COMPOUNDS AND METHODS FOR REDUCING APOE EXPRESSION

Abstract

Provided are compounds, methods, and pharmaceutical compositions for reducing the amount or activity of APOE RNA in a cell or animal, and in certain instances reducing the amount of APOE protein in a cell or animal Such compounds, methods, and pharmaceutical compositions are useful to ameliorate at least one symptom or hallmark of a neurodegenerative disease. Such symptoms and hallmarks include cognitive impairment, progressive memory loss, behavioral abnormality, dementia, difficulty performing daily activities, amyloid plaques, neurofibrillary tangles, and neuroinflammation.

Claims

1. An oligomeric compound comprising a modified oligonucleotide consisting of 12 to 30 linked nucleosides wherein the nucleobase sequence of the modified oligonucleotide is at least 80% complementary to an equal length portion of an APOE RNA, and wherein the modified oligonucleotide comprises at least one modification selected from a modified sugar and a modified internucleoside linkage.

2. An oligomeric compound comprising a modified oligonucleotide consisting of 12 to 30 linked nucleosides, wherein the nucleobase sequence of the modified oligonucleotide comprises at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, or at least 20 nucleobases of any of SEQ ID NOS: 20-2551 or 2934; wherein the modified oligonucleotide comprises at least one modification selected from a modified sugar and a modified internucleoside linkage.

3. An oligomeric compound comprising a modified oligonucleotide consisting of 12 to 30 linked nucleosides, wherein the nucleobase sequence of the modified oligonucleotide comprises at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, or at least 23 nucleobases of any of SEQ ID NOS: 2552-2742 or 2935-2944; wherein the modified oligonucleotide comprises at least one modification selected from a modified sugar and a modified internucleoside linkage.

4. An oligomeric compound comprising a modified oligonucleotide consisting of 12 to 30 linked nucleosides wherein the nucleobase sequence of the modified oligonucleotide is complementary to at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, or at least 21 contiguous nucleobases of: an equal length portion of nucleobases 1155-1178 of SEQ ID NO: 2; an equal length portion of nucleobases 1207-1230 of SEQ ID NO: 2; or an equal length portion of nucleobases 1259-1295 of SEQ ID NO: 2; wherein the modified oligonucleotide comprises at least one modification selected from a modified sugar and a modified internucleoside linkage.

5. An oligomeric compound comprising a modified oligonucleotide consisting of 12 to 30 linked nucleosides wherein the nucleobase sequence of the modified oligonucleotide is complementary to at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, or at least 21 contiguous nucleobases of: an equal length portion of nucleobases 1135-1166 of SEQ ID NO: 2; or an equal length portion of nucleobases 1255-1294 of SEQ ID NO: 2; wherein the modified oligonucleotide comprises at least one modification selected from a modified sugar and a modified internucleoside linkage.

6. An oligomeric compound comprising a modified oligonucleotide consisting of 12 to 30 linked nucleosides wherein the nucleobase sequence of the modified oligonucleotide is complementary to at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, or at least 21 contiguous nucleobases of an equal length portion of nucleobases 1255-1295 of SEQ ID NO: 2, wherein the modified oligonucleotide comprises at least one modification selected from a modified sugar and a modified internucleoside linkage.

7. An oligomeric compound comprising a modified oligonucleotide consisting of 12 to 30 linked nucleosides and having a nucleobase sequence comprising at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22 or at least 23 contiguous nucleobases of any of the nucleobase sequences of: SEQ ID NOS: 70, 71, 169, 170, 447, 448, 543, 552, 553, 919, 1061, 1132, 1938, 1991, 2066, 2154, 2226, 2259, 2324, 2417, or 2486; SEQ ID NOS: 460, 461, 462, 563, 564, 565, 566, 990, 1469, 1572, 1653, 1746, 1914, 1955, 2026, 2110, 2211, 2247, 2344, 2393, or 2481; or SEQ ID NOS: 77, 475, 476, 477, 478, 479, 480, 481, 482, 483, 578, 579, 580, 581, 582, 622, 623, 624, 625, 626, 627, 1063, 1193, 1231, 1232, 1300, 1305, 1378, 1409, 1493, 1526, 1564, 1576, 1678, 1679, 1695, 1827, 1870, 1921, 1928, 1950, 1982, 2012, 2046, 2051, 2074, 2088, 2118, 2158, 2169, 2208, 2223, 2232, 2255, 2321, 2343, 2380, 2436, 2449, or 2451.

8. An oligomeric compound comprising a modified oligonucleotide consisting of 12 to 30 linked nucleosides and having a nucleobase sequence comprising at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22 or at least 23 contiguous nucleobases of any of the nucleobase sequences of: SEQ ID NOS: 2600, 2601, 2604, 2605, 2606, 2607, 2608, 2609, 2610, or 2613; or SEQ ID NOS: 2720, 2721, 2722, 2726, 2727, 2729, 2730, 2731, 2732, 2733, 2734, 2735, 2736, 2737, 2738, or 2740.

9. An oligomeric compound comprising a modified oligonucleotide consisting of 12 to 30 linked nucleosides and having a nucleobase sequence comprising at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22 or at least 23 contiguous nucleobases of any of the nucleobase sequences of SEQ ID NOs: 76, 77, 473, 474, 475, 476, 477, 478, 479, 480, 481, 482, 483, 576, 578, 579, 580, 581, 582, 622, 623, 624, 625, 626, 627, 1063, 1193, 1231, 1232, 1300, 1305, 1378, 1409, 1493, 1526, 1564, 1576, 1678, 1679, 1695, 1701, 1792, 1827, 1870, 1886, 1906, 1921, 1928, 1950, 1982, 2012, 2046, 2051, 2074, 2088, 2118, 2158, 2169, 2208, 2223, 2232, 2255, 2321, 2343, 2370, 2380, 2436, 2449, 2490, 2451, 2720, 2721, 2722, 2725, 2726, 2727, 2729, 2730, 2731, 2732, 2733, 2734, 2735, 2736, 2737, 2738, 2740, 2935 or 2936.

10. The oligomeric compound of any of claims 1-9, wherein the nucleobase sequence of the modified oligonucleotide is at least 80%, 85%, 90%, 95%, or 100% complementary to any of the nucleobase sequences of SEQ ID NOs: 1-6 when measured across the entire nucleobase sequence of the modified oligonucleotide.

11. The oligomeric compound of any of claims 1-10, wherein at least one nucleoside of the modified oligonucleotide is a modified nucleoside.

12. The oligomeric compound of claim 11, wherein at least one modified nucleoside of the modified oligonucleotide comprises a modified sugar moiety.

13. The oligomeric compound of claim 12, wherein the modified sugar moiety comprises a bicyclic sugar moiety.

14. The oligomeric compound of claim 13, wherein the bicyclic sugar moiety comprises a 2′-4′ bridge selected from —O—CH.sub.2—; and —O—CH(CH.sub.3)—.

15. The oligomeric compound of any of claims 11-14, wherein at least one modified nucleoside of the modified oligonucleotide comprises a non-bicyclic modified sugar moiety.

16. The oligomeric compound of claim 15, wherein at least one modified nucleoside of the modified oligonucleotide comprises a bicyclic sugar moiety having a 2′-4′ bridge and at least one nucleoside comprising a non-bicyclic modified sugar moiety.

17. The oligomeric compound of claim 15 or 16, wherein the non-bicyclic modified sugar moiety is a 2′-O(CH.sub.2).sub.2—OCH.sub.3 ribosyl modified sugar moiety, a 2′-OMe modified sugar moiety, or a 2′-F modified sugar moiety.

18. The oligomeric compound of any of claims 1-17, wherein the modified oligonucleotide comprises at least one modified nucleoside comprising a sugar surrogate.

19. The oligomeric compound of claim 18, wherein at least one modified nucleoside of the modified oligonucleotide comprises a sugar surrogate selected from morpholino and PNA.

20. The oligomeric compound of any of claims 1-19, wherein the modified oligonucleotide comprises at least one modified internucleoside linkage.

21. The oligomeric compound of claim 20, wherein each internucleoside linkage of the modified oligonucleotide is a modified internucleoside linkage.

22. The oligomeric compound of claim 20 or 21, wherein at least one internucleoside linkage is a phosphorothioate internucleoside linkage.

23. The oligomeric compound of claim 20 or 22, wherein the modified oligonucleotide comprises at least one phosphodiester internucleoside linkage.

24. The oligomeric compound of any of claim 20, 22, or 23, wherein each internucleoside linkage is independently selected from a phosphodiester internucleoside linkage or a phosphorothioate internucleoside linkage.

25. The oligomeric compound of any of claim 20 or 22-24, wherein at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, or at least 19 internucleoside linkages of the modified oligonucleotide are phosphorothioate internucleoside linkages.

26. The oligomeric compound of any of claims 20-25, wherein each internucleoside linkage is a phosphorothioate internucleoside linkage.

27. The oligomeric compound of any of claim 20 or 22-26, wherein the internucleoside linkage motif of the modified oligonucleotide is selected from: 5′-sssssssssssssssssss-3′, 5′-soossssssssssooss-3′, 5′-sooosssssssssssooss-3′, 5′-soossssssssssos-3′, 5′-ssooooooooooooooooooss-3′, 5′-ssooooooooooooooooss-3′, 5′-soooossssssssssooss-3′, 5′-sossssssssssssssoss-3′, 5′-soosssssssssooss-3′, and 5′-sooooossssssssssoss-3′; wherein each ‘o’ represents a phosphodiester internucleoside linkage and each ‘s’ represents a phosphorothioate internucleoside linkage.

28. The oligomeric compound of any of claims 1-27, wherein the modified oligonucleotide comprises a modified nucleobase.

29. The oligomeric compound of claim 28, wherein the modified nucleobase is a 5-methyl cytosine.

30. The oligomeric compound of any of claims 1-29, wherein the oligomeric compound comprises a modified oligonucleotide consisting of 12-22, 12-20, 14-18, 14-20, 15-17, 15-25, 16-20, 16-18, 18-22, 18-25, 18-20, 20-25, or 21-23 linked nucleosides, or a pharmaceutically acceptable salt thereof

31. The oligomeric compound of claim 30, which is a pharmaceutically acceptable salt comprising one or more cations selected from sodium, potassium, calcium, and magnesium.

32. The oligomeric compound of any of claims 1-31, wherein the modified oligonucleotide consists of 16 or 18 linked nucleosides.

33. The oligomeric compound of any of claims 1-31, wherein the modified oligonucleotide consists of 20 linked nucleosides.

34. The oligomeric compound of any of claims 1-31, wherein the modified oligonucleotide consists of 21 linked nucleosides.

35. The oligomeric compound of any of claims 1-31, wherein the modified oligonucleotide consists of 23 linked nucleosides.

36. The oligomeric compound of any of claims 1-35, wherein the oligomeric compound is an RNase H compound.

37. The oligomeric compound of claim 36, wherein the modified oligonucleotide is a gapmer.

38. The oligomeric compound of any of claims 1-37, wherein the modified oligonucleotide has a sugar motif comprising: a 5′-region consisting of 1-6 linked 5′-region nucleosides; a central region consisting of 6-10 linked central region nucleosides; and a 3′-region consisting of 1-6 linked 3′-region nucleosides; wherein the 3′-most nucleoside of the 5′-region and the 5′-most nucleoside of the 3′-region comprise modified sugar moieties, and each of the central region nucleosides is selected from a nucleoside comprising a 2′-β-D-deoxyribosyl sugar moiety and a nucleoside comprising a 2′-substituted sugar moiety, wherein the central region comprises at least six nucleosides comprising a 2′-β-D-deoxyribosyl sugar moiety and no more than two nucleosides comprising a 2′-substituted sugar moiety.

39. The oligomeric compound of any of claim 1-34 or 36-37, wherein the modified oligonucleotide has a sugar motif comprising: a 5′-region consisting of 1-6 linked 5′-region nucleosides; a central region consisting of 6-10 linked central region nucleosides; and a 3′-region consisting of 1-6 linked 3′-region nucleosides; wherein each of the 5′-region nucleosides and each of the 3′-region nucleosides comprises a modified sugar moiety and each of the central region nucleosides comprises a 2′-β-D-deoxyribosyl sugar moiety.

40. The oligomeric compound of claim 39, wherein the modified oligonucleotide has a sugar motif comprising: a 5′-region consisting of 5 linked 5′-region nucleosides; a central region consisting of 10 linked central region nucleosides; and a 3′-region consisting of 5 linked 3′-region nucleosides; wherein each of the 5′-region nucleosides and each of the 3′-region nucleosides comprises either a cEt modified sugar moiety or a 2′-O(CH.sub.2).sub.2—OCH.sub.3 ribosyl modified sugar moiety, and each of the central region nucleosides comprises a 2′-β-D-deoxyribosyl sugar moiety.

