Polypeptide tag, highly soluble recombinant nitrilase and application thereof in synthesis of pharmaceutical chemicals

11807883 · 2023-11-07

Assignee

Inventors

Cpc classification

International classification

Abstract

The present invention provides a polypeptide tag and its application in the synthesis of pharmaceutical chemicals, the recombinant nitrilase was obtained by connecting a polypeptide tag to the N-terminus of the amino acid sequence of the nitrilase; wherein amino acids at both ends of the polypeptide tag are uncharged glycine G, and the rest are a random combination of any one or more of glycine G, histidine H, glutamic acid E, aspartic acid D, lysine K and arginine R; The activity of the recombinant nitrilase in the preparation of 1-cyanocyclohexyl acetic acid is up to 3034.7 U/g dcw, the polypeptide tag significantly improves the soluble expression of nitrilase, and the whole cell catalyst hydrolyzes 1M substrate with the same concentration 30 minutes faster than the mother enzyme. The method provided by the present invention can also be used for the biocatalytic reaction of other pharmaceutical intermediates as the substrate catalyzed by the nitrilase, improving the activity of the whole cell catalyst in reaction, and also improving the solubility of other types of nitrilases and the activity of the corresponding whole cell catalysts.

Claims

1. A recombinant nitrilase, comprising: a polypeptide tag, wherein the polypeptide tag is attached to the recombinant nitrilase on the N terminus, wherein the polypeptide tag is selected from the group consisting of: GKGKG (SEQ ID NO: 3), GKGEG (SEQ ID NO: 4), GKGHG (SEQ ID NO: 5), GRGRG (SEQ ID NO: 6), GRGGG (SEQ ID NO: 7), GHGHG (SEQ ID NO: 8), GKGKGKG (SEQ ID NO: 26), and GKGKGKGKG (SEQ ID NO: 27), wherein the polypeptide tag is universal and enhances soluble expression of the recombinant nitrilase, wherein the recombinant nitrilase has the amino acid sequence set forth in SEQ ID NO: 1, and wherein enzyme activity of the recombinant nitrilase with the polypeptide tag is at least 101.6% of the original strain.

2. The recombinant nitrilase of claim 1, wherein the polypeptide tag is connected to the recombinant nitrilase by a linker peptide, and wherein the linker peptide is selected from the group consisting of: GKGKG-GS (SEQ ID NO: 31), GKGKG-GGS (SEQ ID NO: 32), GKGKG-GGGS (SEQ ID NO: 33), and GKGKG-GGGGS (SEQ ID NO: 34).

3. The recombinant nitrilase of claim 1, wherein the polypeptide tag is linked to a linker peptide, and the linker peptide is selected from the group consisting of: GS, GGS, GGGS (SEQ ID NO: 29), and GGGGS (SEQ ID NO: 30).

Description

BRIEF DESCRIPTION OF THE DRAWINGS

(1) FIG. 1: A schematic map of the recombinant plasmid pET-28b+/tag-AcN-M with the polypeptide tag.

(2) FIG. 2: Nucleic acid gel electrophoresis diagram, lane M is Maker, lane 1 is the product of full-length plasmid PCR.

(3) FIG. 3: SDS-PAGE electrophoresis diagram of cell breaking supernatant and precipitation samples of the recombinant strain E. coli BL21(DE3)/pET-28b(+)/GKGKG (SEQ ID NO: 3)-AcN-M; wherein M is protein molecular weight makers, 1 and 2 are the cell breaking supernatant and precipitation of the original strain, respectively; 3 and 4 are cell breaking supernatant and precipitation of the recombinant strain, respectively.

(4) FIG. 4: Comparison of the relative enzyme activity of the original strain and the recombinant strain E. coli BL21(DE3)/pET-28b(+)/GKGKG(SEQ ID NO: 3)-AcN-M at different temperatures; wherein the activity value of the original strain under standard enzyme activity determination conditions is set as 100%.

(5) FIG. 5: Comparison of the relative enzyme activity of the original strain and the recombinant strain E. coli BL21(DE3)/pET-28b(+)/GKGKG(SEQ ID NO: 3)-AcN-M under different pHs; wherein the activity value of the original strain under standard enzyme activity determination conditions is set as 100%.

(6) FIG. 6: Comparison of the accumulation concentration of catalytic products between the original strain and the recombinant strain E. coli BL21(DE3)/pET-28b(+)/GKGKG(SEQ ID NO: 3)-AcN-M at different substrate concentrations, wherein the substrate concentration of A is 1M, and the substrate concentration of B is 2M.

SPECIFIC EMBODIMENTS

(7) The present invention is further illustrated below with specific examples, but the scope of the present invention is not limited thereto:

(8) The medium involved in the following examples are as follows:

(9) Mass composition LB of solid medium: 5 g/L yeast powder, 10 g/L peptone, 10 g/L NaCl, 2% agar powder, the solvent is water, pH=7.0.

(10) LB liquid medium: 5 g/L yeast powder, 10 g/L peptone, 10 g/L NaCl, the solvent is water, pH=7.0.

(11) Fermentation medium: 20 g/L yeast powder, 15 g/L sucrose, 5 g/L NaCl, 0.9 g/L dipotassium hydrogen phosphate trihydrate, the solvent is water, pH=6.8.

