fuc- (R = 4Z- Methoxycinnamic acid) NP-017774 Gypsogenin Gal-(1.fwdarw.2)-[Xyl-(1.fwdarw.3)]-GlcA- Xyl-(1.fwdarw.4)-[Gal-(1.fwdarw.3)]-Rha-(1.fwdarw.2)-4-OAc- Fuc- NP-018110.sup.c, Gypsogenin Gal-(1.fwdarw.2)-[Xyl-(1.fwdarw.3)]-GlcA- Xyl-(1.fwdarw.4)-[Glc-(1.fwdarw.3)]-Rha-(1.fwdarw.2)-3,4-di- NP-017772.sup.d OAc-Fuc- NP-018109 Gypsogenin Gal-(1.fwdarw.2)-[Xyl-(1.fwdarw.3)]-GlcA- Xyl-(1.fwdarw.4)-[Glc-(1.fwdarw.3)]-Rha-(1.fwdarw.2)-[R-(.fwdarw.4)]- 3-OAc-Fuc- (R = 4E-Methoxycinnamic acid) NP-017888 Gypsogenin Gal-(1.fwdarw.2)-[Xyl-(1.fwdarw.3)]-GlcA- Glc-(1.fwdarw.3)-Xyl-(1.fwdarw.4)-[Glc-(1.fwdarw.3)]-Rha- (1.fwdarw.2)-4-OAc-Fuc- NP-017889 Gypsogenin Gal-(1.fwdarw.2)-[Xyl-(1.fwdarw.3)]-GlcA- Glc-(1.fwdarw.3)-Xyl-(1.fwdarw.4)-Rha-(1.fwdarw.2)-4-OAc-Fuc- NP-018108 Gypsogenin Gal-(1.fwdarw.2)-[Xyl-(1.fwdarw.3)]-GlcA- Ara/Xyl-(1.fwdarw.3)-Ara/Xyl-(1.fwdarw.4)-Rha/Fuc- (1.fwdarw.2)-[4-OAc-Rha/Fuc-(1.fwdarw.4)]-Rha/Fuc- SA1641.sup.a, Gypsogenin Gal-(1.fwdarw.2)-[Xyl-(1.fwdarw.3)]-GlcA- Xyl-(1.fwdarw.3)-Xyl-(1.fwdarw.4)-Rha-(1.fwdarw.2)-[Qui- AE X55.sup.b (1.fwdarw.4)]-Fuc- NP-017674 Quillaic acid Gal-(1.fwdarw.2)-[Xyl-(1.fwdarw.3)]-GlcA- Api-(1.fwdarw.3)-Xyl-(1.fwdarw.4)-[Glc-(1-3)]-Rha- (1.fwdarw.2)-Fuc- NP-017810 Quillaic acid Gal-(1.fwdarw.2)-[Xyl-(1.fwdarw.3)]-GlcA- Xyl-(1.fwdarw.4)-[Gal-(1.fwdarw.3)]-Rha-(1.fwdarw.2)-Fuc- AG1 Quillaic acid Gal-(1.fwdarw.2)-[Xyl-(1.fwdarw.3)]-GlcA- Xyl-(1.fwdarw.4)-[Glc-(1.fwdarw.3)]-Rha-(1.fwdarw.2)-Fuc- NP-003881 Quillaic acid Gal-(1.fwdarw.2)-[Xyl-(1.fwdarw.3)]-GlcA- Ara/Xyl-(1.fwdarw.4)-Rha/Fuc-(1.fwdarw.4)-[Glc/Gal- (1.fwdarw.2)]-Fuc- NP-017676 Quillaic acid Gal-(1.fwdarw.2)-[Xyl-(1.fwdarw.3)]-GlcA- Api-(1.fwdarw.3)-Xyl-(1.fwdarw.4)-[Glc-(1.fwdarw.3)]-Rha- (1.fwdarw.2)-[R-(.fwdarw.4)]-Fuc- (R = 5-O-[5-O-Ara/Api-3,5-dihydroxy-6- methyl-octanoyl]-3,5-dihydroxy-6-methyl- octanoic acid) NP-017677 Quillaic acid Gal-(1.fwdarw.2)-[Xyl-(1.fwdarw.3)]-GlcA- Api-(1.fwdarw.3)-Xyl-(1.fwdarw.4)-Rha-(1.fwdarw.2)-[R-(.fwdarw.4)]- Fuc- (R = 5-O-[5-O-Ara/Api-3,5-dihydroxy-6- methyl-octanoyl]-3,5-dihydroxy-6-methyl- octanoic acid) NP-017706 Quillaic acid Gal-(1.fwdarw.2)-[Xyl-(1.fwdarw.3)]-GlcA- Api-(1.fwdarw.3)-Xyl-(1.fwdarw.4)-Rha-(1.fwdarw.2)-[Rha- (1.fwdarw.3)]-4-OAc-Fuc- NP-017705 Quillaic acid Gal-(1.fwdarw.2)-[Xyl-(1.fwdarw.3)]-GlcA- Api-(1.fwdarw.3)-Xyl-(1.fwdarw.4)-[Glc-(1.fwdarw.3)]-Rha- (1.fwdarw.2)-[Rha-(1.fwdarw.3)]-4-OAc-Fuc- NP-017773 Quillaic acid Gal-(1.fwdarw.2)-[Xyl-(1.fwdarw.3)]-GlcA- 6-OAc-Glc-(1.fwdarw.3)-Xyl-(1.fwdarw.4)-Rha-(1.fwdarw.2)-[3- OAc-Rha-(1.fwdarw.3)]-Fuc- NP-017775 Quillaic acid Gal-(1.fwdarw.2)-[Xyl-(1.fwdarw.3)]-GlcA- Glc-(1.fwdarw.3)-Xyl-(1.fwdarw.4)-Rha-(1.fwdarw.2)-[3-OAc-- Rha-(1.fwdarw.3)]-Fuc- SA1657 Quillaic acid Gal-(1.fwdarw.2)-[Xyl-(1.fwdarw.3)]-GlcA- Xyl-(1.fwdarw.3)-Xyl-(1.fwdarw.4)-Rha-(1.fwdarw.2)-[Qui- (1.fwdarw.4)]-Fuc- AG2 Quillaic acid Gal-(1.fwdarw.2)-[Xyl-(1.fwdarw.3)]-GlcA- Glc-(1.fwdarw.3)-[Xyl-(1.fwdarw.4)]-Rha-(1.fwdarw.2)-[Qui- (1.fwdarw.4)]-Fuc- SO1861 Quillaic acid Gal-(1.fwdarw.2)-[Xyl-(1.fwdarw.3)]-GlcA- Glc-(1.fwdarw.3)-Xyl-(1.fwdarw.4)-Rha-(1.fwdarw.2)-[Xyl-(1.fwdarw.3)- 4-OAc-Qui-(1.fwdarw.4)]-Fuc- GE1741 Quillaic acid Gal-(1.fwdarw.2)-[Xyl-(1.fwdarw.3)]-GlcA- Xyl-(1.fwdarw.3)-Xyl-(1.fwdarw.4)-Rha-(1.fwdarw.2)-[3,4-di-OAc- Qui-(1.fwdarw.4)]-Fuc- SO1542 Quillaic acid Gal-(1.fwdarw.2)-[Xyl-(1.fwdarw.3)]-GlcA- Glc-(1.fwdarw.3)-[Xyl-(1.fwdarw.4)]-Rha-(1.fwdarw.2)-Fuc- SO1584 Quillaic acid Gal-(1.fwdarw.2)-[Xyl-(1.fwdarw.3)]-GlcA- 6-OAc-Glc-(1.fwdarw.3)-[Xyl-(1.fwdarw.4)]-Rha-(1.fwdarw.2)- Fuc- SO1658 Gypsogenin Gal-(1.fwdarw.2)-[Xyl-(1.fwdarw.3)]-GlcA- Glc-(1.fwdarw.3)-[Xyl-(1.fwdarw.3)-Xyl-(1.fwdarw.4)]-Rha- (1.fwdarw.2)-Fuc- SO1674 Quillaic acid Gal-(1.fwdarw.2)-[Xyl-(1.fwdarw.3)]-GlcA- Glc-(1.fwdarw.3)-[Xyl-(1.fwdarw.3)-Xyl-(1.fwdarw.4)]-Rha- (1.fwdarw.2)-Fuc- SO1832 Quillaic acid Gal-(1.fwdarw.2)-[Xyl-(1.fwdarw.3)]-GlcA- Xyl-(1.fwdarw.3)-Xyl-(1.fwdarw.4)-Rha-(1.fwdarw.2)-[Xyl-(1.fwdarw.3)- 4-OAc-Qui-(1.fwdarw.4)]-Fuc- QS-7 (also Quillaic acid Gal-(1.fwdarw.2)-[Xyl-(1.fwdarw.3)]-GlcA- Api/Xyl-(1.fwdarw.3)-Xyl-(1.fwdarw.4)-[Glc-(1.fwdarw.3)]-Rha- referred to (1.fwdarw.2)-[Rha-(1.fwdarw.3)]-4OAc-Fuc- as QS1861) QS-7 api (also Quillaic acid Gal-(1.fwdarw.2)-[Xyl-(1.fwdarw.3)]-GlcA- Api-(1.fwdarw.3)-Xyl-(1.fwdarw.4)-[Glc-(1.fwdarw.3)]-Rha- referred to as (1.fwdarw.2)-[Rha-(1.fwdarw.3)]-4OAc-Fuc- QS1862) QS-17 Quillaic acid Gal-(1.fwdarw.2)-[Xyl-(1.fwdarw.3)]-GlcA- Api/Xyl-(1.fwdarw.3)-Xyl-(1.fwdarw.4)-[Glc-(1.fwdarw.3)]-Rha- (1.fwdarw.2)-[R-(.fwdarw.4)]-Fuc- (R = 5-O-[5-O-Rha-(1.fwdarw.2)-Ara/Api-3,5- dihydroxy-6-methyl-octanoyl]-3,5-dihydroxy- 6-methyl-octanoic acid) QS-18 Quillaic acid Gal-(1.fwdarw.2)-[Xyl-(1.fwdarw.3)]-GlcA- Api/Xyl-(1.fwdarw.3)-Xyl-(1.fwdarw.4)-[Glc-(1.fwdarw.3)]-Rha- (1.fwdarw.2)-[R-(.fwdarw.4)]-Fuc- (R = 5-O-[5-O-Ara/Api-3,5-dihydroxy-6- methyl-octanoyl]-3,5-dihydroxy-6-methyl- octanoic acid) QS-21 A-apio Quillaic acid Gal-(1.fwdarw.2)-[Xyl-(1.fwdarw.3)]-GlcA- Api-(1.fwdarw.3)-Xyl-(1.fwdarw.4)-Rha-(1.fwdarw.2)-[R-(.fwdarw.4)]- Fuc- (R = 5-O-[5-O-Ara/Api-3,5-dihydroxy-6- methyl-octanoyl]-3,5-dihydroxy-6-methyl- octanoic acid) QS-21 A-xylo Quillaic acid Gal-(1.fwdarw.2)-[Xyl-(1.fwdarw.3)]-GlcA- Xyl-(1.fwdarw.3)-Xyl-(1.fwdarw.4)-Rha-(1.fwdarw.2)-[R-(.fwdarw.4)]- Fuc- (R = 5-O-[5-O-Ara/Api-3,5-dihydroxy-6- methyl-octanoyl]-3,5-dihydroxy-6-methyl- octanoic acid) QS-21 B-apio Quillaic acid Gal-(1.fwdarw.2)-[Xyl-(1.fwdarw.3)]-GlcA- Api-(1.fwdarw.3)-Xyl-(1.fwdarw.4)-Rha-(1.fwdarw.2)-[R-(.fwdarw.3)]- Fuc- (R = 5-O-[5-O-Ara/Api-3,5-dihydroxy-6- methyl-octanoyl]-3,5-dihydroxy-6-methyl- octanoic acid) QS-21 B-xylo Quillaic acid Gal-(1.fwdarw.2)-[Xyl-(1.fwdarw.3)]-GlcA- Xyl-(1.fwdarw.3)-Xyl-(1.fwdarw.4)-Rha-(1.fwdarw.2)-[R-(.fwdarw.3)]- Fuc- (R = 5-O-[5-O-Ara/Api-3,5-dihydroxy-6- methyl-octanoyl]-3,5-dihydroxy-6-methyl- octanoic acid) beta-Aescin Protoaescigenin- Glc-(1.fwdarw.2)-[Glc-(1.fwdarw.4)]-GlcA- — (described: Aescin Ia) 21(2-methylbut-2- enoate)-22-acetat Teaseed saponin I 23-Oxo- Glc-(1.fwdarw.2)-Ara-(1.fwdarw.3)-[Gal- — barringtogenol C - (1.fwdarw.2)]-GlcA- 21,22-bis(2- methylbut-2-enoate) Teaseedsaponin J 23-Oxo- Xyl-(1.fwdarw.2)-Ara-(1.fwdarw.3)-[Gal- — barringtogenol C - (1.fwdarw.2)]-GlcA- 21,22-bis(2- methylbut-2-enoate) Assamsaponin F 23-Oxo- Glc-(1.fwdarw.2)-Ara-(1.fwdarw.3)-[Gal- — barringtogenol C - (1.fwdarw.2)]-GlcA- 21(2-methylbut-2- enoate)-16,22- diacetat Digitonin Digitogenin Glc-(1.fwdarw.3)-Gal-(1.fwdarw.2)-[Xyl- — (1.fwdarw.3)]-Glc-(1.fwdarw.4)-Gal- Primula acid 1 3,16,28- Rha-(1.fwdarw.2)-Gal-(1.fwdarw.3)-[Glc- — Trihydroxyoleanan- (1.fwdarw.2)]-GlcA- 12-en AS64R Gypsogenic acid — Glc-(1.fwdarw.3)-[Glc-(1.fwdarw.6)]-Gal- Carbohydrate substituent at the C-23-OH group AS6.2 Gypsogenic acid Gal- Glc-(1.fwdarw.3)-[Glc-(1.fwdarw.6)]-Gal- .sup.a,bDifferent names refer to different isolates of the same structure .sup.c,dDifferent names refer to different isolates of the same structure
