Method for expanding stemness and differentiation potential of pluripotent cells
11814650 · 2023-11-14
Assignee
Inventors
- Marcos Malumbres (Guadalix de la Sierra, ES)
- Maria Salazar-Roa (Madrid, ES)
- Marianna Trakala (Cambridge, MA, US)
- Mónica Alvarez-Fernandez (Madrid, ES)
Cpc classification
C12N2501/999
CHEMISTRY; METALLURGY
C12N2506/45
CHEMISTRY; METALLURGY
C12N5/0696
CHEMISTRY; METALLURGY
International classification
Abstract
Method for expanding stemness and differentiation potential of pluripotent cells. The invention is based on the finding that increasing micro RNA-203 levels in induced pluripotent stem (iPSCs) or embryonic stem (ESCs) cells improves the quality cell fate potential and ability of these cells to differentiate into multiple cell lineages and to reach further maturation properties without interfering with their self-renewal properties. This effect is mediated through the mi R-203-dependent control of de novo DNA methyltransferases Dnmt3a and Dnmt3b, which in turn regulate the methylation landscape of pluripotent cells. The effect can be achieved by overexpression of micro RNA-203 or by adding micro RNA-203 or analogues thereof to the cell culture medium and can be observed using a variety of cellular and in vivo models. The generated cells are naïve pluripotent cells with an improved capacity to differentiate, that can be used to obtain more efficiently differentiated and mature cells proficient for regenerative medicine strategies.
Claims
1. A method for dedifferentiating pluripotent stem cells to a more-naive state, which comprises: culturing pluripotent cells and exposing the pluripotent cells to miR-203 or an analogue thereof.
2. The method according to claim 1, wherein the cells are induced pluripotent stem cells or embryonic stem cells.
3. The method of claim 1, wherein exposing occurs for three to five days.
4. The method of claim 1, wherein the exposing comprises transducing the pluripotent cells with an expression vector that encodes miR-203.
5. The method of claim 1, wherein the exposing comprises adding to the culture medium miR-203 or the analogue thereof.
6. The method of claim 5, wherein the miR-203 is selected from hsa-miR-203a-3p or mmu-miR-203-5p.
7. The method of claim 1, wherein the exposing comprises transfecting the pluripotent cells with the miR-203 or the analogue thereof.
8. The method of claim 7, wherein the miR-203 is selected from hsa-miR-203a-3p or mmu-miR-203-5p.
9. The method of claim 1, wherein the exposing comprises adding to the culture medium the miR-203 analogue and wherein the miR-203 analogue is selected from: a) a modified RNA wherein at least one of the nucleotides is replaced by a chemically modified nucleotide, wherein the chemical modification is selected from the group of: i. replacing one or more phosphate bonds by phosphorothyoate bonds, ii. one or more modifications at the 2′ position of the sugar moiety selected from 2′-O-methyl or 2′-O-methoxyethyl modifications, and/or iii. one or more modifications in the ribose moiety selected from the group of: those that give rise to a link connecting the oxygen at 2′ with the carbon at 4′, thus blocking the ribose in the conformation 3′-endo (LNAs: locked nucleic acids) or 2′-O, 4′-C ethylene bridged nucleic acids (ENA); the replacement of the sugar backbone by an amide-containing backbone such as an aminoethylglycine backbone, as in peptide nucleic acids (PNAs); and use of PMOs (nucleic acids where the ribose moiety is replaced by a morpholine group); b) a double stranded RNA with a duplex region of between 16 and 31 nucleotides in length and which contains a fragment which is at least 50% identical in their sequence to the sequence of nitrogenous bases of the RNA molecule represented by SEQ ID NO: 1, and c) optionally, additionally comprising at least one end of at least one of the strands a conjugate moiety comprising one or more units of cholesterol, cholestanol, stigmastrol, cholanic acid and ergosterol and, also optionally and additionally, a linker moiety that attaches the conjugate moiety to the strand, and d) also optionally and additionally, presenting one or more mismatches among the two strands.
10. The method of claim 1, wherein the dedifferentiating is characterized by an improvement of differentiation potential of the dedifferentiated pluripotent stem cells to cardiomyocytes.
11. The method of claim 1, wherein the pluripotent stem cells are obtained by contacting somatic differentiated cells with a nuclear reprogramming factor comprising a gene product of each one of the following families: Oct family, Klf family, Myc family and Sox family before the exposure to miR-203 or an analogue thereof.
12. A method for obtaining differentiated cells comprising i) obtaining dedifferentiated pluripotent stem cells according to the method of claim 1, and ii) differentiating the dedifferentiated pluripotent stem cells to obtain differentiated cells.
13. The method of claim 12, wherein the differentiated cells are selected from the group consisting of cardiomyocytes, neural cells, glial cells, chondrocytes, and pancreatic cells.
14. The method of claim 1, wherein the amount of miR203 is sufficient to down-regulate Dnmt3a, Dnmt3b, or a combination thereof.
15. The method of claim 1, wherein said exposing results in a genome-wide increase of unmethylated CpG compared to methylated CpG.
16. The method of claim 1, which further comprises exposing the cells to a composition comprising a MEK inhibitor (PD0325901), a GSK3 inhibitor (CHIR99021), and a cytokine leukemia inhibitory factor (LIF).
Description
BRIEF DESCRIPTION OF THE FIGURES
(1)
(2)
(3)
(4)
(5)
(6)
(7)
(8)
(9)
(10)
(11)
(12)
(13)
(14)
(15)
(16)
(17)
(18)
(19)
(20)
DETAILED DESCRIPTION OF THE INVENTION
(21) The present invention, as indicated above, provides a method for improving the efficiency of pluripotent cells, particularly iPSCs, and therefore, generating naïve pluripotent cells more suitable for therapeutic approaches, very specially for their differentiation and maturation into differentiated cells useful for regenerative purposes.
(22) The invention is based in the results of the assays disclosed in the Examples of the present application, which assays demonstrate that just a transient exposure to miR-203 sequences strengthen stemness potential of pluripotent cells and favours differentiation.
(23) In the Examples below it is shown how transient over-expression of a single microRNA (miR-203), or an analogue thereof, potentiates differentiation of pluripotent cells (both embryonic stem cells and induced pluripotent cells) maintaining at the same time their stemness capacity. miR-203 significantly improves not only stem cell markers expression, teratoma formation containing cell types from the three primitive embryonic layers, and differentiation efficiency to any lineage. Even more importantly, miR-203 transient expression on iPSCs notably favors the stemness capacity of those cells to produce live-born progenies, as ESCs do. Both chimera contribution (of particular interest, in tetraploid complementation assays) and germline transmission are dramatically increased when iPSCs or ESCs have been exposed to a transient induction of the microRNA. Thus, it can be said that the pluripotent cells resulting from applying the method of the present invention to iPSCs (that is, by submitting iPSCs to an increased level of miR-203 transiently) show properties that are proper of pluripotent cells in the naïve state, so that the resulting cells can be considered naïve pluripotent cells. These results are consistent with the additional study carried out by the present inventors and disclosed in the present application, where miR-203 is identified as a microRNA preferentially expressed in the 2C-morula stages during preimplantation development in the mouse embryo.
(24) It is remarkable that the mentioned effects, particularly the expansion of differentiation potential of pluripotent cells and the strengthening of the stemness potential, are achieved by increasing the level of miR-203 to which the cells are exposed (by transient expression from a vector previously introduced in the cell or by addition of miR-203 to the culture media of the cells), because miR-203 was considered by some authors as a stemness repressor (see Yi et al., 2008; Volinia et al., 2014) which limits stemness potential in the skin and the asymmetry hsa-miR-302(high)/has-miR-203a (low) has been found to be associated with stemness. In the same line, even though one skilled in the art had had knowledge of the review of Huang et al. (Huang et al., 2011) and had read that miR-203 cooperatively modulate Sox2 and Klf4 without having verified what it is commented indeed in the cited source of information for that statement (Wellner et al., 2009, where, as commented above, it is said that miR-203 cooperates with miR-200c and miR-183 to suppress stem factors), that one skilled in the art would have expected that an increase in miR-203 would lead to deficient stemness, because miR-203 represses targets. It can be said that every information in the prior art would lead to predict that miR-203 expression, whatever the environment or differentiation state of the cell, would repress, and not enhance, stemness potential.
(25) Thus, it was not expectable that an increase in miR-203 levels will lead to improved stemness in ESCs or iPSCs that could be considered truly pluripotent and had not begun the process of commitment to a particular differentiated cell type or tissue, such as keratinocytes. In connection to that, it is important to remark that the assays disclosed in the present application and the results obtained are different from those described by Nissan et al. (Nissan et al., 2011) and do not interfer with them, because Nissan et al., as discussed above, reported that miR-203 becomes relevant in keratinocyte differentiation once the hESCs have been already committed to epidermal differentiation by an additional treatment (specifically, treatment with BMP4), which are conditions in which miR-203 becomes a critical factor involved in early keratinocyte commitment and that can be considered already known since 2008 (see Yi et al., 2008). And this is different from what is disclosed in the present application, where it is shown that the transient induction of miR-203 is relevant for pursuing a pluripotent naïve state, which is deriving lately in improved differentiation commitment. These two concepts are completely different, as well as their implications in regenerative medicine. In other words: transient expression of miR-203 acts as a stimulator of stemness potential of pluripotent cells, whatever their subsequent differentiation commitment is. This is shown, for instance, in the assays of the present application related to embroid body and teratoma, where it can be observed an improved differentiation capacity to the three germ layers of those pluripotent cells shortly exposed to miR-203, compared to their control counterparts.
(26) Moreover, the results of the assays disclosed in the present application were also difficult to conceive having knowledge of the conclusions achieved after studies of the influence of miR-203 in nuclear survivin levels in hESCs (Kapinas et al., 2015), which studies had led to propose miR-203 as an inhibitor of pluripotency acting by negatively regulating survivin expression.
(27) It is significant that de novo DNA methyltransferases likely play an important role in the effects observed after miR-203 transient overexpression. Significant improvement of the efficiency of iPS cells in the generation of quimeras and tetraploid complementation assays, that allow these cells to form complex teratomas and embryo-like structures in vivo, seem to be mediated, mechanistically, by direct miR-203-dependent repression of de novo DNA methyltransferases Dnmt3a and Dnmt3b, leading to erasure of global DNA methylation of pluripotent cells.
(28) DNA methylation dynamics have been previously widely described, controlling both pluripotency and differentiation processes. General DNA hypomethylation and maintenance of genomic imprints are known to be essential to assure chimeric contribution and germline transmission, as proof of pluripotency. While the naïve pluripotent state is characterized by global DNA hypomethylation, the differentiation status is correlated with higher levels of methylation and upregulation of the de novo methyltransferases Dnmt3a and Dnmt3b, as well as their counteracting protein Dnmt31.
(29) Interestingly, downregulation of those de novo Dnmts is observed in cells of early preimplantation epiblasts, accompanying upregulation of pluripotency-related genes. Those features are recapitulated in the naïve state, and can be sustained in vitro under certain conditions. The derivation of embryonic stem cells in vitro with intact genomic imprints, even in the context of global DNA hypomethylation, is not easy to achieve. Imprint instability is normally assessed in some ESC lines and cultures, and the DNA methylation landscape is commonly altered, leading to low to medium efficiency in chimera contribution, germline transmission and differentiation. However, in our system, we have observed a global DNA hypomethylation in miR-203 transient-overexpressing pluripotent cells, while genomic imprints remain unaltered. We have described in detail how miR-203 targets the de novo methyltransferases Dnmt3a and Dmt3b, reducing global DNA methylation and therefore favoring naïve pluripotency. Dnmt1 remains unaffected in these conditions, presumably avoiding DNA methylation erase on genomic imprints. This is another proof of concept of the naïve state of miR-203 transient over-expressing IPSCs and ESCs.
(30) Lack of these DNA methyltransferases in ESCs is known to induce progressive hypomethylation of chromatin with passages (Liao et al., 2015). Expression of miR-203-resistant Dnmt3a and Dnmt3b cDNAs rescue the phenotypes induced by miR-203 (
(31) Therefore, the method of the present invention has several important differences with the previously known methods directed to improve the quality of cultured pluripotent cells that can be summarized as follows: i) The method can be used in already-established pluripotent clones (iPSCs and ESCs) and it is therefore an additive procedure to the methods discussed above, and combinable with them. This is an important difference with regard to most variants of Yamanaka's original protocol, where the efficiency or the safety of the method are trying to be increased by replacing some of original Yamanaka's factors by other compounds or by adding additional compounds in order to carry out the reprogramming process. In the present case, the additional compound, miR-203, is added to already-established iPSCs or ESCs. ii) Pluripotent cells exposed to miR-203 display enhanced function both in vitro and in vivo in the generation of differentiated and functional cells. iii) The effect of the exposure to pluripotent cells to increased levels of miR-203 can also be achieved easily by using synthetic small RNA molecules that are analogues of miR-203, such as specific mimics, that are commercially available. iv) Mechanistically, miR-203 has been observed to exert its effect by erasing the epigenetic memory of pluripotent cells, a factor known to act as a barrier in the establishment of pluripotent cells. This is another important difference with the methods where demethylases, for instance, are used during the reprogramming process to pluripotent cells, because that demethylation is irreversible or induces cytotoxicity, what makes the obtained cells useless for regenerative medicine. The present method, transiently exposing already-established iPSCs or ESCs to increased levels of miR-203 (or an analogue thereof), provokes a transient genome-wide hypomethylation that improves their pluripotency and, since such hypomethylation is transient and reversible, it also permits an expansion of their differentiation potential. Thus, the present method gives rise to naïve pluripotent cells that might be useful for obtaining gold differentiated cells applicable in regenerative medicine. v) The exposure of already-obtained pluripotent cells to increased levels of miR-203 (or analogues thereof) levels (for instance, and preferably, by transient expression) means a safer alternative to some known methods, such as the methods where DNA methylation inhibitors such as AZA are used during reprogramming, since AZA is known to induce cell death. In that sense, it must be also pointed out that, differentially to other factors, miR-203 is a well established tumor suppressor, whose use also allows avoiding concerns related to the use of oncogenic factors during reprogramming (Tapia et al., 2016).