(12) The detection methods involved in the following examples are as follows:

(13) The definition of enzyme activity: under certain conditions, the amount of enzyme required to catalyze the production of 1 μmol of 1-cyanocyclohexyl acetic acid (1-CA) from the substrate per minute is defined as one unit of activity, denoted as U.

(14) Specific enzyme activity refers to the number of enzyme activity units per unit weight (mg) of protein under certain conditions.

(15) Determination method of the activity of resting cells: 0.01 g of resting cells is suspended in 1 mL of 0.2 M, pH 7.0 Na.sub.2HPO.sub.4—NaH.sub.2PO.sub.4 buffer and incubated at 35° C. for 10 min, 0.03 g of substrate 1-cyanocyclohexylacetonitrile (1-CN) (final concentration of 0.2 M) is added, the resulting mixture is subjected to shaking reaction at 200 rpm and 35° C. constant temperature for 10 minutes, after the reaction, the resulting reaction solution is subjected to centrifugation at 12,000 rpm for 5 minutes, and the supernatant is taken to determine the product concentration.

(16) The specific enzyme activity of the original strain under the standard enzyme activity determination conditions is set as 100%, and the ratio of the specific enzyme activity of the recombinant strain to the specific enzyme activity of the original strain is the relative cell activity (%).

(17) Substrate 1-CN concentration detection method: gas chromatography: Agilent 7890A, chromatographic column: Agilent J&WHP-5 Column (30 m×0.32 mm, film thickness 0.25 μm), the temperatures of injection port and detector are set up as 320° C.; the temperature of column is set up as 160° C. for 8 min; carrier gas: high-purity helium; carrier gas flow: 1.0 mL/min; injection volume: 1 μL; split ratio is 30:1.

(18) Product 1-CA concentration detection method: liquid chromatography: chromatographic column type is C18-H, 250 mm×4.6 mm, J&K Scientific Ltd., China; chromatographic conditions are column temperature at 40° C., UV detection wavelength at 215 nm and mobile phase as 76% buffer (0.58 g/L NH.sub.4H.sub.2PO.sub.4 and 1.83 g/L NaClO.sub.4, pH 1.8) and 24% acetonitrile.

(19) The nitrilase gene was cloned from Acidovorax facilis (Acidovorax facilis ZJB09122), and the amino acid sequence is shown in SEQ ID NO: 1 and the nucleotide sequence is shown in SEQ ID NO: 2. The Acidovorax facilis (Acidovorax facilis ZJB09122) is deposited in the China Center for Type Culture Collection, and the deposit number is CCTCC NO.M209044, which has been disclosed in the patent CN101629192B.

Example 1: Construction of a Recombinant Plasmid Containing a Polypeptide Tag

(20) 1. The design principle is as follows: the solubility of a protein is closely related to the hydrophobicity of the residues, and it is also affected by the net charge of the protein or the proportion of helical residues. Polar amino acids have an important influence on the solubility of proteins. The palindrome element sequence is usually composed of multiple repeating units containing one or two polar amino acids, with positive or negative charge, and it has been reported that it can promote protein folding, and is usually less than 15 residues.

(21) Based on the above principles, we first designed a pentapeptide tag, in which amino acids at both ends and the middle (ie amino acids at position 1, 3, 5) are uncharged glycine (G), and the rest (ie amino acids at position 2, 4) are a random combination of any one or more of glycine (G), histidine (H), glutamic acid (E), aspartic acid (D), lysine (K), arginine (R), specifically one of the following: GDGDG(SEQ ID NO: 9), GDGEG(SEQ ID NO: 10), GDGRG(SEQ ID NO: 11), GDGKG(SEQ ID NO: 12), GDGGG(SEQ ID NO: 35), GEGEG(SEQ ID NO: 13), GEGKG(SEQ ID NO: 14), GEGGG(SEQ ID NO: 15), GEGRG(SEQ ID NO: 16), GEGDG(SEQ ID NO: 17), GKGKG(SEQ ID NO: 3), GKGDG(SEQ ID NO: 18), GKGEG(SEQ ID NO: 4), GKGGG(SEQ ID NO: 19), GKGHG(SEQ ID NO: 5), GKGRG(SEQ ID NO: 20), GRGRG(SEQ ID NO: 6), GRGDG(SEQ ID NO: 21), GRGEG(SEQ ID NO: 22), GRGKG(SEQ ID NO: 23), GRGGG(SEQ ID NO: 7), GGGEG(SEQ ID NO: 25), GHGHG(SEQ ID NO: 8) and GGGKG(SEQ ID NO: 24).

(22) Secondly, the linker peptide was designed, and the amino acid sequence is one of the following: GS, GGS, GGGS(SEQ ID NO: 29), or GGGGS(SEQ ID NO: 30).

(23) Finally, a polypeptide tags with an extended peptide chain and the polypeptide tags containing linker peptides are designed: GKGKGKG (SEQ ID NO: 26), GKGKGKGKG (SEQ ID NO: 27), GKGKGKGKGKG (SEQ ID NO: 28), GKGKG-GS(SEQ ID NO: 31), GKGKG-GGS(SEQ ID NO: 32), GKGKG-GGGS(SEQ ID NO: 33), or GKGKG-GGGGS(SEQ ID NO: 34).