Examples and Exemplary Embodiments
Materials:
[0371] SO1861, SO1832, SO1862 (isomer) and SO1904 were isolated and purified by Analyticon Discovery GmbH from raw plant extract obtained from Saponaria officinalis L. QS21(pure), QS18 (fraction), QS17 (fraction), QS7 (fraction) QS21 (fraction) were purchased from Desert King International, San Diego. Trastuzumab (Tras, Herceptin®, Roche), Cetuximab (Cet, Erbitux®, Merck KGaA) were purchased from pharmacy. EGFdianthin was produced from E. coli according to standard procedures. Cetuximab-saporin conjugates were produced and purchased from Advanced Targeting Systems (San Diego, CA). Tris(2-carboxyethyl)phosphine hydrochloride (TCEP, 98%, Sigma-Aldrich), 5,5-Dithiobis(2-nitrobenzoic acid) (DTNB, Ellman's reagent, 99%, Sigma-Aldrich), Zeba™ Spin Desalting Columns (2 mL, Thermo-Fisher), NuPAGE™ 4-12% Bis-Tris Protein Gels (Thermo-Fisher), NuPAGE™ MES SDS Running Buffer (Thermo-Fisher), Novex™ Sharp Pre-stained Protein Standard (Thermo-Fisher), PageBlue™ Protein Staining Solution (Thermo-Fischer), Pierce™ BCA Protein Assay Kit (Thermo-Fisher), N-Ethylmaleimide (NEM, 98%, Sigma-Aldrich), 1,4-Dithiothreitol (DTT, 98%, Sigma-Aldrich), Sephadex G25 (GE Healthcare), Sephadex G50 M (GE Healthcare), Superdex 200P (GE Healthcare), Isopropyl alcohol (IPA, 99.6%, VWR), Tris(hydroxymethyl)aminomethane (Tris, 99%, Sigma-Aldrich), Tris(hydroxymethyl)aminomethane hydrochloride (Tris.HCL, Sigma-Aldrich), L-Histidine (99%, Sigma-Aldrich), D-(+)-Trehalose dehydrate (99%, Sigma-Aldrich), Polyethylene glycol sorbitan monolaurate (TWEEN 20, Sigma-Aldrich), Dulbecco's Phosphate-Buffered Saline (DPBS, Thermo-Fisher), Guanidine hydrochloride (99%, Sigma-Aldrich), Ethylenediaminetetraacetic acid disodium salt dihydrate (EDTA-Na2, 99%, Sigma-Aldrich), sterile filters 0.2 μm and 0.45 μm (Sartorius), Succinimidyl 4-(N-maleimidomethyl)cyclohexane-1-carboxylate (SMCC, Thermo-Fisher), Vivaspin T4 and T15 concentrator (Sartorius), Superdex 200PG (GE Healthcare), Tetra(ethylene glycol) succinimidyl 3-(2-pyridyldithio)propionate (PEG4-SPDP, Thermo-Fisher), [0-(7-Azabenzotriazol-1-yl)-N,N,N,N-tetramethyluronium-hexafluorphosphat] (HATU, 97%, Sigma-Aldrich), Dimethyl sulfoxide (DMSO, 99%, Sigma-Aldrich), N-(2-Aminoethyl)maleimide trifluoroacetate salt (AEM, 98%, Sigma-Aldrich), L-Cysteine (98.5%, Sigma-Aldrich), deionized water (DI) was freshly taken from Ultrapure Lab Water Systems (MilliQ, Merck), Nickel-nitrilotriacetic acid agarose (Ni-NTA agarose, Protino), Glycine (99.5%, VWR), 5,5-Dithiobis(2-nitrobenzoic acid (Ellman's reagent, DTNB, 98%, Sigma-Aldrich), S-Acetylmercaptosuccinic anhydride Fluorescein (SAMSA reagent, Invitrogen) Sodium bicarbonate (99.7%, Sigma-Aldrich), Sodium carbonate (99.9%, Sigma-Aldrich), PD MiniTrap desalting columns with Sephadex G-25 resin (GE Healthcare), PD10 G25 desalting column (GE Healthcare), Zeba Spin Desalting Columns in 0.5, 2, 5, and 10 mL (Thermo-Fisher), Vivaspin Centrifugal Filters T4 10 kDa MWCO, T4 100 kDa MWCO, and T15 (Sartorius), Biosep s3000 aSEC column (Phenomenex), Vivacell Ultrafiltration Units 10 and 30 kDa MWCO (Sartorius), Nalgene Rapid-Flow filter (Thermo-Fisher).
Abbreviations
[0372] AEM: N-(2-Aminoethyl)maleimide trifluoroacetate salt [0373] AMPD: 2-Amino-2-methyl-1,3-propanediol [0374] BOP: (Benzotriazol-1-yloxy)tris(dimethylamino)phosphonium hexafluorophosphate [0375] DIPEA: N,N-diisopropylethylamine [0376] DMF: N,N-dimethylformamide [0377] EMCH.TFA: N-(ε-maleimidocaproic acid) hydrazide, trifluoroacetic acid salt [0378] HATU: 1-[Bis(dimethylamino)methylene]-1H-1,2,3-triazolo[4,5-b]pyridinium 3-oxid hexafluorophosphate [0379] Min: minutes [0380] NMM: 4-Methylmorpholine [0381] r.t.: retention time [0382] TCEP: tris(2-carboxyethyl)phosphine hydrochloride [0383] Temp: temperature [0384] TFA: trifluoroacetic acid
[0385] Analytical Methods
[0386] LC-MS Method 1
[0387] Apparatus: Waters IClass; Bin. Pump: UPIBSM, SM: UPISMFTN with SO; UPCMA, PDA: UPPDATC, 210-320 nm, SQD: ACQ-SQD2 ESI, mass ranges depending on the molecular weight of the product neg or neg/pos within in a range of 1500-2400 or 2000-3000; ELSD: gas pressure 40 psi, drift tube temp: 50° C.; column: Acquity C18, 50×2.1 mm, 1.7 μm Temp: 60° C., Flow: 0.6 mL/min,
[0388] Gradient Depending on the Polarity of the Product: [0389] At0=2% A, t5.0 min=50% A, t6.0 min=98% A [0390] Bt0=2% A, t5.0 min=98% A, t6.0 min=98% A [0391] Post time: 1.0 min, Eluent A: acetonitrile, Eluent B: 10 mM ammonium bicarbonate in water (pH=9.5).
[0392] LC-MS Method 2, .sup.2
[0393] Apparatus: Waters IClass; Bin. Pump: UPIBSM, SM: UPISMFTN with SO; UPCMA, PDA: UPPDATC, 210-320 nm, SQD: ACQ-SQD2 ESI, mass ranges depending on the molecular weight of the product: pos/neg 100-800 or neg 2000-3000; ELSD: gas pressure 40 psi, drift tube temp: 50° C.; column: Waters XSelect™ CSH C18, 50×2.1 mm, 2.5 μm, Temp: 25° C., Flow: 0.5 mL/min, Gradient: t0min=5% A, t2.0 min=98% A, t2.7 min=98% A, Posttime: 0.3 min, Eluent A: acetonitrile, Eluent B: 10 mM ammonium bicarbonate in water (pH=9.5).
[0394] LC-MS Method 3
[0395] Apparatus: Waters IClass; Bin. Pump: UPIBSM, SM: UPISMFTN with SO; UPCMA, PDA: UPPDATC, 210-320 nm, SQD: ACQ-SQD2 ESI, mass ranges depending on the molecular weight of the product pos/neg 105-800, 500-1200 or 1500-2500; ELSD: gas pressure 40 psi, drift tube temp: 50° C.; column: Waters XSelect™ CSH C18, 50×2.1 mm, 2.5 μm, Temp: 40° C., Flow: 0.5 mL/min, Gradient: t0min=5% A, t2.0 min=98% A, t2.7 min=98% A, Posttime: 0.3 min, Eluent A: 0.1% formic acid in acetonitrile, Eluent B: 0.1% formic acid in water.
[0396] LC-MS Method 4
[0397] Apparatus: Waters IClass; Bin. Pump: UPIBSM, SM: UPISMFTN with SO; UPCMA, PDA: UPPDATC, 210-320 nm, SQD: ACQ-SQD2 ESI, mass ranges depending on the molecular weight of the product: pos/neg 100-800 or neg 2000-3000; ELSD: gas pressure 40 psi, drift tube temp: 50° C. column: Waters Acquity Shield RP18, 50×2.1 mm, 1.7 μm, Temp: 25° C., Flow: 0.5 mL/min, Gradient: t0min=5% A, t2.0 min=98% A, t2.7 min=98% A, Posttime: 0.3 min, Eluent A: acetonitrile, Eluent B: 10 mM ammonium bicarbonate in water (pH=9.5).
[0398] Preparative Methods
[0399] Preparative MP-LC Method 1, [0400] Instrument type: Reveleris™ prep MPLC; column: Waters XSelect™ CSH C18 (145×25 mm, 10 μm); [0401] Flow: 40 mL/min; Column temp: room temperature; Eluent A: 10 mM ammoniumbicarbonate in water pH=9.0); Eluent B: 99% acetonitrile+1% 10 mM ammoniumbicarbonate in water; Gradient: [0402] .sup.At0min=5% B, t1 min=5% B, t2 min=10% B, t17 min=50% B, t18 min=100% B, t23 min=100% B [0403] .sup.Bt0min=5% B, t1 min=5% B, t2 min=20% B, t17 min=60% B, t18 min=100% B, t23 min=100% B; [0404] Detection UV: 210, 235, 254 nm and ELSD.