(32) As can be seen in the Examples below, the pluripotent cells obtained after carrying out the method of the present invention exhibit improved stemness potential, when compared with their control counterparts, which can be observed thanks to the following features, which are characteristic of pluripotent cells in a naïve state: (i) In vitro differentiation to embryoid bodies (EBs) is significantly increased compared to control iPSCs. EBs generated from iPSCs which have undergone the steps of the method of the invention (specifically, tKI iPSC-derived EBs) grow faster, differentiate better, show a higher percentage and efficiency at beating and exhibit a perfect architecture of the three germ layers. The differentiation and functionality of their cells is also revealed by the formation of long cavities, which is rarely found in control iPSC-derived EBs; (ii) In vivo differentiation to teratomas is also dramatically improved when iPSCs that have undergone the steps of the method of the invention (specifically, tKI iPSCs) are injected in mice, when compared with their respective controls. The level of differentiation of the three germ layers is notorious, and some atypical tissues such as pancreas, bone marrow, cartilage or even extra-embryonic tissue (placenta) are easily found in tKI iPSC-derived teratomas. When these tKI iPSCs are injected intraperitoneally in mice, they are able to develop complex embryo-like structures, never found in wild-type iPSC injections. Those structures are characterized by the expression of several markers of embryonic development, the three germ layers and extra-embryonic tissues; (iii) The expression of embryonic 2-cell-stage markers, such as certain retrotransposons, is higher in tKI iPSCs when compared to their WT counterparts. Moreover, the transcriptomic profile of those iPSCs illustrates how tKI iPSCs activate a number of signalling networks involved in development, morphogenesis, stemness maintenance, chromatin organization and cell fate commitment, proving their naïve state. Of interest, Principal Component Analysis, Hierarchical Clustering and Heatmap analysis of the RNA sequencing samples demonstrated the significant proximity between naïve tKI iPSCs and ES cells, compared to WT iPSCs. Tetraploid complementation assay is the most stringent assay to test pluripotency potential of iPSCs. There, tetraploid blastocysts are produced via the fusion of 2-cell stage embryos and are developmentally defective by only forming extraembryonic tissues in vivo. As expected, ES cells with full pluripotency compensate for the developmental deficiency of tetraploid embryos, and a full-term organism can be produced from ESCs together with extraembryonic tissues derived from such tetraploid embryos. While the efficiency to generate live-born progenies is around 20% for ESCs in such assays, iPSCs usually fail this stringent test and do not support “all-iPSC” mice. However, miR-203 transiently-expressing iPSCs proficiently generate live-born pups by 4n complementation, to a similar extent of that achieved using WT ESCs. Even more, those ESCs that have been exposed to transient miR-203 induction exhibit a significant higher competency in this test when compared to WT ESCs. The data clearly asserts that miR-203 improves the efficiency of iPSC technology. (iv) Chimera contribution is definitely the best proof of concept to demonstrate the value of pluripotent (iPS or ES cells). The experiments of cell aggregation and even more importantly, tetraploid complementation assays show how tKI iPSCs contribute to chimera generation and germline transmission significantly more than their respective control iPSCs.
(33) Additional data reinforcing the finding that exposure of iPSCs of ESCs to increased levels of miR-203 promotes naïve pluripotency and that the method of the present invention is advantageous with regard to other previously described methods aimed to sustain pluripotency in vitro are the following ones: (i) miR-203 expression peaks at the 2-cell stage and in morula, in agreement with the data showing that this microRNA favors the expression of transcripts typical of the 2-cell stage. This observation supports the fact that miR-203 is relevant for acquiring naive pluripotency in vivo, and thus it might be used as an advantage for boosting naive pluripotency in vitro. (ii) Expression of miR-203 in PSCs induces the expression of genes typically expressed in the embryonic 2-cell stage. In addition to a specific 2-cell reporter, the expression of transcripts included in the “2-cell transcriptome” have been analysed in detail. The fact that miR-203 induces 281 out of the top 282 genes included in the 2-cell signature is a remarkable finding. Again, these observations reinforce the idea of miR-203 promoting naïve pluripotency. (iii) miR-203 also significantly improves developmental potential in 2i/LIF conditions, the former standard for maintaining stemness potential. In addition, the analysis of Imprinting Control Regions shows that miR-203 has little effect in these regions compared to 2i/L conditions, thus explaining the significant improvement of miR-203-treated cells in multiple in vivo assays. These results support the preferable use of miR-203 over the former methods aimed to sustain pluripotency in vitro (iv) The effect of miR-203 has been also tested in human cells, showing similar effects in the expression of 2-cell markers, and differentiation potential. Thus, observations in mouse pluripotent cells are extended to human pluripotent cells. (v) The relevance of Dnmt3a/b as relevant targets is shown by rescue assays as well as Dnmt3a/b knockdown in WT PSCs, thus mimicking miR-203. These data reinforce the identification of de novo DNA methyltransferases as miR-203 targets responsible for the described phenotype.
(34) Additionally, pluripotent cells exposed to miR-203 displayed enhanced differentiation and maturation potential, as is demonstrated by the following found effects: (i) The number of tissues and level of differentiation is increased in tKI cells (pluripotent cells that have undergone the steps of the method of the present invention), as observed in the embryoid body differentiation assays, formation of complex teratomas and embryo-like structures including differentiated tissues usually not observed such as bone marrow, placental tissues or exocrine pancreas. In addition, teratomas derived from tKI cells, but not control teratomas, contain cells positive for the hormone insulin, suggesting the presence of differentiated pancreatic beta cells, and further illustrating the expanded capacity of tKI cells in differentiation to multiple cellular lineages. (ii) Differentiation and maturation of iPSCs into cardiomyocytes is improved as detected by the expression of maturation markers as well as functional assays. (iii) Differentiation of neonatal cardiomyocytes is improved as well as the maturation level they reach after exposure to miR-203. (iv) Tissue regeneration assays (assays that typically are not included in reports of improved pluripotent cells, given the complication for cells improved in vitro in performing properly in complex regeneration assays in vivo show that miR-203 expression significantly potentiates heart regeneration and overall survival after cardiac injury, a result that strengthen the differentiation potential of pluripotent cells submitted to miR-203 treatment and their functionally in vivo and that suggests the relevance of this microRNA in regeneration medicine.
(35) It is remarkable that the method of the present invention differs from the methods and means for deriving cardiomyctes from iPSCs or ESCs disclosed in International Patent Application WO2014201254A1 in that microRNAs of the let-7 family are the only ones mentioned in said International Patent Application as important microRNAs for in vitro cardiac maturation starting from pluripotent cells and other microRNAs are not mentioned. Then, the present invention provides an alternative and not previously suggested method for cardiomyocyte differentiation, starting from pluripotent cells that have been previously submitted to a transient increased of level of miR-203 (either by transient expression in the cells or transient exposure of the cells to miR-203 or an analogue thereof by addition to their culture medium), which pluripotent cells are later submitted to cardiomyocyte differentiation achieving an improve in effectiveness, since the resulting cardiomyocytes are mature and functional.
(36) Given their potential utility for feature clinical applications, it can be considered that it is an important embodiment of the method of the present invention that one wherein the enhancement of differentiation potential of the cells is characterized by an improvement of differentiation efficiency, for instance to cardiomyocytes, but also to other differentiated cells, specially those of clinical interest such as cells of nervous system (neurons and glial cells, for instance), chondrocytes, pancreatic beta cells . . . .
(37) miR-203 improves the potential of already-established ES and iPS cells to contribute to multiple cell lineages. Thus, the method of the present invention can be also defined as a method to improve the stemness properties/potential of already-established pluripotent cells, (since it works with embryonic stem cells and with induced pluripotent stem cells), and/or as method to enhance differentiation and/or maturation potential of pluripotent cells. Thus, the pluripotent cells that have undergone by the steps of the method of the invention exhibit a) higher percentage, faster growing, better differentiation, better efficiency at beating and better architecture of the three germ layers compared to control cells, when differentiated to embryoid bodies; b) improvement of in vivo differentiation to teratomas; and c) higher expression of 2-cell-stage markers. Now, regarding the enhancement of differentiation and/or maturation potential, pluripotent cells that have underwent by the steps of the method of the invention exhibit: a) an increased number of tissues and higher level of differentiation compared to control, when differentiated to embryoid bodies; b) formation of complex teratomas and embryo-like structures that include differentiated tissues usually not observed in control conditions; c) improved differentiation and maturation potential when specifically differentiated to cardiomyocytes, including faster and increased expression of maturation markers and faster acquisition of their functionality.
(38) As commented above, the effects of the exposure to increased levels (by overexpression or addition to the culture medium) of miR-203, or an analogue thereof, can be seen both in induced pluripotent stem cells (iPSCs) and embryonic stem cells (ESCs). For the purposes of the present invention, both the iPSCs and the ESCs can be cells derived of any mammal. Human ESCs can be optionally excluded. When the ESCs are human ESCs, it is preferred that the human ESCs used in the method of the invention have been obtained by a method that does not imply the destruction of the embryos, such as the method described in Chung et al., 2008. But, in order to above moral or legal concerns related to the use of human ESCs and for handling reasons, it is preferred that the method of the invention is carried out with iPSCs. For easiness of generation and handling, it is particularly preferred that the iPSCs are in culture when the method of the invention is applied on them, and it is also preferred that the generation of said iPSCs has occurred in vitro, from cultured differentiated cells such as fibroblasts, although the use of in vivo generated iPSCs (Abad et al., 2013) is compatible with the method of the present invention and can be considered included in its scope. For obtaining in vitro (in culture) generated iPSCs, any of the known reprogramming procedures can be used, including the original Yamanaka method (contacting somatic differentiated cells with a nuclear reprogramming factor comprising a gene product of each one of the following families: Oct family, Klf family, Myc family and Sox family) and any of its variants.
(39) The Examples of the present invention contained some assays wherein the increased levels of microRNA-203 are obtained thanks to its genetically-induced overexpression in the iPSCs cells, due to fact that such cells have been reprogrammed in vitro from differentiated cells (fibroblasts) that have been extracted from a mouse model wherein a Doxyclycline-inducible cassette for miR-203 expression is included. Then, in that case, the increased levels result directly from the intracellular overexpression of miR-203; such increase occurs transiently due to the fact that doxycycline is added only for 3-5 days. Other assays, as some of the assays described in Example 4, have been performed with wild-type iPSCs in culture and the exposure of the iPSCs to the increased levels/amounts of miR-203 has been achieved by the addition of a miR-203, specifically a chemically-modified double-stranded miR-203, to the culture media; the results obtained with this mimic of natural miR-203 show that the addition of miR-203 to the culture medium is a possible embodiment of the method of the present application that also solve the same technical problem. As the miR-203 or its analogue or mimic has to enter the cell to exert its effect, adding to the endogenous miR-203 amount (naturally present in the cell) the miR-203 amount resulting from the penetrance of the added compound from the culture medium, the result is analogously that cells are exposed to increased level of miR-203 (or an analogous compound with the same kind of activity). For that reason, the step that is necessary to take to perform the method of the present invention has been defined as exposing the cells to increased levels of miR-203. Even if the starting level could be considered to be zero (0) (as might be the case in the culture medium or in some of the models used in the Examples below), it could be considered an increase in the levels: from 0 to a certain amount.
(40) Such increase of miR-203 levels can be achieved by the use of expression vectors well known in the state of the art, wherefrom miR-203 can be expressed, for instance, because a coding sequence of the immature progenitor form (for instance, hsa-miR203, represented by SEQ ID NO:2, in the case of human beings or mmu-miR-203, represented by SEQ ID NO:3, in the case of Mus musculus), which form will give rise to the corresponding mature form in the cell (hsa-miR-203a-3p, represented by SEQ ID NO:1, for human beings, or mmu-miR-203-3p, represented by SEQ ID NO:4, for Mus musculus). It can be seen that the human and the mouse mature forms are identical, so the use of precursor forms and/or mature forms of one species which is different from the species of origin of the pluripotent cells is compatible with the method of the invention and comprised in its scope, specially among human beings, both when the microRNA is directly added to the culture media or when is produced from or as a expression product from a vector.
(41) Also possible embodiments are those that start with a mutated differentiated cell that has inserted in its genome an expression cassette wherefrom the microRNA or its precursor is expressed, as in some Examples of the present invention.
(42) As transient expression in preferred (for instance, 3-5 days), it is preferable that the coding sequence giving rise to the microRNA or its precursor is under the control of an inducible promoter, as the tetracycline inducible promoter (inducible, for instance, by doxycycline) used in Examples of the present application, so that the time of expression in easily controllable and stoppable by removing the inducible compound. It is also possible, and can be considered another possible embodiment, that the expression vector is a plasmid or a non-integrative virus-derived vector, such as those derived from viruses such as adenoviruses of adeno-associated viruses, which facilitates a transient expression by themselves without additional control.
(43) The product of the expression can be an mRNA that exhibits a part that corresponds to the molecule of the miRNA and a coding sequence of a tag or a protein usable, for instance, as marker.