(24) 2. According to the patent application (CN104212784A), the recombinant E. coli BL21(DE3)/pET28b(+)-AcN2 containing the expression vector pET-28b(+) was obtained from Acidovorax facilis (Acidovorax facilis ZJB09122), and then according to the patent application (CN107177576A) E. coli BL21(DE3)/pET28b(+)-AcN-T151V/C223A/C250G was prepared.

(25) The recombinant plasmid pET28b(+)-AcN-T151V/C223A/C250G was extracted from E. coli BL21(DE3)/pET28b(+)-AcN-T151V/C223A/C250G, which was the recombinant plasmid pET-28b(+)/AcN-M, wherein the nucleotide sequence of AcN-M was shown in SEQ ID NO:2, and the amino acid sequence was shown in SEQ ID NO:1.

(26) The recombinant plasmid pET-28b(+)/AcN-M containing the encoding gene of the nitrilase (AcN-M) shown in SEQ ID NO:1 as the template and the forward and reverse primers containing the polypeptide tag in step 1 were used to carry out PCR amplification and the polypeptide tag designed in step 1 was directly linked to the N-terminal of the nitrilase gene through PCR amplification, the PCR amplification product was subjected to gel electrophoresis to verify the success of the PCR, and then dpn I was added in the amount of 1 μL/50 μL amplification system and reacted at 37° C. for 30 min to digest the template, 25 μL of the resulting reaction solution was taken for sequencing verification (Hangzhou tsingke Biological Technology Co., Ltd.), and the PCR product containing the recombinant plasmid ET-28b(+)/tag-AcN-M was obtained, shown in table 1, tag represented the polypeptide tag.

(27) The PCR system was as follows: 25 μL of 2×Phanta Max Buffer (PCR system buffer), 1 μL of d NTP Mix (dATP, dCTP, dGTP, dTTP), 1 μL of the template, 1 μL of the forward primer, 1 μL of the reverse primer, 1 μL of Phanta Max Super-Fidelity DNA Polymerase (High-fidelity Thermostable DNA Polymerase), 20 μL of dd H2O, 50 μL in total.

(28) The PCR reaction conditions were: pre-denaturation at 95° C. for 5 min; 30 cycles: denaturation at 95° C. for 30 seconds, annealing at 55-65° C. for 1 min, extension at 72° C. for 5.5 min and 72° C. for 10 min.