[0405] Preparative MP-LC Method 2 [0406] Instrument type: Reveleris™ prep MPLC; Column: Phenomenex LUNA C18(3) (150×25 mm, 10 μm); Flow: 40 mL/min; Column temp: room temperature; Eluent A: 0.1% (v/v) Formic acid in water, Eluent B: 0.1% (v/v) Formic acid in acetonitrile; Gradient: [0407] .sup.At0min=5% B, t1 min=5% B, t2 min=20% B, t17 min=60% B, t18 min=100% B, t23 min=100% B [0408] .sup.Bt0min=2% B, t1 min=2% B, t2 min=2% B, t17 min=30% B, t18 min=100% B, t23 min=100% B [0409] .sup.Ct0min=5% B, t1 min=5% B, t2 min=10% B, t17 min=50% B, t18 min=100% B, t23 min=100% B [0410] .sup.Dt0 min=5% B, t1 min=5% B, t2 min=5% B, t17 min=40% B, t18 min=100% B, t23 min=100% B; [0411] Detection UV: 210, 235, 254 nm and ELSD.
[0412] Preparative LC-MS Method 3
[0413] MS instrument type: Agilent Technologies G6130B Quadrupole; HPLC instrument type: Agilent Technologies 1290 preparative LC; Column: Waters XSelect™ CSH (C18, 150×19 mm, 10 μm); Flow: 25 ml/min; Column temp: room temperature; Eluent A: 100% acetonitrile; Eluent B: 10 mM ammonium bicarbonate in water pH=9.0; Gradient: [0414] .sup.At0=20% A, t2.5 min=20% A, t11 min=60% A, t13 min=100% A, t17 min=100% A [0415] .sup.Bt0=5% A, t2.5 min=5% A, t11 min=40% A, t13 min=100% A, t17 min=100% A; [0416] Detection: DAD (210 nm); Detection: MSD (ESI pos/neg) mass range: 100-800; Fraction collection based on DAD.
[0417] Preparative LC-MS Method 4
[0418] MS instrument type: Agilent Technologies G6130B Quadrupole; HPLC instrument type: Agilent Technologies 1290 preparative LC; Column: Waters XBridge Protein (C4, 150×19 mm, 10 μm); Flow: 25 ml/min; Column temp: room temperature; Eluent A: 100% acetonitrile; Eluent B: 10 mM ammonium bicarbonate in water pH=9.0; Gradient: [0419] .sup.At0=2% A, t2.5 min=2% A, t11 min=30% A, t13 min=100% A, t17 min=100% A [0420] .sup.Bt0=10% A, t2.5 min=10% A, t11 min=50% A, t13 min=100% A, t17 min=100% A [0421] .sup.Ct0=5% A, t2.5 min=5% A, t11 min=40% A, t13 min=100% A, t17 min=100% A; [0422] Detection: DAD (210 nm); Detection: MSD (ESI pos/neg) mass range: 100-800; Fraction collection based on DAD
[0423] Flash Chromatography
[0424] Grace Reveleris X2® C-815 Flash; Solvent delivery system: 3-piston pump with auto-priming, 4 independent channels with up to 4 solvents in a single run, auto-switches lines when solvent depletes; maximum pump flow rate 250 mL/min; maximum pressure 50 bar (725 psi); Detection: UV 200-400 nm, combination of up to 4 UV signals and scan of entire UV range, ELSD; Column sizes: 4-330 g on instrument, luer type, 750 g up to 3000 g with optional holder.
Example 1: Synthesis of Saponin Derivatives
[0425] The following modified SO1861 saponins, i.e. saponin derivatives, were synthesized based on the naturally occurring SO1861, as summarized in Table A2:
TABLE-US-00003 TABLE A2 overview of the synthesized modified SO1861 (SO1861 derivatives): Number of Molecule Derivatised derivatised Saponin derivative No. group groups Type of derivatisation SO1861-Ald-EMCH 2 aldehyde 1 Transformation of the aglycone core aldehyde group into a hydrazone bond through reaction with N-ε-maleimidocaproic acid hydrazide (EMCH) (Molecule 2). See FIG. 60. SO1861-Ald-EMCH- 3 aldehyde 1 Transformation of the aglycone core aldehyde group into a hydrazone bond mercaptoethanol through reaction with EMCH which has been derivatised by formation of a or thio-ether bond with mercaptoethanol (Molecule 3). SO1861-Ald-EMCH- blocked SO1861-Glu-AMPD 3A Glucuronic acid 1 Transformation of the carboxyl group of the glucuronic acid unit in the first saccharide chain bound to C.sub.3 of the aglycone core structure of the saponin into an amide bond through reaction with 2-amino-2-methyl-1,3-propanediol (AMPD). See FIG. 1. SO1861-Ald-OH 6 Aldehyde 1 Reduction of the aglycone core aldehyde group into an alcohol (treatment with NaBH.sub.4 (4)). See FIG. 2. SO1861-Ac—OH 8 Acetoxy 1 Transformation of the acetoxy (Me(CO)O—) group in the second saccharide chain bound to C.sub.28 of the aglycone core structure of the saponin into a hydroxyl group (HO—) by deacetylation. See FIG. 3. SO1861-(Ald-OH)- 9 Aldehyde 2 Reduction of the aglycone core aldehyde group into an alcohol and (Glu-AMPD) Glucuronic acid transformation of the carboxyl group of the glucuronic acid unit in the first saccharide chain bound to C.sub.3 of the aglycone core structure of the saponin into an amide bond through reaction with AMPD. See FIG. 4. SO1861-(Ald-OH)- 10 Aldehyde 2 Reduction of the aglycone core aldehyde group into an alcohol and (Ac—OH) Acetoxy transformation of the acetoxy (Me(CO)O—) group in the second saccharide chain bound to C.sub.28 of the aglycone core structure of the saponin into a hydroxyl group (HO—) by deacetylation. See FIG. 5. SO1861-(Ac—OH)- 11 Acetoxy 2 Transformation of the acetoxy (Me(CO)O—) group in the second saccharide (Glu-AMPD) Glucuronic acid chain bound to C.sub.28 of the aglycone core structure of the saponin into a hydroxyl group (HO—) by deacetylation and transformation of the carboxyl group of the glucuronic acid unit in the first saccharide chain bound to C.sub.3 of the aglycone core structure of the saponin into an amide bond through reaction with AMPD. See FIG. 6. SO1861-(Ald-OH)- 12 Aldehyde 3 Reduction of the aglycone core aldehyde group into an alcohol, (Ac—OH)-(Glu-AMPD) Acetoxy transformation of the acetoxy (Me(CO)O—) group in the second saccharide Glucuronic acid chain bound to C.sub.28 of the aglycone core structure of the saponin into a hydroxyl group (HO—) by deacetylation and transformation of the carboxyl group of the glucuronic acid unit in the first saccharide chain bound to C.sub.3 of the aglycone core structure of the saponin into an amide bond through reaction with AMPD. See FIG. 7. SO1861-(Ald-EMCH)- 14 Aldehyde 2 Transformation of the aglycone core aldehyde group into a hydrazone bond (Glu-AMPD) Glucuronic acid through reaction with EMCH and transformation of the carboxyl group of the glucuronic acid unit in the first saccharide chain bound to C.sub.3 of the aglycone core structure of the saponin into an amide bond through reaction with AMPD. See FIG. 8. SO1861-(Ald-EMCH)- 15 Acetoxy 2 Transformation of the aglycone core aldehyde group into a hydrazone bond (Ac—OH) Aldehyde through reaction with EMCH and transformation of the acetoxy (Me(CO)O—) group in the second saccharide chain bound to C.sub.28 of the aglycone core structure of the saponin into a hydroxyl group (HO—) by deacetylation. See FIG. 9. SO1861-(Ald-EMCH)- 16 Acetoxy 3 Transformation of the aglycone core aldehyde group into a hydrazone bond (Ac—OH)-(Glu-AMPD) Aldehyde through reaction with EMCH, transformation of the acetoxy (Me(CO)O—) group Glucuronic acid in the second saccharide chain bound to C.sub.28 of the aglycone core structure of the saponin into a hydroxyl group (HO—) by deacetylation and transformation of the carboxyl group of the glucuronic acid unit in the first saccharide chain bound to C.sub.3 of the aglycone core structure of the saponin into an amide bond through reaction with AMPD. See FIG. 10. SO1861-Glu-AEM or 18 Glucuronic acid 1 Transformation of the carboxyl group of the glucuronic acid unit in the first SPT-S-Mal saccharide chain bound to C.sub.3 of the aglycone core structure of the saponin into an amide bond through reaction with N-(2-aminoethyl)maleimide (AEM). See FIG. 11. SO1861-(Glu-AEM)- 19 Acetoxy 2 Transformation of the acetoxy (Me(CO)O—) group in the second saccharide (Ac—OH) Glucuronic acid chain bound to C.sub.28 of the aglycone core structure of the saponin into a hydroxyl group (HO—) by deacetylation and transformation of the carboxyl group of the glucuronic acid unit in the first saccharide chain bound to C.sub.3 of the aglycone core structure of the saponin into an amide bond through reaction with AEM. See FIG. 12. SO1861-(Glu-AEM)- 20 Aldehyde 2 Reduction of the aglycone core aldehyde group into an alcohol and (Ald-OH) Glucuronic acid transformation of the carboxyl group of the glucuronic acid unit in the first saccharide chain bound to C.sub.3 of the aglycone core structure of the saponin into an amide bond through reaction with AEM. See FIG. 13. SO1861-(Glu-AEM)- 21 Aldehyde 3 See FIG. 14. (Ald-OH)-(Ac—OH) Acetoxy Glucuronic acid SO1861-L-N.sub.3 23 Aldehyde 1 Transformation of the aglycone core aldehyde group into a hydrazone bond through reaction with molecule 22 (see FIG. 36) SO1861-L-NHS 25 Aldehyde 1 Transformation of the aglycone core aldehyde group into a hydrazone bond through reaction with first the molecule 22 (see FIG. 36), providing molecule 23, which has been derivatised by reaction with DBCO-NHS (molecule 24, see FIG. 37) SO1861-Glu-HATU 26 Glucuronic acid 1 Transformation of the carboxyl group of the glucuronic acid unit in the first saccharide chain bound to C.sub.3 of the aglycone core structure of the saponin through reaction with 1-[Bis(dimethylamino)methylene]-1H-1,2,3-triazolo[4,5- b]pyridinium 3-oxid hexafluorophosphate (See FIG. 59)
[0426] Referring to the following description of the syntheses of SO1861 derivatives, reference is made to Table A2 and to the drawings.
[0427] Synthesis of SO1861-Ald-EMCH (Molecule 2); See
[0428] SO1861 from Saponaria officinalis L (59 mg, 31.7 μmol) and EMCH (301 mg, 888 μmol) were placed in a round flask with stirrer and dissolved in 13 mL methanol. TFA (400 μL, cat.) was added to the solution and the reaction mixture was stirred for 3 h at 800 rpm and room temperature on a RCT B magnetic stirrer (IKA Labortechnik). After stirring for 3 h, the mix was diluted either with MilliQ water or PBS and dialyzed extensively for 24 h against either with MilliQ water or PBS using regenerated cellulose membrane tubes (Spectra/Por 7) with a MWCO of 1 kDa. After dialysis, the solution was lyophilized to obtain a white powder. Yield 62.4 mg (95%). Dried aliquots were further used for characterization via 1H NMR and MALDI-TOF-MS.
[0429] .sup.1H NMR (400 MHz, methanol-04) (SO1861): b=0.50-5.50 (m, saponin triterpenoid and sugar backbone protons), 9.43 (1H, s, aldehyde proton of saponin, H.sup.a).
[0430] .sup.1H NMR (400 MHz, methanol-04) (SO1861-Ald-EMCH, PBS workup): δ=0.50-5.50 (m, saponin triterpenoid and sugar backbone protons), 6.79 (2H, s, maleimide protons, H.sup.c), 7.62-7.68 (1H, m, hydrazone proton, H.sup.b).