(44) Another possible embodiment, which is one of the preferred ones, is adding miR-203, or an analogue thereof, to the culture medium of the already-generated pluripotent cells. and, when transient exposure is desired, removing it from the culture medium when the desired exposure time (for instance, 3-5 days, as previously commented) is completed. Transient transfection of such microRNA mimics permits transient exposure (around 3-5 days, as previously commented). In that case, both the mature or the precursor molecule of miR-203 can be added. As discussed above, in the case of miR-203, the most abundant mature form is the one originating from the 3′ arm of the pre-miRNA (hsa-miR-203a-3p in human beings and mmu-miR-203-3p in mice), which is the form responsible, at least in a high level, for the effects described in the present application; therefore, it is the form preferentially used in the present method, it is a possible embodiment of the present method to submit the pluripotent cells to a mixture of both mature forms, the one originating from the 3′ arm and the one originating from the 5′ arm, like in some assays of the present application, so that the endogenous scenario in the cells is faithfully mimicked faithfully.).
(45) The use of synthetic compounds instead of the natural molecule of miR-203 is possible, as it is demonstrated in some Examples of the present invention. It is particularly considered the use of “analogues”. RNA analogues are molecules that are similar to the natural microRNAs, but which contain at least a modification that makes them different and distinct. Included in the definition of RNA analogues are those RNA molecules where at least one nucleotide is replaced by another one: given that the complementarity among an microRNA and the fragment of the mRNA 3′UTR with which they base-paired is hardly ever complete (100%), changes in the microRNA sequence are admissible, provided that there are still base-pairing, so that an RNA analogue can be at least 50-60% similar to a natural microRNA, provided that its function is still accomplished. To that aim, it must be taken into account that there is always a region of 6-8 nucleotides, known as the seed region, where the complementarity among microRNA and mRNA 3′UTR is complete (100%) or almost complete (see
(46) More frequently, but compatible with the previous modifications, there are chemical modifications in the nucleotides (the units of the microRNA), that give rise to analogues of nucleotides. Such modifications are usually made to increase stability and/or resistance to nucleases, facilitate entry into the cell, increase the strength of interaction among microRNA and mRNA, increase the desired activity of the microRNA and/or bias the processing of the microRNA through a particular cellular pathway (such as RISC, the RNA-induced silencing complex, that incorporates one strand of a small interfering RNA or a microRNA, uses it as a template for recognizing complementary mRNA and, thereafter, activates RNase and cleaves the RNA). Such modifications are usually in the sugar moiety and/or in the phosphate bond, and include the addition of one or more non-nucleotide moieties. Some common modifications are: the commonly used phosphorothyoate bonds instead of the phosphate bonds; modifications at the 2′ position of the sugar moiety such as 2′-O-methyl or 2′-O-methoxyethyl modifications; modifications where the ribose exhibits a link connecting the oxygen at 2′ with the carbon at 4′, thus blocking the ribose in the conformation 3′-endo (LNAs: locked nucleic acids) or 2′-O, 4′-C ethylene bridged nucleic acids (ENA); the replacement of the sugar backbone by an amide-containing backbone such as an aminoethylglycine backbone, as in peptide nucleic acids (PNAs); use of PMOs (nucleic acids where the ribose moiety is replaced by a morpholine group); and other modifications well known by those skilled in the art that can be found reviewed, for instance, by Kole et al. (2012). As the nitrogenous bases are the element less commonly modified in the analogues of nucleotides, the comparison of their homology or identity with regard to fragment or the whole sequence of natural oligonucleotides or polynucleotides is more properly done with regard to the sequence of nitrogenous bases. Modifications at at least one of the strand ends, such as the addition of one of more unities of moieties of compounds such as cholesterol, cholestanol, stigmasttrol, cholanic acid and ergosterol and, also optionally and additionally, a linker moiety that attaches the conjugate moiety to the strand, are also common, specially to facilite the entry of the microRNA analogue into the cell.
(47) Also included within the microRNA analogues, as the term is used in the present application, are the RNA mimics, specifically microRNA mimics (miRNA mimic). An RNA mimic, as commented above with regard to US20130345289A1, is a synthetic miRNA that has enhanced stability due to modified nucleotides or structural modifications (e.g. bulges or loops), and also those small, chemically modified double-stranded RNAs that mimic endogenous miRNAs and enable miRNA functional analysis by up-regulation of miRNA activity. MicroRNA mimics added to culture media are incorporated by the cells and act directly as double stranded molecules (cell expression is not required) that copycat faithfully their respective microRNA, miR-203 in the present case. The method where miR-203 mimics (only one or a mixture thereof) are added to the culture medium of the iPSCs, as in some Examples of the present invention (such as Example 4), is a preferred embodiment of the present invention, especially when the mimic is characterized by: a. being an RNA-modified molecule wherein at least one of the nucleotides is replaced by a chemically modified nucleotide, wherein the chemical modification is selected from the group of: i. replacing one or more phosphate bonds by phosphorothyoate bonds, ii. one or more modifications at the 2′ position of the sugar moiety selected from 2′-O-methyl or 2′-O-methoxyethyl modifications; and/or iii. one or more modifications in the ribose moiety selected from the group of: those that give rise to a link connecting the oxygen at 2′ with the carbon at 4′, thus blocking the ribose in the conformation 3′-endo (LNAs: locked nucleic acids) or 2′-O, 4′-C ethylene bridged nucleic acids (ENA); the replacement of the sugar backbone by an amide-containing backbone such as an aminoethylglycine backbone, as in peptide nucleic acids (PNAs); and use of PMOs (nucleic acids where the ribose moiety is replaced by a morpholine group), and combinations thereof; b. being a double stranded molecule with a duplex region of between 16 and 31 nucleotides in length and which contains a fragment which is at least 50% identical in their sequence to the sequence of nitrogenous bases of the RNA molecule represented by SEQ ID NO:1 (hsa-miR-203a-3p) or SEQ ID NO:4 (mmu-miR-203-3p), and c. optionally, additionally comprising at at least one end of at least one of the strands a conjugate moiety comprising one or more units of cholesterol, cholestanol, stigmasttrol, cholanic acid and ergosterol and, also optionally and additionally, a linker moiety that attaches the conjugate moiety to the strand, and d. also optionally and additionally, presenting one or more mismatches among the two strands.
(48) Examples of specific microRNA mimics can be also found, for instance, in United States Patent applications US 2009/0209626 and US 2011/0263675, both of them of Dharmacon, Inc., where the mimics are specific cases of the mimics described above. Very preferred are microRNA mimics such as the miR-203 mimics of the miRIDIAN series of Dharmacon (http://dharmacon.gelifesciences.com/rnai-and-custom-rna-synthesis/microrna/miridian-microrna-mimics/) used in assays of the present application that commercializes mimics of miR-203 of Homo sapiens, Mus musculus and other species such as Rattus norvegicus. miRIDIAN mimics are chemically enhanced with the ON-TARGET modification pattern to preferentially program RISC with the active microRNA strand. This modification includes an RNA where the first and second nucleotide of the sense region each has a 2′-O-methyl moiety, and the antisense strand is phosphorylated at its 5′ end, wherein such an on-target modification also refers to a proprietary modification coined On-Target™ (Dharmacon, Inc.). In any event, on-target modifications can be used to help reduce off-target effects by blocking the sense (passenger) strand from being taken up by the RISC process. In any case, other examples of microRNA mimics can be found for instance in Sigma Aldrich, which commercializes also hsa-miR-203a mimics (HMI0357).
(49) The naïve pluripotent cells resulting from putting into practice the method of the invention starting from iPSCs are different from said starting iPSCs, as can be seen in Table 3. The obtained naïve pluripotent cells, when subjected to well-established differentiation protocols, continue to express pluripotency markers such as Nanog, Oct and Sox2, while they co-exist with cells that express differentiation markers such as Nestin, Gata4 and CD34. Thus, the resultant population of cells is characterized by expressing both pluripotency markers and differentiation markers are also a goal of the present invention, particularly those obtained by the method of the present invention.
(50) The assays disclosed in the Examples below show that controlling transient miR-203 expression in iPSCs and also in ESCs improves the ability of these cells to differentiate into multiple cells lineages and to reach further maturation properties without interfering with there self-renewal properties. Thus, the method of the present invention and the pluripotent stem cells obtained from it open new possibilities for the clinical application of pluripotent stem cells and solve some of the difficulties that remained to be solved in order to seriously think and planify their use for clinical purposes.
(51) Pluripotent stem cells have the potential to become research and clinical tools to understand and model diseases, develop and screen candidate drugs, and deliver cell-replacement therapy to support regenerative medicine. Reprogramming technology offers the potential to treat many diseases, including neurodegenerative diseases, cardiovascular disease, diabetes, and amyotrophic lateral sclerosis (ALS). In theory, easily accessible cell types (such as skin fibroblasts) could be biopsied from a patient and reprogrammed, effectively recapitulating the patient's disease in a culture dish. Such cells could then serve as the basis for autologous cell replacement therapy. Because the source cells originate within the patient, immune rejection of the differentiated derivatives would be minimized. Yet while iPSCs have great potential as sources of adult mature cells, much remains to be learned about the processes by which these cells differentiate. The method of the present invention and the pluripotent cells obtained from it can be seen as a new and improved research tool that may be of use for understanding the process by which pluripotent cells differentiate and, also, a useful improvement that facilitates and makes more feasible the clinical application of said cells, after their differentiation, specially for regenerative medicine. Therefore, the use of the pluripotent cells of the present invention for obtaining differentiated cells, the methods for obtaining differentiated cells that use as starting material the pluripotent cells of the present invention, as well as the methods for obtaining differentiated cells from iPSCs which comprise a step such as the characterizing step of the method of the present invention (the exposure of the cells to increased level of miR-203) are comprised with the scope of the present invention.
(52) Possible uses of the present technology, (the methods of the present invention and the cells obtained form them), include: The field of cardiac regeneration. iPSCs created from human and murine fibroblasts can give rise to functional cardiomyocytes that display hallmark cardiac action potentials. However, the maturation process into cardiomyocytes is impaired when iPSCs are used—cardiac development of iPSCs is delayed compared to that seen with cardiomyocytes derived from ESCs or fetal tissue. Furthermore, variation exists in the expression of genetic markers in the iPSC-derived cardiac cells as compared to that seen in ESC-derived cardiomyocytes. Therefore, iPSC-derived cardiomyocytes demonstrate normal commitment but impaired maturation, and it is unclear whether observed defects are due to technical (e.g., incomplete reprogramming of iPSCs) or biological barriers (e.g., functional impairment due to genetic factors). Neural regeneration, including the modelling and treatment of neurodegenerative diseases, such as Parkinson's disease, Huntington's disease, amyotrophic lateral sclerosis or spinal muscular atrophy. Patient-derived iPSCs can be rewound to affected neuronal subtypes via in vitro differentiation or repaired iPS cells using gene targeting to repair disease-causing mutation. Still, the protocols for applying IPSC-based regeneration in neurodegenerative disorders are far from reality. Also, greater progress has been made in generating matured populations of distinct neurons and glia for the purpose of screening drugs and replacement therapy. However, these cells may not truly reflect the cellular responses to compounds that the body would have at a physiological level. Lastly, researchers still face the problems of low efficiency conversion and laborious to conduct. The average conversion efficiency of such methods is less than 1%, which further restrict the extensively use of the technology. Remodelling in a cartilage regeneration system. Since articular cartilage is not restored by natural healing, many attempts have been made to improve the quality of this tissue repair. Autologous chondrocyte transplantation has changed the paradigm of the treatment of cartilage defects from repair to regeneration, and this has been demonstrated in randomised trials proving the concept of regenerating tissue in a cell-based therapy approach. In this scenario, the present inventors speculate that miR-203 treatment in autologous chondrocytes prior transplantation might facilitate the remodelling of the damaged tissue and its full regeneration.
(53) As controlling transient miR-203 expression in iPSCs and also in ESCs improves the ability of these cells to differentiate into multiple cells lineages (in particular, to cardiomyocytes) and to reach further maturation properties without interfering with there self-renewal properties, the method of the present invention means an important improvement for the generation of differentiated cells applicable in the above mentioned fields. Thus, the use of the pluripotent cells obtained by the method of the present invention for obtaining differentiated cells applicable in the above mentioned fields (cardiac regeneration, neural regeneration and cartilage regeneration) that is, cardiomycytes, neural or glial cells, chondrocytes and insulin-producing cells, is a preferred embodiment of the use of the pluripotent cells of the present invention.
(54) It must be pointed out that transient exposure to miR-203 sequences improves both functional differentiation and maturation, as it is shown in the Examples of the present application, especially Example 4, related to differentiation and maturation of cardiomyocytes. Therefore, the possible therapeutic uses of this microRNA in regenerative medicine, such as neural regeneration, cartilague regenation, replacement of insulin-producing cells and, very especially, cardiac regeneration, are supported by the assays disclosed in the present application.
(55) Together, it can be concluded that modulating the DNA methylation landscape of pluripotent cells by exposure to small microRNA mimics may enhance the performance of these cells in multiple functional assays, including the differentiation and maturation to multiple cellular lineages of interest in regenerative medicine.
(56) The present invention will be explained in more detail by means of the Examples and Figures set forth below.