(29) TABLE-US-00001 TABLE 1 Primers containing the peptide tags Name of the primers Amino acid sequence T7 TAATACGACTCACTATAGGG (SEQ ID NO: 36) T7 ter TGCTAGTTATTGCTCAGCGG (SEQ ID NO: 37) GDGDG-F ACCATGGGTGATGGTGATGGTGTATCTTACAACTCC (SEQ ID NO: 38) GDGDG-R GTAAGATACACCATCACCATCACCCATGGTATATCTCC (SEQ ID NO: 39) GDGEG-F ACCATGGGTGATGGTGAAGGTGTATCTTACAACTCC (SEQ ID NO: 40) GDGEG-R GTAAGATACACCTTCACCATCACCCATGGTATATCTCC (SEQ ID NO: 41) GDGRG-F TACCATGGGTGATGGTCGAGGTGTATCTTACAACTCC (SEQ ID NO: 42) GDGRG-R GATACACCTCGACCATCACCCATGGTATATCTCCTTCT (SEQ ID NO: 43) GDGKG-F TACCATGGGTGATGGTAAAGGTGTATCTT (SEQ ID  NO: 44) GDGKG-R GAAATTTGGAGTTGTAAGATACACCATCACC (SEQ ID  NO: 45) GDGGG-F TACCATGGGTGATGGTGGTGGTGTATCTT (SEQ ID  NO: 46) GDGGG-R GAAATTTGGAGTTGTAAGATACACCACCACC (SEQ ID  NO: 47) GEGEG-F CATGGGTGAAGGTGAAGGTGTATCT (SEQ ID NO: 48) GEGGE-R ACCTTCACCTTCACCCATGGTATA (SEQ ID NO: 49) GEGKG-F CATGGGTGAAGGTGAAGGTGTATCT (SEQ ID NO: 50) GEGKG-R ACCTTCACCTTCACCCATGGTATA (SEQ ID NO: 51) GEGGG-F TACCATGGGTGAAGGTGGTGGTGTATCT (SEQ ID NO: 52) GEGGG-R AGTTGTAAGATACACCACCACCTTCACCCATG (SEQ ID  NO: 53) GEGRG-F TACCATGGGTGAAGGTCGAGGTGTATCT (SEQ ID NO: 54) GEGRG-R AGTTGTAAGATACACCTCGACCTTCACCCATG (SEQ ID  NO: 55) GEGDG-F CATGGGTGAAGGTGATGGTGTATCT (SEQ ID NO: 56) GEGDG-R ACCATCACCTTCACCCATGGTATA (SEQ ID NO: 57) GKGKG-F GGTAAAGGTAAAGGTGTATCTTACAACT (SEQ ID NO: 58) GKGKG-R TACACCTTTACCTTTACCCATGG (SEQ ID NO: 59) GKGDG-F ACCATGGGTAAAGGTGATGGTGTATCTTACAACTCC (SEQ ID NO: 60) GKGDG-R GTAAGATACACCATCACCTTTACCCATGGTATATCTCC (SEQ ID NO: 61) GKGEG-F ACCATGGGTAAAGGTGAAGGTGTATCTTACAACTCC (SEQ ID NO: 62) GKGEG-R GTAAGATACACCTTCACCTTTACCCATGGTATATCTCC (SEQ ID NO: 63) GKGGG-F TACCATGGGTAAAGGTGTTGGTGTATCTTACAAC (SEQ ID  NO: 64) GKGGG-R TACACCAACACCTTTACCCATGGTATATCTCCTT (SEQ ID  NO: 65) GKGHG-F TACCATGGGTAAAGGTCACGGTGTATCTTACAACTCCA (SEQ ID NO: 66) GKGHG-R GATACACCGTGACCTTTACCCATGGTATATCTCCTT (SEQ ID NO: 67) GKGRG-F TACCATGGGTAAAGGTCGAGGTGTATCTTACAACTCCA (SEQ ID NO: 68) GKGRG-R GATACACCTCGACCTTTACCCATGGTATATCTCCTT (SEQ ID NO: 69) GRGRG-F TACCATGGGTCGAGGTCGAGGTGTATCTTACAACTCC (SEQ ID NO: 70) GRGRG-R GATACACCTCGACCTCGACCCATGGTATATCTCCTTCT (SEQ ID NO: 71) GRGDG-F ACCATGGGTCGTGGTGATGGTGTATCTTACAAC (SEQ ID  NO: 72) GRGDG-R ATACACCATCACCACGACCCATGGTAATCTCC (SEQ ID  NO: 73) GRGEG-F ACCATGGGTCGTGGTGAAGGTGTATCTTACAAC (SEQ ID  NO: 74) GRGEG-R ATACACCTTCACCACGACCCATGGTAATCTCC (SEQ ID  NO: 75) GRGKG-F TACCATGGGTCGAGGTAAAGGTGTATCTTACAACTCCA (SEQ ID NO: 76) GRGKG-R GATACACCTTTACCTCGACCCATGGTATATCTCCTT (SEQ  ID NO: 77) GRGGG-F ACCATGGGTCGTGGTGGTGGTGTATCTTACAAC (SEQ ID  NO: 78) GRGGG-R ATACACCACCACCACGACCCATGGTAATCTCC (SEQ ID  NO: 79) GGGKG-F TACCATGGGTGGTGGTAAAGGTGTATCTT (SEQ ID  NO: 80) GGGKG-R GAAATTTGGAGTTGTAAGATACACCTTTACC (SEQ ID  NO: 81) GGGEG-F TACCATGGGTGGTGGTGAAGGTGTAT (SEQ ID NO: 82) GGGEG-R TTGTAAGATACACCTTCACCACCACCCAT (SEQ ID  NO: 83) GHGHG-F TACCATGGGTCACGGTCACGGTGTATCTTACAACTCCA (SEQ ID NO: 84) GHGHG-R GATACACCGTGACCGTGACCCATGGTATATCTCCTT (SEQ ID NO: 85) GKGKGKG-F ACCATGGGTAAAGGTAAAGGTAAAGGTGTATCTTACA (SEQ ID NO: 86) GKGKGKG-R TGGAGTTGTAAGATACACCTTTACCTTTACCTTTA (SEQ ID NO: 87) GKGKGKGKG-F ACCATGGGTAAAGGTAAAGGTAAAGGTAAAGGTGTATCTTAC (SEQ ID NO: 88) GKGKGKGKG-R TGGAGTTGTAAGATACACCTTTACCTTTACCTTTACCTTTA (SEQ ID NO: 89) GKGKGKGKGKG-F ACCATGGGTAAAGGTAAAGGTAAAGGTAAAGGTAAAGGTGT ATCTTAC (SEQ ID NO: 90) GKGKGKGKGKG-R TAAAGGTAAAGGTGGTTCTGTATCTTACAACTCCAAGATACA GAACCACCTTTACCTTTACCCATG (SEQ ID NO: 91) GKGKG-GS-F TAAAGGTAAAGGTGGTTCTGGTTCTGTATCTTACAACTCCA (SEQ ID NO: 92) GKGKG-GS-R AGATACAGAACCAGAACCACCTTTACCTTTACCCATG (SEQ ID NO: 93) GKGKG-GGS-F TAAAGGTAAAGGTGGTGGTTCTGTATCTTACAACTCCA (SEQ ID NO: 94) GKGKG-GGS-R AGATACAGAACCACCACCTTTACCTTTACCCATG (SEQ ID NO: 95) GKGKG-GGGS-F TAAAGGTAAAGGTGGTGGTGGTTCTGTATCTTACAACTCCA (SEQ ID NO: 96) GKGKG-GGGS-R AGATACAGAACCACCACCACCTTTACCTTTACCCATG (SEQ ID NO: 97) GKGKG-GGGGS-F TAAAGGTAAAGGTGGTGGTGGTGGTTCTGTATCTTACAACTC (SEQ ID NO: 98) GKGKG-GGGGS-R AGATACAGAACCACCACCACCACCTTTACCTTTACCCATG (SEQ ID NO: 99)