[0431] MALDI-TOF-MS (RP mode): m/z 2124 Da ([M+K].sup.+, saponin-EMCH), m/z 2109 Da ([M+K].sup.+, SO1861-ALD-EMCH), m/z 2094 Da ([M+Na].sup.+, SO1861-ALD-EMCH). See
[0432] MALDI-TOF-MS (RN mode): m/z 2275 Da ([M−H].sup.−, saponin-EMCH conjugate), 2244 Da ([M−H].sup.−, saponin-EMCH conjugate), 2222 Da ([M−H].sup.−, saponin-EMCH conjugate), 2178 Da ([M−H].sup.−, saponin-EMCH conjugate), 2144 Da ([M−H].sup.−, saponin-EMCH conjugate), 2122 Da ([M−H].sup.−, saponin-EMCH conjugate), 2092 Da ([M−H].sup.−, saponin-EMCH conjugate), 2070 Da ([M−H].sup.−, SO1861-ALD-EMCH), 2038 Da ([M−H].sup.−, 501832-EMCH), 1936 Da ([M−H].sup.−, 501730-EMCH), 1861 Da ([M−H].sup.−, SO1861). The SO1861-ALD-EMCH is represented by Molecule 2 (Chemical Formula: C.sub.93H.sub.143N.sub.3O.sub.48, Exact Mass: 2069.88):
##STR00015##
[0433] For testing the pH dependent hydrolysis of the hydrazone bond, SO1861-Ald-EMCH was dissolved in an HCl solution at pH 3 and MALDI-TOF-MS spectra were recorded at two different points in time (
[0434] Synthesis of SO1861-Ald-EMCH-Mercaptoethanol (Molecule 3; SO1861-Ald-EMCH-Blocked); See
[0435] The maleimide group of SO1861-Ald-EMCH performs a rapid and specific Michael addition reaction with thiols when carried out in a pH range of 6.5-7.5.
[0436] To SO1861-Ald-EMCH (0.1 mg, 48 nmol) 200 μL mercaptoethanol (18 mg, 230 μmol) was added and the solution was shaken for 1 h at 800 rpm and room temperature on a ThermoMixer C (Eppendorf). After shaking for 1 h, the solution was diluted with methanol and dialyzed extensively for 4 h against methanol using regenerated cellulose membrane tubes (Spectra/Por 7) with a MWCO of 1 kDa. After dialysis the SO1861-Ald-EMCH-mercaptoethanol was provided (Molecule 3), an aliquot was taken out and analyzed via MALDI-TOF-MS.
[0437] MALDI-TOF-MS (RP mode): m/z 2193 Da ([M+K].sup.+, SO1861-Ald-EMCH-mercaptoethanol), m/z 2185 Da ([M+K].sup.+, SO1861-Ald-EMCH-mercaptoethanol), m/z 2170 Da ([M+Na].sup.+, SO1861-Ald-EMCH-mercaptoethanol). See
##STR00016##
[0438] Synthesis of SO1861-Glu-AMPD (Molecule 3A); See
[0439] SO1861 (28.8 mg, 0.015 mmol), AMPD (8.11 mg, 0.077 mmol) and HATU (17.6 mg, 0.046 mmol) were dissolved in a mixture of DMF (1.00 mL) and NMM (8.48 μL, 0.077 mmol). The reaction mixture was shaken for 1 min and left standing at room temperature. After 1 hour the reaction mixture was subjected to preparative MP-LC..sup.2 Fractions corresponding to the product were immediately pooled together, frozen and lyophilized overnight. Next, the product was repurified by using preparative LC-MS..sup.3 Fractions corresponding to the product were immediately pooled together, frozen and lyophilized overnight to give the title compound (20.2 mg, 67%) as a white fluffy solid. Purity based on LC-MS=93% (Chemical Formula: C.sub.87H.sub.139NO.sub.47, Exact Mass: 1949.85.
[0440] LRMS (m/z): 1949 [M−1].sup.1−
[0441] LC-MS r.t. (min): 2.45.sup.1B
[0442] Synthesis of SO1861-Ald-OH (molecule 6); see
[0443] SO1861 (20.0 mg, 10.7 μmol) was dissolved in methanol (1.00 mL). Next, sodium borohydride (4.06 mg, 0.107 mmol; NaBH.sub.4) was added. The reaction mixture was shaken for 1 min and left standing at room temperature. After 30 min the reaction mixture was diluted with water (0.50 mL) and submitted to preparative MP-LC..sup.2 Fractions corresponding to the product were immediately pooled together, frozen and lyophilized overnight to give the title compound (15.9 mg, 79%) as a white fluffy solid. Purity based on LC-MS 97% (Chemical Formula: C.sub.83H.sub.132O.sub.46, Exact Mass: 1864.80).
[0444] LRMS (m/z): 1865 [M−1].sup.1− (see
[0445] LC-MS r.t. (min): 1.951B
[0446] Synthesis of SO1861-Ac—OH (Molecule 8); See
[0447] To SO1861 (9.30 mg, 4.99 μmol) was added a solution of sodium hydroxide (2.00 mg, 0.050 mmol) in water (0.25 mL) and methanol (0.25 mL). The reaction mixture was shaken for 1 min and left standing at room temperature. After 2 hours the reaction mixture was subjected to preparative MP-LC..sup.2 Fractions corresponding to the product were immediately pooled together, frozen and lyophilized overnight to give the title compound (8.86 mg, 97%) as a white fluffy solid. Purity based on LC-MS=97% (Chemical Formula: C.sub.81H.sub.128O.sub.45, Exact Mass: 1820.77).
[0448] LRMS (m/z): 1820 [M−1].sup.1−
[0449] LC-MS r.t. (min): 1.831B
[0450] Synthesis of SO1861-(Ald-OH)-(Glu-AMPD) (Molecule 9); See
[0451] SO1861-Ald-OH (9.37 mg, 5.02 μmol), AMPD (2.64 mg, 0.025 mmol) and BOP (6.66 mg, 0.015 mmol) were dissolved in a mixture of DMF (0.50 mL) and NMM (5.52 μL, 0.050 mmol). The reaction mixture was shaken for 1 min and left standing at room temperature. After 1 hour the reaction mixture was subjected to preparative MP-LC..sup.2 Fractions corresponding to the product were immediately pooled together, frozen and lyophilized overnight to give the title compound (6.32 mg, 64%) as a white fluffy solid. Purity based on LC-MS=95% (Chemical Formula: C.sub.87H.sub.141NO.sub.47, Exact Mass: 1951.87. LRMS (m/z): 1952 [M−1].sup.1− (see
[0452] Synthesis of SO1861-(Ald-OH)—(Ac—OH) (Molecule 10); See
[0453] To SO1861-Ald-OH (26.8 mg, 0.014 mmol) was added a solution of sodium hydroxide (5.74 mg, 0.144 mmol) in water (0.50 mL) and methanol (0.50 mL). The reaction mixture was shaken for 1 min and left standing at room temperature. After 2 hours the reaction mixture was subjected to preparative MP-LC..sup.2 Fractions corresponding to the product were immediately pooled together, frozen and lyophilized overnight to give the title compound (24.2 mg, 92%) as a white fluffy solid. Purity based on LC-MS=98%. (Chemical Formula: C.sub.81H.sub.130O.sub.45, Exact Mass: 1822.79)
[0454] LRMS (m/z): 1822 [M−1].sup.1−
[0455] LC-MS r.t. (min): 1.811B
[0456] Synthesis of SO1861-(Ac—OH)-(Glu-AMPD) (Molecule 11); See
[0457] SO1861-Ac—OH (14.3 mg, 7.84 μmol), AMPD (4.12 mg, 0.039 mmol) and BOP (10.4 mg, 0.024 mmol) were dissolved in a mixture of DMF (0.50 mL) and NMM (8.62 μL, 0.078 mmol). The reaction mixture was shaken for 1 min and left standing at room temperature. After 1 hour the reaction mixture was subjected to preparative MP-LC..sup.2 Fractions corresponding to the product were immediately pooled together, frozen and lyophilized overnight. Next, the product was repurified by using first preparative MP-LC.sup.2, followed by preparative LC-MS..sup.3 Fractions corresponding to the product were immediately pooled together, frozen and lyophilized overnight to give the title compound (9.47 mg, 63%) as a white fluffy solid. Purity based on LC-MS=98% (Chemical Formula: C.sub.85H.sub.137NO.sub.46, Exact Mass: 1907.84).
[0458] LRMS (m/z): 1908 [M−1].sup.1−
[0459] LC-MS r.t. (min): 2.311B
[0460] Synthesis of SO1861-(Ald-OH)—(Ac—OH)-(Glu-AMPD) (Molecule 12); See
[0461] SO1861-(Ald-OH)—(Ac—OH) (8.57 mg, 4.70 μmol), AMPD (42.58 mg, 0.025 mmol) and BOP (6.57 mg, 0.015 mmol) were dissolved in a mixture of DMF (0.50 mL) and NMM (5.17 μL, 0.047 mmol). The reaction mixture was shaken for 1 min and left standing at room temperature. After 1 hour the reaction mixture was subjected to preparative MP-LC..sup.2 Fractions corresponding to the product were immediately pooled together, frozen and lyophilized overnight. Next, the product was repurified by using again preparative MP-LC.sup.2. Fractions corresponding to the product were immediately pooled together, frozen and lyophilized overnight to give the title compound (7.21 mg, 80%) as a white fluffy solid. Purity based on LC-MS=97.8% Chemical Formula: C.sub.85H.sub.139NO.sub.46, Exact Mass: 1909.86)
[0462] LRMS (m/z): 1910 [M−1].sup.1−
[0463] LC-MS r.t. (min): 2.211B
[0464] Synthesis of SO1861-(Ald-EMCH)-(Glu-AMPD) (Molecule 14); See
[0465] SO1861-Glu-AMPD (10.6 mg, 5.43 μmol) and EMCH.TFA (9.22 mg, 0.027 mmol) were dissolved in methanol (extra dry, 0.50 mL). Next, TFA (1.66 μL, 0.022 mmol) was added. The reaction mixture was shaken for 1 min and left standing at room temperature. After 2 hours the reaction mixture was subjected to preparative MP-LC..sup.1 Fractions corresponding to the product were immediately pooled together, frozen and lyophilized overnight. Next, the product was repurified by using by preparative LC-MS..sup.3 Fractions corresponding to the product were pooled together. The resulting solution was neutralized using formic acid, frozen and lyophilized overnight to give the title compound (2.61 mg, 22%) as a white fluffy solid. Purity based on LC-MS=95% (Chemical Formula: C.sub.97H.sub.152N.sub.4O.sub.49, Exact Mass: 2156.95).
[0466] LRMS (m/z): 2156 [M−1].sup.1−
[0467] LC-MS r.t. (min): 2.641B
[0468] Synthesis of SO1861-(Ald-EMCH)—(Ac—OH) (Molecule 15); See
[0469] SO1861-Ac—OH (9.05 mg, 4.97 μmol) and EMCH.TFA (8.43 mg, 0.025 mmol) were dissolved in methanol (extra dry, 0.50 mL). Next, TFA (1.52 μL, 0.022 mmol) was added. The reaction mixture was shaken for 1 min and left standing at room temperature. After 2 hours the reaction mixture was subjected to to preparative MP-LC..sup.1 Fractions corresponding to the product were immediately pooled together, frozen and lyophilized overnight to give the title compound (6.58 mg, 65%) as a white fluffy solid. Purity based on LC-MS=97% (Chemical Formula: C.sub.91H.sub.141N.sub.3O.sub.47, Exact Mass: 2027.87).
[0470] LRMS (m/z): 2028 [M−1].sup.1−
[0471] LC-MS r.t. (min): 1.961B
[0472] Synthesis of SO1861-(Ald-EMCH)—(Ac—OH)-(Glu-AMPD) (Molecule 16); See
[0473] SO1861-(Ac—OH)-(Glu-AMPD) (6.00 mg, 3.14 μmol) and EMCH.TFA (5.33 mg, 0.016 mmol) were dissolved in methanol (extra dry, 0.50 mL). Next, TFA (0.96 μL, 0.013 mmol) was added. The reaction mixture was shaken for 1 min and left standing at room temperature. After 2 hours the reaction mixture was subjected to to preparative MP-LC..sup.1 Fractions corresponding to the product were immediately pooled together, frozen and lyophilized overnight. Next, the product was repurified by using by preparative LC-MS..sup.3 Fractions corresponding to the product were pooled together. The resulting solution was neutralized using formic acid, frozen and lyophilized overnight to give the title compound (1.04 mg, 16%) as a white fluffy solid. Purity based on LC-MS=94% (Chemical Formula: C.sub.95H.sub.150N.sub.4O.sub.48, Exact Mass: 2114.94).