EXAMPLES
(57) Summary of the Experimental Procedure
(58) The present inventors have generated a mouse model in which miR-203 expression can be modulated by Doxycicline (DOX) treatment. Their knock in animal model (ColA_miR203; Rosa 26_rtTA) permits an over-expression of more that 100 fold of this microRNA whenever the animal- or the cells derived from the animal—are exposed to Doxycycline treatment. Their first approach was extracting the mouse embryonic fibroblasts from those mice, reprogram them in vitro using the Yamanaka factors and generate miR-203 knock in inducible pluripotent cells (miR-203 KI iPSCs). Those iPSCs were then treated with DOX for 3 to 5 days, and then exposed to DOX withdrawal for several passages. Those iPSCs have been named as “transient KI (tKI) iPSCs” to simplify. Then, several readouts were analysed to demonstrate how those tKI iPSCs exhibit an improved stemness potential, when compared with their control counterparts (the very same iPSC clone treated with vehicle): (i) In vitro differentiation to embryoid bodies (EBs) is significantly increased in tKI compared to control iPSCs. tKI iPSC-derived EBs grow faster, differentiate better, show a higher percentage and efficiency at beating and exhibit a perfect architecture of the three germ layers. The differentiation and functionality of their cells is also revealed by the formation of long cavities, which is rarely found in control iPSC-derived EBs; (ii) in vivo differentiation to teratomas is also dramatically improved when tKI iPSCs are injected in mice, when compared with their respective controls. The level of differentiation of the three germ layers is notorious, and some atypical tissues such as pancreas, bone marrow, cartilage or even extra-embryonic tissue (placenta) are easily found in tKI iPSC-derived teratomas. When these tKI iPSCs were injected intraperitoneally in mice, they were able to develop complex embryo-like structures, never found in WT iPSC injections. Those structures are characterized by the expression of several markers of embryonic development, the three germ layers and extra-embryonic tissues; (iii) the expression of 2-cell-stage markers, such as certain retrotransposons, is higher in tKi iPSCs when compared to their WT counterparts. Moreover, the transcriptomic profile of those iPS cells illustrates how tKI iPSCs activate a number of signalling networks involved in development, morphogenesis, stemness maintenance, chromatin organization and cell fate commitment, proving their naïve state. Of interest, Principal Component Analysis, Hierarchical Clustering and Heatmap analysis of the RNA sequencing samples demonstrated the significant proximity between tKI iPS and ES cells, compared to WT iPSCs; (iv) chimera contribution is definitely the best proof of concept to demonstrate the value of iPS or ES cells. The provided experiments of cell aggregation and even more importantly, tetraploid complementation assays showed how tKI iPSCs contribute to chimera generation and germline transmission significantly more than their respective control iPSCs.
(59) The inventors' secondary approaches to further validate the data were directed to reproduce those proofs of concept in some other different models. Thus, it was demonstrated that the very same effects were observed when the miR-203 was transiently over-expressed in a number of clones of WT IPSCs or WT ESCs. The quality of transient miR-203 pluripotent cells (either iPSCs or ESCs) was in all cases better than their control counterparts. The over-expression was reproduced also using retroviruses (pMCSV) that are silenced in pluripotent cells after a few days from transduction, allowing a transient expression of the microRNA. Finally, and very important, the data were reproduced transfecting the miR-203 by using microRNA mimics and ordinary methods for RNA transfection, such as Lipofectamine RNAi Max (Invitrogen) or Dharmafect (Dharmacon).
(60) The assays of the Examples set forth below were performed with the following materials and methodologies:
(61) Animal Models and Procedures.
(62) miR-203 conditional knockout model was generated by flanking the mmu-mir203 locus with loxP sites (ET recombination; Genebridges, Heidelberg, Germany) using homologous recombination into ES cells (
(63) Animal experimentation was performed according to protocols approved by the CNIO-ISCIII Ethics Committee for Research and Animal Welfare (CEIyBA).
(64) For subcutaneous teratomas, iPSCs were trypsinized and 2-3 million cells were suspended in 100 μl PBS supplemented with 0.1% glucose and were subcutaneously injected into both flanks of athymic nude mice Crl:NU(NCr)-Foxn1nu (provided by Charles River). Teratomas were daily controlled and measured by a caliper and finally isolated when their diameters reached 1.5 cm. Animals were euthanized at that point and teratomas were weighted and processed for RNA extraction or histopathological analysis.
(65) For intraperitoneal injections, wild-type athymic mice were injected with 4-5×10.sup.5 iPSCs resuspended in 100 μl PBS supplemented with 0.1% glucose. Mice were supervised daily from the day of the injection. Usually, 30 or 40 days after injection mice were euthanized and the visceral teratomas and embryo-like structures were isolated and processed, either for RNA extraction or histopathological analysis.
(66) For chimera generation, iPSCs or ESCs (5-7 cells per embryo, 10 passages) were microinjected into C57BL/6J-Tyrc-2J/J blastocysts and transferred to Crl:CD1 (ICR) pseudo-pregnant females.
(67) For tetraploid complementation studies, zygotes were cultured overnight until they reached the 2-cell stage, or 2-cell stage Hsd:ICR(CD-1) embryos were harvested from pregnant females at E1.5 and electrofused, at which point they were electrofused in 0.3 M mannitol using a BLS CF-150/B cell fusion instrument with a 250 μm electrode chamber. The electric pulse conditions were 30 V amplitude, 31 μs width and 1.5 AC voltage. One hour later, 1-cell (tetraploid) embryos were carefully identified and separated from embryos that had failed to fuse, cultured in KSOM for another 1 or 2 days. Next day, 4-cell stage embryos were selected and aggregated with ESC or iPSCs. Aggregated embryos were then injected to pseudo-pregnant females 24 hours later.
(68) To study the contribution to germline, black ES-iPS mice (from tetraploid complementation assays) or chimeras (from diploid embryo Es-iPS microinjection) were crossed with Albino B6 or C57BL/6J-Tyrc-2J/J females and the color of the progeny was tested.
(69) Cell Culture and Gene Expression.
(70) Primary mouse embryonic fibroblasts (MEFs) were obtained from embryos at E13.5 and cultured in DMEM supplemented with 10% of FBS and Penicillin/Streptomycin. Cultures were routinely tested for mycoplasma. Reprogramming was induced on these MEF cultures by Oct4-Sox2-Klf4-cMyc (OSKM) lentiviral transduction (Takahasi & Yamanaka, 2006). For lentiviral transduction, HEK293T cell were transfected with Tet-O-FUW-OSKM (Addgene #20321) and packaging vectors using Lipofectamine 2000 (Invitrogen). Viral supernatants were collected twice a day on two consecutive days starting 24 h after transfection and were used to infect MEFs, previously plated at a density of 250000 cells per well in 6-well plates. Previous to infection, polybrene was added to the viral supernatants at a concentration of 2 μg/ml. Infected MEFs were then cultured in IPSCs medium, containing KO-DMEM (Gibco), 2-Mercaptoethanol 50 mM (Invitrogen), non-essential aminoacids MEM NEAA (Invitrogen), Penicillin and Streptomycin (5000 μg/ml, Invitrogen), LIF (Leukemia Inhibitor Factor, ESGRO, Millipore) and 20% knock-out serum replacement (KSR, Invitrogen). Medium was changed every 24 h and plates were stained for alkaline phosphatase activity to assure the efficiency of reprogramming (AP detection kit, Sigma-Aldrich). Once colonies were picked, IPSCs were cultured in IPSCs media over mitomycin C (Roche) inactivated feeder cells. G4 ESCs were cultured over mitomycin C-inactivated feeders and in the presence of ESCs medium containing KO-DMEM, 2-Mercaptoethanol, non-essential aminoacids, Glutamax, Penicillin and Streptomycin, LIF and 10% Fetal Calf Serum (Hyclone). When indicated, the culture media for pluripotent cells included 2i factors (MEK inhibitor PD0325901 1 μM, Gsk3 inhibitor CHIR99021 3 μM) and mouse LIF (as above) in N2B27 medium, as described previously (Ying et al., 2008).
(71) For inducing transient miR-203 over-expression in miR-203 KI cells, (ColA1(miR-203/miR-203), Rosa26(rtTA/rt/TA) iPSCs or ESCs cultures were treated with doxycycline (1 μg/ml; Invitrogen) during 5 days. After that, doxycycline withdrawal was standardized for the cultures during following several passages (15-30 days). Doxycycline treatment was also applied to wild-type ESCs or iPSCs to evaluate the effect of the treatment itself.
(72) For over-expression experiments, miR-203 and full-length cDNAs of Dnmt3a and Dnmt3b were subcloned into the retroviral vector pMCSV-PIG (Available through Addgene plasmid 21654: https://www.addgene.org/21654/) (Abad et al., 2013) by restriction-directed subcloning, using pCMV-Sport6-mDnmt3a (MGC clone:5662) and attB-mCh-mDnmt3b-Poly (A)-NeoR (Addgene plasmid 65553) plasmids as templates, respectively. When transduced with these retroviral vectors, both ESCs and iPSCs cells were sorted by FACS and GFP-positive cells were selected for subsequent cultures and analysis.
(73) For retroviral transduction, we transfected HEK293T cells with the respective pMCSV-PIG vector (Abad et al, Nature 2013) expressing a GFP reporter (including either only GFP; miR-203-GFP; Dnmt3a-GFP or Dnmt3b-GFP) and the packaging vector pCL-ECO, using Lipofectamine 2000 (Invitrogen). Viral supernatants were collected twice a day on two consecutive days starting 24 h after transfection and were used to infect either ESCs or IPSCs, previously plated over feeders in 6-well plates. Preceding the infection, polybrene was added to the viral supernatants at a concentration of 2 μg/ml.
(74) For transfection with mimics, the present inventors used miRIDIAN microRNA human hsa-miR-203a-5p (C-302893-00)/hsa-miR-203a-3p (C-300562-03) mimics or mimic transfection control with Dy547 (CP-004500-01), from Dharmacon, so that the cells were subjected to a mixture of analogues/mimics of both mature forms of microRNA-203, just to mimic faithfully the endogenous scenario in the cells. Transfection was performed using either Dharmafect transfection reagent (Dharmacon) or Lipofectamine RNAiMAX (Invitrogen) following the manufacturer's instructions. Transfection efficiency was evaluated 24 hours post-transfection by Dy547 fluorescence, and experiments were then performed as indicated in the figures.
(75) For RNA interference assays, ON-TARGETplus SMARTpool for Non-targeting control siRNA (D-001810-01, 02, 03, 04), Dnmt3a siRNAs (J-065433-09, 10,11, 12) and Dnmt3b siRNAs (J-044164-05, 06, 07, 08) from Dharmacon were used. Transfection was performed using Darmafect transfection reagent (Dharmacon) following the manufacturer's instructions. Transfection efficiency was evaluated 24 hours post-transfection by pPCR, using the primers indicated in Table 2.
(76) Luciferase reported assays were performed in HEK293T cells. Briefly, 200.000 cells per well were seeded on 6-well plates and the day after, cells were transfected using Lipofectamine 2000 (Invitrogen), following the manufacturer's instructions. The 3′UTR regions from the murine genes Dnmt3a, Dnmt3b, Dnmt3l and Dnmt1 were amplified by PCR with specific primers (Dnmt3a_EcoRI-Fw: 5′-GAATTCAGGGACATGGGGGCAAACTGAA-3′ (SEQ ID NO:55); Dnmt3a_NdeI-Rv: 5′-CATATGCTGAGGCAGTCATTTTAGATTCAT-3′ (SEQ ID NO:56); Dnmt3b_EcoRI-Fw: 5′-GAATTCTTTTAGCTCACCTGTGTGGGG-3′ (SEQ ID NO:57); Dnmt3b_NdeI-Rv: 5′-CATATGCCAGAAAGGTAAACTCTGGGCA-3′ (SEQ ID NO:58); Dnmt3l_EcoRI-Fw: 5′-GAATTCGAAATGAATCACCATAAGATGAAAG-3′ (SEQ ID NO:59); Dnmt3_NdeI-Rv: 5′-CATATGAACAATCCTATGATATATTTGAAAAA-3′ (SEQ ID NO:60); Dnmt1 EcoRI-Fw: 5′-GAATTCGTGCTCTCACCCAGAGCCCCA-3′ (SEQ ID NO:61); Dnmt1 NdeI-Rv: 5′-CATATGGCTTGACAGAAGCGCTTTATTTTG-3′) (SEQ ID NO:62) using cDNA clones (pCMV-Sport6-mDnmt3a, cDNA clone MGC:5662; pBluescript-mDnmt31, RIKEN clone: 2410006021; pYX-Asc-mDnmt1, MGC clone:62302) or mouse cDNA (in the case of Dnmt3b). PCR products were verified by sequencing and ligated into the pGL3-Control vector (Promega), downstream of the luciferase reporter gene. Mutations in the miR-203 binding sites (
(77) Human iPSCs expressing the long terminal repeat (LTR7) of HERVH endogenous retroviruses fused with GFP reporter (Wang et al., 2016) were cultured in mTeSRTM1 media (Stem Cell Technologies) over a Matrigel basement (Corning). Experimentation with human cells was performed according to protocols approved by the ISCIII Ethics Committee for Research (CEI; number PI 61_2017).
(78) Embryoid Body Generation.
(79) Briefly, when wild type iPSCs or ESCs were used, they were previously transduced with retroviruses expressing miR-203 (pMSCV-miR-203) or transfected with miRNA mimics for transient expression of miR-203, as can be seen in the schematic representation of
(80) Immunofluorescence and Immunohistochemistry.
(81) Cells previously seeded in cover slips were fixed in 4% paraformaldehyde for 15 min, permeabilized using PBS 0.1% Triton X-100 for 15 min and blocked in BSA for 1 h at room temperature. Primary antibody incubation was performed overnight at 4° C. in all cases, followed by secondary antibody incubation for 1 hour at room temperature. Nuclear staining was included in the last PBS wash, using Hoescht or DAPI. Primary antibodies used in this study were against Cd34 (Abcam), Gata4 (Santa Cruz), Pax6 (Abcam), Nestin (Millipore), cTnT (Abcam) and phospho-histone H3 (Millipore). Table 1 below shows detailed information about said antibodies and other antibodies used in the assays of the present application. Cells were examined under a Leica SP5 microscope equipped with white light laser and hybrid detection.