41. The oligomeric compound of claim 39 or claim 40, wherein the modified oligonucleotide has a sugar motif comprising: a 5′-region consisting of 5 linked 5′-region nucleosides; a central region consisting of 10 linked central region nucleosides; and a 3′-region consisting of 5 linked 3′-region nucleosides; wherein each of the 5′-region nucleosides and each of the 3′-region nucleosides comprises a 2′-O(CH.sub.2).sub.2—OCH.sub.3 ribosyl modified sugar moiety, and each of the central region nucleosides comprises a 2′-β-D-deoxyribosyl sugar moiety.

42. The oligomeric compound of any of claims 1-35, wherein the oligomeric compound is an RNAi agent.

43. The oligomeric compound of any of claims 1-42, wherein the oligomeric compound comprises an antisense RNAi oligonucleotide comprising a targeting region comprising at least 15 contiguous nucleobases, wherein the targeting region is at least 90% complementary to an equal-length portion of an APOE RNA.

44. The oligomeric compound of claim 43, wherein the targeting region of the antisense RNAi oligonucleotide is at least 95% complementary or is 100% complementary to the equal length portion of an APOE RNA.

45. The oligomeric compound of any of claims 43-44, wherein the targeting region of the antisense RNAi oligonucleotide comprises at least 19, 20, 21, or 25 contiguous nucleobases.

46. The oligomeric compound of any of claims 43-45, wherein the APOE RNA has the nucleobase sequence of any of SEQ ID NOs: 1-6.

47. The oligomeric compound of any of claims 43-46, wherein at least one nucleoside of the antisense RNAi oligonucleotide comprises a modified sugar moiety selected from: 2′-F, 2′-O(CH.sub.2).sub.2—OCH.sub.3, 2′-NMA, LNA, and cEt; or a sugar surrogate selected from GNA, and UNA.

48. The oligomeric compound of any of claims 43-47, wherein each nucleoside of the antisense RNAi oligonucleotide comprises a modified sugar moiety or a sugar surrogate.

49. The oligomeric compound of any of claims 43-48, wherein at least 80%, at least 90%, or 100% of the nucleosides of the antisense RNAi oligonucleotide comprises a modified sugar moiety selected from 2′-F and 2′-OMe.

50. The oligomeric compound of any of claims 43-49, comprising a stabilized phosphate group attached to the 5′ position of the 5′-most nucleoside of the antisense RNAi oligonucleotide.

51. The oligomeric compound of claim 50, wherein the stabilized phosphate group comprises a cyclopropyl phosphonate or an (E)-vinyl phosphonate.

52. The oligomeric compound of any of claims 1-51, wherein the oligomeric compound is a single-stranded oligomeric compound.

53. The oligomeric compound of any of claims 1-52, consisting of the modified oligonucleotide or the RNAi antisense oligonucleotide.

54. The oligomeric compound of any of claims 1-53, comprising a conjugate group comprising a conjugate moiety and a conjugate linker.

55. The oligomeric compound of claim 54, wherein the conjugate linker consists of a single bond.

56. The oligomeric compound of claim 54, wherein the conjugate linker is cleavable.

57. The oligomeric compound of claim 54, wherein the conjugate linker comprises 1-3 linker-nucleosides.

58. The oligomeric compound of any of claims 54-57, wherein the conjugate group is attached to the 5′-end of the modified oligonucleotide or the antisense RNAi oligonucleotide.

59. The oligomeric compound of any of claims 54-57, wherein the conjugate group is attached to the 3′-end of the modified oligonucleotide or the antisense RNAi oligonucleotide.

60. The oligomeric compound of any of claims 1-59, comprising a terminal group.

61. The oligomeric compound of any of claim 1-56 or 58-60, wherein the oligomeric compound does not comprise linker-nucleosides.

62. An oligomeric duplex, comprising a first oligomeric compound comprising an antisense RNAi oligonucleotide of any of claims 43-61 and a second oligomeric compound comprising a sense RNAi oligonucleotide consisting of 17 to 30 linked nucleosides, wherein the nucleobase sequence of the sense RNAi oligonucleotide comprises an antisense-hybridizing region comprising least 15 contiguous nucleobases wherein the antisense-hybridizing region is at least 90% complementary to an equal length portion of the antisense RNAi oligonucleotide.

63. The oligomeric duplex of claim 62, wherein the sense RNAi oligonucleotide consists of 18-25, 20-25, or 21-23 linked nucleosides.

64. The oligomeric duplex of claim 62, wherein the sense RNAi oligonucleotide consists of 21 or 23 linked nucleosides.

65. The oligomeric duplex of any of claims 62-64, wherein 1-4 3′-most nucleosides of the antisense or the sense RNAi oligonucleotide are overhanging nucleosides.

66. The oligomeric duplex of any of claims 62-65, wherein 1-4 5′-most nucleosides of the antisense or sense RNAi oligonucleotide are overhanging nucleosides.

67. The oligomeric duplex of any of claims 62-64, wherein the duplex is blunt ended at the 3′-end of the antisense RNAi oligonucleotide.

68. The oligomeric duplex of any of claims 62-64, wherein the duplex is blunt ended at the 5′-end of the antisense RNAi oligonucleotide.

69. The oligomeric duplex of any of claims 62-68, wherein at least one nucleoside of the sense RNAi oligonucleotide comprises a modified sugar moiety selected from: 2′-F, 2′-OMe, LNA, cEt, or a sugar surrogate selected from GNA, and UNA.

70. The oligomeric duplex of claim 69, wherein each nucleoside of the sense RNAi oligonucleotide comprises a modified sugar moiety or a sugar surrogate.

71. The oligomeric duplex of claim 70, wherein at least 80%, at least 90%, or 100% of the nucleosides of the sense RNAi oligonucleotide comprises a modified sugar moiety selected from 2′-F and 2′-OMe.

72. The oligomeric duplex of any of claims 62-71, wherein at least one nucleoside of the sense RNAi oligonucleotide comprises a modified nucleobase.

73. The oligomeric duplex of any of claims 62-72, wherein at least one internucleoside linkage of the sense RNAi oligonucleotide is a modified internucleoside linkage.

74. The oligomeric duplex of claim 73, wherein at least one internucleoside linkage of the sense RNAi oligonucleotide is a phosphorothioate internucleoside linkage.

75. The oligomeric duplex of any of claims 62-74, wherein the oligomeric duplex comprises 1-5 abasic sugar moieties attached to one or both ends of the antisense or sense RNA oligonucleotide.

76. The oligomeric duplex of any of claims 62-75, consisting of the antisense RNAi oligonucleotide and the sense RNAi oligonucleotide.

77. The oligomeric duplex of any of claims 62-75, wherein the second oligomeric compound comprises a conjugate group comprising a conjugate moiety and a conjugate linker.

78. The oligomeric duplex of claim 77, wherein the conjugate linker consists of a single bond.

79. The oligomeric duplex of claim 78, wherein the conjugate linker is cleavable.

80. The oligomeric duplex of claim 78, wherein the conjugate linker comprises 1-3 linker-nucleosides.

81. The oligomeric duplex of any of claims 78-80, wherein the conjugate group is attached to the 5′-end of the sense RNAi oligonucleotide.

82. The oligomeric duplex of any of claims 78-80, wherein the conjugate group is attached to the 3′-end of the sense RNAi oligonucleotide.

83. The oligomeric duplex of any of claims 78-80, wherein the conjugate group is attached via the 2′ position of a ribosyl sugar moiety at an internal position of the sense RNAi oligonucleotide.

84. The oligomeric compound of any of claims 54-59 or the oligomeric duplex of any of claims 77-83, wherein at least one conjugate group comprises a C.sub.16 alkyl group.

85. The oligomeric duplex of claim 62, wherein the second oligomeric compound comprises a terminal group.

86. An antisense agent comprising an antisense compound, wherein the antisense compound is the oligomeric compound of any of claims 1-61.

87. The antisense agent of claim 86, wherein the antisense agent is the oligomeric duplex of any of claims 62-85.

88. The antisense agent of claim 86 or claim 87, wherein the antisense agent is: i) an RNase H agent capable of reducing the amount of APOE nucleic acid through the activation of RNase H; or ii) an RNAi agent capable of reducing the amount of APOE nucleic acid through the activation of RISC/Ago2.

89. The antisense agent of any of claims 86-88, wherein the antisense agent comprises a conjugate group, wherein the conjugate group comprises a cell-targeting moiety.

90. A chirally enriched population of oligomeric compounds of any of claims 1-61, wherein the population is enriched for modified oligonucleotides comprising at least one particular phosphorothioate internucleoside linkage having a particular stereochemical configuration.

91. The chirally enriched population of claim 90, wherein the population is enriched for modified oligonucleotides comprising at least one particular phosphorothioate internucleoside linkage having the (Sp) or (Rp) configuration.

92. The chirally enriched population of claim 90, wherein the population is enriched for modified oligonucleotides having a particular, independently selected stereochemical configuration at each phosphorothioate internucleoside linkage.

93. The chirally enriched population of claim 90, wherein the population is enriched for modified oligonucleotides having the (Rp) configuration at one particular phosphorothioate internucleoside linkage and the (Sp) configuration at each of the remaining phosphorothioate internucleoside linkages.

94. The chirally enriched population of claim 90, wherein the population is enriched for modified oligonucleotides having at least 3 contiguous phosphorothioate internucleoside linkages in the Sp, Sp, and Rp configurations, in the 5′ to 3′ direction.

95. A population of oligomeric compounds of any of claims 1-61, wherein all of the phosphorothioate internucleoside linkages of the modified oligonucleotide are stereorandom.

96. A pharmaceutical composition comprising an oligomeric compound of any of claims 1-61, an oligomeric duplex of any of claims 62-85, an antisense agent of any of claims 86-89, or a population of any of claims 90-95, and a pharmaceutically acceptable carrier or diluent.

97. The pharmaceutical composition of claim 96, wherein the pharmaceutically acceptable diluent is artificial cerebral spinal fluid (aCSF), sterile saline, or PBS.

98. The pharmaceutical composition of claim 97, wherein the pharmaceutical composition consists essentially of the modified oligonucleotide, the oligomeric duplex, the antisense agent, or the population and PBS or aCSF.

99. A method comprising administering to a subject an oligomeric compound of any of claims 1-61, an oligomeric duplex of any of claims 62-85, an antisense agent of any of claims 86-89, a population of any of claims 90-95, or a pharmaceutical composition of any of claims 96-98.

100. A method of treating a disease associated with APOE comprising administering to a subject having or at risk for developing a disease associated with APOE a therapeutically effective amount of an oligomeric compound of any of claims 1-61, an oligomeric duplex of any of claims 62-85, an antisense agent of any of claims 86-89, a population of any of claims 90-95, or a pharmaceutical composition according to any of claims 96-98; and thereby treating the disease associated with APOE.

101. The method of claim 100, wherein the APOE-associated disease is Alzheimer's Disease.

102. The method of any of claims 99-101, wherein at least one symptom or hallmark of the APOE-associated disease is ameliorated.

103. The method of claim 102, wherein the symptom or hallmark is cognitive impairment, progressive memory loss, behavioral abnormality, dementia, difficulty performing daily activities, amyloid plaques, neurofibrillary tangles, or neuroinflammation.

104. The method of any of claims 100-103, wherein administering an oligomeric compound of any of claims 1-61, an oligomeric duplex of any of claims 62-85, an antisense agent of any of claims 86-89, a population of any of claims 90-95, or a pharmaceutical composition according to any of claims 96-98 reduces cognitive impairment, behavioral abnormality, dementia, difficulty performing daily activities, amyloid plaques, neurofibrillary tangles, or neuroinflammation, or slows memory loss in the subject.

105. The method of any of claims 99-104, wherein the subject is human.

106. A method of reducing expression of APOE in a cell comprising contacting the cell with an oligomeric compound of any of claims 1-61, an oligomeric duplex of any of claims 62-85, an antisense agent of any of claims 86-89, a population of any of claims 90-95, or a pharmaceutical composition according to any of claims 96-98.

107. The method of claim 106, wherein the cell is a neuron or a glial cell, optionally wherein the cell is an astrocyte or microglial cell.

108. The method of claim 106 or claim 107, wherein the cell is a human cell.

109. Use of an oligomeric compound of any of claims 1-61, an oligomeric duplex of any of claims 62-85, an antisense agent of any of claims 86-89, a population of any of claims 90-95, or a pharmaceutical composition according to any of claims 96-98 for treating a disease associated with APOE.