[0474] LRMS (m/z): 2115 [M−1].sup.1−
[0475] LC-MS r.t. (min): 2.551B
[0476] Synthesis of SO1861-Glu-AEM (Molecule 18); See
[0477] SO1861 (10.4 mg, 5.58 μmol), AEM (7.10 mg, 0.028 mmol) and HATU (6.36 mg, 0.017 mmol) were dissolved in a mixture of DMF (1.00 mL) and NMM (6.13 μL, 0.056 mmol). The reaction mixture was shaken for 1 min and left standing at room temperature. After 1 hour the reaction mixture was subjected to preparative MP-LC..sup.2 Fractions corresponding to the product were immediately pooled together, frozen and lyophilized overnight to give the title compound (7.82 mg, 71%) as a white fluffy solid. Purity based on LC-MS=95% (Chemical Formula: C.sub.89H.sub.136N.sub.2O.sub.47, Exact Mass: 1984.83). LRMS (m/z): 1985 [M−1].sup.1−
[0478] LC-MS r.t. (min): 2.621B
[0479] Synthesis of SO1861-(Glu-AEM)-(Ac—OH) (Molecule 19); See
[0480] SO1861-Ac—OH (9.02 mg, 4.95 μmol), AEM (7.10 mg, 0.028 mmol) and HATU (5.65 mg, 0.015 mmol) were dissolved in a mixture of DMF (0.50 mL) and NMM (5.44 μL, 0.050 mmol). The reaction mixture was shaken for 1 min and left standing at room temperature. After 1 hour the reaction mixture was subjected to preparative MP-LC..sup.2 Fractions corresponding to the product were immediately pooled together, frozen and lyophilized overnight to give the title compound (7.16 mg, 74%) as a white fluffy solid. Purity based on LC-MS=96% (Chemical Formula: C.sub.8H.sub.134N.sub.2O.sub.46, Exact Mass: 1942.82). LRMS (m/z): 1944 [M−1].sup.1−
[0481] LC-MS r.t. (min): 2.4718
[0482] Synthesis of SO1861-(Glu-AEM)-(Ald-OH) (Molecule 20); See
[0483] SO1861-Ald-OH (9.38 mg, 5.03 μmol), AEM (6.39 mg, 0.025 mmol) and HATU (5.73 mg, 0.015 mmol) were dissolved in a mixture of DMF (0.50 mL) and NMM (5.53 μL, 0.050 mmol). The reaction mixture was shaken for 1 min and left standing at room temperature. After 1 hour the reaction mixture was subjected to preparative MP-LC..sup.2 Fractions corresponding to the product were immediately pooled together, frozen and lyophilized overnight to give the title compound (8.63 mg, 86%) as a white fluffy solid. Purity based on LC-MS=95% (Chemical Formula: C.sub.89H.sub.138N.sub.2O.sub.47, Exact Mass: 1986.85).
[0484] LRMS (m/z): 1987 [M−1].sup.1−
[0485] LC-MS r.t. (min): 2.6218
[0486] Synthesis of SO1861-(Glu-AEM)-(Ald-OH)—(Ac—OH) (Molecule 21); See
[0487] SO1861-(Ald-OH)—(Ac—OH) (8.92 mg, 4.89 μmol), AEM (6.54 mg, 0.026 mmol) and HATU (5.65 mg, 0.015 mmol) were dissolved in a mixture of DMF (0.50 mL) and NMM (5.38 μL, 0.049 mmol). The reaction mixture was shaken for 1 min and left standing at room temperature. After 1 hour the reaction mixture was subjected to preparative MP-LC..sup.2 Fractions corresponding to the product were immediately pooled together, frozen and lyophilized overnight to give the title compound (8.92 mg, 94%) as a white fluffy solid. Purity based on LC-MS=97% (Chemical Formula: C.sub.87H.sub.136N.sub.2O.sub.46, Exact Mass: 1944.84).
[0488] LRMS (m/z): 1944 [M−1].sup.1−
[0489] LC-MS r.t. (min): 2.461B
[0490] Synthesis of SO1861-L-N.sub.3 (Molecule 23); See
[0491] Chemical Formula: C.sub.94H.sub.151N.sub.5O.sub.50, Exact Mass: 2149.94
[0492] Synthesis of SO1861-L-NHS (Molecule 25); See
[0493] SO1861-L-N.sub.3 (7.71 mg, 3.58 μmol) and DBCO-NHS (2.88 mg, 7.17 μmol) were dissolved in dry DMF (0.50 mL). The reaction mixture was shaken for 1 min and left standing at room temperature. After 30 min the reaction mixture was added dropwise to diethyl ether (40 mL). After centrifugation (7800 RPM, 5 min) the supernatant was decanted and the pellet was resuspended in diethyl ether (20 mL) and centrifuged again. After decanting the supernatant the residue was dissolved in water/acetonitrile (3:1, v/v, 3 mL) and the resulting solution was directly frozen and lyophilized overnight to give the title compound (8.81 mg, 96%) as a white fluffy solid. Purity based on LC-MS 84%. Contains 14% of the hydrolysed NHS ester (Chemical Formula: C.sub.117H.sub.169N.sub.7O.sub.55, Exact Mass: 2552.06).
[0494] LRMS (m/z): 2551 [M−1].sup.1−
[0495] LC-MS r.t. (min): 2.76/2.782 (double peaks due to isomers)
[0496] Synthesis of SO1861-Glu-HATU (Molecule 26); See
[0497] For producing SO1861-Glu-HATU the carboxylic group of SO1861 is activated via a reagent used in peptide coupling chemistry to generate an active ester, namely 1-[Bis(dimethylamino)methylene]-1H-1,2,3-triazolo[4,5-b]pyridinium 3-oxide hexafluorophosphate (HATU). The resulting active ester of SO1861 is shown in
[0498] The following modified QS-21 saponins, i.e. saponin derivatives, were synthesized based on the naturally occurring QS-21:
TABLE-US-00004 TABLE A3 overview of the synthesized modified QS-21: Number of Molecule Derivatised derivatised Saponin derivative No. group groups Type of derivatisation QS21-Ald-OH 27 Aldehyde 1 Reduction of the aglycone core aldehyde group into an alcohol. See FIG. 38. QS21-Glu-AEM 28 Glucuronic acid 1 Transformation of the carboxyl group of the glucuronic acid unit in the first saccharide chain bound to C.sub.3 of the aglycone core structure of the saponin into an amide bond through reaction with N-(2-aminoethyl)maleimide (AEM). See FIG. 39. QS21-(Ald-OH)-(Glu- 29 Aldehyde 2 Reduction of the aglycone core aldehyde group into an alcohol and AEM) Glucuronic acid transformation of the carboxyl group of the glucuronic acid unit in the first saccharide chain bound to C.sub.3 of the aglycone core structure of the saponin into an amide bond through reaction with AEM. See FIG. 40. QS21-Ald-EMCH 30 aldehyde 1 Transformation of the aglycone core aldehyde group into a hydrazone bond through reaction with EMCH. See FIG. 40B. QS21-Glu-AMPD 31 Glucuronic acid 1 Transformation of the carboxyl group of the glucuronic acid unit in the first saccharide chain bound to C.sub.3 of the aglycone core structure of the saponin into an amide bond through reaction with AMPD. See FIG. 40C. QS21-(Ald-EMCH)- 32 Aldehyde, 2 Transformation of the aglycone core aldehyde group into a hydrazone (Glu-AMPD) glucuronic acid bond through reaction with EMCH and transformation of the carboxyl group of the glucuronic acid unit in the first saccharide chain bound to C.sub.3 of the aglycone core structure of the saponin into an amide bond through reaction with AMPD. See FIG. 40D. QS21-(Ald-OH)-(Glu- 33 Aldehyde, 2 Reduction of the aglycone core aldehyde group into an alcohol and AMPD) glucuronic acid transformation of the carboxyl group of the glucuronic acid unit in the first saccharide chain bound to C.sub.3 of the aglycone core structure of the saponin into an amide bond through reaction with AMPD. See FIG. 40E.
[0499] Synthesis of QS21-Ald-OH (Molecule 27); See
[0500] QS21 (9.41 mg, 4.73 μmol) was dissolved in methanol (0.50 mL). Next, sodium borohydride (1.79 mg, 0.047 mmol) was added. The reaction mixture was shaken for 1 min and left standing at room temperature. After 30 min the reaction mixture was diluted with water (0.50 mL) and submitted to preparative MP-LC.2A Fractions corresponding to the product were immediately pooled together, frozen and lyophilized overnight to give the title compound (4.68 mg, 50%) as a white fluffy solid. Purity based on LC-MS 99% (Exact mass: 1990, 4 Isomers: Api/Xyl (2:1)).
[0501] LRMS (m/z): 1990 [M−1].sup.1−
[0502] LC-MS r.t. (min): 1.25/2.311B (double peaks, 17/83 UV-area %, due to QS21 being a mixture)
[0503] Synthesis of QS21-Glu-AEM (Molecule 28); See
[0504] QS-21 (2.42 mg, 1.22 μmol;
[0505] LRMS (m/z): 2110 [M−1].sup.1−
[0506] LC-MS r.t. (min): 2.84/2.931B (double peaks, 10/90 UV-area %, due to QS21 being a mixture)
[0507] Synthesis of QS21-(Ald-OH)-(Glu-AEM) (Molecule 29); See
[0508] QS-21-Ald-OH (1.92 mg, 0.964 μmol), AEM (1.29 mg, 5.08 μmol) and HATU (1.10 mg, 2.89 μmol) were dissolved in a mixture of DMF (0.50 mL) and NMM (1.06 μL, 9.64 μmol). The reaction mixture was shaken for 1 min and left standing at room temperature. After 1 hour the reaction mixture was subjected to preparative MP-LC..sup.2A Fractions corresponding to the product were immediately pooled together, frozen and lyophilized overnight to give the title compound (1.46 mg, 72%) as a white fluffy solid. Purity based on LC-MS 92% (Exact mass: 2112, 4 Isomers: Api/Xyl (2:1)).
[0509] LRMS (m/z): 2112 [M−1].sup.1−
[0510] LC-MS r.t. (min): 2.83/2.921B (double peaks, 7/93 UV-area %, due to QS21 being a mixture)
[0511] Synthesis of QS21-Ald-EMCH (
[0512] QS21 (4.82 mg, 2.42 μmol) and EMCH.TFA (4.11 mg, 0.012 mmol) were dissolved in methanol (extra dry, 0.25 mL). The reaction mixture was shaken for 1 min and left standing at room temperature. After 2 hours the reaction mixture was subjected to to preparative MP-LC..sup.2A Fractions corresponding to the product were immediately pooled together, frozen and lyophilized overnight. Next, the product was repurified by using preparative MP-LC..sup.2A Fractions corresponding to the product were immediately pooled together, frozen and lyophilized overnight to give the title compound (2.78 mg, 52%) as a white fluffy solid. Purity based on LC-MS 96%.
[0513] LRMS (m/z): 2196 [M−1].sup.1−
[0514] LC-MS r.t. (min): 2.4418 (multiple peaks due to QS21 being a mixture)
[0515] Synthesis of QS21-Glu-AMPD (
[0516] QS21 (4.89 mg, 2.46 μmol), AMPD (1.29 mg, 0.012 mmol) and BOP (3.26 mg, 7.37 μmol) were dissolved in a mixture of DMF (0.50 mL) and NMM (2.70 μL, 0.025 mmol). The reaction mixture was shaken for 1 min and left standing at room temperature. After 1 hour the reaction mixture was subjected to preparative MP-LC..sup.2A Fractions corresponding to the product were immediately pooled together, frozen and lyophilized overnight to give the title compound (3.76 mg, 74%) as a white fluffy solid. Purity based on LC-MS 94%.