(82) For immunohistochemistry, tissue samples were fixed in 10% formalin, paraffin-embedded and cut in 3-μm sections, which were mounted in super-frost-plus porta-objects and rehydrated. Consecutive sections were stained with hematoxylin and eosin (H&E) or subjected to immunohistochemistry using automated immunostaining platforms (Ventana Discovery XT, Roche or Autostainer Plus Link 48). Antigen retrival was first performed with high or low pH buffer depending on the primary antibody (CC1m, Roche or low pH antigen retrival buffer, Dako), endogenous peroxidase was blocked (peroxide hydrogen at 3%) and slides were incubated with primary antibodies against Nanog (Cell Signalling Biotechnology, 8822), cytokeratin 8 (CK8; CNIO Monoclonal Antibodies Core Unit, AM-TROMA I), GFP (Roche, 11814460001), Sox2 (Cell Signaling Technology, 3728), alpha-fetoprotein (AFP; R&D Systems, AF5369), Oct4 (Santa Cruz Biotechnology, sc-9081), KI-67 (Master Diagnostica, 0003110QD), Nestin (Millipore MAB353), Cd31 (Abcam), Cd34 (ABCAM ab8158), Cd73 (Cell Signaling Technology), Collagenase Type I (Rockland), Gata4 (Santa Cruz Biotechnology, sc-1237), Insulin (Dako A0564), Smooth muscle actin (Thermo Scientific RB-9010-PO), skeletal actin (Dako, M0635), and Ter119 (LY-76; BD Bioscience, 550565) were used. Detailed information about them can be also found in Table 1 below. Slides were then incubated with the corresponding secondary antibodies conjugated with horseradish peroxidase (OmniRabbit Ventana, Roche) and the immunohistochemical reaction was developed using 3,30-diaminovenzidine tetrahydrochloride (DAB) as a chromogen (Chromomap DAB, Ventana, Roche or DAB solution, Dako) and nuclei were counterstained with Carazzi's hematoxylin. Finally, the slides were dehydrated, cleared and mounted with a permanent mounting medium for microscopic evaluation. For Sims red staining, Weigert's Hematoxylin was incubated for 8 min and Picro/Sirius Red for 1 h, followed by a wash (10 min) with water. The images were acquired with a slide scanner (AxioScan Z1, Zeiss). Sirius red staining was measured using both bright-field and polarized lights. Images were captured and quantified using the Zen Software (Zeiss).
(83) TABLE-US-00001 TABLE 1 Antibodies used in the assays of the present application Catalog Clone Source Antigen Number number Ig Source AFP AF5369 — goat R&D Systems Cd31 AF28364 — rabbit Abcam Cd34 Ab8158 MEC14.7 rat Abcam Cd73 13160 D7F9A rabbit Cell Signaling Technology CK8 AM-TROMA I — mouse CNIO Monoclonal Antibodies Core Unit Collagenase 600-401-103S — rabbit Rockland type I Gata4 (C-20) Sc-1237 — goat Santa Cruz Biotechnology GFP 11 814 460 001 7.1 + 13.1 mouse Roche Histone 3 06-570 — rabbit Millipore (phospho- Ser10) Insulin A0564 Guinea Dako pig Ki67 0003110QD SP6 rabbit Master Diagnostics Nestin MAB353 RAT401 mouse Millipore Nanog 8822 D2A3 rabbit Cell Signaling Technology Oct4 Ab19857 — rabbit Abcam Pax6 Ab5790 — rabbit Abcam Skeletal M0635 HHF35 mouse Dako muscle actin Smooth RB-9010-PO — rabbit Thermo Scientific muscle actin Sox2 3728 C70B1 rabbit Cell Signaling Technology Ter119 (LY- 550565 Ter119 rat BD Bioscience 76) Troponin T Ab8295 1C11 mouse Abcam
(84) Analysis of mRNA and microRNA Levels.
(85) RNA was extracted from cell or tissue samples with Trizol (Invitrogen) or by using the miRVana miRNA isolation kit (Thermo Fisher), following the manufacturer's recommendations. Retrotranscription into cDNA was performed using M-MLV Reverse Transcriptase (Promega) following the manufacturer's protocol. Quantitative real time PCR was performed using Syber Green Power PCR Master Mix (Applied Biosystems) in an ABI PRISM 7700 Thermocycler (Applied Biosystems). The housekeeping gene Gapdh was used for normalization. The oligonucleotide primers used in the assays of the present application are listed in the Table 2 below.
(86) TABLE-US-00002 TABLE 2 Oligonucleotides used as primers Forward Oligonucleotide SEQ ID Reverse Oligonucleotide SEQ ID Gene (5′-3′) No (5′-3′) No qRT-PCR (mouse genes) Dazl ggttttaccacccgaactctg 5 tgtggttgctgatgaagactg 6 Dnmt1 cagagactcccgaggacaga 7 tttacgtgtcgtttttcgtctc 8 Dnmt3a aaacggaaacgggatgagt 9 actgcaattaccttggattct 10 Dnmt3a2 gggcaaactgaagtagtgatga 11 ttacacggcacctgctga 12 Dnmt3b ccctcccccatccatagt 13 tctgctgtctccatcattgt 14 Dnmt3l aagtgaaccgacggagcat 15 ccgagtgtacacctggagagtt 16 Ecat1 tgtggggccctgaaaggcgagctgagat 63 atgggccgccatacgacgacgctcaact 64 Eras actgcccctcatcagactgctact 65 cactgccagtactcgggtagctg 66 Esg1 gaagtctggttccttggcaggatg 67 actcgatacactggcctagc 68 Fgf4 cgtggtgagcatcttcggagtgg 69 ccttcaggtccgcccgttctta 70 Gapdh aggtcggtgtgaacggatttg 25 tgtagaccatgtagttgaggtca 26 Gata6 accttatggcgtagaaatgctgagggtg 27 ctgaatacttgaggtcactgactcggg 28 Gdf3 gttccaacctgtgcctcgcgtat 71 agcgaggcatggagagagcggagcag 72 Hcn1 tgaagctgacagatggctat 31 ctggcagtacgacgtccttt 32 Isl1 ttgtacgggatcaaatgcgccaag 33 aggccacacagcggaaaca 34 Kcna4 tcattgctctgacctgatgc 35 tcactcagctccctcaggat 36 Kcnh2 acgcttactgccagggtgac 37 gccgactggcaaccagag 38 Myh ctcaagctcatggccactct 39 gcctcctagctataccact 40 Nanog caggtgtttgagggtagctc 41 cggttcatcatggtacagtc 42 Nppa gaaccagaggggagagacagag 43 ccctcagcttgctttttaggag 44 Tbx5 aaatgaaacccagcataggagctggc 45 acactcagcctcacatcttaccct 46 Tnnt2 ggcagcggaagaggatgctgaa 47 gaggcaccaagttgggcatgaacga 48 qrt-pcr (rat genes) Ccnb1 ggagatgaagattctgagagttctg 73 gtatgctgctccacatcgac 74 Gapdh ggcaagttcaatggcacagt 75 tggtgaagacgccagtagactc 76 Myh6 gggctggagcactgagag 77 gagagaggaacaggcaggaa 78 Myh7 atggcggatcgagagatg 79 ggtcaaagggcctggtct 80 dna methylation analysis (mouse genes) Elf5 (a) taaaggttgtaatgaatagatattaggtt 81 aactacttacttaaaaacaaataataactaaa 82 Elf5 (b) taaaggttgtaatgaatagatattaggtt 83 aaataataactaaatccaaacaaaaaa 84 Sirt6 tttggttttttttaggttatgttaggattt 85 cacttacctctacctcccaataaaaaa 86
(87) For reverse transcription of microRNAs, the Taqman small RNA assay (ThermoFisher Scientific, 4366596) was used, including the specific commercial oligonucleotides for mmu-miR-203-5p and 3p (ThermoFisher Scientific, 002580 and 000507) and the housekeeping RNAs sno-202 or sno-142 (ThermoFisher Scientific). Conditions for miRNA amplification were as follows: 30 minutes at 16° C.; 30 minutes at 42° C. and a final step of 5 minutes at 85° C. Quantitative real time PCR was then performed using the Taqman Universal PCR Master Mix (434437) following the manufacturer's instructions in an ABI PRISM 7700 Thermocycler (Applied Biosystems).
(88) For RNAseq, total RNA was extracted using the miRVana miRNA isolation kit (ThermoFisher), following the manufacturer's recommendations. Between 0.8 and 1 μg of total RNA was extracted from iPSCs, ESCs or teratomas, with RIN (RNA integrity number) numbers in the range 7 to 10 (Agilent 2100 Bioanalyzer). Poly A+ fractions were purified and randomly fragmented, converted to double stranded cDNA and processed using the Illumina's “TruSeq Stranded mRNA Sample Preparation Part #15031047 Rev. D” kit. The adapter-ligated library was completed by PCR with Illumina PE primers (8-11 cycles) and the resulting directional cDNA libraries were sequenced for 50 bases in a single-read format (Illumina HiSeq2000) and analyzed with nextpresso (available at http://bioinfo.cnio.es/nextpresso/) (Graña et al., 2017). Reads were quality-checked with FastQC (http://www.bioinformatics.babraham.ac.uk/projects/fastqc) and aligned to the mouse genome (GRCm38/mm10) with TopHat-2.0.10 (available at https://ccb.jhu.edu/software/tophat/) (Trapnell et al., 2012), using Bowtie 1.0.0 (downloadable from different Internet resources, such as https://slackbuilds.org/repository/14.2/academic/bowtie/) (Langmead et al., 2009) and Samtools 0.1.19 (https://sourceforge.net/projects/samtools/files/samtools/0.1.19/) (Li et al., 2009), allowing two mismatches and five multihits. Transcripts assembly, estimation of their abundances and differential expression were calculated with Cufflinks 2.2.1 (available at http://cole-trapnell-lab.github.io/cufflinks/releases/v2.2.1/) (Trapnell et al., 2012), using the mouse genome annotation data set GRCm38/mm10 from the UCSC Genome Browser (https://genome.ucsc.edu/) (Rosenbloom et al., 2015). A false discovery rate (FDR) of 0.05 is used as threshold for significance in differential expression. Heatmaps were later built using GENE-E (http://www.broadinstitute.org/cancer/software/GENE-E/index.html). RNAseq data have been deposited in the GEO repository (accession number GSE81571).
(89) Bisulphite Conversion, Genome-Wide DNA Methylation and Validation of DMRs.
(90) DNA samples were prepared for whole genome bisulphite sequencing using the TrueMethyl® Whole Genome Kit (CEGX®) according to the manufacturer's instructions. Briefly, 200 ng of genomic DNA was sheared to 800 bp using M220 Focused-Ultrasonicator™ (Covaris®). Then the fragmented DNA was denatured and oxidised by a chemical oxidant to convert 5-hydroxymethyl cytosine to 5-formylcytosine (5fC). The purpose of the oxidation was to ensure that we purely captured the information for 5′ methyl cytosine methylation and not an indistinguishable pattern combination of 5′methyl cytosine and 5′hydroxymethyl cytosine. Following oxidation, the DNA was subjected to bisulphite conversion for the deamination of cytosines and 5fC to uracils. Bisulphite converted DNA was desulfonated and purified to then proceed to library preparation. In this “post-bisulphite conversion” library preparation method, the fragmented single stranded bisulphite converted DNA was adapted with sequencing adaptors at the 3′end followed by an extension step and finally ligation of adaptors at the 5′ end of the molecules. Finally, the libraries were indexed and amplified. The PCR was performed for 10 cycles followed by bead-based purification. An additional purification and size selection step using Agencourt AMPure XP beads (Beckman Coulter, Cat: A63881) was performed to remove adaptor dimers. The purified library was eluted in a final volume of 14 μl pure water. Quality of the library obtained was checked using the DNA High sensitivity chip on the Agilent Bioanalyzer. The library was quantified using Qubit and KAPA Biosystems Library quantification kit (#KK4824) according to manufacturer's instructions. A total of 1 2 pMol of multiplexed libraries were loaded on a 125 bp PE rapid run on Illumina HiSeq2500. Adapter sequences were removed using cutadapt version 1.9.1 (Martin, 2011) in paired-end mode with parameters “-m 15 -u 6 -U 6”. Bwa-meth (Pedersen et al., 2014) was then used to align reads to mm10 using default parameters. PCR duplicates were removed using Picard v1.91 (http://broadinstitute.github.io/picard). Count tables of the number of methylated and unmethylated bases sequenced at each CpG site in the genome were constructed using the “tabulate” module of bwa-meth and BisSNP-0.82.2 (Liu et al., 2012) with default parameters. All libraries passed basic quality control checks with a minimum of 82.7% of read pairs aligning uniquely. DMRs were called using the WGBS module of DMRcate (Peters et al., 2015) with parameters lambda=1000 and C=50, DMPs were called using DSS(Feng et al., 2014), PMDs, LMRs and UMRs were called using MethylSeekR (Burger et al., 2013) and PMDs were called using the R package ‘aaRon’ (https://github.com/astatham/aaRon).
(91) For the validation of DMRs, clonal bisulphite sequencing was performed at two particular loci: Elf5 (chr2: 103, 423, 778-103, 424, 180) and Sirt6 (chr10: 81, 624, 595-81, 625, 547) promoter regions (Genome Browser: Mouse mm10 Dec. 2011. Genome Reference Consortium GRCm38). 100 ng of DNA was bisulphite treated using EZ DNA-Methylation-Lighting™ kit (Zymo Research) following manufacturer's instructions. Bisulphite converted DNA was then analyzed by bisulphite PCR analysis. Triplicate PCR amplifications were performed using semi-nested bisulphite conversion specific primers listed in the last part of Table 2 (“DNA methylation analysis (mouse genes)”), following the PCR conditions previously described for Elf5 (Lee et al., 2011) or using the following protocol: 95° C. 4 min; 5 cycles (95° C. 45 sec, 54° C. 1.5 min, 72° C. 2 min); 25 cycles (95° C. 45 sec, 54° C. 1.5 min; 72° C. 1.5 min) and final extension at 72° C. 4 min, for Sirt6. The methylation status of the PCR amplicons was determined by Sanger clonal sequencing of the pooled PCR products to ensure representative clonal analysis using between 8-10 clones per sample. The analysis of the methylation status of the clones was performed using BiQ Analyzer (Bock et al., 2005).