Example 2: Construction of the Recombinant E. coli

(30) Axygen clean-up kit (purchased from Corning Life Sciences (Wujiang) Co. Ltd.) was used to purify (clean-up) the PCR product containing the recombinant plasmid pET-28b(+)/tag-AcN-M in Example 1, and the specific operations were as follows: 5 μL of the PCR product in Example 1 was added with three sample volumes of PCR-A buffer, mixed thoroughly, transferred to the preparation tube, and subjected to centrifugation at 12000 rpm for 1 min, the filtrate was discard, and 700 μL of W2 buffer was added to the preparation tube, the resulting mixture was subjected to centrifugation at 12000 rpm for 1 min, the filtrate was discard and a W2 buffer was used to wash the leftover twice; pre-thawed competent cells E. coli BL21(DE3) was added with 5 μL of the product, kept in ice bath for 30 min, subjected to heat shock at 42° C. for 90 s, kept in ice bath for 3-5 min again, added with 700 μL of LB liquid medium, and incubated at 37° C. for 1 h. 500 μL of the resulting inoculum was inoculated to LB solid medium containing 0.5 μg/mL kanamycin, spread evenly and incubated at 37° C. for 12-14 h, the single colonies was picked for sequencing verification, thereby obtaining the recombinant E. coli BL21(DE3)/pET-28b(+)/tag-AcN-M. Under the same conditions, the original strain E. coli BL21(DE3)/pET-28b(+)/AcN-M was constructed.

Example 3: Expression of Nitrilase in the Recombinant Escherichia coli

(31) 1. Resting cells: the recombinant E. coli BL21(DE3)/pET-28b(+)/tag-AcN-M strain constructed in Example 2 and stored at −80° C. in a refrigerator was taken out and inoculated into LB medium containing 0.5 μg/mL kanamycin and cultivated at 37° C. for 12-14 h hours to obtain single colonies; a single colony was picked, inoculated to 10 mL of LB medium containing 0.5 μg/mL kanamycin, and cultivated at 37° C. for 8 h, 2 mL of the resulting inoculum was inoculated to 100 mL of fermentation medium containing 0.5 μg/mL kanamycin and cultivated at 37° C. for 2 h, and then 100 μL of IPTG was added (the final concentration was 0.1 mM), and the bacteria solution was induced to produce the enzyme at 28° C. for 12-14 h and subjected to centrifugation at 12,000 rpm for 10 min, the collected wet cells was washed with 0.9% saline twice to obtain the resting cell suspension, and the relative enzyme activity was determined.

(32) 2. Pure enzyme: 1 g of the resting cells obtained by the method in step 1 were suspended in 10 mL of 0.2 M, pH 7.0 Na.sub.2HPO.sub.4—NaH.sub.2PO.sub.4 buffer, ultrasonic breaking was carried out under ice bath condition, the ultrasonic disrupter was set to the power of 40 W, 1 s breaking and 1 s pause, and the total breaking time is 20 min. Then the resulting cell breaking solution was subjected to centrifugation at 12,000×g and 4° C. for 15 min, the cell debris was removed and the crude enzyme solution was collected; a BCA kit was used to detect the protein content, which is the total protein content.

(33) A Ni column was equilibrated with a binding buffer (Binding buffer: 50 mM NaH.sub.2PO.sub.4, 300 mM NaCl, 50 mM imidazole, pH 8.0) at a flow rate of 2 mL/min. Then, the crude enzyme solution was loaded at a flow rate of 2 mL/min, and impurity proteins and weakly adsorbed proteins were eluted with a binding buffer at a flow rate of 2 mL/min. Finally, the Ni column was eluted with an elution buffer (Elution buffer: 50 mM NaH.sub.2PO.sub.4, 300 mM NaCl, 500 mM imidazole, pH 8.0) at a flow rate of 3 mL/min, according to the UV parameters of the protein purifier (Bio-Rad BioLogic LP chromatography system), when UV≥2, the enzyme solution was collected, and when UV≤2, the collection was ended. Then a dialysis bag (Shanghai labsee Biotechnology Co., Ltd.) was used for dialysis in a 50 mM Na.sub.2HPO.sub.4—NaH.sub.2PO.sub.4(pH 7.0) buffer overnight, and the retentate was the pure nitrilase and it was stored in an ice bath for use. A BCA kit was used to detect the protein content, which was the protein content of the supernatant.
Solubility (%)=supernatant protein amount/total protein amount×100%.

(34) TABLE-US-00002 TABLE 2 Comparison of relative enzyme activity and  solubility of the recombinant strains  containing different peptide tags Relative cell  Solubility Tags enzyme activity (%) (%) AcN-M 100 53.6 GDGDG (SEQ  55.8 60.6 ID NO: 9) GDGEG (SEQ  50.9 60.8 ID NO: 10) GDGRG (SEQ  25.0 60.1 ID NO: 11) GDGKG (SEQ  35.9 70.9 ID NO: 12) GDGGG (SEQ  19.0 62.1 ID NO: 35) GEGEG (SEQ  18.3 68.8 ID NO: 13) GEGKG (SEQ  72.6 84.7 ID NO: 14) GEGGG (SEQ  5.5 74.6 ID NO: 15) GEGRG (SEQ  64.5 83.4 ID NO: 16) GEGDG (SEQ  45.6 60.8 ID NO: 17) GKGKG (SEQ  237.3 87.9 ID NO: 3) GKGDG (SEQ  32.9 70.9 ID NO: 18) GKGEG (SEQ  154.1 84.7 ID NO: 4) GKGGG (SEQ  40.5 75.8 ID NO: 19) GKGHG (SEQ  109.6 87.5 ID NO: 5) GKGRG (SEQ  103.6 87.6 ID NO: 20) GRGRG (SEQ  115.6 86.7 ID NO: 6) GRGDG (SEQ  23.0 60.1 ID NO: 21) GRGEG (SEQ  60.5 83.4 ID NO: 22) GRGKG (SEQ  65.5 82.4 ID NO: 23) GRGGG (SEQ  101.6 84.7 ID NO: 7) GGGKG (SEQ  18.4 70.4 ID NO: 24) GGGEG (SEQ  0 74.6 ID NO: 25) GHGHG (SEQ  108.2 83.8 ID NO: 8)