110. Use of an oligomeric compound of any of claims 1-61, an oligomeric duplex of any of claims 62-85, an antisense agent of any of claims 86-89, a population of any of claims 90-95, or a pharmaceutical composition according to any of claims 96-98 in the manufacture of a medicament for treating a disease associated with APOE.

111. The use of claim 109 or claim 110, wherein the APOE-associated disease is Alzheimer's Disease.

Description

DETAILED DESCRIPTION OF THE INVENTION

[0009] It is to be understood that both the foregoing general description and the following detailed description are exemplary and explanatory only and are not restrictive. Herein, the use of the singular includes the plural unless specifically stated otherwise. As used herein, the use of “or” means “and/or” unless stated otherwise. Furthermore, the use of the term “including” as well as other forms, such as “includes” and “included”, is not limiting. Also, terms such as “element” or “component” encompass both elements and components comprising one unit and elements and components that comprise more than one subunit, unless specifically stated otherwise.

[0010] The section headings used herein are for organizational purposes only and are not to be construed as limiting the subject matter described. All documents, or portions of documents, cited in this application, including, but not limited to, patents, patent applications, articles, books, and treatises, are hereby expressly incorporated-by-reference for the portions of the document discussed herein, as well as in their entirety.

Definitions

[0011] Unless specific definitions are provided, the nomenclature used in connection with, and the procedures and techniques of, analytical chemistry, synthetic organic chemistry, and medicinal and pharmaceutical chemistry described herein are those well-known and commonly used in the art. Where permitted, all patents, applications, published applications and other publications and other data referred to throughout in the disclosure are incorporated by reference herein in their entirety.

[0012] Unless otherwise indicated, the following terms have the following meanings:

Definitions

[0013] As used herein, “2′-deoxynucleoside” means a nucleoside comprising a 2′-H(H) deoxyribosyl sugar moiety. In certain embodiments, a 2′-deoxynucleoside is a 2′-β-D-deoxynucleoside and comprises a 2′-β-D-deoxyribosyl sugar moiety, which has the β-D configuration as found in naturally occurring deoxyribonucleic acids (DNA). In certain embodiments, a 2′-deoxynucleoside or a nucleoside comprising an unmodified 2′-deoxyribosyl sugar moiety may comprise a modified nucleobase or may comprise an RNA nucleobase (uracil).

[0014] As used herein, “2′-substituted nucleoside” means a nucleoside comprising a 2′-substituted sugar moiety. As used herein, “2′-substituted” in reference to a sugar moiety means a sugar moiety comprising at least one 2′-substituent group other than H or OH.

[0015] As used herein, “3′ target site” refers to the 3′-most nucleotide of a target nucleic acid which is complementary to an antisense oligonucleotide, when the antisense oligonucleotide is hybridized to the target nucleic acid.

[0016] As used herein, “5′ target site” refers to the 5′-most nucleotide of a target nucleic acid which is complementary to an antisense oligonucleotide, when the antisense oligonucleotide is hybridized to the target nucleic acid.

[0017] As used herein, “5-methyl cytosine” means a cytosine modified with a methyl group attached to the 5 position. A 5-methyl cytosine is a modified nucleobase.

[0018] As used herein, “abasic sugar moiety” means a sugar moiety of a nucleoside that is not attached to a nucleobase. Such abasic sugar moieties are sometimes referred to in the art as “abasic nucleosides.”

[0019] As used herein, “administration” or “administering” means providing a pharmaceutical agent or composition to an animal.

[0020] As used herein, “amyloid plaque” means an aggregate of peptides that are encoded by a human amyloid precursor protein gene, APP.

[0021] As used herein, “animal” and “subject” are used interchangeably and the terms mean a human or non-human animal.

[0022] As used herein, “antisense activity” means any detectable and/or measurable change attributable to the hybridization of an antisense compound to its target nucleic acid. In certain embodiments, antisense activity is a decrease in the amount or expression of a target nucleic acid or protein encoded by such target nucleic acid compared to target nucleic acid levels or target protein levels in the absence of the antisense compound.

[0023] As used herein, “antisense agent” means an antisense compound and optionally one or more additional features, such as a sense compound.

[0024] As used herein, “antisense compound” means an antisense oligonucleotide and optionally one or more additional features, such as a conjugate group.

[0025] As used herein, “sense compound” means a sense oligonucleotide and optionally one or more additional features, such as a conjugate group.

[0026] As used herein, “antisense oligonucleotide” means an oligonucleotide, including the oligonucleotide portion of an antisense compound, that is capable of hybridizing to a target nucleic acid and is capable of at least one antisense activity. Antisense oligonucleotides include but are not limited to antisense RNAi oligonucleotides and antisense RNase H oligonucleotides.

[0027] As used herein, “sense oligonucleotide” means an oligonucleotide, including the oligonucleotide portion of a sense compound, that is capable of hybridizing to an antisense oligonucleotide.

[0028] As used herein, “ameliorate” in reference to a treatment means improvement in at least one symptom relative to the same symptom in the absence of the treatment. In certain embodiments, amelioration is the reduction in the severity or frequency of a symptom or the delayed onset or slowing of progression in the severity or frequency of a symptom. In certain embodiments, the symptom or hallmark is cognitive impairment, progressive memory loss, behavioral abnormality, dementia, difficulty performing daily activities, amyloid plaques, neurofibrillary tangles, and neuroinflammation.

[0029] As used herein, “behavioral abnormality” means a behavior exhibited by a subject that is atypical or out of the ordinary for the subject. In certain embodiments, the behavior abnormality is selected from depression, anxiety, panic, phobia, paranoia, and a combination thereof. In certain embodiments, the behavior abnormality is a dysfunctional or deviant behavior (e.g., causes distress for others).

[0030] As used herein, “bicyclic nucleoside” or “BNA” means a nucleoside comprising a bicyclic sugar moiety.

[0031] As used herein, “bicyclic sugar” or “bicyclic sugar moiety” means a modified sugar moiety comprising two rings, wherein the second ring is formed via a bridge connecting two of the atoms in the first ring thereby forming a bicyclic structure. In certain embodiments, the first ring of the bicyclic sugar moiety is a furanosyl moiety. In certain embodiments, the bicyclic sugar moiety does not comprise a furanosyl moiety.

[0032] As used herein, “blunt” or “blunt ended” in reference to a duplex formed by two oligonucleotides mean that there are no terminal unpaired nucleotides (i.e. no overhanging nucleotides). One or both ends of a double-stranded RNAi agent can be blunt.

[0033] As used herein, “cell-targeting moiety” means a conjugate group or portion of a conjugate group that is capable of binding to a particular cell type or particular cell types.

[0034] As used herein, “cerebrospinal fluid” or “CSF” means the fluid filling the space around the brain and spinal cord. “Artificial cerebrospinal fluid” or “aCSF” means a prepared or manufactured fluid that has certain properties of cerebrospinal fluid.

[0035] As used herein, “cleavable moiety” means a bond or group of atoms that is cleaved under physiological conditions, for example, inside a cell, an animal, or a human. As used herein, “cognitive impairment” means confusion, poor motor coordination, loss of short-term memory, loss of long-term memory, identity confusion, impaired judgment, or any combination thereof.

[0036] As used herein, “complementary” in reference to an oligonucleotide means that at least 70% of the nucleobases of the oligonucleotide or one or more regions thereof and the nucleobases of another nucleic acid or one or more regions thereof are capable of hydrogen bonding with one another when the nucleobase sequence of the oligonucleotide and the other nucleic acid are aligned in opposing directions. Complementary nucleobases means nucleobases that are capable of forming hydrogen bonds with one another. Complementary nucleobase pairs include adenine (A) and thymine (T), adenine (A) and uracil (U), cytosine (C) and guanine (G), 5-methyl cytosine (mC) and guanine (G). Certain modified nucleobases that pair with natural nucleobases or with other modified nucleobases are known in the art. For example, inosine can pair with adenosine, cytosine, or uracil. Complementary oligonucleotides and/or nucleic acids need not have nucleobase complementarity at each nucleoside. Rather, some mismatches are tolerated. As used herein, “fully complementary” or “100% complementary” in reference to oligonucleotides means that oligonucleotides are complementary to another oligonucleotide or nucleic acid at each nucleoside of the oligonucleotide.

[0037] As used herein, “conjugate group” means a group of atoms that is directly attached to an oligonucleotide. Conjugate groups include a conjugate moiety and a conjugate linker that attaches the conjugate moiety to the oligonucleotide.

[0038] As used herein, “conjugate linker” means a single bond or a group of atoms comprising at least one bond that connects a conjugate moiety to an oligonucleotide.

[0039] As used herein, “conjugate moiety” means a group of atoms that modifies one or more properties of a molecule compared to the identical molecule lacking the conjugate moiety, including but not limited to pharmacodynamics, pharmacokinetics, stability, binding, absorption, tissue distribution, cellular distribution, cellular uptake, charge and clearance.

[0040] As used herein, “contiguous” in the context of an oligonucleotide refers to nucleosides, nucleobases, sugar moieties, or internucleoside linkages that are immediately adjacent to each other. For example, “contiguous nucleobases” means nucleobases that are immediately adjacent to each other in a sequence.

[0041] As used herein, “constrained ethyl” or “cEt” or “cEt modified sugar moiety” means a β-D ribosyl bicyclic sugar moiety wherein the second ring of the bicyclic sugar is formed via a bridge connecting the 4′-carbon and the 2′-carbon of the β-D ribosyl sugar moiety, wherein the bridge has the formula 4′-CH(CH.sub.3)—O-2′, and wherein the methyl group of the bridge is in the S configuration.

[0042] As used herein, “cEt nucleoside” means a nucleoside comprising a cEt modified sugar moiety.

[0043] As used herein, “chirally enriched population” means a plurality of molecules of identical molecular formula, wherein the number or percentage of molecules within the population that contain a particular stereochemical configuration at a particular chiral center is greater than the number or percentage of molecules expected to contain the same particular stereochemical configuration at the same particular chiral center within the population if the particular chiral center were stereorandom. Chirally enriched populations of molecules having multiple chiral centers within each molecule may contain one or more stereorandom chiral centers. In certain embodiments, the molecules are modified oligonucleotides. In certain embodiments, the molecules are oligomeric compounds comprising modified oligonucleotides.

[0044] As used herein, “daily activities” mean one or more activities selected from dressing, eating, walking, bathing, cooking, shopping, cleaning and exercising.

[0045] As used herein, “dementia” means any combination of symptoms selected from memory loss, difficulty communicating, disorientation, difficulty reasoning, difficulty planning, discoordination, compromised motor function, confusion, disorientation, depression, anxiety, paranoia, agitation, and hallucination.

[0046] As used herein, “double-stranded” means a duplex formed by complementary strands of nucleic acids (including, but not limited to oligonucleotides) hybridized to one another. In certain embodiments, the two strands of a double-stranded region are separate molecules. In certain embodiments, the two strands are regions of the same molecule that has folded onto itself (e.g., a hairpin structure).

[0047] As used herein, “duplex” or “duplex region” means the structure formed by two oligonucleotides or portions thereof that are hybridized to one another.

[0048] As used herein, “gapmer” means a modified oligonucleotide comprising an internal region positioned between external regions having one or more nucleosides, wherein the nucleosides comprising the internal region are chemically distinct from the nucleoside or nucleosides comprising the external regions, and wherein the modified oligonucleotide supports RNase H cleavage. The internal region may be referred to as the “gap” and the external regions may be referred to as the “wings” or “wing segments.” In certain embodiments, the internal region is a deoxy region. The positions of the internal region or gap refer to the order of the nucleosides of the internal region and are counted starting from the 5′-end of the internal region. Unless otherwise indicated, “gapmer” refers to a sugar motif. In certain embodiments, each nucleoside of the gap is a 2′-β-D-deoxynucleoside. In certain embodiments, the gap comprises one 2′-substituted nucleoside at position 1, 2, 3, 4, or 5 of the gap, and the remainder of the nucleosides of the gap are 2′-β-D-deoxynucleosides. As used herein, the term “MOE gapmer” indicates a gapmer having a gap comprising 2′-β-D-deoxynucleosides and wings comprising 2′-MOE modified nucleosides. As used herein, the term “mixed wing gapmer” indicates a gapmer having wings comprising modified nucleosides comprising at least two different sugar modifications. Unless otherwise indicated, a gapmer may comprise one or more modified internucleoside linkages and/or modified nucleobases and such modifications do not necessarily follow the gapmer pattern of the sugar modifications.

[0049] As used herein, “hotspot region” is a range of nucleobases on a target nucleic acid that is amenable to oligomeric compound-mediated reduction of the amount or activity of the target nucleic acid.