(92) Neonatal Cardiomyocyte Isolation and Differentiation Studies.
(93) Neonatal mouse and rat cardiomyocytes were prepared as described previously (Huang et al., 2015). Briefly, neonatal cardiomyocytes were isolated by enzymatic disassociation of 1-day-old neonatal mouse or rat hearts with the Neonatal Cardiomyocyte Isolation System (Cellutron Life Technology). Cardiomyocytes were pre-plated for 2 hours to remove fibroblasts. Cells were then plated on 1% gelatin-coated plates in medium containing 10% horse serum and 5% fetal calf serum. Eighteen hours after plating, cells were changed into serum-free medium and then transfected with 50 nM miR-203a-3p & miR-203a-5p mimics or control mimics (all of them from Dharmacon) by using Lipofectamine RNAiMAX transfection reagent, following the manufacturer's instructions. Six hours later, media with transfection reagent were removed and substituted by media containing 1% serum. Different time points (as indicated in
(94) For in vitro differentiation from mouse iPSCs to cardiomyocytes, wild-type mouse iPSCs were transfected with either control or miR-203a-3p/-5p mimics prior to differentiation. In some experiments, additionally pMCSV-Dnmt3a and 3b or empty pMCSV vector were transiently transduced, 24 hours after mimics transfection. iPSCs were then maintained in culture under the standard conditions (under 2i/LIF media) for 15 days, before differentiation started. Then, cells were plated in Matrigel pre-coated 6-well plates. Once they become confluent, the media was changed to RPMI 1640/B27 medium (Thermo Fisher Scientific, 61870127 for the RPMI 1640 media and A1895601 for B27) with CHIR99021 5 μM (Stem Cell Technologies, 72054). After two days, cells were washed and media without CHIR99021 was added. At day 3 of differentiation, media was supplemented with IWR1 5 μM (Stem Cell Technologies, 72564) and maintained in these conditions for 2 more days. At day 7 of differentiation, the media was changed to RPMI 1640/B27 plus insulin. Then, from day 9 to day 15, cells were cultured in RPMI 1640/B27 and the media was changed every 2 days. From day 16 to day 18 of differentiation, cells were cultured in DMEM without glucose and with lactate 4 mM. From day 18 to day 21, the media was changed to RPMI 1640/B27 and changed every day. Finally, from day 22 to day 28, monolayer cells can be isolated into cell clusters and kept in low attachment for another week.
(95) Cardiac Cryoinjury in Neonatal Mice
(96) The neonatal mouse cardiac cryoinjury experiments were performed as described previously (Polizzotti et al., 2016). Briefly, at postnatal day 1, neonates were placed on a heated water blanket set to 37° C. and covered with bedding from mother's nest. They were then anesthetized by placing the pups into an ice-water bath for 3 minutes. After that, the pups were dried using a sterile gauze pad and placed in the surgical area in the supine position, immobilized at the arms legs and tail. A transverse skin incision across the chest was made using a pair of micro-scissors and then carefully, a lateral thoracotomy was performed, by making a small incision at the fourth or fifth intercostal space. The pericardial sac was then carefully removed and the heart was exteriorized by gently pressing the abdomen. The left ventricle was identified and then the precooled cryoprobe was applied on the ventricle surface for just 2 seconds. To close the chest wall we used 8-0 Non-absorbable Prolene sutures and to close the skin, we used Webglue sutures. After closure, the surgical area was washed with wet gauzes to remove any residual blood. Rapidly, the pup was warmed for several minutes, returned to the heating blanket with the other pups and covered with bedding from the mother's cage. Once all the pups had fully recovered from the surgery, they were swapped in the mother's cage. Seven days after the cryoinjury, the pups were euthanized by decapitation and the hearts were collected and fixed in formaldehyde. The hearts were then processed normally for paraffin embedding as indicated above.
(97) Statistics.
(98) Normal distribution and equal variance was confirmed before using the Student's t-test (two-tailed, unpaired) to estimate statistical significance. For contingency tables, we used the Fisher's exact test. Statistical analysis was performed using Prism (GraphPad Software, La Jolla, Calif.).
Example 1. miR-203 Enhances the Function of Pluripotent Cells In Vitro
(99) To study miR-203 in vivo, the inventors first generated a conditional knockout mouse model in which the miR-203 encoding gene could be eliminated after expression of Cre recombinase (see
(100) A knockin inducible model (KI: ColA_MiR203; Rosa 26_rtTA) was also generated, where the miR-203-encoding sequence was inserted downstream of the type I collagen gene under the control of the tetracycline-responsive sequences [ColA1(miR-203/miR-203)] in the presence of tetracycline reverse transactivator expressed from the Rosa26 locus [Rosa26(rtTA/rtTA)] (
(101) The first approach was extracting the mouse embryonic fibroblasts (MEFs) from those mice (KO and KI), reprogramming them in vitro using the viral version of the Yamanaka factors and generating miR-203 knock in inducible pluripotent cells (miR-203 KI iPSCs).
(102) Treatment of mouse embryonic fibroblasts (MEFs) isolated from these mice with doxycycline led to a 1000-fold-induction in the levels of miR-203 (
(103) To directly study the effect of miR-203 expression in pluripotent cells, iPSCs were generated from MEFs isolated from these miR-203 KO and KI models. Wild-type, KO and un-induced KI MEFs were transduced with lentiviral vectors expressing Oct4, Sox2, Klf4 and Myc to generate iPSCs, and KI cultures were later treated with doxycycline (DOX) for 3-5 days, and then exposed to DOX withdrawal for several passages, thus obtaining iPSCs that were named transiently induced KI or, in abbreviated form, tKI iPSCs (see
(104) Although it was previously proposed that miR-203 prevents the stemness potential of skin progenitors (Yi et al., 2008), RNA sequencing of these iPSC clones as well as wild-type ES cells (ESC) unexpectedly revealed that tKI cells were transcriptionally closer to ESCs than WT iPSCs (
(105) To study the differentiation potential of mutant iPSCs, wild-type and mutant (KO and tKI) iPSCs were tested in the embryoid body formation assay in vitro. It was observed that in vitro differentiation to embryoid bodies (EBs) is significantly increased in tKI compared to control iPSCs and, besides, that tKI iPSC-derived EBs grow faster, differentiate better, show a higher percentage and efficiency at beating and exhibit a perfect architecture of the three germ layers. Thus, whereas lack of miR-203 resulted in deficient formation of embryoid bodies, transient induction of miR-203 for 5 days, 2 weeks prior to this assay, resulted in a significantly higher number and volume of embryoid bodies (
(106) TABLE-US-00003 TABLE 3 Gene Ontology Analysis of genes up- regulated in tKI iPSCs vs. KI iPSCs log10 (p- Gene Ontology value) Anatomical structure development (GO:0048856) −125.1 Anatomical structure morphogenesis (GO:0009653) −92.5 Organ development (GO:0048513) −90.7 Cell differentiation (GO:0030154) −74.7 Nervous system development (GO:0007399) −73.0 Organ morphogenesis (GO:0009887) −64.4 Regulation of cell communication (GO:0010646) −58.2 Cell adhesion (GO:0007155) −56.7 Regulation of developmental process (GO:0050793) −53.3 Cell development (GO:0048468) −50.3 Cell proliferation (GO:0008283) −49.4 Tissue development (GO:0009888) −49.3 Skeletal system development (GO:0001501) −46.8 Neurogenesis (GO:0022008) −44.6 Generation of neurons (GO:0048699) −40.6 Response to wounding (GO:0009611) −36.0 Neuron differentiation (GO:0030182) −35.9 Embryonic development (GO:0009790) −34.3 Positive regulation of metabolic process (GO:0009893) −34.1 Embryonic morphogenesis (GO:0048598) −33.7 Cell projection organization (GO:0030030) −33.0 Cell morphogenesis (GO:0000902) −32.9 Anatomical structure formation involved in morphogenesis −32.3 (GO:0048646) Central nervous system development (GO:0007417) −32.1 Cell morphogenesis involved in differentiation (GO:0000904) −32.0 Neuron development (GO:(0048666) −31.7 Cellular component movement (GO:0006928) −31.1 Vasculature development (GO:0001944) −31.0 Vesicle-mediated transport (GO:0016192) −30.7 Cell migration (GO:0016477) −30.1 Blood vessel development (GO:0001568) −30.0 Transmission of nerve impulse (GO:0019226) −29.4 Extracellular matrix organization (GO:0030198) −29.0 Positive regulation of cell differentiation (GO:0045597) −27.2 Anterior/posterior pattern formation (GO:0009952) −25.9 Bone development (GO:0060348) −25.8 Ossification (GO:0001503) −25.5 Embryonic skeletal system development (GO:0048706) −25.0 Blood vessel morphogenesis (GO:0048514) −24.56 Chordate embryonic development (GO:0043009) −23.9 Brain development (GO:0007420) −23.8 Tube development (GO:0035295) −21.0 Muscle organ development (GO:0007517) −20.9 Heart development (GO:0007507) −19.0 Regulation of cell adhesion (GO:0030155) −18.3 Tissue morphogenesis (GO:0048729) −17.8 Osteoblast differentiation (GO:0001649) −17.6 Urogenital system development (GO:0001655) −17.4 Gland development (GO:0048732) −17.3 Regulation of cell migration (GO:0030334) −17.2 Cartilage development (GO:0051216) −17.0 Kidney development (GO:0001822) −16.8 Blood circulation (GO:0008015) −16.7 Respiratory tube development (GO:0030323) −15.1 Respiratory system development (GO:0060541) −15.1 Regulation of immune system process (GO:0002682) −15.0 Lung development (GO:0030324) −14.6 Aging (GO:0007568) −13.4 Muscle fiber development (GO:0048747) −12.6 Metanephros development (GO:0001656) −12.6 Regulation of striated muscle tissue development (GO:0016202) −12.4 Branching morphogenesis of a tube (GO:0048754) −12.1 Muscle cell differentiation (GO:0042692) −12.1 Morphogenesis of an epithelium (GO:0002009) −12.1 Mammary gland development (GO:0030879) −12.1 Tissue remodeling (GO:0048771) −12.1 Ear development (GO:0043583) −11.7 Regulation of osteoblast differentiation (GO:0045667) −11.6 Positive regulation of epithelial cell proliferation (GO:0050679) −11.4 Mesenchymal cell development (GO:0014031) −10.4 Mesenchymal cell differentiation (GO:0048762) −10.4 Vasoconstriction (GO:0042310) −10.0 Regulation of smooth muscle cell proliferation (GO:0048660) −9.9 Regulation of blood pressure (GO:0008217) −9.9 Muscle contraction (GO:0006936) −9.9 Mesoderm formation (GO:0001707) −8.3 Mesoderm morphogenesis (GO:0048332) −8.3 Mesoderm development (GO:0007498) −8.3 Skin development (GO:0043588) −7.8 Regulation of heart contraction (GO:0008016) −7.7
(107) Interestingly, the upregulation of development and morphogenesis pathways was also accompanied by enhanced expression of pluripotency genes after transient induction of miR-203 in these iPSCs (
(108) The inventors next tested whether miR-203 had a similar effect in ES cells. ES cells were generated from ColA1(miR-203/miR-203); Rosa26(rtTA/rtTA) mice and these cells were left untreated (KI) or treated with doxycycline transiently for 5 days (tKI), 2 weeks before performing the embryoid body assays. As shown in
(109) Together, these results suggest that transient induction of miR-203 sequences improves pluripotency in iPSCs and ESCs favoring the differentiation of these cells to multiple lineages in vitro.
Example 2. miR-203 Improves Pluripotent Function of iPS Cells In Vivo
(110) It was then tested the potential of tKI iPSCs (in which the expression of miR-203 had only been induced for 5 days in vitro) after subcutaneous injection in mice. And it was found that in vivo differentiation to teratomas is also dramatically improved when tKI IPs are injected in mice when compared with their respective controls.
(111) Whereas the formation of teratomas was reduced in miR-203 KO cells, tKI iPSCs formed significantly bigger tumors in these assays (
(112) Transcriptomic studies in these teratomas suggested upregulation of genes involved in embryonic development and organ morphogenesis when derived from tKI iPSCs (
(113) It has been recently reported that iPSCs generated in vivo from an OSKM transgene are able to form small embryo-like structures, containing tissues derived from the three germinal layers, when inoculated intraperitoneally (Abad et al., 2013). In previous assays carried out by the group of the present inventors, wild-type iPSCs generated in vivo were able to form embryo-like structures in 11% of injected mice, an efficiency similar to the one reported previously (Abad et al., 20139. However, tKI iPSCs generated in vitro were much more efficient with 83% of injected mice showing embryo-like structures, even complex embryo-like structures never found after WT iPSCs injections, characterized by the expression of several markers or embryonic development, the three germ layers and extra-embryonic tissues (see
(114) TABLE-US-00004 TABLE 4 Embryo-like (E-Ls) structures in abdominal cavity after i.p. injection of iPSCs Cells No of clones Mice inoculated Mice with E-Ls % WT iPSCs 8 8 0 0 iv* WT iPSCs 9 9 1 11 tKI iPSCs 12 12 10 83 *iv: in vivo-generated
(115) It was next tested whether miR-203 could also influence the potential of pluripotent cells in forming chimeras. Table 5 shows the frequency of chimeric contribution exhibited by KI iPSCs and ESCs, transiently treated in vitro with vehicle (KI) or Dox (tKI) as indicated (2 independent clones were analyzed per condition) and summarizes the obtained results. From said Table 5, it can be seen that tKI ES cells showed a 27.5% of success in the formation of chimeras with 100% chimerism (as determined by coat color) versus 11.8% in control non-induced KI ES cells. Moreover, tKI iPSCs showed a 5.8% of success in the generation of 100% chimeras, while control non-induced iPSCs showed 1.5% of success in these assays. All the chimeras generated in these experiments contributed to germline transmission.