[0517] LRMS (m/z): 2076 [M−1].sup.1−
[0518] LC-MS r.t. (min): 2.781B (multiple peaks due to QS21 being a mixture)
[0519] Synthesis of QS21-(Ald-EMCH)-(Glu-AMPD) (
[0520] QS21-Glu (2.47 mg, 1.19 μmol) and EMCH.TFA (2.02 mg, 5.95 μmol) were dissolved in methanol (extra dry, 100 μL). Next, TFA (0.36 μL, 4.76 μmol) was added. The reaction mixture was shaken for 1 min and left standing at room temperature. After 2 hours the reaction mixture was subjected to to preparative MP-LC..sup.2A Fractions corresponding to the product were immediately pooled together, frozen and lyophilized overnight to give the title compound (2.25 mg, 83%) as a white fluffy solid. Purity based on LC-MS 95%.
[0521] LRMS (m/z): 2283 [M−1].sup.1−
[0522] LC-MS r.t. (min): 2.881B (multiple peaks due to QS21 being a mixture)
[0523] Synthesis of QS21-(Ald-OH)-(Glu-AMPD) (
[0524] QS21-(Ald-OH) (4.90 mg, 2.46 μmol), AMPD (1.29 mg, 0.012 mmol) and BOP (3.26 mg, 7.37 μmol) were dissolved in a mixture of DMF (0.50 mL) and NMM (2.70 μL, 0.025 mmol). The reaction mixture was shaken for 1 min and left standing at room temperature. After 1 hour the reaction mixture was subjected to preparative MP-LC..sup.2A Fractions corresponding to the product were immediately pooled together, frozen and lyophilized overnight to give the title compound (2.16 mg, 42%) as a white fluffy solid. Purity based on LC-MS 96%.
[0525] LRMS (m/z): 2077 [M−1].sup.1−
[0526] LC-MS r.t. (min): 2.7718 (multiple peaks due to QS21 being a mixture)
Example 2: Activity of Saponin Derivatives—Pilot Study
[0527] It was found that the saponin modifications described herein not interfere substantially with the ability of the saponin to enhance endosomal escape (modified saponin or saponin freed from the conjugate inside the endosome). Results of experiments are summarized in Table Ex2, here below.
[0528] Chemically modified saponin SO1861 did show reactivity in a cell-based bioassay, with relative cell viability as the read out. HeLa cells were incubated for 72 h with the following constructs and cell viability before and after the 72 h-incubation was assessed. In the experiments, cells were exposed to 1.5 pM dianthin-EGF conjugate. A negative control were cells incubated with buffer vehicle and 10 microgram/ml saponin, without dianthin-EGF. Cell viability was set to 100% for the control in which both saponin and EGF-dianthin were omitted. Positive controls were 10 microgram/ml of non-modified saponin SO1861+dianthin-EGF. Cell viability after 72 h was essentially 0%. For the chemically modified saponin variants, 10 microgram/ml saponin was tested in combination with 1.5 pM dianthin-EGF. SO1861-Ald-EMCH reduced cell viability at 10 microgram/ml.
[0529] These data demonstrate that the saponin can be modified at the free aldehyde group or at the free carbonyl group without losing the endosomal escape enhancing activity.
TABLE-US-00005 TABLE Ex2 Cell killing activity (+ or −) of SO1861 and SO1861 derivatives when co-administrated with a targeted toxin (EGFdianthin). Co-administration results in enhanced cell killing compared to untreated control of EGFR expressing cells (e.g. A431, HeLa) SO1861- SO1861- SO1861-Glu- Ald-EMCH L-N.sub.3 HATU (also (also (also referred to as referred referred ‘SO1861- to as to as HATU’ and Buffer ‘SO1861- ‘SO1861 ‘SO1861- only SO1861 EMCH’) N3/Azide’) (S)’) 10 μg/ml SO1861 − − − − − or SO1861- derivative 10 μg/ml SO1861 − + + + + or SO1861- derivative + 1.5 pM EGFdianthin
Example 3: Activity of Saponin Derivatives—Detailed Study
[0530] Various saponins (e.g. SO1861, QS-21) were co-administrated as ‘free’ unconjugated molecules to cells in combination with a ligand toxin fusion (e.g. EGF-dianthin) or an antibody-protein toxin conjugate, resulting in enhanced cell killing activity of target-expressing cells.
[0531] The current inventors chemically modified SO1861 (isolated and purified from a root extract of Saponaria officinalis) and QS21 (isolated and purified from Quillaja saponaria; Desert King) at various positions within the molecule (single, double or triple modifications), therewith providing a series of saponin derivatives as outlined in Tables A2 and A3. Saponin derivatives were tested for 1) endosomal escape enhancing activity of a ligand toxin (modified SO1861/QS21 titration+5 pM EGFdianthin) on EGFR expressing cells (HeLa and A431); for 2) intrinsic cellular toxicity (modified SO1861/QS21 titration) on HeLa and A431; and for 3) Human red blood cell hemolysis activity (modified SO1861/QS21 titration on human red blood cells).
[0532] For determining the endosomal escape enhancing activity, modified SO1861 were titrated in the presence of a non-effective fixed concentration of 5 pM EGF-dianthin on EGFR expressing cells (HeLa and A431) (see
[0533] As said, for determining the endosomal escape enhancing activity, SO1861 derivatives, QS21 derivatives and their non-derivatised counterparts were titrated in the presence of a non-effective fixed concentration of 5 pM EGFdianthin on EGFR expressing cells (HeLa and A431). This revealed that non-derivatised SO1861 and non-derivatised QS21 and the QS21 derivative QS21-Glu-AMPD were effective at IC50=200 nM in HeLa and A431 cells. Single SO1861/QS21 modifications (SO1861-Ald-EMCH, SO1861-Ald-EMCH (blocked) (SO1861-Ald-EMCH(mercaptoethanol), SO1861-Glu-AMPD, SO1861-(Ald-OH), SO1861-Ac—OH, SO1861-Glu-AEM, QS21-Ald-EMCH, QS21-(Ald-OH), QS21-Glu-AEM) showed activity at IC50=600 nM-2000 nM in HeLa or A431 (Table A5 and A6) whereas double SO1861 modification and double QS21 modification showed activity at IC50=1500-40.000 nM in Hela or A431 cells (Table A5 and A6). For the triple modification of SO1861 no activity could be observed up to 20.000 nM.
[0534] For the toxicity determination modified SO1861 was titrated on HeLa cells (see
[0535] In addition, hemolysis activity of the unmodified and modified SO1861 was determined by a human red blood cell hemolysis assay (see
[0536] The endosomal escape enhancing activity (titration of saponin+5 pM cetuximab-Saporin on HeLa and A431 cells, see
[0537] The hemolytic activity of various SO saponins (SO1862 (isomer), SO1832, SO1904) was tested as well as the antibody-SO1861 conjugates (cetuximab-SO1861 (DAR4), trastuzuzmab-SO1861 (DAR4)). This revealed that hemolytic activity of SO1862 (isomer, SO1832, SO1904 was comparable with SO1861 (IC50=10.000 nM) (
[0538] When comparing the cytotoxicity, the hemolytic activity and the endosomal escape enhancing activity of SO1861, SO1861-Ald-EMCH and SO1861-Ald-EMCH-mercaptoethanol (SO1861-Ald-EMCH-Blocked), the latter two were similarly or essentially equally cytotoxic, hemolytically active and active in the endosomal escape enhancing activity bio-assay, and the latter two were less cytotoxic and less hemolytically active than SO1861. See also Table A5 and Table A6.
Cell Viability Assay
[0539] Cell viability was determined by an MTS-assay, performed according to the manufacturer's instruction (CellTiter 96® AQueous One Solution Cell Proliferation Assay, Promega). The MTS solution was diluted 20× in DMEM without phenol red (PAN-Biotech GmbH) supplemented with 10% FBS (PAN-Biotech GmbH). The cells were washed once with 200 μL PBS per well, after which 100 μL diluted MTS solution was added per well. The plate was incubated for approximately 20-30 minutes at 37° C. Subsequently, the optical density at 492 nm was measured on a Thermo Scientific Multiskan FC plate reader (Thermo Scientific). For quantification the background signal of ‘medium only’ wells was subtracted from all other wells, before the ratio of untreated/treated cells was calculated, by dividing the background corrected signal of untreated wells over the background corrected signal of the treated wells.
FACS Analysis
[0540] Cells were seeded in DMEM (PAN-Biotech GmbH) supplemented with 10% fetal calf serum (PAN-Biotech GmbH) and 1% penicillin/streptomycin (PAN-Biotech GmbH), at 500,000 c/plate in 10 cm dishes and incubated for 48 hrs (5% CO.sub.2, 37° C.), until a confluency of 90% was reached. Next, the cells were trypsinized (TrypIE Express, Gibco Thermo Scientific) to single cells. 0.75×10.sup.6 Cells were transferred to a 15 mL falcon tube and centrifuged (1,400 rpm, 3 min). The supernatant was discarded while leaving the cell pellet submerged. The pellet was dissociated by gentle tapping the falcon tube on a vortex shaker and the cells were washed with 4 mL cold PBS (Mg.sup.2+ and Ca.sup.2+ free, 2% FBS). After washing, the cells were resuspended in 3 mL cold PBS (Mg.sup.2+ and Ca.sup.2+ free, 2% FBS) and divided equally over 3 round bottom FACS tubes (1 mL/tube). The cells were centrifuged again and resuspended in 200 μL cold PBS (Mg.sup.2+ and Ca.sup.2+ free, 2% FBS) or 200 μL antibody solution; containing 5 μL antibody in 195 μL cold PBS (Mg.sup.2+ and Ca.sup.2+ free, 2% FBS). APC Mouse IgG1, κ Isotype Ctrl FC (#400122, Biolegend) was used as isotype control, and APC anti-human EGFR (#352906, Biolegend) was used. Samples were incubated for 30 min at 4° C. on a tube roller mixer. Afterwards, the cells were washed 3× with cold PBS (Mg.sup.2+ and Ca.sup.2+ free, 2% FBS) and fixated for 20 min at room temperature using a 2% PFA solution in PBS. Cells were washed 2× with cold PBS, and resuspended in 250-350 μL cold PBS for FACS analysis. Samples were analyzed with a BD FACSCanto II flow cytometry system (BD Biosciences) and FlowJo software. Results of the FACS analyses are summarized in Table A4.
TABLE-US-00006 TABLE A4 Cell surface expression levels (Mean Fluorescent Intensity (MFI) of EGFR and HER2 in various cell lines. EGFR HER2 expression expression Cell line level (MFI) (MFI) A431 1593 10 HeLa 91 7 SK-BR-3 28 1162 A2058 1 5
[0541] Hemolysis Assay
[0542] Red blood cells (RBCs) were isolated from a buffy coat using a Ficoll gradient. The obtained RBC pellet (˜4-5 ml) was washed 2× with 50 ml DPBS (without Ca.sup.2+/Mg.sup.2+, PAN-Biotech GmbH). Cells were pelleted by centrifugation for 10 min, 800×g at RT. RBC were counted and resuspended at 500.000.000 c/ml in DPBS (without Ca.sup.2+/Mg.sup.2+), based on total cell count.
[0543] Saponin dilutions were prepared in DPBS (with Ca.sup.2+/Mg.sup.2+, PAN-Biotech GmbH), at 1.11×final strength. For positive lysis control a 0.02% Triton-X100 solution was prepared in DPBS.sup.+/+. Of all compound solutions 135 μl was dispensed/well in a 96 well V-bottom plate. To this 15 μl RBC suspension was added and mixed shortly (10 sec-600 rpm). The plate was incubated 30 min at RT, with gentle agitation. Afterwards the plate was spun for 10 min at 800×g to pellet the RBC and 100-120 μl supernatant was transferred to a standard 96 wp (96 well-plate). Subsequently, the OD at 405 nm was measured on a Thermo Scientific Multiskan FC plate reader (Thermo Scientific). For quantification the background signal of DPBS.sup.+/+ only' wells was subtracted from all other wells before the percentage of hemolysis was calculated in comparison to 0.02% Triton-X100, by dividing the background corrected signal of treated wells over the background corrected signal of the 0.02% Triton-X100 wells (×100).