[0050] As used herein, “hybridization” means the annealing of oligonucleotides and/or nucleic acids. While not limited to a particular mechanism, the most common mechanism of hybridization involves hydrogen bonding, which may be Watson-Crick, Hoogsteen or reversed Hoogsteen hydrogen bonding, between complementary nucleobases. In certain embodiments, complementary nucleic acid molecules include, but are not limited to, an antisense compound and a nucleic acid target. In certain embodiments, complementary nucleic acid molecules include, but are not limited to, an oligonucleotide and a nucleic acid target.

[0051] As used herein, “internucleoside linkage” is the covalent linkage between adjacent nucleosides in an oligonucleotide. As used herein “modified internucleoside linkage” means any internucleoside linkage other than a phosphodiester internucleoside linkage. “Phosphorothioate internucleoside linkage” is a modified internucleoside linkage in which one of the non-bridging oxygen atoms of a phosphodiester internucleoside linkage is replaced with a sulfur atom.

[0052] As used herein, “inverted nucleoside” means a nucleotide having a 3′ to 3′ and/or 5′ to 5′ internucleoside linkage, as shown herein.

[0053] As used herein, “inverted sugar moiety” means the sugar moiety of an inverted nucleoside or an abasic sugar moiety having a 3′ to 3′ and/or 5′ to 5′ internucleoside linkage.

[0054] As used herein, “linker-nucleoside” means a nucleoside that links, either directly or indirectly, an oligonucleotide to a conjugate moiety. Linker-nucleosides are located within the conjugate linker of an oligomeric compound. Linker-nucleosides are not considered part of the oligonucleotide portion of an oligomeric compound even if they are contiguous with the oligonucleotide.

[0055] “Lipid nanoparticle” or “LNP” is a vesicle comprising a lipid layer encapsulating a pharmaceutically active molecule, such as a nucleic acid molecule, e.g., an RNAi or a plasmid from which an RNAi is transcribed. LNPs are described in, for example, U.S. Pat. Nos. 6,858,225, 6,815,432, 8,158,601, and 8,058,069, the entire contents of which are hereby incorporated herein by reference.

[0056] As used herein, “non-bicyclic modified sugar moiety” means a modified sugar moiety that comprises a modification, such as a substituent, that does not form a bridge between two atoms of the sugar to form a second ring.

[0057] As used herein, “neuroinflammation” means inflammation of the peripheral nervous system or the central nervous system. In certain embodiments, the amount of a cytokine in the cerebrospinal fluid of a subject with neuroinflammation is significantly greater than the amount of the cytokine in the cerebrospinal fluid of a subject that does not have neuroinflammation. In certain embodiments, a subject with neuroinflammation has Alzheimer's Disease. In certain embodiments, a subject that does not have neuroinflammation does not have Alzheimer's Disease.

[0058] As used herein, “mismatch” or “non-complementary” means a nucleobase of a first nucleic acid sequence that is not complementary with the corresponding nucleobase of a second nucleic acid sequence or target nucleic acid when the first and second nucleic acid sequences are aligned.

[0059] As used herein, “MOE” means O-methoxyethyl. “2′-MOE” or “2′-MOE modified sugar” or “2′-MOE modified sugar moiety” means a 2′-OCH.sub.2CH.sub.2OCH.sub.3 group (or a 2′-O(CH.sub.2).sub.2—OCH.sub.3 group) in place of the 2′-OH group of a ribosyl sugar moiety. Unless otherwise indicated, a 2′-MOE modified sugar moiety is in the β-D-ribosyl configuration. As used herein, “2′-MOE modified nucleoside” means a nucleoside comprising a 2′-MOE modified sugar moiety (or a 2′-O(CH.sub.2).sub.2—OCH.sub.3 ribosyl modified sugar moiety).

[0060] As used herein, “2′-OMe” means a 2′-OCH.sub.3 group in place of the 2′-OH group of a ribosyl sugar moiety. A “2′-O-methyl sugar moiety” or “2′-OMe sugar moiety” or “2′-OMe modified sugar moiety” or “2′-O methylribosyl sugar” means a sugar moiety with a 2′-OCH.sub.3 group in place of the 2′-OH group of a ribosyl sugar moiety. Unless otherwise indicated, a 2′-OMe sugar moiety is in the β-D-ribosyl configuration.

[0061] As used herein, “2′-OMe nucleoside” means a nucleoside comprising a 2′-OMe modified sugar moiety.

[0062] As used herein, “2′-F” means a 2′-fluoro group in place of the 2′-OH group of a ribosyl sugar moiety. A “2′-F sugar moiety” or “2′-F modified sugar moiety” or “2′-fluororibosyl sugar” means a sugar moiety with a 2′-F group in place of the 2′-OH group of a ribosyl sugar moiety. Unless otherwise indicated, a 2′-F sugar moiety is in the β-D-ribosyl configuration.

[0063] As used herein, “2′-F nucleoside” or “2′-F modified nucleoside” means a nucleoside comprising a 2′-F modified sugar moiety.

[0064] As used herein, “motif” means the pattern of unmodified and/or modified sugar moieties, nucleobases, and/or internucleoside linkages, in an oligonucleotide.

[0065] As used herein, “neurodegenerative disease” means a condition marked by progressive loss of function or structure, including loss of neuronal function and death of neurons. In certain embodiments, the neurodegenerative disease is Alzheimer's Disease. In certain embodiments, the neurodegenerative disease is Alzheimer's Disease in Down Syndrome patients. In certain embodiments, the neurodegenerative disease is Cerebral Amyloid Angiopathy.

[0066] As used herein, “nucleobase” means an unmodified nucleobase or a modified nucleobase. A nucleobase is a heterocyclic moiety. As used herein an “unmodified nucleobase” is adenine (A), thymine (T), cytosine (C), uracil (U), or guanine (G). As used herein, a “modified nucleobase” is a group of atoms other than unmodified A, T, C, U, or G capable of pairing with at least one other nucleobase. A “5-methyl cytosine” is a modified nucleobase. A universal base is a modified nucleobase that can pair with any one of the five unmodified nucleobases.

[0067] As used herein, “nucleobase sequence” means the order of contiguous nucleobases in a nucleic acid or oligonucleotide independent of any sugar or internucleoside linkage modification.

[0068] As used herein, “nucleoside” means a compound or fragment of a compound comprising a nucleobase and a sugar moiety. The nucleobase and sugar moiety are each, independently, unmodified or modified.

[0069] As used herein, “nucleoside overhang” refers to unpaired nucleotides at either or both ends of a duplex formed by hybridization of an antisense RNAi oligonucleotide and a sense RNAi oligonucleotide.

[0070] As used herein, “modified nucleoside” means a nucleoside comprising a modified nucleobase and/or a modified sugar moiety.

[0071] As used herein, “linked nucleosides” are nucleosides that are connected in a contiguous sequence (i.e., no additional nucleosides are presented between those that are linked).

[0072] As used herein, “modified oligonucleotide” means an oligonucleotide, wherein at least one nucleoside or internucleoside linkage is modified. As used herein, “unmodified oligonucleotide” means an oligonucleotide that does not comprise any nucleoside modifications or internucleoside modifications. Thus, each nucleoside of an unmodified oligonucleotide is a DNA or RNA nucleoside and each internucleoside linkage is a phosphodiester linkage.

[0073] As used herein, “neurofibrillary tangles” mean hyperphosphorylated insoluble aggregates of tau protein. Tau protein is encoded by a human MAPT gene.

[0074] As used herein, “oligomeric compound” means an oligonucleotide and optionally one or more additional features, such as a conjugate group or terminal group. An oligomeric compound may be paired with a second oligomeric compound that is complementary to the first oligomeric compound or may be unpaired. A “singled-stranded oligomeric compound” is an unpaired oligomeric compound. The term “oligomeric duplex” means a duplex formed by two oligomeric compounds having complementary nucleobase sequences. Each oligomeric compound of an oligomeric duplex may be referred to as a “duplexed oligomeric compound.”

[0075] As used herein, “oligonucleotide” means a polymer of linked nucleosides connected via internucleoside linkages, wherein each nucleoside and internucleoside linkage may be modified or unmodified. Unless otherwise indicated, oligonucleotides consist of 8-50 linked nucleosides. An oligonucleotide may be paired with a second oligonucleotide that is complementary to the oligonucleotide or it may be unpaired. A “single-stranded oligonucleotide” is an unpaired oligonucleotide. A “double-stranded oligonucleotide” is an oligonucleotide that is paired with a second oligonucleotide. An “oligonucleotide duplex” means a duplex formed by two paired oligonucleotides having complementary nucleobase sequences. Each oligo of an oligonucleotide duplex is a “duplexed oligonucleotide” or a “double-stranded oligonucleotide.”

[0076] As used herein, “pharmaceutically acceptable carrier or diluent” means any substance suitable for use in administering to an animal. Certain such carriers enable pharmaceutical compositions to be formulated as, for example, tablets, pills, dragees, capsules, liquids, gels, syrups, slurries, suspension and lozenges for the oral ingestion by a subject. In certain embodiments, a pharmaceutically acceptable carrier or diluent is sterile water, sterile saline, sterile buffer solution or sterile artificial cerebrospinal fluid.

[0077] As used herein “pharmaceutically acceptable salts” means physiologically and pharmaceutically acceptable salts of compounds. Pharmaceutically acceptable salts retain the desired biological activity of the parent compound and do not impart undesired toxicological effects thereto.

[0078] As used herein “pharmaceutical composition” means a mixture of substances suitable for administering to a subject. For example, a pharmaceutical composition may comprise an oligomeric compound and a sterile aqueous solution. In certain embodiments, a pharmaceutical composition shows activity in free uptake assay in certain cell lines.

[0079] As used herein “prodrug” means a therapeutic agent in a first form outside the body that is converted to a second form within an animal or cells thereof. Typically, conversion of a prodrug within the animal is facilitated by the action of an enzymes (e.g., endogenous or viral enzyme) or chemicals present in cells or tissues and/or by physiologic conditions. In certain embodiments, the first form of the prodrug is less active than the second form.

[0080] As used herein, “progressive memory loss” means occurrences of forgetfulness (e.g., inability to remember events, names, and facts) that increase in frequency over time.

[0081] As used herein, “reducing or inhibiting the amount or activity” refers to a reduction or blockade of the transcriptional expression or activity relative to the transcriptional expression or activity in an untreated or control sample and does not necessarily indicate a total elimination of transcriptional expression or activity.

[0082] As used herein, “RNAi agent” means an antisense compound that acts, at least in part, through RISC or Ago2 to modulate a target nucleic acid and/or protein encoded by a target nucleic acid. RNAi agents include, but are not limited to double-stranded siRNA, single-stranded RNA (ssRNA), and microRNA, including microRNA mimics. RNAi agents may comprise conjugate groups and/or terminal groups. In certain embodiments, an RNAi agent modulates the amount and/or activity of a target nucleic acid. The term RNAi agent excludes antisense compounds that act through RNase H.

[0083] As used herein, “RNAi oligonucleotide” means an antisense RNAi oligonucleotide or a sense RNAi oligonucleotide.

[0084] As used herein, “antisense RNAi oligonucleotide” means an oligonucleotide comprising a region that is complementary to a target sequence, and which includes at least one chemical modification suitable for RNAi.

[0085] As used herein, “sense RNAi oligonucleotide” means an oligonucleotide comprising a region that is complementary to a region of an antisense RNAi oligonucleotide, and which is capable of forming a duplex with such antisense RNAi oligonucleotide. A duplex formed by an antisense RNAi oligonucleotide and a sense RNAi oligonucleotide is referred to as a double-stranded RNAi agent (dsRNAi) or a short interfering RNA (siRNA).

[0086] As used herein, “RNase H compound” means an antisense compound that acts, at least in part, through RNase H to modulate a target nucleic acid and/or protein encoded by a target nucleic acid. In certain embodiments, RNase H compounds are single-stranded. In certain embodiments, RNase H compounds are double-stranded. RNase H compounds may comprise conjugate groups and/or terminal groups. In certain embodiments, an RNase H compound modulates the amount or activity of a target nucleic acid. The term RNase H compound excludes antisense compounds that act principally through RISC/Ago2.

[0087] As used herein, “antisense RNase H oligonucleotide” means an oligonucleotide comprising a region that is complementary to a target sequence, and which includes at least one chemical modification suitable for RNase H-mediated nucleic acid reduction.

[0088] As used herein, “self-complementary” in reference to an oligonucleotide means an oligonucleotide that at least partially hybridizes to itself.