(116) TABLE-US-00005 TABLE 5 Frequency of chimeric contribution exhibited by KI iPSCs and ESC KI iPSCs tKI iPSCs KI ESCs tKI ESCs Cells (n = 2) (n = 2) (n = 2) (n = 2) Embryo transferred 135 137 68 69 Pups born 4 10 12 19 Chimeras born (adult) 2 (0) 8 (1) 8 (1) 19 (10) % success 1.5 5.8 11.8 27.5
(117) Finally, the performance of tKI iPSCs was tested in the tetraploid complementation assay with WT or tKI iPSCs or WT ESCs (n=3 clones per condition). Tetraploid embryo complementation represents the most stringent test for pluripotency and developmental potency. iPSCs are very inefficient in this assay in which any viable live-born animal develops uniquely at the expenses of the injected diploid iPS (or ES) cells in a tetraploid blastocyst. As can be seen in Table 6, no viable pups were obtained in control iPSCs, while tKI iPSCs were able to form full-chimeras (one of them is shown in
(118) TABLE-US-00006 TABLE 6 Results of embryo tetrapioid complementation assays WT iPSCs tKI iPSCs ESCs Cells (n = 3) (n = 3) (n = 3) Embryos transferred 69 144 42 All IPSC/ESC mice 0 4 5 % success 0 2.8 11.9
Example 3. miR-203 Effects in Pluripotency are Dnmt3a/b-Dependent
(119) To identify possible miR-203 targets involved in the control of pluripotency, the inventors searched for predicted miR-203 targets among the transcripts upregulated in miR-203-null iPSCs (more or equal than 2-fold increase respect to the wild type IPSCs) and downregulated in the miR-203 tKI inducible model (more or equal than 2 fold decrease respect to the wild type situation).
(120) 678 transcripts were found upregulated in miR-203-null iPSCs and downregulated in miR-203 tKI iPSCs, and 35 of those were predicted miR-203 targets (
(121) When the search was restricted to identify predicted miR-203 targets among the transcripts downregulated in tKI iPSCs (
(122) TABLE-US-00007 TABLE 7a List of miR-203 predicted targets in Mus musculus among the transcripts downregulated in miR-203 tKI and upregulated in miR-203-null iPSCs log2 (fold_change) Predicted miR-203 targets tKI vs. KO vs. Computational Predictions Transcript WT WT.sup.a Agreement.sup.b (method|target-site) Tspan1 −3.25 4.91 −0.77 ″Microlar|7mer-m8| Slc2a3 −4.79 4.21 1.54 ″Miranda|7mer-m8| Podxl −5.01 4.21 1.31 ″Miranda|7mer-m8| Nptx1 −2.67 3.96 −0.76 ″Targetscan|8mer| Dnmt3b −2.36 3.39 1.33 Miranda|Offset 3-8 6mer| Ptpn3 −1.77 3.38 1.36 ″Miranda|7mer-m8| Epb4.1l4b −1.16 3.17 −0.76 ″Targetscan|8mer| Hic2 −1.34 2.98 −0.77 ″Targetscan|7mer-1A| Hells −1.40 2.95 1.24 ″Miranda|7mer-m8| Fam81a −2.38 2.93 1.21 ″Miranda|7mer-m8| Cth −3.23 2.84 1.26 ″Miranda|N/A| Alg13 −2.46 2.57 1.21 ″Miranda|N/A| Ppat −1.32 2.45 1.28 ″Miranda|7mer-m8| Ap1s3 −1.06 2.43 1.30 ″Miranda|7mer-m8| Dppa2 −3.40 2.39 1.29 ″Miranda|6mer+| Tet2 −1.03 2.35 1.37 ″Miranda|8mer| Dock5 −1.87 2.33 −0.77 ″Targetscan|7mer-1A| Cdc6 −1.45 2.30 1.26 ″Miranda|Offset 3-8 6mer| Nfatc2 −2.59 2.28 1.30 ″Miranda|N/A| Glt1d1 −6.89 2.18 1.38 ″Miranda|7mer-m8| Fam60a −1.15 2.00 1.27 ″Miranda|6mer| Hspa12b −1.05 1.91 1.33 ″Miranda|N/A| Tfrc −2.32 1.77 1.26 ″Miranda|Offset 3-8 6mer| Sgol1 −1.36 1.74 1.34 ″Miranda|8mer| Rad51 −1.23 1.74 1.25 ″Miranda|Offset 3-8 6mer| Grb7 −0.64 1.66 −0.76 ″Microtar|Offset 1-7 7mer-m8| Cited2 −1.30 1.56 1.52 ″Miranda|7mer-m8| Dnmt3a −0.53 1.50 1.43 Miranda|7mer-m8| Pola1 −2.53 1.42 1.59 ″Miranda|7mer-m8| Msh3 −1.09 1.32 1.30 ″Miranda|7mer-m8| Tmpo −1.42 1.29 1.21 ″Miranda|N/A| Adh7 −1.03 1.20 1.38 ″Miranda|N7A| Xrcc2 −1.23 1.19 1.37 ″Miranda|7mer-m8| Fam49a −1.16 1.18 1.29 ″Miranda|8mer| Nsl1 −1.63 1.03 1.48 ″Miranda|7mer-m8| .sup.aList ordered by level of upregulation in miR-203 KO iPSCs. For those targets with multiple predictions, only the values corresponding to the highest prediction is shown. .sup.bThe agreement score of the target, which is a weighted mean (using each method's experimental AUC) of the computational methods scores in the prediction group.
(123) TABLE-US-00008 TABLE 7b List of miR-203 predicted targets in Mus musculus among the transcripts downregulated in miR-203 tKI and involved in the epigenetic regulation of gene expression (GO0040029) Predicted miR-203 targets tKI vs. WT log2 Agree- Computational Predictions Transcript (fold change) ment.sup.a (method|target-site) Dnmt3a −0.53 1.43 Miranda|7mer-m8| Dnmt3b −2.36 1.33 Miranda|Offset 3-8 6 mer Uhrf2 −0.52 1.31 Miranda|N/A∥ Trim27 −0.74 1.29 Miranda|Offset 3-8 6 mer Tet1 −1.05 1.29 Miranda|8mer∥ Apobec1 −0.67 1.26 Miranda|N/A| Ctcf −0.65 1.24 Miranda|6mer| Hells −1.40 1.24 Miranda|7mer-m8∥ Klf2 −1.11 1.23 Miranda|N/A| Mier1 −0.86 1.21 Miranda|6mer| Smarca5 −0.63 1.20 Miranda|N/A| Dnd1 −1.34 1.20 Miranda|Offset 3-8 6 mer Brca1 −1.51 1.20 Miranda|6mer Dpy30 −0.90 0.27 Miranda|N/A| Rnahybrid|Offset 1-7 8mer| Rlim −0.51 −0.75 Pita|8mer| Rbm3 −1.04 −0.76 Pita|8mer∥ H2afy −0.54 −0.76 Targetscan|7mer-m8| .sup.aThe agreement score of the target, which is a weighted mean (using each method's experimental AUC) of the computational methods scores in the prediction group.
(124) Among the transcripts deregulated in these two analyses, the inventors decided to focus on de novo DNA methyltransferases Dnmt3a (DNA Methyltransferase 3 Alpha, EC_number 2.1.1.37; Human Gene HGNC:2978, Ensembl: ENSG00000119772, NCBI gene: 1788, NCBI accession number: NM_022552 version NM_022552.4 7 Oct. 2016); Mus musculus gene MGI: 1261827, Ensembl: ENSMUSG00000020661; NCBI Gene: 13435, NCBI accession number: NM_001271753 version NM_001271753.1 15 Feb. 2015) and Dnmt3b (DNA Methyltransferase 3 beta EC_number 2.1.1.37; Human Gene HGNC:2979, Ensembl: ENSG00000088305 version ENSG00000088305.18; NCBI gene: 1789, NCBI accession number: NM_006892 version NM_006892.3 3 Nov. 2016; Mus musculus gene MGI: 1261819, Ensembl ENSMUSG00000027478 version ENSMUSG00000027478.15, NCBI gene 13436, NCBI accession number: NM_001003961 version NM_001003961 15 Feb. 2015) (data based on the following databases: HUGO Gene Nomenclature Committee (http://www.genenames.org/); MGI Mouse Genome Informatics (http://www.informatics.jax.org/) updated Mar. 13, 2017; Ensembl (www.ensembl.org) release 87, December 2016). The decision was based on the relevance of chromatin modifications in pluripotency, and the long-term effect resulting from transient expression of miR-203 suggestive of an epigenetic alteration. In addition, these two transcripts were also significantly downregulated after expression of miR-203 mimics in wild-type iPSCs (log 2 fold change=−0.24 for Dnmt3a and −0.22 for Dnmt3b transcripts). Human miR-203 and DNMT3a/b transcripts have been previously shown to display inverse expression profiles in cancer cells (Sandhu et al., 2012; Gasque Schoof et al., 2015) and DNMT3b was recently shown to be a direct miR-203 target in human colon cancer cells (To et al., 2016).
(125) Both Dnmt3a and Dnmt3b transcripts contain conserved miR-203 sites in their 3′-UTR (
(126) To test to what extent downregulation of Dnmt3a/b could mimic the effect of miR-203, the inventors knocked down these de novo DNA methyltransferases by RNA interference means (siDnmt3a/b). RNA sequencing of these samples revealed that siDnmt3a/b iPSCs exhibited a transcriptomic profile closer to tKI iPSCs (
(127) Knockdown of Dnmt3a/b also increased the 2C-like population in wild-type ESCs as scored by the expression of the MERVL element (
(128) As Dnmt3a/b are de novo methyltransferases involved in methylation of DNA, the inventors next analyzed the genome-wide methylation profile of wild-type and tKI iPSCs (before and after induction with doxycycline) as well as embryoid bodies derived from them (
(129) As validation of these observations, bisulphite modification followed by sequencing confirmed miR-203-dependent hypomethylation of the locus encoding the E74 Like ETS Transcription Factor 5 (Elf5), a protein involved in the differentiation of epithelial cells and trophoblast stem-cell renewal and differentiation (
(130) Previous data suggest that interfering with DNA methyltransferase expression or activity results in general hypomethylation in the genome (Blattler et al., 2014; Liao et al., 2015; Mikkelsen et al., 2008). To further analyze whether the changes in methylation in tKI iPSCs were related to the miR-203-mediated repression of Dnmt3a/b, the authors studied the changes in DMR methylation after overexpression a miR-203-resistant form of these DNA methyltransferases in tKI iPSCs. As depicted in
Example 4. Transient Expression of miR-203 Improves Differentiation and Maturation into Cardiomyocytes
(131) Since transient expression of miR-203 improves the function of pluripotent cells in several assays (
(132) The inventors also tested a cardiomyocyte differentiation protocol from wild-type iPSCs (Kattman et al., 2011). Mouse iPSCs were transiently transfected with miR-203 or control mimics and 15 days later they were differentiated into cardiomyoytes using specific media and culture conditions (see Methods). This differentiation was accompanied by increased expression of cardiomyocyte differentiation transcripts such as myosin heavy chain (Myh), atrial natriuretic peptide (Nppa), cardiac troponin T (encoded by the Tnnt2 gene), markers for cardiac progenitors such as insulin gene enhancer transcription factor Isl1 and Tbx5 in iPSCs previously treated with miR-203 mimics (
(133) The fact that miR-203 renders iPSCs more naive and increases their potency and plasticity to differentiate, inspired the inventors to test the effect of miR-203 in cardiac regeneration after injury. The neonatal mouse cardiac cryoinjury enables testing of molecular interventions to stimulate regeneration, in a model with characteristics similar to those observed in pediatric heart disease (Polizzotti et al., 2016). Heart muscle cell death was induced by cryoinjury in ColA1(miR-203/miR-203); Rosa26(rtTA/rtTA) mice at postnatal day 1 (
Example 5. miR-203 Induces a Ground Naïve State In Vitro
(134) In order to be able to compare properly the properties of the pluripotent cells obtained after transient exposure to increased levels of miR-203 with those of natural cells in a ground state, quantitative PCR analysis in mouse embryos isolated at different stages was performed. The results (
(135) The expression of miR-203 at the 2-cell stage inspired the inventors to analyze the expression of 2C markers in cultured tKI mouse PSCs. Transient expression of miR-203-GFP in wild-type ES cells significantly increased the number of 2C-like cells as determined by the expression of the murine endogenous retrovirus with leucine tRNA primer (MuERV-L; 2C::tdTomato reporter) (Macfarlan et al., 2012) (
Example 6. miR-203 Induces Naïve Pluripotency in Cells Cultured in 2i/LIF Medium
(136) Since the combination of the MEK inhibitor PD0325901 and the GSK3 inhibitor CH1R99021 with LIF (2i/L conditions) has been previously shown to render iPSCs closer to ESCs (Ying et al., 2008), so that it can be considered the former standard for maintaining stemness potential, it was also decided to test the effect of miR-203 under 2i/L conditions.