(35) According to Table 2, the relative enzyme activity results showed that the enzyme activity of recombinant E. coli BL21(DE3)/pET-28b(+)/GKGKG(SEQ ID NO: 3)-AcN-M is 2.37 times that of the original strain, and the insertion of the tag hardly affected the normal growth of the recombinant E. coli. The protein electrophoresis experiment was shown in FIG. 3, the soluble expression (supernatant protein amount/total protein amount) of the recombinant strain was significantly enhanced, the solubility of the original strain was only 53.6%, whereas the solubility of the recombinant strain reached 87.9%.

(36) 4. The effect of the length of the polypeptide tag sequence on the solubility of the enzymes of the original strain and the recombinant strain E. coli BL21(DE3)/pET-28b(+)/tag-AcN-M

(37) TABLE-US-00003 TABLE 3 Comparison of relative enzyme activity and  solubility of recombinant strains containing  polypeptide tags with different lengths Relative cell  Solubility Tag enzyme activity (%) (%) AcN-M  100 53.6 GKGKG (SEQ 237.3 87.9 ID NO: 3) GKGKGKG (SEQ 222.9 90.9 ID NO: 26) GKGKGKGKG (SEQ 111.4 88.6 ID NO: 27) GKGKGKGKGKG 35.9 86.8  (SEQ ID NO:  28)

(38) According to Table 3, the influence of the polar amino acids in the polypeptide tags on the solubility was more obvious. The solubility of the nitrilase with the polypeptide tag containing 3 lysine residues reached 90.9%, while the solubility of the nitrilase with tags in other length did not change dramatically.

(39) 5. The effect of the linker between the polypeptide tag and the target gene on the solubility of the original strain and the recombinant strain E. coli BL21(DE3)/pET-28b(+)/tag-AcN-M

(40) TABLE-US-00004 TABLE 4 Comparison of relative enzyme activity and  solubility of recombinant strains containing  different linkers Relative cell  Solubility Linker enzyme activity (%) (%) GKGKG (SEQ 237.3 87.9 ID NO: 3) GKGKG-GS (SEQ 219.6 67.3 ID NO: 31) GKGKG-GGS 150.5 70.5 (SEQ ID NO: 32) GKGKG-GGGS  90.2 80.4 (SEQ ID NO: 33) GKGKG-GGGGS  59.6 89.1 (SEQ ID NO: 34)

(41) According to Table 4, the linkers played an very important role in polypeptide tags and target genes. The longer the linker was, the higher the solubility of nitrilase was, but the stronger the inhibitory effect on its catalytic activity was. And the catalytic activity of the recombinant strain cells which contained the polypeptide tag combined with the longest linker was as low as 59.6%.

(42) According to Table 2 to Table 4, the recombinant strain E. coli BL21(DE3)/pET-28b(+)/GKGKG(SEQ ID NO: 3)-AcN-M was selected for subsequent experiments.

Example 4: Effect of Temperature on Cell Enzyme Activity of the Original Strain and the Recombinant Strain E. coli BL21(DE3)/pET-28b(+)/GKGKG(SEQ ID NO: 3)-AcN-M

(43) 1 ml of a reaction system was constructed by mixing 900 μL of 200 mM, pH 7.0 Na.sub.2HPO.sub.4—NaH.sub.2PO.sub.4 buffer with 100 μL of the resting cell suspension prepared by the method in Example 3 to make the amount of the resting cells added to the reaction system was 10 g/L, maintained on an oscillation reactor for 10 minutes at a set temperatures of 20° C., 25° C., 30° C., 35° C., 40° C., 45° C., 50° C., 55° C., 60° C., 65° C. and 70° C., respectively, added with 1-CN with the final concentration of 0.2 M, and reacted on the oscillation reactor at 800 rpm for 10 minutes. Then the sample was subjected to centrifugation, the supernatant was picked, and the concentration of 1-CA in the supernatant was analyzed by HPLC. Under the same conditions, with the original strain E. coli BL21(DE3)/pET-28b(+)/AcN-M as a control, the results were shown in FIG. 4, the optimal temperature for the recombinant strain was 55° C., which is the same as the original strain, and at the same temperature, the cell enzyme activity of the recombinant strain was higher than that of the original strain.