TABLE-US-00007 TABLE A5 Treatment of red blood cells and of HeLa cells with SO1861, SO1861 derivatives, QS-21 derivatives and QS-21. Ratio: IC50 Ratio: IC50 IC50 nM IC50 nM IC50 nM toxicity/ hemolysis/ Conjugate Sample (Activity) (Toxicity) (hemolysis) IC50 activity IC50 activity SO1861 200 2000 10.000 11 70 QS21 200 6000 3000 30 15 SO1861-Ald-EMCH 1500 >100.000 >1.000.000 >50 >500 SO1861-Ald-EMCH- 1500 >100.000 300.000 >50 200 blocked.sup.‡ SO1861-Glu-AMPD 600 20.000 20.000 66 66 SO1861-Ald-OH 600 >100.000 30.000 >166 88 SO1861-Ac—OH 1.000 10.000 20.000 10 30 SO1861-(Ald-OH)- 4.000 >100.000 100.000 >25 25 (Glu-AMPD) SO1861-(Ald-OH)- 5.000 >100.000 200.000 >20 40 (Ac—OH) SO1861-(Ac—OH)- 3.000 >100.000 140.000 >33 46 (Glu-AMPD) SO1861-(Ald-OH)- >20.000 >100.000 >1.000.000 Not active/ Not active/ (Ac—OH)-(Glu-AMPD) no tox no tox SO1861-(Ald-EMCH)- 5000 >100.000 >1.000.000 >20 >200 (Glu-AMPD) SO1861-(Ald-EMCH)- 8.000 >100.000 >1.000.000 >12 >125 (Ac—OH) SO1861-(Ald-EMCH)- >20.000 >100.000 >1.000.000 Not active/ Not active/ (Ac—OH)-(Glu-AMPD) no tox no tox SO1861-Glu-AEM 1.500 >100.000 30.000 >66 20 SO1861-(Glu-AEM)- 8.000 >100.000 100.000 >12 12 (Ac—OH) SO1861-(Glu-AEM)- 40.000 >100.000 >1.000.000 >2 >25 (Ald-OH) SO1861-(Glu-AEM)- >20.000 >100.000 >1.000.000 Not active/ Not active/ (Ald-OH)-(Ac—OH) no tox no tox QS21-Ald-OH 600 20.000 20.000 33 QS21-Glu-AEM 600 >100.000 10.000 >166 16 QS21-(Ald-OH)-(Glu- 1500 >100.000 >1.000.000 >50 >500 AEM) .sup.‡See Molecule 3, also referred to as SO1861-Ald-EMCH-mercaptoethanol or SO1861-Ald-EMCH(mercaptoethanol)
TABLE-US-00008 TABLE A6 Treatment of red blood cells and of A431 cells with SO1861, SO1861 derivatives, QS-21 derivatives and QS-21. Ratio: IC50 Ratio: IC50 IC50 nM IC50 nM IC50 nM toxicity/ hemolysis/ Conjugate Sample (Activity) (Toxicity) (hemolysis) IC50 activity IC50 activity SO1861 200 1000 8000 5 40 QS21 200 3000 3000 15 15 SO1861-Ald-EMCH 1500 30.000 >1.000.000 15 >500 SO1861-Ald-EMCH- 1500 30.000 300.000 20 200 blocked SO1861-Glu-AMPD 600 20.000 20.000 33 33 SO1861-Ald-OH 600 7000 30.000 11 50 SO1861-Ac—OH 800 2000 20.000 2.5 25 SO1861-(Ald-OH)- 4.000 >100.000 100.000 >25 25 (Glu-AMPD) SO1861-(Ald-OH)- 4.000 >100.000 200.000 >25 50 (Ac—OH) SO1861-(Ac—OH)- 3.000 >100.000 140.000 >33 46 (Glu-AMPD) SO1861-(Ald-OH)- >20.000 >100.000 >1.000.000 Not active/ Not active/ (Ac—OH)-(Glu-AMPD) no tox no tox SO1861-(Ald-EMCH)- 15.000 >100.000 >1.000.000 >7 >66 (Glu-AMPD) SO1861-(Ald-EMCH)- 10.000 >100.000 >1.000.000 >10 >100 (Ac—OH) SO1861-(Ald-EMCH)- >20.000 >100.000 >1.000.000 Not active/ Not active/ (Ac—OH)-(Glu-AMPD) no tox no tox SO1861-Glu-AEM 2000 >100.000 30.000 >50 15 SO1861-(Glu-AEM)- 4.000 >100.000 100.000 >25 25 (Ac—OH) SO1861-(Glu-AEM)- 20.000 >100.000 >1.000.000 >50 >50 (Ald-OH) SO1861-(Glu-AEM)- >20.000 >100.000 >1.000.000 Not active/ Not active/ (Ald-OH)-(Ac—OH) no tox no tox QS21-Ald-OH 600 20.000 20.000 33 33 QS21-Glu-AEM 700 >100.000 10.000 >142 14 QS21-(Ald-OH)- 3000 >100.000 >1.000.000 >33 >333 (Glu-AEM)
Example 4: Critical Micellar Concentration (CMC) of Saponin Derivatives
Materials and Methods
[0544] The critical micellar concentration (CMC) of saponins derived from Saponaria officinalis (SO) (Table A7) and derived from Quillaja saponaria (QS) (Table A8, and Table A9) was determined by the method of DeVendittis et al. (A fluorimetric method for the estimation of the critical micelle concentration of surfactants, Analytical Biochemistry, Volume 115, Issue 2, August 1981, Pages 278-286) as follows:
[0545] The emission spectrum of 8-Anilinonaphthalene-1-sulfonic acid (ANS) in either purified water (MQ) or PBS (Dulbecco's PBS+/+) was determined at dry weight concentrations of saponins ranging from 1 to 1400 μM to cover the range below and above the CMC. Above the CMC, the fluorescence yield of ANS increases and the wavelength of maximum emission decreases due to portioning of the fluorescent dye into micelles. Fluorescence yields were recorded on a Fluoroskan Ascent FL (Thermo Scientific) at an excitation wavelength of 355 nm, and an emission wavelength of 460 nm. 6 μg at a concentration of 75.86 μM of ANS were used per sample and measurement.
Results
SO1861 Saponins
[0546] The chemical modification at the functional groups aldehyde (Ald), glucuronic acid (Glu), and the removal of the acetyl group (Ac) showed an impact on micellar properties of the respective saponins. As shown in
[0547] Similar observations with respect to the site of modification have been obtained for bi-modification (
[0548] When comparing the tri-modified saponins SO1861-(Glu-AEM)-(Ald-OH)—(Ac—OH) and SO1861-(Ald-OH)—(Ac—OH)-(Glu-AMPD), the modification on the glucuronic acid at SO1861-(Glu-AEM)-(Ald-OH)—(Ac—OH) resulted in a flatter slope of the respective ANS fluorescence yields while the modification on the glucuronic acid at SO1861-(Ald-OH)—(Ac—OH)-(Glu-AMPD) resulted in a steeper slope of the respective ANS fluorescence yields with respect to the native SO1861 (
TABLE-US-00009 TABLE A7 CMC values of SO saponins determined in PBS Saponin CMC (μM) SO1861 185 ± 19 SO1861-Ald-EMCH n.d. SO1861-Ac—OH 350 ± 35 SO1861-Ald-OH 135 ± 14 SO1861-Glu-AMPD 50 ± 5 SO1861-Ald-EMCH-blocked 50 ± 5 SO1861-Glu-AEM 45 ± 5 SO1861-(Ald-EMCH)-(Ac—OH) >300 SO1861-(Ald-OH)-(Ac—OH) >280 SO1861-(Glu-AEM)-(Ald-OH) 90 ± 10 SO1861-(Glu-AEM)-(Ac—OH) 90 ± 10 SO1861-(Ac—OH)-(Glu-AMPD) 90 ± 10 SO1861-(Ald-EMCH)-(Glu-AMPD) >30 SO1861-(Ald-OH)-(Glu-AMPD) 50 ± 5 SO1861-(Glu-AEM)-(Ald-OH)-(Ac—OH) >150 SO1861-(Ald-OH)-(Ac—OH)-(Glu-AMPD) 120 ± 12 SO1861-(Ald-EMCH)-(Ac—OH)-(Glu-AMPD) n.d.
QS Saponins
[0549] For the saponins derived from Quillaja saponaria (QS), QS7, QS17, QS18, QS21 Frac, and QS21 SP CMC values have been determined which are displayed in Table A8. As shown in
[0550] When comparing the ANS fluorescence yields of QS21 SP measured in purified water (MQ) and PBS, the slope in purified water (MQ) is slightly steeper leading to expected slightly higher CMC values in purified water (
[0551] For the mono-modified QS21 saponins QS21-Ald-EMCH (molecule 30;
[0552] Similar to the finding for bi-modifications on the Saponaria officinalis saponin SO1861, also the AldGlu modification of the QS21 saponin (QS21-(Ald-OH)-(Glu-AMPD),
TABLE-US-00010 TABLE A8 CMC values of QS saponins determined in purified water (MQ) Saponin CMC (μM) QS7 230 ± 25 QS21 (Frac) 75 ± 8 QS17 70 ± 7 QS18 68 ± 7 QS21 (SP) 49 ± 5
TABLE-US-00011 TABLE A9 CMC values of modified QS21 saponins determined in PBS Saponin CMC (μM) QS21 (SP) in MQ 49 ± 5 QS21 (SP) in PBS 40 ± 5 QS21-Ald-OH >60 QS21-Ald-EMCH n.d. QS21-Glu-AMPD 20 QS21-Glu-AEM n.d. QS21-(Ald-OH)-(Glu-AEM) n.d. QS21-Ald-EMCH-(Glu-AMPD) n.d. QS21-(Ald-OH)-(Glu-AMPD) 39 ± 4
Example 5: Endosomal Escape Enhancing Activity of SO1861 and SO1861-Ald-EMCH
[0553] SO1861 and SO1861-Ald-EMCH (also referred to as SO1861-EMCH, for example in
[0554] Next, cetuximab-dianthin or cetuximab-saporin were titrated on various fixed concentrations of SO1861 or SO1861-Ald-EMCH. This revealed efficient cell killing with low pM concentrations of cetuximab-dianthin (IC50=1 pM,
[0555] Next, SO1861 or SO1861-Ald-EMCH was titrated on a fixed concentration of 10 pM EGFdianthin (EGFR targeting fusion protein toxin) on EGFR expressing cells (A431). This revealed that SO1861 (IC50=800 nM) and SO1861-Ald-EMCH (IC50=2000 nM) induce efficient cell killing of A431 cells in combination with 10 pM EGFdianthin, whereas SO1861 or SO1861-Ald-EMCH alone showed no cell killing activity (
[0556] Next, EGFdianthin was titrated on various fixed concentration of SO1861 or SO1861-Ald-EMCH. This revealed efficient cell killing with low pM concentrations of EGFdianthin (IC50=0.1 pM,
[0557] Next, trastuzumab-dianthin or trastuzumab-saporin (trastuzumab conjugated to the protein toxin, saporin, with a DAR4) was titrated on a fixed concentration of 1500 nM SO1861 or 4000 nM SO1861-Ald-EMCH on HER2 expressing cells (SK-BR-3). This revealed efficient cell killing with low pM concentrations of trastuzumab-dianthin (IC50=0.1 pM) or trastuzumab-saporin (IC50=0.1 pM) in the presence of 1500 nM SO1861 or 4000 nM SO1861-Ald-EMCH (
[0558] All these results outlined in
[0559] SO1861-Ald-EMCH was tested for its ability to enhance endosomal escape of an antisense oligo nucleotide (BNA, bridged nucleic acid) against HSP27 mRNA. For this, SO1861-Ald-EMCH was titrated on a fixed concentration of 100 nM HSP27BNA, 100 nM cetuximab-HSP27BNA (cetuximab conjugated to the HSP27BNA, with a DAR4) or 100 nM trastuzumab-HSP27BNA (trastuzumab conjugated to the HSP27BNA, with a DAR4) on EGFR/HER2 expressing cells (A431). This revealed that SO1861-Ald-EMCH (IC50=700 nM) induces efficient HSP27 gene silencing cells in combination with 100 nM HSP27BNA, 100 nM cetuximab-HSP27BNA (
[0560] Next, cetuximab-HSP27BNA (DAR1.5 or DAR4), trastuzumab-HSP27BNA (DAR4.4) was titrated on various fixed concentration of SO1861-Ald-EMCH in EGFR (A431) or HER2 (SK-BR-3) expressing cells. This revealed efficient HSP27 gene silencing in A431 cells with low nM concentrations of cetuximab-HSP27BNA (IC50=0.5 nM,
[0561] Next, untargeted HSP27BNA was titrated on a fixed concentration of SO1861-Ald-EMCH in various cell lines. This revealed effective HSP27 gene silencing (
[0562] All this shows that SO1861-Ald-EMCH efficiently enhances endosomal escape and cytoplasmic delivery of a targeted antisense BNA oligo as well as untargeted BNA/LNA oligos, thereby significantly reducing the effective concentration of the targeted and untargeted antisense oligo from μM range to low nM range.