(137) It was observed that tKI iPSCs grown in 2i/L also displayed an enrichment in the transcription of stemness factors and developmental pathways when compared to wildtype iPSCs grown in the same conditions (
Example 7. miR-203 has Little Effect in ICR Regions Compared to 2i/L Conditions
(138) Given the recent findings showing that a widespread loss of methylation in PSC cultures might be deleterious when accompanied by massive erasure of genomic imprints (Choi et al., 2017; Yagi et al., 2017), the inventors decided to test the methylation levels at 103 different Imprinting Control Regions (ICR) in tKI iPSCs.
(139) Whereas tKI iPSCs displayed a progressive demethylation of genes (darker signal, red in the original, at t=10 and t=25 in
(140) Thus, it can be seen that miR-203 has little effect in ICR regions compared to 2i/L conditions, thus explaining the significant improvement of miR-203 treated cells in multiple in vivo assays.
CONCLUSION
(141) In conclusion, it is herein disclosed and demonstrated, by using a variety of cellular and in vivo models, that controlling transient miR-203 expression in induced pluripotent stem (iPS) or embryonic stem (ES) cells improves the ability of these cells to differentiate into multiple cell lineages and to reach further maturation properties without interfering with their self-renewal properties. This effect is mediated through the miR-203-dependent control of de novo DNA methyltransferases Dnmt3a and Dnmt3b, which in turn regulate the methylation landscape of pluripotent cells.
REFERENCES
(142) Abad, M. et al. Reprogramming in vivo produces teratomas and iPS cells with totipotency features. Nature 502, 340-345, doi:10.1038/nature12586 (2013) Ambros, V. The functions of animal microRNAs. Nature 431, 350-355, doi:10.1038/nature02871 (2004). Beard, C., Hochedlinger, K., Plath, K., Wutz, A. & Jaenisch, R. Efficient method to generate single-copy transgenic mice by site-specific integration in embryonic stem cells. Genesis 44, 23-28, doi:10.1002/gene.20180 (2006) Biase, F. H., et al., Cell fate inclination within 2-cell and 4-cell mouse embryos revealed by single-cell RNA sequencing. Genome research 24, 1787-1796 (2014). Bilic, J. and Izpisua Belmonte, J. C. Induced Pluripotent Stem Cells Versus Embryonic Stem Cells: Close Enough or Yet Too Far Apart?. Stem Cells, 30(1), 33-41 (2012). Blattler, A. et al. Global loss of DNA methylation uncovers intronic enhancers in genes showing expression changes. Genome biology 15, 469, doi:10.1186/s13059-014-0469-0 (2014) Bock, C. et al. BiQ Analyzer: visualization and quality control for DNA methylation data from bisulfite sequencing. Bioinformatics 21, 4067-4068, doi:10.1093/bioinformatics/bti652 (2005). Bueno, M. J. et al. Genetic and epigenetic silencing of microRNA-203 enhances ABL1 and BCR-ABL1 oncogene expression. Cancer cell 13, 496-506, doi:10.1016/j.ccr.2008.04.018 (2008). Card D A, Hebbar P B, Li L, Trotter K W, Komatsu Y, Mishina Y, Archer T K 2008. Oct4/Sox2-regulated miR-302 targets cyclin D1 in human embryonic stem cells. Mol Cell Biol 28: 6426-6438 Chetty, S., Pagliuca F, Honore C, Kweudjeu A, Rezania A, Melton D A. A simple tool to improve pluripotent stem cell differentiation. Nat Methods 10(6): 553-556 (2013). Choi, J., et al. Prolonged Mek1/2 suppression impairs the developmental potential of embryonic stem cells. Nature 548, 219-223 (2017). Chung et al, Human Embryonic Stem Cell lines generated without embryo destruction, Cell Stem Cell (2008) Chung, H. C. et al. Human induced pluripotent stem cells derived under feeder-free conditions display unique cell cycle and DNA replication gene profiles. Stem cells and development 21, 206-216, doi:10.1089/scd.2010.0440 (2012). Gasque Schoof, C. R., Izzotti, A., Jasiulionis, M. G. & Vasques Ldos, R. The Roles of miR-26, miR-29, and miR-203 in the Silencing of the Epigenetic Machinery during Melanocyte Transformation. BioMed research international 2015, 634749, doi:10.1155/2015/634749 (2015). Graña, O., Rubio-Camarillo, M., Fernandez-Riverola, F., Pisano, S. G. & Gonzalez-Peña, D. nextpresso: next generation sequencing expression analysis pipeline. Curr Bioinformatics Accepted for Publication. ISSN: (Online) 2212-392X—(Print) 1574-8936 (2017) Hanna, J. Saha K, Pando B, van Zon J, Lengner C J, Creyghton M P, van Oudenaarden A, Jaenisch R. Direct cell reprogramming is a stochastic process amenable to acceleration. Nature. 2009 Dec. 3; 462(7273):595-601. doi: 10.1038/nature08592. Epub 2009 Nov. 8. Honda, A., Hatori M., Hirose M., Honda C, Izu H, Inoue K, Hirasawa R, Matoba S, Togayachi S, Miyoshi H, Ogura A. Naive-like Conversion Overcomes the Limited Differentiation Capacity of Induced Pluripotent Stem Cells. J Biol Chem. 288(6): 26157-26166 (2013). Huang, Z. P. et al. Cardiomyocyte-enriched protein CIP protects against pathophysiological stresses and regulates cardiac homeostasis. The Journal of clinical investigation 125, 4122-4134, doi:10.1172/JCI82423 (2015) Huang, X. A. et al. The microRNA regulation of stem cells. Willey Interdisciplinary Reviews: Developmental Biology, vol. 1, no. 1, pages 83-95, doi:10.1002/wdev.5 (2011). Jackson, M. et al. Severe global DNA hypomethylation blocks differentiation and induces histone hyperacetylation in embryonic stem cells. Molecular and cellular biology 24, 8862-8871, doi:10.1128/MCB.24.20.8862-8871.2004 (2004). Kapinas, K. et al. microRNA-Mediated Survivin Control of Plutipotency. Journa of Cellular Physiology 230, 63-70 (2015). Kattman, S. J. et al. Stage-specific optimization of activin/nodal and BMP signaling promotes cardiac differentiation of mouse and human pluripotent stem cell lines. Cell stem cell 8, 228-240, doi:10.1016/j.stem.2010.12.008 (2011). Kole, R., Krainer A. R., Altman S. RNA therapeutics: beyond RNA interference and antisense oligonucleotides. Nat. Rev. Drug Discov., 11, 125-140 (2012). Langmead, B., Trapnell, C., Pop, M. & Salzberg, S. L. Ultrafast and memory-efficient alignment of short DNA sequences to the human genome. Genome biology 10, R25, doi:10.1186/gb-2009-10-3-r25 (2009). Lee, H. J. et al. Lineage specific methylation of the Elf5 promoter in mammary epithelial cells. Stem cells 29, 1611-1619, doi:10.1002/stem.706 (2011) Leonardo, T. R., Schultheisz, H. L., Loring, J. F. & Laurent, L. C. The functions of microRNAs in pluripotency and reprogramming. Nature cell biology 14, 1114-1121, doi:10.1038/ncb2613 (2012). Li, H. & Durbin, R. Fast and accurate short read alignment with Burrows-Wheeler transform. Bioinformatics 25, 1754-1760, doi:10.1093/bioinformatics/btp324 (2009). Li, M. & Izpisua Belmonte, J. C. Looking to the future following 10 years of induced pluripotent stem cell technologies. Nature protocols 11, 1579-1585, doi:10.1038/nprot.2016.108 (2016). Liao, J. et al. Targeted disruption of DNMT1, DNMT3A and DNMT3B in human embryonic stem cells. Nature genetics 47, 469-478, doi:10.1038/ng.3258 (2015) Lin L, Chang D C, Chang-Lin S, Lin C H, Wu D T, Chen D T, Ying S Y 2008. Mir-302 reprograms human skin cancer cells into a pluripotent ES-cell-like state. RNA 14: 2115-2124 Macfarlan, T. S. et al. Embryonic stem cell potency fluctuates with endogenous retrovirus activity. Nature 487, 57-63, doi:10.1038/nature11244 (2012) Marson A, Levine S S, Cole M F, Frampton G M, Brambrink T, Johnstone S, Guenther M G, Johnston W K, Wernig M, Newman J, et al. 2008. Connecting microRNA genes to the core transcriptional regulatory circuitry of embryonic stem cells. Cell 134: 521-533 Michel, C. I. & Malumbres, M. microRNA-203: Tumor Suppression and Beyond. MicroRNA 2, 118-126 (2013). Mikkelsen, T. S. et al. Dissecting direct reprogramming through integrative genomic analysis. Nature 454, 49-55, doi:10.1038/nature07056 (2008). Miyata, S., Minobe, W., Bristow, M. R. & Leinwand, L. A. Myosin heavy chain isoform expression in the failing and nonfailing human heart. Circulation research 86, 386-390 (2000). Nissan, X., et al. miR-203 modulates epithelial differentiation of human embryonic stem cells towards epidermal stratification. Developmental Biology 356(2), 506-515 (2011). Niwa H, Ogawa K, Shimosato D, Adachi K. A parallel circuit of LIF signalling pathways maintains pluripotency of mouse ES cells. Nature; 460(7251):118-22 (2009). doi:10.1038/nature08113 Okano, M., Bell, D. W., Haber, D. A. & Li, E. DNA methyltransferases Dnmt3a and Dnmt3b are essential for de novo methylation and mammalian development. Cell 99, 247-257 (1999) Otsuji, T. G. et al. Progressive maturation in contracting cardiomyocytes derived from human embryonic stem cells: Qualitative effects on electrophysiological responses to drugs. Stem cell research 4, 201-213, doi:10.1016/j.scr.2010.01.002 (2010). Papp, B. and Plath, K-. Reprogramming to pluripotency: stepwise resetting of the epigenetic landscape. Cell Research, 21(3), 486-501 (2011) Polizzotti, B. D., Ganapathy, B., Haubner, B. J., Penninger, J. M., and Kuhn, B. A cryoinjury model in neonatal mice for cardiac translational and regeneration research. Nature protocols 11, 542-552 (2016) Rodriguez, C. I. et al. High-efficiency deleter mice show that FLPe is an alternative to Cre-loxP. Nature genetics 25, 139-140, doi:10.1038/75973 (2000). Rosenbloom, K. R. et al. The UCSC Genome Browser database: 2015 update. Nucleic acids research 43, D670-681, doi:10.1093/nar/gku1177 (2015) Sandhu, R., Rivenbark, A. G. & Coleman, W. B. Loss of post-transcriptional regulation of DNMT3b by microRNAs: a possible molecular mechanism for the hypermethylation defect observed in a subset of breast cancer cell lines. International journal of oncology 41, 721-732, doi:10.3892/ijo.2012.1505 (2012). Schwenk, F., Baron, U. & Rajewsky, K. A cre-transgenic mouse strain for the ubiquitous deletion of loxP-flanked gene segments including deletion in germ cells. Nucleic acids research 23, 5080-5081 (1995) Shenoy, A. & Blelloch, R. H. Regulation of microRNA function in somatic stem cell proliferation and differentiation. Nature reviews. Molecular cell biology 15, 565-576, doi:10.1038/nrm3854 (2014). Takahashi, K. & Yamanaka, S. Induction of pluripotent stem cells from mouse embryonic and adult fibroblast cultures by defined factors. Cell 126, 663-676, doi:10.1016/j.cell.2006.07.024 (2006). Takahashi, K. & Yamanaka, S. A decade of transcription factor-mediated reprogramming to pluripotency. Nature reviews. Molecular cell biology 17, 183-193, doi:10.1038/nrm.2016.8 (2016). Tapia, N. & Scholer, H. R. Molecular Obstacles to Clinical Translation of iPSCs. Cell stem cell 19, 298-309, doi:10.1016/j.stem.2016.06.017 (2016). To, K. K., Leung, W. W. & Ng, S. S. A novel miR-203-DNMT3b-ABCG2 regulatory pathway predisposing colorectal cancer development. Molecular carcinogenesis, doi:10.1002/mc.22508 (2016). Trapnell, C. et al. Differential gene and transcript expression analysis of RNA-seq experiments with TopHat and Cufflinks. Nature protocols 7, 562-578, doi:10.1038/nprot.2012.016 (2012) Volinia S, Nuovo G, Drusco A, Costinean S, Abujarour R, Desponts C, Garofalo M, Baffa R, Aeqilan R, Maharry K, et al. 2014. Pluripotent Stem Cell miRNAs and Metastasis in Invasive Breast Cancer. J Natl Cancer Inst 106(12): dju324doi: 10.1093/jnci/dju324 Wang, J., et al. Isolation and cultivation of naïve-like human pluripotent stem cells based on HERVH expression. Nature protocols 11, 327-346 (2016). Wellner U, et al. The EMT-activator ZEB1 promotes tumorigenicity by repressing stemness inhibiting microRNA. Nature Cell Biology 11, 1487-1495 (2009). Xu, Quing, et al. Overexpression of KLF4 promotes cell senescene through microRNA-203-survivin-p21 pathway. Oncotarget 7, 11 Aug. 2016, doi: 10.18632/oncotarget.11200 Yi, R., Poy, M. N., Stoffel, M. & Fuchs, E. A skin microRNA promotes differentiation by repressing ‘stemness’. Nature 452, 225-229, doi:10.1038/nature06642 (2008). Ying Q L, Wray J, Nichols J, Batlle-Morera L, Doble B, Woodgett J et al. The ground state of embryonic stem cell self-renewal. Nature 453(7194):519-23 (2008). doi:10.1038/nature06968