[0089] As used herein, “single-stranded” means a nucleic acid (including but not limited to an oligonucleotide) that is unpaired and is not part of a duplex. Single-stranded compounds are capable of hybridizing with complementary nucleic acids to form duplexes, at which point they are no longer single-stranded.

[0090] As used herein, “stabilized phosphate group” means a 5′-phosphate analog that is metabolically more stable than a 5′-phosphate as naturally occurs on DNA or RNA.

[0091] As used herein, “standard in vitro assay,” with respect to means the assay described in Example 1 or Example 10 and reasonable variations thereof.

[0092] As used herein, “stereorandom chiral center” in the context of a population of molecules of identical molecular formula means a chiral center having a random stereochemical configuration. For example, in a population of molecules comprising a stereorandom chiral center, the number of molecules having the (S) configuration of the stereorandom chiral center may be but is not necessarily the same as the number of molecules having the (R) configuration of the stereorandom chiral center. The stereochemical configuration of a chiral center is considered random when it is the result of a synthetic method that is not designed to control the stereochemical configuration. In certain embodiments, a stereorandom chiral center is a stereorandom phosphorothioate internucleoside linkage.

[0093] As used herein, “sugar moiety” means an unmodified sugar moiety or a modified sugar moiety. As used herein, “unmodified sugar moiety” means a 2′-OH(H) ribosyl moiety, as found in RNA (an “unmodified RNA sugar moiety”), or a 2′-H(H) deoxyribosyl sugar moiety, as found in DNA (an “unmodified DNA sugar moiety”). Unmodified sugar moieties have one hydrogen at each of the 1′, 3′, and 4′ positions, an oxygen at the 3′ position, and two hydrogens at the 5′ position. As used herein, “modified sugar moiety” or “modified sugar” means a modified furanosyl sugar moiety or a sugar surrogate.

[0094] As used herein, “sugar surrogate” means a modified sugar moiety having other than a furanosyl moiety that can link a nucleobase to another group, such as an internucleoside linkage, conjugate group, or terminal group in an oligonucleotide. Modified nucleosides comprising sugar surrogates can be incorporated into one or more positions within an oligonucleotide and such oligonucleotides are capable of hybridizing to complementary oligomeric compounds or target nucleic acids.

[0095] As used herein, “symptom or hallmark” means any physical feature or test result that indicates the existence or extent of a disease or disorder. In certain embodiments, a symptom is apparent to a subject or to a medical professional examining or testing said subject. In certain embodiments, a hallmark is apparent upon invasive diagnostic testing, including, but not limited to, post-mortem tests.

[0096] As used herein, “target nucleic acid” and “target RNA” mean a nucleic acid that an antisense compound is designed to affect. Target RNA means an RNA transcript and includes pre-mRNA and mRNA unless otherwise specified.

[0097] As used herein, “target region” means a portion of a target nucleic acid to which an oligomeric compound is designed to hybridize.

[0098] As used herein, “terminal group” means a chemical group or group of atoms that is covalently linked to a terminus of an oligonucleotide.

[0099] As used herein, “treating” means improving a subject's disease or condition by administering an oligomeric agent or oligomeric compound described herein. In certain embodiments, treating a subject improves a symptom relative to the same symptom in the absence of the treatment. In certain embodiments, treatment reduces in the severity or frequency of a symptom, or delays the onset of a symptom, slows the progression of a symptom, or slows the severity or frequency of a symptom.

[0100] As used herein, “therapeutically effective amount” means an amount of a pharmaceutical agent or composition that provides a therapeutic benefit to an animal. For example, a therapeutically effective amount improves a symptom of a disease.

Certain Embodiments

[0101] The present disclosure provides the following non-limiting numbered embodiments:

[0102] Embodiment 1. An oligomeric compound comprising a modified oligonucleotide consisting of 12 to 30 linked nucleosides wherein the nucleobase sequence of the modified oligonucleotide is at least 80% complementary to an equal length portion of an APOE RNA, and wherein the modified oligonucleotide comprises at least one modification selected from a modified sugar and a modified internucleoside linkage.

[0103] Embodiment 2. An oligomeric compound comprising a modified oligonucleotide consisting of 12 to 30 linked nucleosides, wherein the nucleobase sequence of the modified oligonucleotide comprises at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, or at least 20 nucleobases of any of SEQ ID NOS: 20-2551 or 2934; wherein the modified oligonucleotide comprises at least one modification selected from a modified sugar and a modified internucleoside linkage.

[0104] Embodiment 3. An oligomeric compound comprising a modified oligonucleotide consisting of 12 to 30 linked nucleosides, wherein the nucleobase sequence of the modified oligonucleotide comprises at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, or at least 23 nucleobases of any of SEQ ID NOS: 2552-2742 or 2935-2944; wherein the modified oligonucleotide comprises at least one modification selected from a modified sugar and a modified internucleoside linkage.

[0105] Embodiment 4. An oligomeric compound comprising a modified oligonucleotide consisting of 12 to 30 linked nucleosides wherein the nucleobase sequence of the modified oligonucleotide is complementary to at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, or at least 21 contiguous nucleobases of: [0106] an equal length portion of nucleobases 1155-1178 of SEQ ID NO: 2; [0107] an equal length portion of nucleobases 1207-1230 of SEQ ID NO: 2; or [0108] an equal length portion of nucleobases 1259-1295 of SEQ ID NO: 2; [0109] wherein the modified oligonucleotide comprises at least one modification selected from a modified sugar and a modified internucleoside linkage.

[0110] Embodiment 5. An oligomeric compound comprising a modified oligonucleotide consisting of 12 to 30 linked nucleosides wherein the nucleobase sequence of the modified oligonucleotide is complementary to at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, or at least 21 contiguous nucleobases of: [0111] an equal length portion of nucleobases 1135-1166 of SEQ ID NO: 2; or [0112] an equal length portion of nucleobases 1255-1294 of SEQ ID NO: 2; [0113] wherein the modified oligonucleotide comprises at least one modification selected from a modified sugar and a modified internucleoside linkage.

[0114] Embodiment 6. An oligomeric compound comprising a modified oligonucleotide consisting of 12 to 30 linked nucleosides wherein the nucleobase sequence of the modified oligonucleotide is complementary to at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, or at least 21 contiguous nucleobases of an equal length portion of nucleobases 1255-1295 of SEQ ID NO: 2, wherein the modified oligonucleotide comprises at least one modification selected from a modified sugar and a modified internucleoside linkage.

[0115] Embodiment 7. An oligomeric compound comprising a modified oligonucleotide consisting of 12 to 30 linked nucleosides and having a nucleobase sequence comprising at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22 or at least 23 contiguous nucleobases of any of the nucleobase sequences of: [0116] SEQ ID NOS: 70, 71, 169, 170, 447, 448, 543, 552, 553, 919, 1061, 1132, 1938, 1991, 2066, 2154, 2226, 2259, 2324, 2417, or 2486; [0117] SEQ ID NOS: 460, 461, 462, 563, 564, 565, 566, 990, 1469, 1572, 1653, 1746, 1914, 1955, 2026, 2110, 2211, 2247, 2344, 2393, or 2481; or [0118] SEQ ID NOS: 77, 475, 476, 477, 478, 479, 480, 481, 482, 483, 578, 579, 580, 581, 582, 622, 623, 624, 625, 626, 627, 1063, 1193, 1231, 1232, 1300, 1305, 1378, 1409, 1493, 1526, 1564, 1576, 1678, 1679, 1695, 1827, 1870, 1921, 1928, 1950, 1982, 2012, 2046, 2051, 2074, 2088, 2118, 2158, 2169, 2208, 2223, 2232, 2255, 2321, 2343, 2380, 2436, 2449, or 2451.

[0119] Embodiment 8. An oligomeric compound comprising a modified oligonucleotide consisting of 12 to 30 linked nucleosides and having a nucleobase sequence comprising at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22 or at least 23 contiguous nucleobases of any of the nucleobase sequences of: [0120] SEQ ID NOS: 2600, 2601, 2604, 2605, 2606, 2607, 2608, 2609, 2610, or 2613; or [0121] SEQ ID NOS: 2720, 2721, 2722, 2726, 2727, 2729, 2730, 2731, 2732, 2733, 2734, 2735, 2736, 2737, 2738, or 2740.

[0122] Embodiment 9. An oligomeric compound comprising a modified oligonucleotide consisting of 12 to 30 linked nucleosides and having a nucleobase sequence comprising at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22 or at least 23 contiguous nucleobases of any of the nucleobase sequences of SEQ ID NOs: 76, 77, 473, 474, 475, 476, 477, 478, 479, 480, 481, 482, 483, 576, 578, 579, 580, 581, 582, 622, 623, 624, 625, 626, 627, 1063, 1193, 1231, 1232, 1300, 1305, 1378, 1409, 1493, 1526, 1564, 1576, 1678, 1679, 1695, 1701, 1792, 1827, 1870, 1886, 1906, 1921, 1928, 1950, 1982, 2012, 2046, 2051, 2074, 2088, 2118, 2158, 2169, 2208, 2223, 2232, 2255, 2321, 2343, 2370, 2380, 2436, 2449, 2490, 2451, 2720, 2721, 2722, 2725, 2726, 2727, 2729, 2730, 2731, 2732, 2733, 2734, 2735, 2736, 2737, 2738, 2740, 2935 or 2936.

[0123] Embodiment 10. The oligomeric compound of any of embodiments 1-9, wherein the nucleobase sequence of the modified oligonucleotide is at least 80%, 85%, 90%, 95%, or 100% complementary to any of the nucleobase sequences of SEQ ID NOs: 1-6 when measured across the entire nucleobase sequence of the modified oligonucleotide.

[0124] Embodiment 11. The oligomeric compound of any of embodiments 1-10, wherein at least one nucleoside of the modified oligonucleotide is a modified nucleoside.

[0125] Embodiment 12. The oligomeric compound of embodiment 11, wherein at least one modified nucleoside of the modified oligonucleotide comprises a modified sugar moiety.

[0126] Embodiment 13. The oligomeric compound of embodiment 12, wherein the modified sugar moiety comprises a bicyclic sugar moiety.

[0127] Embodiment 14. The oligomeric compound of embodiment 13, wherein the bicyclic sugar moiety comprises a 2′-4′ bridge selected from —O—CH.sub.2— and —O—CH(CH.sub.3)—.

[0128] Embodiment 15. The oligomeric compound of any of embodiments 11-14, wherein at least one modified nucleoside of the modified oligonucleotide comprises a non-bicyclic modified sugar moiety.

[0129] Embodiment 16. The oligomeric compound of embodiment 15, wherein at least one modified nucleoside of the modified oligonucleotide comprises a bicyclic sugar moiety having a 2′-4′ bridge and at least one nucleoside comprising a non-bicyclic modified sugar moiety.

[0130] Embodiment 17. The oligomeric compound of embodiment 15 or 16, wherein the non-bicyclic modified sugar moiety is a 2′-O(CH.sub.2).sub.2—OCH.sub.3 ribosyl modified sugar moiety, a 2′-OMe modified sugar moiety, or a 2′-F modified sugar moiety.

[0131] Embodiment 18. The oligomeric compound of any of embodiments 1-17, wherein the modified oligonucleotide comprises at least one modified nucleoside comprising a sugar surrogate.

[0132] Embodiment 19. The oligomeric compound of embodiment 18, wherein at least one modified nucleoside of the modified oligonucleotide comprises a sugar surrogate selected from morpholino and PNA.

[0133] Embodiment 20. The oligomeric compound of any of embodiments 1-19, wherein the modified oligonucleotide comprises at least one modified internucleoside linkage.

[0134] Embodiment 21. The oligomeric compound of embodiment 20, wherein each internucleoside linkage of the modified oligonucleotide is a modified internucleoside linkage.

[0135] Embodiment 22. The oligomeric compound of embodiment 20 or 21, wherein at least one internucleoside linkage is a phosphorothioate internucleoside linkage.

[0136] Embodiment 23. The oligomeric compound of embodiment 20 or 22, wherein the modified oligonucleotide comprises at least one phosphodiester internucleoside linkage.

[0137] Embodiment 24. The oligomeric compound of any of embodiments 20, 22, or 23, wherein each internucleoside linkage is independently selected from a phosphodiester internucleoside linkage or a phosphorothioate internucleoside linkage.

[0138] Embodiment 25. The oligomeric compound of any of embodiments 20 or 22-24, wherein at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, or at least 19 internucleoside linkages of the modified oligonucleotide are phosphorothioate internucleoside linkages.

[0139] Embodiment 26. The oligomeric compound of any of embodiments 20-25, wherein each internucleoside linkage is a phosphorothioate internucleoside linkage.