Example 5: Effect of pH on Cell Enzyme Activity of the Original Strain and the Recombinant Strain E. coli BL21(DE3)/pET-28b(+)/GKGKG(SEQ ID NO: 3)-AcN-M

(44) 1 mL of a reaction system was constructed by adding 900 μL of buffers with different pH values (0.1 M, pH 4.0-6.0 citric acid-sodium citrate buffer; 0.2 M, pH 6.0-8.0 Na.sub.2HPO.sub.4—NaH.sub.2PO.sub.4 buffer) to 100 μL of the resting cell suspension prepared by the method in Example 3 to make the amount of the resting cells added to the reaction system was 10 g/L, preheated on an oscillation reactor for 10 minutes at 35° C., added with 1-CN with the final concentration of 0.2 M, and reacted at 800 rpm for 10 minutes. Then the sample was subjected to centrifugation at 12,000 rpm for 5 min, the supernatant was picked, and the concentration of 1-CA in the supernatant was analyzed by HPLC. Under the same conditions, with the original strain E. coli BL21(DE3)/pET-28b(+)/AcN-M as a control, the results were shown in FIG. 5, the optimal pH for the recombinant strain was 8.0, which is the same as the original strain, and at the same pH, the cell enzyme activity of the recombinant strain was higher than that of the original strain.

Example 6: Comparison of the Cell Catalytic Efficiency of the Original Strain and the Recombinant Strain E. coli BL21(DE3)/pET-28b(+)/GKGKG(SEQ ID NO: 3)-AcN-M

(45) 5 g of the wet cells of recombinant E. coli BL21(DE3)/pET-28b(+)/GKGKG(SEQ ID NO: 3)-AcN-M prepared by the method of Example 3 were suspended in 100 mL of Na.sub.2HPO.sub.4—NaH.sub.2PO.sub.4 buffer (0.2 M, pH=7.0), 1.48 g and 2.2 g of 1-CN were added (the final concentrations were 1 M and 2 M respectively), the reaction was carried out in a constant temperature water bath at 35° C. for 12 h. Samples were taken every 30 minutes, and subjected to centrifugation at 12,000 rpm for 5 minutes, then the supernatant was taken, and the concentrations of 1-CA and 1-CN in the supernatant were analyzed by HPLC. Under the same conditions, comparing with the original strain E. coli BL21(DE3)-AcN-M, the results were shown in FIG. 6. When catalyzing 1 M 1-CN, the reaction time required for the recombinant strain was 2 h, the reaction time of the original strain was 2.5 h, and the conversion rate of both reached more than 99%; however, in the case of 2 M substrate, after 12 h of reaction, the conversion rate of the original strain on the substrate was 77.5% due to the high substrate concentration, and the conversion rate of the recombinant strain reached 81.7% under the same conditions due to the amount increase of functional protein.

Example 7: Preparation of Gabapentin-Lactam Using 1-Cyanocyclohexyl Acetic Acid in the Conversion Solution Produced by the Whole Cell Catalyst

(46) The conversion solution from Example 6 was subjected to centrifugation (8000 rpm, 10 min) to remove the bacterial cells, and the collected filtrate was 1-cyanocyclohexyl acetic acid. 150 mL of the filtrate was placed in a hydrogenation reactor, 1.5 g of Raney nickel (RTH-4110), 1 mL of triethylamine (analytical grade) and 500 μL of formic acid (analytical grade) are added; nitrogen was pumped in to replace the air and this operation was repeated 3 times to ensure that there was no air in the reactor; then hydrogen was pumped in again (the pressure of the reaction was maintained at 2 Mpa), and the reaction was carried out at 1000 rpm for 8 hours; and after cooling, the Raney nickel was recovered by filtration, and the resulting filtrate was added with isovolumetric dichloromethane for extraction, and after standing and stratification, the organic phase was subjected to rotary evaporation at 40° C., the obtained solid was gabapentin-lactam, and the dichloromethane could be recycled for reuse. The experimental results showed that the conversion solution obtained from the whole cell catalysis can be directly used in the subsequent hydrogenation reaction, and the substrate conversion rate reached 99.6%, the yield rate of gabapentin-lactam was 95.8%, and the substrate conversion rate and the product yield met the requirements for industrially produced chemicals.

Example 8: Preparation of Pharmaceutical Chemicals-Gabapentin from Gabapentin-Lactam Obtained by Hydrogenation

(47) 76.7 g of the gabapentin-lactam obtained in Example 7 was dissolved in 500 mL of 6 M HCl solution and subjected to heating reflux for 2.5 h, after cooling to room temperature, isovolumetric dichloromethane was added extraction, after standing and stratification, the water phase was subjected to crystallization at 0-4° C. and suction filtration, the obtained white solid was ground with acetone and subjected to filtration to remove the acetone and drying at 40° C. to obtain gabapentin hydrochloride; all the obtained gabapentin hydrochloride was dissolved in 500 mL of water, heated to 40° C. and stirred at 300 rpm to be fully dissolved, after the pH was adjusted to 7.0-7.5 by 6 M NaOH, 125 mL of toluene was added and stirred at 500 rpm for 30 min; and after the stirring, the mixture was subjected to crystallization at 0-4° C. and filtration to obtain the white solid which was crude gabapentin, and the crude gabapentin was subjected to heavy crystallization with 60% methanol or isopropanol and drying to obtain gabapentin. All the unused samples and used reagents involved in the extraction, suction filtration, and filtration operations of the above experiments can be recycled. The experimental results showed that the yield of gabapentin hydrochloride reached 81%, the yield of gabapentin obtained by recrystallization reached 73.6%, and the yield of gabapentin after repeated recovery of the mother liquor for 3-5 times reached 93.2%. The yields of gabapentin and intermediates thereof have all reached a relatively high level, and multiple times of sample and reagent recovery steps reduced costs and waste water generation, which met the concept of green chemistry, and realized the high efficient production of the chemical-enzymatic method of pharmaceutical chemicals.