Materials
[0563] Trastuzumab (Tras, Herceptin®, Roche), Cetuximab (Cet, Erbitux®, Merck KGaA). Dianthin-cys was produced and purchased from Proteogenix, France, EGFdianthin was produced from E. coli. according to standard procedures. Cetuximab-saporin and trastuzumab-saporin conjugates were produced and purchased from Advanced Targeting Systems (San Diego, CA).
Methods
Flash Chromatography
[0564] Grace Reveleris X2® C-815 Flash; Solvent delivery system: 3-piston pump with auto-priming, 4 independent channels with up to 4 solvents in a single run, auto-switches lines when solvent depletes; maximum pump flow rate 250 mL/min; maximum pressure 50 bar (725 psi); Detection: UV 200-400 nm, combination of up to 4 UV signals and scan of entire UV range, ELSD; Column sizes: 4-330 g on instrument, luer type, 750 g up to 3000 g with optional holder.
HSP27BNA Oligo Sequences
[0565] HSP27 BNA oligo (5′-GGCacagccagtgGCG-3′) according to Zhang et al. (2011) [Y Zhang, Z Qu, S Kim, V Shi, B Liao1, P Kraft, R Bandaru, Y Wu, LM Greenberger and ID Horak, Down-modulation of cancer targets using locked nucleic acid (LNA)-based antisense oligonucleotides without transfection, Gene Therapy (2011) 18, 326-333]) ([SEQ-ID NO: 2]) was ordered with or without 5′-Thiol C6 linker at Bio-Synthesis Inc. (Lewisville, Texas). HSP27 LNA oliogo (5′-ggcacagccagtggcg-3′) ([SEQ-ID NO: 3]) was ordered at at Bio-Synthesis Inc. (Lewisville, Texas).
RNA Isolation and Gene Expression Analysis
[0566] RNA from cells was isolated and analysed according to standard protocols (Biorad). qPCR primers that were used are indicated in Table A10.
TABLE-US-00012 TABLE A10 Primers used in qPCR are shown below: SEQ ID Gene Primer Sequence (5′-3′) NO: HSP27 Forward GCAGTCCAACGAGATCACCA 4 Reverse TAAGGCTTTACTTGGCGGCA 5
Tratuzumab-Saporin and Cetuximab-Saporin Synthesis
[0567] Custom mAb-saporin conjugate were produced and purchased from Advanced Targeting Systems (San Diego, CA).
Trastuzumab-Dianthin and Cetuximab-Dianthin Synthesis
[0568] Dianthin-Cys (17.0 ml, ˜9.6 mg) was concentrated by ultrafiltration using a vivaspin T15 filter tube (3,000 g, 20° C., 10 minutes). The resulting 3.25 ml aliquot was gel filtered using zeba 10 ml spin columns eluting with TBS pH 7.5.
[0569] Trastuzumab (mAb) or Cetuximab (mAb) (0.30 ml, ˜10 mg) was diluted to 10 mg/ml with DPBS pH 7.5, desalted via zeba 5 ml spin column eluting with DPBS pH 7.5 and normalised to 2.50 mg/ml. To an aliquot of mAb was added an aliquot of freshly prepared SMCC solution (1.00 mg/ml, 4.20 mole equivalents, 13.9×10.sup.−5 mmol) in DMSO, the mixture vortexed briefly then incubated for 60 minutes at 20° C. with roller-mixing. After, the reaction was quenched by the addition of an aliquot of a freshly prepared glycine solution (2.0 mg/ml, 5.0 mole equivalents, 69.5×10.sup.−5 mmol) in DPBS pH 7.5. mAb-SMCC (4.27 mg, 2.80×10.sup.−5 mmol, 1.514 mg/ml) was obtained after gel filtration using a zeba 10 ml spin column eluting with TBS pH 7.5.
[0570] To Dianthin-Cys (7.54 mg, 25.3×10.sup.−5 mmol, 2.258 mg/ml) was added an aliquot of freshly prepared TCEP solution (1.00 mg/ml, 0.5 mole equivalents, 12.6×10.sup.−5 mmol) in TBS pH 7.5, the mixture briefly vortexed then incubated for 60 minutes at 20° C. with roller-mixing. After, Dianthin-SH (6.0 mg, 20.2×10.sup.−5 mmol, 1.722 mg/ml, Dianthin:SH=1.1) was obtained by gel filtration using a zeba 10 ml spin column eluting with TBS pH 7.5.
[0571] To the bulk mAb-SMCC was added the aliquot of Dianthin-SH (7.20 mole equivalents), the mixture vortexed briefly then incubated overnight at 20° C. After ca. 16 hours, the reaction was quenched by the addition of an aliquot of freshly prepared NEM solution (2.50 mg/ml, 5.0 mole equivalents, 101×10.sup.−5 mmol) in TBS pH 7.5. The reaction mixture was filtered to 0.45 μm and then concentrated to <2 ml by ultrafiltration using a vivaspin T15 filter tube (3,000 g, 20° C., 15 minutes). The conjugate was purified by gel filtration using a 1.6×35 cm Superdex 200PG column eluting with DPBS pH 7.5.
Antibody-(L-HSP27 BNA).SUP.n .[Over HSP27 BNA Disulfide]
[0572] Trastuzumab-(L-HSP27).sup.4, Cetuximab-(L-HSP27).sup.4, Synthesis Via PEG.sub.4-SPDP with a DAR4 and Cetuximab-(L-HSP27).sup.2 Synthesis Via PEG.sub.4-SPDP with a DAR2
[0573] Trastuzumab, Cetuximab, are referred hereafter as “Ab”. Ab was conjugated to HSP27 BNA disulfide via a tetra(ethylene glycol) succinimidyl 3-(2-pyridyldithio)propionate (PEG.sub.4-SPDP) linker forming a labile (L) disulfide bond between Ab and HSP27 BNA. The procedure is exemplary described for Trastuzumab-(L-HSP27 BNA).sub.4: [0574] HSP27 BNA disulfide oligo (2.7 mg, 470 nmol, 6.10 mg/ml) was reacted with TCEP (10 mole equivalents, 4.7 μmol, 1.34 mg, 50 mg/ml) for 30 minutes at 20° C. with roller mixing. After, the oligo-SH was purified by PD10 G25 desalting column eluting into TBS pH 7.5 and used promptly. Oligo-SH was obtained (2.48 mg, 90%, 1.24 mg/ml, SH to oligo ratio=0.8) [0575] Trastuzumab (1.5 mg, 10.3 nmol, 2.50 mg/ml) was reacted with an aliquot of freshly prepared PEG.sub.4-SPDP solution (6.81 mole equivalents, 70.1 nmol, 39 pg) in DMSO (1 mg/ml) for 60 minutes at 20° C. with roller mixing. After, the reaction was quenched with glycine (15.1 μl of 2 mg/ml freshly prepared solution in TBS pH 7.5) and then desalted via zeba desalting column eluting with TBS pH 7.5. An aliquot of the resulting Tras-S-PEG.sub.4-SPDP was taken out and tested by UV-Vis analysis. SPDP incorporation was determined using TCEP to liberate pyridiyl-2-thione (PDT) and by UV-vis analysis at 343 nm (SPDP to Ab ratio: 4). The remaining Tras-(S-PEG.sub.4-SPDP).sub.4 was reacted with an aliquot of freshly prepared HSP27 oligonucleotide (oligo-SH) (8 mole equivalents, 82.4 nmol, 1.24 mg/ml) and incubated overnight at 20° C. with roller mixing. After 17 hours, the conjugate was analysed by UV-vis analysis to ascertain incorporation of HSP27 by displacement of pyridiyl-2-thione (PDT) at 343 nm. The crude conjugate was purified using a 1.6×33 cm Sephadex G50 column eluting with DPBS pH 7.5. The resulting Trastuzumab-(L-HSP27).sub.4 was obtained as a single fraction. Yield: n.d. Purity: 96%, HSP27 BNA to Ab ratio=4.4
Example 6—Endosomal Escape Enhancing Activity of Saponins
[0576] Previously, the efficacy of various saponins (SO1861, SA1642) were co administrated as ‘free’ unconjugated molecules to cells in combination with a ligand toxin fusion (e.g. EGFdianthin) or an antibody-protein toxin conjugate, resulting in enhanced cell killing activity of target expressing cells. Here, three different saponin molecules (SO1861, SO1862 (isomer of SO1861), SO1832 and SO1904) isolated from a root extract of Saponaria officinalis were titrated in the presence and absence of a non-effective fixed concentration of 1.5 pM EGFdianthin on HeLa (EGFR.sup.+) cells. This revealed a strong enhancement of cell killing activity for all tested saponin variants (IC50=300 nM;
[0577] To extend this test, saponins from other sources were analyzed. A saponin purified from a root extract of Gypsophila elegans M. Bieb. (GE1741) was titrated on HeLa cells in the presence and absence of 1.5 pM EGFdianthin and compared with purified SO1861. GE1741 also enhances the EGFdianthin induced HeLa cell killing, but shows slightly less efficacy compared to SO1861. (GE1741 IC50=800 nM;
Example 7—Endosomal Escape Enhancing Activity of Saponins and Saponin Derivatives
[0578] Labile/acid sensitive derivatisations (Ald-EMCH or SO1861-L-N.sub.3 (also referred to as SO1861-N.sub.3 and SO1861-azide or SO1861-N.sub.3/azide), were applied to SO1861 via the aldehyde group, producing SO1861-Ald-EMCH or SO1861-L-N.sub.3. To verify the activity of SO1861-Ald-EMCH the molecule was titrated in the presence and absence of a fixed non-effective (1.5 pM) EGFdianthin concentration on EGFR expressing (A431, HeLa) and non-expressing cells (A2058). In all three cell lines SO1861 alone showed a strong cell viability reduction, whereas SO1861-Ald-EMCH as single compound showed no toxicity up to 25.000 nM (
[0579] HATU was conjugated to SO1861 via the carboxylic acid group of SO1861 producing, SO1861-(S), also referred to as SO1861-HATU and SO1861-Glu-HATU. To determine the activity, different concentrations of SO1861-(S) were co-administrated with 1.5 pM EGFdianthin and tested for cell killing activity in EGFR expressing HeLa cells. SO1861-(S) showed a similar activity as SO1861, indicating that conjugation to the carboxylic acid group does not affect the endosomal escape enhancing potency of the molecule, similar to what is observed with SO1861-Ald-EMCH (