[0140] Embodiment 27. The oligomeric compound of any of embodiments 20 or 22-26, wherein the internucleoside linkage motif of the modified oligonucleotide is selected from: 5′-sssssssssssssssssss-3′, 5′-soossssssssssooss-3′, 5′-sooosssssssssssooss-3′, 5′-soossssssssssos-3′, 5′-ssoooooooooooooooooss-3′, 5′-ssooooooooooooooooss-3′, 5′-soooossssssssssooss-3′, 5′-sossssssssssssssoss-3′, 5′-soosssssssssooss-3′, and 5′-sooooossssssssssoss-3′; wherein each ‘o’ represents a phosphodiester internucleoside linkage and each ‘s’ represents a phosphorothioate internucleoside linkage.

[0141] Embodiment 28. The oligomeric compound of any of embodiments 1-27, wherein the modified oligonucleotide comprises a modified nucleobase.

[0142] Embodiment 29. The oligomeric compound of embodiment 28, wherein the modified nucleobase is a 5-methyl cytosine.

[0143] Embodiment 30. The oligomeric compound of any of embodiments 1-29, wherein the oligomeric compound comprises a modified oligonucleotide consisting of 12-22, 12-20, 14-18, 14-20, 15-17, 15-25, 16-20, 16-18, 18-22, 18-25, 18-20, 20-25, or 21-23 linked nucleosides, or a pharmaceutically acceptable salt thereof.

[0144] Embodiment 31. The oligomeric compound of embodiment 30, which is a pharmaceutically acceptable salt comprising one or more cations selected from sodium, potassium, calcium, and magnesium.

[0145] Embodiment 32. The oligomeric compound of any of embodiments 1-31, wherein the modified oligonucleotide consists of 16 or 18 linked nucleosides.

[0146] Embodiment 33. The oligomeric compound of any of embodiments 1-31, wherein the modified oligonucleotide consists of 20 linked nucleosides.

[0147] Embodiment 34. The oligomeric compound of any of embodiments 1-31, wherein the modified oligonucleotide consists of 21 linked nucleosides.

[0148] Embodiment 35. The oligomeric compound of any of embodiments 1-31, wherein the modified oligonucleotide consists of 23 linked nucleosides.

[0149] Embodiment 36. The oligomeric compound of any of embodiments 1-35, wherein the oligomeric compound is an RNase H compound.

[0150] Embodiment 37. The oligomeric compound of embodiment 36, wherein the modified oligonucleotide is a gapmer.

[0151] Embodiment 38. The oligomeric compound of any of embodiments 1-37, wherein the modified oligonucleotide has a sugar motif comprising: [0152] a 5′-region consisting of 1-6 linked 5′-region nucleosides; [0153] a central region consisting of 6-10 linked central region nucleosides; and [0154] a 3′-region consisting of 1-6 linked 3′-region nucleosides; [0155] wherein the 3′-most nucleoside of the 5′-region and the 5′-most nucleoside of the 3′-region comprise modified sugar moieties, and [0156] each of the central region nucleosides is selected from a nucleoside comprising a 2′-β-D-deoxyribosyl sugar moiety and a nucleoside comprising a 2′-substituted sugar moiety, wherein the central region comprises at least six nucleosides comprising a 2′-β-D-deoxyribosyl sugar moiety and no more than two nucleosides comprising a 2′-substituted sugar moiety.

[0157] Embodiment 39. The oligomeric compound of any of embodiments 1-34 or 36-37, wherein the modified oligonucleotide has a sugar motif comprising: [0158] a 5′-region consisting of 1-6 linked 5′-region nucleosides; [0159] a central region consisting of 6-10 linked central region nucleosides; and [0160] a 3′-region consisting of 1-6 linked 3′-region nucleosides; wherein [0161] each of the 5′-region nucleosides and each of the 3′-region nucleosides comprises a modified sugar moiety and each of the central region nucleosides comprises a 2′-β-D-deoxyribosyl sugar moiety.

[0162] Embodiment 40. The oligomeric compound of embodiment 39, wherein the modified oligonucleotide has a sugar motif comprising: [0163] a 5′-region consisting of 5 linked 5′-region nucleosides; [0164] a central region consisting of 10 linked central region nucleosides; and [0165] a 3′-region consisting of 5 linked 3′-region nucleosides; wherein [0166] each of the 5′-region nucleosides and each of the 3′-region nucleosides comprises either a cEt modified sugar moiety or a 2′-O(CH.sub.2).sub.2—OCH.sub.3 ribosyl modified sugar moiety, and each of the central region nucleosides comprises a 2′-β-D-deoxyribosyl sugar moiety.

[0167] Embodiment 41. The oligomeric compound of embodiment 39 or embodiment 40, wherein the modified oligonucleotide has a sugar motif comprising: [0168] a 5′-region consisting of 5 linked 5′-region nucleosides; [0169] a central region consisting of 10 linked central region nucleosides; and [0170] a 3′-region consisting of 5 linked 3′-region nucleosides; wherein [0171] each of the 5′-region nucleosides and each of the 3′-region nucleosides comprises a 2′-O(CH.sub.2).sub.2—OCH.sub.3 ribosyl modified sugar moiety, and each of the central region nucleosides comprises a 2′-β-D-deoxyribosyl sugar moiety.

[0172] Embodiment 42. The oligomeric compound of any of embodiments 1-35, wherein the oligomeric compound is an RNAi agent.

[0173] Embodiment 43. The oligomeric compound of any of embodiments 1-42, wherein the oligomeric compound comprises an antisense RNAi oligonucleotide comprising a targeting region comprising at least 15 contiguous nucleobases, wherein the targeting region is at least 90% complementary to an equal-length portion of an APOE RNA.

[0174] Embodiment 44. The oligomeric compound of embodiment 43, wherein the targeting region of the antisense RNAi oligonucleotide is at least 95% complementary or is 100% complementary to the equal length portion of an APOE RNA.

[0175] Embodiment 45. The oligomeric compound of any of embodiments 43-44, wherein the targeting region of the antisense RNAi oligonucleotide comprises at least 19, 20, 21, or 25 contiguous nucleobases.

[0176] Embodiment 46. The oligomeric compound of any of embodiments 43-45, wherein the APOE RNA has the nucleobase sequence of any of SEQ ID NOs: 1-6.

[0177] Embodiment 47. The oligomeric compound of any of embodiments 43-46, wherein at least one nucleoside of the antisense RNAi oligonucleotide comprises a modified sugar moiety selected from: 2′-F, 2′-OMe, 2′-O(CH.sub.2).sub.2—OCH.sub.3, 2′-NMA, LNA, and cEt; or a sugar surrogate selected from GNA, and UNA.

[0178] Embodiment 48. The oligomeric compound of any of embodiments 43-47, wherein each nucleoside of the antisense RNAi oligonucleotide comprises a modified sugar moiety or a sugar surrogate.

[0179] Embodiment 49. The oligomeric compound of any of embodiments 43-48, wherein at least 80%, at least 90%, or 100% of the nucleosides of the antisense RNAi oligonucleotide comprises a modified sugar moiety selected from 2′-F and 2′-OMe.

[0180] Embodiment 50. The oligomeric compound of any of embodiments 43-49, comprising a stabilized phosphate group attached to the 5′ position of the 5′-most nucleoside of the antisense RNAi oligonucleotide.

[0181] Embodiment 51. The oligomeric compound of embodiment 50, wherein the stabilized phosphate group comprises a cyclopropyl phosphonate or an (E)-vinyl phosphonate.

[0182] Embodiment 52. The oligomeric compound of any of embodiments 1-51, wherein the oligomeric compound is a single-stranded oligomeric compound.

[0183] Embodiment 53. The oligomeric compound of any of embodiments 1-52, consisting of the modified oligonucleotide or the RNAi antisense oligonucleotide.

[0184] Embodiment 54. The oligomeric compound of any of embodiments 1-53, comprising a conjugate group comprising a conjugate moiety and a conjugate linker.

[0185] Embodiment 55. The oligomeric compound of embodiment 54, wherein the conjugate linker consists of a single bond.

[0186] Embodiment 56. The oligomeric compound of embodiment 54, wherein the conjugate linker is cleavable.

[0187] Embodiment 57. The oligomeric compound of embodiment 54, wherein the conjugate linker comprises 1-3 linker-nucleosides.

[0188] Embodiment 58. The oligomeric compound of any of embodiments 54-57, wherein the conjugate group is attached to the 5′-end of the modified oligonucleotide or the antisense RNAi oligonucleotide.

[0189] Embodiment 59. The oligomeric compound of any of embodiments 54-57, wherein the conjugate group is attached to the 3′-end of the modified oligonucleotide or the antisense RNAi oligonucleotide.

[0190] Embodiment 60. The oligomeric compound of any of embodiments 1-59, comprising a terminal group.

[0191] Embodiment 61. The oligomeric compound of any of embodiments 1-56 or 58-60, wherein the oligomeric compound does not comprise linker-nucleosides.

[0192] Embodiment 62. An oligomeric duplex, comprising a first oligomeric compound comprising an antisense RNAi oligonucleotide of any of embodiments 43-61 and a second oligomeric compound comprising a sense RNAi oligonucleotide consisting of 17 to 30 linked nucleosides, wherein the nucleobase sequence of the sense RNAi oligonucleotide comprises an antisense-hybridizing region comprising least 15 contiguous nucleobases wherein the antisense-hybridizing region is at least 90% complementary to an equal length portion of the antisense RNAi oligonucleotide.

[0193] Embodiment 63. The oligomeric duplex of embodiment 62, wherein the sense RNAi oligonucleotide consists of 18-25, 20-25, or 21-23 linked nucleosides.

[0194] Embodiment 64. The oligomeric duplex of embodiment 62, wherein the sense RNAi oligonucleotide consists of 21 or 23 linked nucleosides.

[0195] Embodiment 65. The oligomeric duplex of any of embodiments 62-64, wherein 1-4 3′-most nucleosides of the antisense or the sense RNAi oligonucleotide are overhanging nucleosides.

[0196] Embodiment 66. The oligomeric duplex of any of embodiments 62-65, wherein 1-4 5′-most nucleosides of the antisense or sense RNAi oligonucleotide are overhanging nucleosides.

[0197] Embodiment 67. The oligomeric duplex of any of embodiments 62-64, wherein the duplex is blunt ended at the 3′-end of the antisense RNAi oligonucleotide.

[0198] Embodiment 68. The oligomeric duplex of any of embodiments 62-64, wherein the duplex is blunt ended at the 5′-end of the antisense RNAi oligonucleotide.

[0199] Embodiment 69. The oligomeric duplex of any of embodiments 62-68, wherein at least one nucleoside of the sense RNAi oligonucleotide comprises a modified sugar moiety selected from: 2′-F, 2′-OMe, LNA, cEt, or a sugar surrogate selected from GNA, and UNA.

[0200] Embodiment 70. The oligomeric duplex of embodiment 69, wherein each nucleoside of the sense RNAi oligonucleotide comprises a modified sugar moiety or a sugar surrogate.

[0201] Embodiment 71. The oligomeric duplex of embodiment 70, wherein at least 80%, at least 90%, or 100% of the nucleosides of the sense RNAi oligonucleotide comprises a modified sugar moiety selected from 2′-F and 2′-OMe.

[0202] Embodiment 72. The oligomeric duplex of any of embodiments 62-71, wherein at least one nucleoside of the sense RNAi oligonucleotide comprises a modified nucleobase.

[0203] Embodiment 73. The oligomeric duplex of any of embodiments 62-72, wherein at least one internucleoside linkage of the sense RNAi oligonucleotide is a modified internucleoside linkage.

[0204] Embodiment 74. The oligomeric duplex of embodiment 73, wherein at least one internucleoside linkage of the sense RNAi oligonucleotide is a phosphorothioate internucleoside linkage.

[0205] Embodiment 75. The oligomeric duplex of any of embodiments 62-74, wherein the oligomeric duplex comprises 1-5 abasic sugar moieties attached to one or both ends of the antisense or sense RNA oligonucleotide.

[0206] Embodiment 76. The oligomeric duplex of any of embodiments 62-75, consisting of the antisense RNAi oligonucleotide and the sense RNAi oligonucleotide.

[0207] Embodiment 77. The oligomeric duplex of any of embodiments 62-75, wherein the second oligomeric compound comprises a conjugate group comprising a conjugate moiety and a conjugate linker.

[0208] Embodiment 78. The oligomeric duplex of embodiment 77, wherein the conjugate linker consists of a single bond.

[0209] Embodiment 79. The oligomeric duplex of embodiment 78, wherein the conjugate linker is cleavable.