Example 9: Application Performance of the Polypeptide Tags on Nitrilase from Other Sources

(48) The preferred polypeptide tag GKGKG(SEQ ID NO: 3) in Example 1 was linked to N-terminal of nitrilase LNIT5 (Accession No.: AAR97494.1), nitrilase No. 385,386 (Accession No.: AY487562) and nitrilase derived from R. rhodochrous K22 (Accession No.: Q02068.1) (hereinafter referred to as RrNit) according to the method of Example 1. of nitrilase. The solubility and relative cell enzyme activity were determined according to the method of Example 3.

(49) The results of the experiment were shown in Table 5 below, the solubility of the three different nitrilase enzymes was improved to different degrees. Among them, LNIT5 increased the most, reaching 1.9 times; and when the three nitrilase enzymes used 1-CN as the substrate, improvement level of the cell enzyme activity exceeded 150%, which fully demonstrated the universal applicability of the polypeptide tag to nitrilase from other sources.

(50) TABLE-US-00005 TABLE 5 Comparison of relative enzyme activity and solubility of the nitrilase from different sources Relative cell Solubility enzyme activity improvement Nitrilase (%) factor LNIT5 190.6 1.9 No. 385,386 160.5 1.3 RrNit 173.6 1.5

Example 10 Comparison of the Efficiency of the Original Strain and the Recombinant Strain E. coli BL21(DE3)/pET-28b(+)/GKGKG(SEQ ID NO: 3)-AcN-M in the Catalytic Synthesis of Clopidogrel Intermediate (2-Chloromandelic Acid)

(51) 5 g of the wet c of the recombinant strain E. coli BL21(DE3)/pET-28b(+)/GKGKG(SEQ ID NO: 3)-AcN-M prepared by the method in Example 3 were suspended in 100 mL of Na.sub.2HPO.sub.4—NaH.sub.2PO.sub.4 buffer (0.2 M, pH=7.0), added with o-chloromandelonitrile with the final concentrations of 1 M and 2 M respectively, and reacted in a constant temperature water bath at 35° C. for 12 h. Samples were taken every 30 minutes and subjected to centrifugation at 12,000 rpm for 5 minutes. The supernatant was taken to detect the concentrations of 2-chloromandelic acid and o-chloromandelonitrile by HPLC. Under the same conditions, with the original strain E. coli BL21(DE3)-AcN-M as a control, the results were shown in FIG. 6. When catalyzing 1 M o-chloromandelonitrile, the reaction time of the recombinant strain was 3 h, and the reaction time of the original strain was 4 h, and the conversion rate of both reached more than 99%; however, in the case of 2 M substrate, due to the high substrate concentration, after 12 h of reaction, the conversion rate of the original strain to the substrate was 60.4%, while the recombinant strain reached a conversion rate of 79.4% under the same conditions due to the increase in the amount of functional protein.

(52) TABLE-US-00006 TABLE 6 Comparison of the efficiency of catalyzing the synthesis of clopidogrel intermediate by the original strain and the recombinant strain Substrate concentration Reaction Conversion Nitrilase (M) time(h) rate(%) E. coli BL21(DE3)/pET- 1 4 99.9 28b(+)/AcN-M 2 12 60.4 E. coli BL21(DE3)/pET- 1 3 99.9 28b(+)/GKGKG-AcN-M 2 12 79.4

Example 11 the Application Effect of the Preferred Polypeptide Tag in Deacylase to Transform Echinocandin B to Prepare the Echinocandin B Nucleus

(53) The preferred polypeptide tag GKGKG(SEQ ID NO: 3) of Example 1 was linked to a deacylase (NC_001136.10) according to the method of Example 1, to construct the recombinant strain E. coli BL21(DE3)/pET-28b(+)/GKGKG(SEQ ID NO: 3)-DEA (deacylase), its solubility and enzyme activity were determined. The solubility of the deacylase with the polypeptide tag was 2.8 times higher than that of the deacylase without polypeptide tag, and its specific enzyme activity was increased by 358.5%.

(54) The catalyst in Example 10 was replaced by 50 g/L resting cells of the recombinant E. coli BL21(DE3)/pET-28b(+)/GKGKG(SEQ ID NO: 3)-DEA (deacylase), and the substrate was replaced by Echinocandin B with the final concentrations of 2 g/L, the reaction time was changed to 24 h, and the others were the same as in Example 10. The substrate conversion rate reached 60.6%, while the conversion rate of the deacylase without the polypeptide tag was only 35.7%. It shows that the peptide tag has a certain degree of scalability, but how it can improve the solubility of other enzymes requires deeper discussion.

(55) Although the present invention has been disclosed the above preferred examples, they are not intended to limit the present invention. Anyone familiar with the technology can make various changes and modifications without departing from the spirit and scope of the present invention. Therefore, the protection scope of the present invention should be defined by the claims.