[0210] Embodiment 80. The oligomeric duplex of embodiment 78, wherein the conjugate linker comprises 1-3 linker-nucleosides.

[0211] Embodiment 81. The oligomeric duplex of any of embodiments 78-80, wherein the conjugate group is attached to the 5′-end of the sense RNAi oligonucleotide.

[0212] Embodiment 82. The oligomeric duplex of any of embodiments 78-80, wherein the conjugate group is attached to the 3′-end of the sense RNAi oligonucleotide.

[0213] Embodiment 83. The oligomeric duplex of any of embodiments 78-80, wherein the conjugate group is attached via the 2′ position of a ribosyl sugar moiety at an internal position of the sense RNAi oligonucleotide.

[0214] Embodiment 84. The oligomeric compound of any of embodiments 54-59 or the oligomeric duplex of any of embodiments 77-83, wherein at least one conjugate group comprises a C.sub.16 alkyl group.

[0215] Embodiment 85. The oligomeric duplex of embodiment 62, wherein the second oligomeric compound comprises a terminal group.

[0216] Embodiment 86. An antisense agent comprising an antisense compound, wherein the antisense compound is the oligomeric compound of any of embodiments 1-61.

[0217] Embodiment 87. The antisense agent of embodiment 86, wherein the antisense agent is the oligomeric duplex of any of embodiments 62-85.

[0218] Embodiment 88. The antisense agent of embodiment 86 or embodiment 87, wherein the antisense agent is: [0219] i) an RNase H agent capable of reducing the amount of APOE nucleic acid through the activation of RNase H; or [0220] ii) an RNAi agent capable of reducing the amount of APOE nucleic acid through the activation of RISC/Ago2.

[0221] Embodiment 89. The antisense agent of any of embodiments 86-88, wherein the antisense agent comprises a conjugate group, wherein the conjugate group comprises a cell-targeting moiety.

[0222] Embodiment 90. A chirally enriched population of oligomeric compounds of any of embodiments 1-61, wherein the population is enriched for modified oligonucleotides comprising at least one particular phosphorothioate internucleoside linkage having a particular stereochemical configuration.

[0223] Embodiment 91. The chirally enriched population of embodiment 90, wherein the population is enriched for modified oligonucleotides comprising at least one particular phosphorothioate internucleoside linkage having the (Sp) or (Rp) configuration.

[0224] Embodiment 92. The chirally enriched population of embodiment 90, wherein the population is enriched for modified oligonucleotides having a particular, independently selected stereochemical configuration at each phosphorothioate internucleoside linkage.

[0225] Embodiment 93. The chirally enriched population of embodiment 90, wherein the population is enriched for modified oligonucleotides having the (Rp) configuration at one particular phosphorothioate internucleoside linkage and the (Sp) configuration at each of the remaining phosphorothioate internucleoside linkages.

[0226] Embodiment 94. The chirally enriched population of embodiment 90, wherein the population is enriched for modified oligonucleotides having at least 3 contiguous phosphorothioate internucleoside linkages in the Sp, Sp, and Rp configurations, in the 5′ to 3′ direction.

[0227] Embodiment 95. A population of oligomeric compounds of any of embodiments 1-61, wherein all of the phosphorothioate internucleoside linkages of the modified oligonucleotide are stereorandom.

[0228] Embodiment 96. A pharmaceutical composition comprising an oligomeric compound of any of embodiments 1-61, an oligomeric duplex of any of embodiments 62-85, an antisense agent of any of embodiments 86-89, or a population of any of embodiments 90-95, and a pharmaceutically acceptable carrier or diluent.

[0229] Embodiment 97. The pharmaceutical composition of embodiment 96, wherein the pharmaceutically acceptable diluent is artificial cerebral spinal fluid (aCSF), sterile saline, or PBS.

[0230] Embodiment 98. The pharmaceutical composition of embodiment 97, wherein the pharmaceutical composition consists essentially of the modified oligonucleotide, the oligomeric duplex, the antisense agent, or the population and PBS or aCSF.

[0231] Embodiment 99. A method comprising administering to a subject an oligomeric compound of any of embodiments 1-61, an oligomeric duplex of any of embodiments 62-85, an antisense agent of any of embodiments 86-89, a population of any of embodiments 90-95, or a pharmaceutical composition of any of embodiments 96-98.

[0232] Embodiment 100. A method of treating a disease associated with APOE comprising administering to a subject having or at risk for developing a disease associated with APOE a therapeutically effective amount of an oligomeric compound of any of embodiments 1-61, an oligomeric duplex of any of embodiments 62-85, an antisense agent of any of embodiments 86-89, a population of any of embodiments 90-95, or a pharmaceutical composition according to any of embodiments 96-98; and thereby treating the disease associated with APOE.

[0233] Embodiment 101. The method of embodiment 100, wherein the APOE-associated disease is Alzheimer's Disease.

[0234] Embodiment 102. The method of any of embodiments 99-101, wherein at least one symptom or hallmark of the APOE-associated disease is ameliorated.

[0235] Embodiment 103. The method of embodiment 102, wherein the symptom or hallmark is cognitive impairment, progressive memory loss, behavioral abnormality, dementia, difficulty performing daily activities, amyloid plaques, neurofibrillary tangles, or neuroinflammation.

[0236] Embodiment 104. The method of any of embodiments 100-103, wherein administering an oligomeric compound of any of embodiments 1-61, an oligomeric duplex of any of embodiments 62-85, an antisense agent of any of embodiments 86-89, a population of any of embodiments 90-95, or a pharmaceutical composition according to any of embodiments 96-98 reduces cognitive impairment, behavioral abnormality, dementia, difficulty performing daily activities, amyloid plaques, neurofibrillary tangles, or neuroinflammation, or slows memory loss in the subject.

[0237] Embodiment 105. The method of any of embodiments 99-104, wherein the subject is human.

[0238] Embodiment 106. A method of reducing expression of APOE in a cell comprising contacting the cell with an oligomeric compound of any of embodiments 1-61, an oligomeric duplex of any of embodiments 62-85, an antisense agent of any of embodiments 86-89, a population of any of embodiments 90-95, or a pharmaceutical composition according to any of embodiments 96-98.

[0239] Embodiment 107. The method of embodiment 106, wherein the cell is a neuron or a glial cell, optionally wherein the cell is an astrocyte or microglial cell.

[0240] Embodiment 108. The method of embodiment 106 or embodiment 107, wherein the cell is a human cell.

[0241] Embodiment 109. Use of an oligomeric compound of any of embodiments 1-61, an oligomeric duplex of any of embodiments 62-85, an antisense agent of any of embodiments 86-89, a population of any of embodiments 90-95, or a pharmaceutical composition according to any of embodiments 96-98 for treating a disease associated with APOE.

[0242] Embodiment 110. Use of an oligomeric compound of any of embodiments 1-61, an oligomeric duplex of any of embodiments 62-85, an antisense agent of any of embodiments 86-89, a population of any of embodiments 90-95, or a pharmaceutical composition according to any of embodiments 96-98 in the manufacture of a medicament for treating a disease associated with APOE.

[0243] Embodiment 111. The use of embodiment 109 or embodiment 110, wherein the APOE-associated disease is Alzheimer's Disease.

[0244] I. Certain Oligonucleotides

[0245] In certain embodiments, provided herein are oligomeric compounds comprising oligonucleotides, which consist of linked nucleosides. Oligonucleotides may be unmodified oligonucleotides (RNA or DNA) or may be modified oligonucleotides. Modified oligonucleotides comprise at least one modification relative to unmodified RNA or DNA. That is, modified oligonucleotides comprise at least one modified nucleoside (comprising a modified sugar moiety and/or a modified nucleobase) and/or at least one modified internucleoside linkage. In certain embodiments, provided herein are RNAi agents comprising antisense RNAi oligonucleotides complementary to APOE and optionally sense RNAi oligonucleotides complementary to the antisense RNAi oligonucleotides. Antisense RNAi oligonucleotides and sense RNAi oligonucleotides typically comprise at least one modified nucleoside and/or at least one modified internucleoside linkage. Certain modified nucleosides and modified internucleoside linkages suitable for use in modified oligonucleotides are described below.

[0246] A. Certain Modified Nucleosides

[0247] Modified nucleosides comprise a modified sugar moiety or a modified nucleobase or both a modified sugar moiety and a modified nucleobase. In certain embodiments, modified nucleosides comprising the following modified sugar moieties and/or the following modifed nucleobases may be incorporated into antisense RNAi oligonucleotides and/or sense RNAi oligonucleotides.

[0248] 1. Certain Sugar Moieties

[0249] In certain embodiments, modified sugar moieties are non-bicyclic modified sugar moieties. In certain embodiments, modified sugar moieties are bicyclic or tricyclic sugar moieties. In certain embodiments, modified sugar moieties are sugar surrogates. Such sugar surrogates may comprise one or more substitutions corresponding to those of other types of modified sugar moieties.

[0250] In certain embodiments, modified sugar moieties are non-bicyclic modified sugar moieties comprising a furanosyl ring with one or more substituent groups none of which bridges two atoms of the furanosyl ring to form a bicyclic structure. Such non bridging substituents may be at any position of the furanosyl, including but not limited to substituents at the 2′, 3′, 4′, and/or 5′ positions. In certain embodiments one or more non-bridging substituent of non-bicyclic modified sugar moieties is branched. Examples of 2′-substituent groups suitable for non-bicyclic modified sugar moieties include but are not limited to: 2′-F, 2′-OCH.sub.3 (“OMe” or “O-methyl”), and 2′-O(CH.sub.2)2OCH.sub.3 (“MOE”). In certain embodiments, 2′-substituent groups are selected from among: halo, allyl, amino, azido, SH, CN, OCN, CF.sub.3, OCF.sub.3, O—C.sub.1-C.sub.10 alkoxy, O—C.sub.1-C.sub.10 substituted alkoxy, O—C.sub.1-C.sub.10 alkyl, O—C.sub.1-C.sub.10 substituted alkyl, S-alkyl, N(R.sub.m)-alkyl, O-alkenyl, S-alkenyl, N(R.sub.m)-alkenyl, O-alkynyl, S-alkynyl, N(R.sub.m)-alkynyl, O-alkylenyl-O-alkyl, alkynyl, alkaryl, aralkyl, O-alkaryl, O-aralkyl, O(CH.sub.2)2SCH3, O(CH.sub.2).sub.2ON(R.sub.m)(R.sub.n) or OCH.sub.2C(═O)—N(R.sub.m)(R.sub.n), where each R.sub.m and R.sub.n is, independently, H, an amino protecting group, or substituted or unsubstituted C.sub.1-C.sub.10 alkyl, —O(CH2)2ON(CH3)2 (“DMAOE”), 2′-OCH2OCH2N(CH2)2 (“DMAEOE”), and the 2′-substituent groups described in Cook et al., U.S. Pat. No. 6,531,584; Cook et al., U.S. Pat. No. 5,859,221; and Cook et al., U.S. Pat. No. 6,005,087. Certain embodiments of these 2′-substituent groups can be further substituted with one or more substituent groups independently selected from among: hydroxyl, amino, alkoxy, carboxy, benzyl, phenyl, nitro (NO.sub.2), thiol, thioalkoxy, thioalkyl, halogen, alkyl, aryl, alkenyl and alkynyl. In certain embodiments, non-bicyclic modified sugar moieties comprise a substituent group at the 3′-position. Examples of substituent groups suitable for the 3′-position of modified sugar moieties include but are not limited to alkoxy (e.g., methoxy), alkyl (e.g., methyl, ethyl). In certain embodiments, non-bicyclic modified sugar moieties comprise a substituent group at the 4′-position. Examples of 4′-substituent groups suitable for non-bicyclic modified sugar moieties include but are not limited to alkoxy (e.g., methoxy), alkyl, and those described in Manoharan et al., WO 2015/106128. Examples of 5′-substituent groups suitable for non-bicyclic modified sugar moieties include but are not limited to: 5′-methyl (R or S), 5′-vinyl, ethyl, and 5′-methoxy. In certain embodiments, non-bicyclic modified sugar moieties comprise more than one non-bridging sugar substituent, for example, 2′-F-5′-methyl sugar moieties and the modified sugar moieties and modified nucleosides described in Migawa et al., WO 2008/101157 and Rajeev et al., US2013/0203836).

[0251] In certain embodiments, a 2′-substituted non-bicyclic modified nucleoside comprises a sugar moiety comprising a non-bridging 2′-substituent group selected from: F, NH.sub.2, N.sub.3, OCF.sub.3, OCH.sub.3, O(CH.sub.2).sub.3NH.sub.2, CH.sub.2CH═CH.sub.2, OCH.sub.2CH═CH.sub.2, OCH.sub.2CH.sub.2OCH.sub.3, O(CH.sub.2).sub.2SCH.sub.3, O(CH.sub.2).sub.2ON(R.sub.m)(R.sub.n), O(CH.sub.2).sub.2O(CH.sub.2).sub.2N(CH.sub.3).sub.2, and N-substituted acetamide (OCH.sub.2C(═O)—N(R.sub.m)(R.sub.n)), where each R.sub.m and R.sub.n is, independently, H, an amino protecting group, or substituted or unsubstituted C.sub.1-C.sub.10 alkyl.

[0252] In certain embodiments, a 2′-substituted nucleoside non-bicyclic modified nucleoside comprises a sugar moiety comprising a non-bridging 2′-substituent group selected from: F, OCF.sub.3, OCH.sub.3, OCH.sub.2CH.sub.2OCH.sub.3, O(CH.sub.2).sub.2SCH.sub.3, O(CH.sub.2).sub.2N(CH.sub.3).sub.2, O(CH.sub.2).sub.2O(CH.sub.2).sub.2N(CH.sub.3).sub.2, O(CH.sub.2)2ON(CH3)2 (“DMAOE”), OCH2OCH2N(CH2)2 (“DMAEOE”) and OCH.sub.2C(═O)—N(H)CH.sub.3 (“NMA”).

[0253] In certain embodiments, a 2′-substituted non-bicyclic modified nucleoside comprises a sugar moiety comprising a non-bridging 2′-substituent group selected from: F, OCH.sub.3, and OCH.sub.2CH.sub.2OCH.sub.3.

[0254] In naturally occurring nucleic acids, sugars are linked to one another 3′ to 5′. In certain embodiments, oligonucleotides include one or more nucleoside or sugar moiety linked at an alternative position, for example at the 2′ or inverted 5′ to 3′. For example, where the linkage is at the 2′ position, the 2′-substituent groups may instead be at the 3′-position.

[0255] Certain modified sugar moieties comprise a substituent that bridges two atoms of the furanosyl ring to form a second ring, resulting in a bicyclic sugar moiety. Nucleosides comprising such bicyclic sugar moieties have been referred to as bicyclic nucleosides (BNAs), locked nucleosides, or conformationally restricted nucleotides (CRN). Certain such compounds are described in US Patent Publication No. 2013/0190383; and PCT publication WO 2013/036868. In certain such embodiments, the bicyclic sugar moiety comprises a bridge between the 4′ and the 2′ furanose ring atoms. In certain embodiments, the furanose ring is a ribose ring. Examples of such 4′ to 2′ bridging sugar substituents include but are not limited to: 4′-CH.sub.2-2′, 4′-(CH.sub.2).sub.2-2′, 4′-(CH.sub.2).sub.3-2′, 4′-CH.sub.2—O-2′ (“LNA”), 4′-CH.sub.2—S-2′, 4′-(CH.sub.2).sub.2—O-2′ (“ENA”), 4′-CH(CH.sub.3)—O-2′ (referred to as “constrained ethyl” or “cEt” when in the S configuration), 4′-CH.sub.2—O—CH.sub.2-2′, 4′-CH.sub.2—N(R)-2′, 4′-CH(CH.sub.2OCH.sub.3)—O-2′ (“constrained MOE” or “cMOE”) and analogs thereof (see, e.g., Seth et al., U.S. Pat. No. 7,399,845, Bhat et al., U.S. Pat. No. 7,569,686, Swayze et al., U.S. Pat. No. 7,741,457, and Swayze et al., U.S. Pat. No. 8,022,193), 4′-C(CH.sub.3)(CH.sub.3)—O-2′ and analogs thereof (see, e.g., Seth et al., U.S. Pat. No. 8,278,283), 4′-CH.sub.2—N(OCH.sub.3)-2′ and analogs thereof (see, e.g., Prakash et al., U.S. Pat. No. 8,278,425), 4′-CH.sub.2—O—N(CH.sub.3)-2′ (see, e.g., Allerson et al., U.S. Pat. No. 7,696,345 and Allerson et al., U.S. Pat. No. 8,124,745), 4′-CH.sub.2—C(H)(CH.sub.3)-2′ (see, e.g., Zhou, et al., J. Org. Chem., 2009, 74, 118-134), 4′-CH.sub.2—C(═CH.sub.2)-2′ and analogs thereof (see e.g., Seth et al., U.S. Pat. No. 8,278,426), 4′-C(R.sub.aR.sub.b)—N(R)—O-2′, 4′-C(R.sub.aR.sub.b)—O—N(R)-2′, 4′-CH.sub.2—O—N(R)-2′, and 4′-CH.sub.2—N(R)—O-2′, wherein each R, R.sup.a, and R.sub.b, is, independently, H, a protecting group, or C.sub.1-C.sub.12 alkyl (see, e.g. Imanishi et al., U.S. Pat. No. 7,427,672).

[0256] In certain embodiments, such 4′ to 2′ bridges independently comprise from 1 to 4 linked groups independently selected from: —[C(Ra)(Rb)]n-, —[C(Ra)(Rb)]n-O—, C(Ra)═C(Rb)—, C(Ra)═N—, C(═NRa)—, —C(═O)—, —C(═S)—, —O—, —Si(Ra)2-, —S(═O)x-, and N(Ra)—; [0257] wherein: [0258] x is 0, 1, or 2; [0259] n is 1, 2, 3, or 4; [0260] each Ra and Rb is, independently, H, a protecting group, hydroxyl, C1-C12 alkyl, substituted C1-C12 alkyl, C2-C12 alkenyl, substituted C2-C12 alkenyl, C2-C12 alkynyl, substituted C2-C12 alkynyl, C5-C20 aryl, substituted C5-C20 aryl, heterocycle radical, substituted heterocycle radical, heteroaryl, substituted heteroaryl, C5-C7 alicyclic radical, substituted C5-C7 alicyclic radical, halogen, OJ1, NJ1J2, SJ1, N3, COOJ1, acyl (C(═O)—H), substituted acyl, CN, sulfonyl (S(═O)2-J1), or sulfoxyl (S(═O)-J1); and each J1 and J2 is, independently, H, C1-C12 alkyl, substituted C1-C12 alkyl, C2-C12 alkenyl, substituted C2-C12 alkenyl, C2-C12 alkynyl, substituted C2-C12 alkynyl, C5-C20 aryl, substituted C5-C20 aryl, acyl (C(═O)—H), substituted acyl, a heterocycle radical, a substituted heterocycle radical, C1-C12 aminoalkyl, substituted C1-C12 aminoalkyl, or a protecting group.

[0261] Additional bicyclic sugar moieties are known in the art, see, for example: Freier et al., Nucleic Acids Research, 1997, 25(22), 4429-4443, Albaek et al., J. Org. Chem., 2006, 71, 7731-7740, Singh et al., Chem. Commun., 1998, 4, 455-456; Koshkin et al., Tetrahedron, 1998, 54, 3607-3630; Wahlestedt et al., Proc. Natl. Acad. Sci. U.S.A, 2000, 97, 5633-5638; Kumar et al., Bioorg. Med. Chem. Lett., 1998, 8, 2219-2222; Singh et al., J. Org. Chem., 1998, 63, 10035-10039; Srivastava et al., J. Am. Chem. Soc., 2007, 129, 8362-8379; Elayadi et al., Curr. Opinion Invens. Drugs, 2001, 2, 558-561; Braasch et al., Chem. Biol., 2001, 8, 1-7; Orum et al., Curr. Opinion Mol. Ther., 2001, 3, 239-243; Wengel et al., U.S. Pat. No. 7,053,207, Imanishi et al., U.S. Pat. No. 6,268,490, Imanishi et al. U.S. Pat. No. 6,770,748, Imanishi et al., U.S. RE44,779; Wengel et al., U.S. Pat. No. 6,794,499, Wengel et al., U.S. Pat. No. 6,670,461; Wengel et al., U.S. Pat. No. 7,034,133, Wengel et al., U.S. Pat. No. 8,080,644; Wengel et al., U.S. Pat. No. 8,034,909; Wengel et al., U.S. Pat. No. 8,153,365; Wengel et al., U.S. 7,572,582; and Ramasamy et al., U.S. Pat. No. 6,525,191, Torsten et al., WO 2004/106356, Wengel et al., WO 1999/014226; Seth et al., WO 2007/134181; Seth et al., U.S. Pat. No. 7,547,684; Seth et al., U.S. Pat. No. 7,666,854; Seth et al., U.S. Pat. No. 8,088,746; Seth et al., U.S. Pat. No. 7,750,131; Seth et al., U.S. Pat. No. 8,030,467; Seth et al., U.S. Pat. No. 8,268,980; Seth et al., U.S. Pat. No. 8,546,556; Seth et al., U.S. Pat. No. 8,530,640; Migawa et al., U.S. Pat. No. 9,012,421; Seth et al., U.S. Pat. No. 8,501,805; Allerson et al., US2008/0039618; and Migawa et al., US2015/0191727.

[0262] In certain embodiments, bicyclic sugar moieties and nucleosides incorporating such bicyclic sugar moieties are further defined by isomeric configuration. For example, an LNA nucleoside (described herein) may be in the α-L configuration or in the β-D configuration.

##STR00001##

[0263] α-L-methyleneoxy (4′-CH.sub.2—O-2′) or α-L-LNA bicyclic nucleosides have been incorporated into oligonucleotides that showed antisense activity (Frieden et al., Nucleic Acids Research, 2003, 21, 6365-6372). The addition of locked nucleic acids to siRNAs has been shown to increase siRNA stability in serum, and to reduce off-target effects (Elmen, J. et al., (2005) Nucleic Acids Research 33(1):439-447; Mook, O R. et al., (2007) Mal Cane Ther 6(3):833-843; Grunweller, A. et al., (2003) Nucleic Acids Research 31(12):3185-3193). Herein, general descriptions of bicyclic nucleosides include both isomeric configurations. When the positions of specific bicyclic nucleosides (e.g., LNA or cEt) are identified in exemplified embodiments herein, they are in the β-D configuration, unless otherwise specified.

[0264] In certain embodiments, modified sugar moieties comprise one or more non-bridging sugar substituent and one or more bridging sugar substituent (e.g., 5′-substituted and 4′-2′ bridged sugars).

[0265] In certain embodiments, modified sugar moieties are sugar surrogates. In certain such embodiments, the oxygen atom of the sugar moiety is replaced, e.g., with a sulfur, carbon or nitrogen atom. In certain such embodiments, such modified sugar moieties also comprise bridging and/or non-bridging substituents as described herein. For example, certain sugar surrogates comprise a 4′-sulfur atom and a substitution at the 2′-position (see, e.g., Bhat et al., U.S. Pat. No. 7,875,733 and Bhat et al., U.S. Pat. No. 7,939,677) and/or the 5′ position.

[0266] In certain embodiments, sugar surrogates comprise rings having other than 5 atoms. For example, in certain embodiments, a sugar surrogate comprises a six-membered tetrahydropyran (“THP”). Such tetrahydropyrans may be further modified or substituted. Nucleosides comprising such modified tetrahydropyrans include but are not limited to hexitol nucleic acid (“HNA”), anitol nucleic acid (“ANA”), manitol nucleic acid (“MNA”) (see, e.g., Leumann, CJ. Bioorg. & Med. Chem. 2002, 10, 841-854), fluoro HNA:

##STR00002##

(“F-HNA”, see e.g. Swayze et al., U.S. Pat. No. 8,088,904; Swayze et al., U.S. Pat. No. 8,440,803; Swayze et al., U.S. Pat. No. 8,796,437; and Swayze et al., U.S. Pat. No. 9,005,906; F-HNA can also be referred to as a F-THP or 3′-fluoro tetrahydropyran), and nucleosides comprising additional modified THP compounds having the formula:

##STR00003##

wherein, independently, for each of said modified THP nucleoside: [0267] Bx is a nucleobase moiety; [0268] T.sub.3 and T.sub.4 are each, independently, an internucleoside linking group linking the modified THP nucleoside to the remainder of an oligonucleotide or one of T.sub.3 and T.sub.4 is an internucleoside linking group linking the modified THP nucleoside to the remainder of an oligonucleotide and the other of T.sub.3 and T.sub.4 is H, a hydroxyl protecting group, a linked conjugate group, or a 5′ or 3′-terminal group; q.sub.1, q.sub.2, q.sub.3, q.sub.4, q.sub.5, q.sub.6 and q.sub.7 are each, independently, H, C.sub.1-C.sub.6 alkyl, substituted C.sub.1-C.sub.6 alkyl, C.sub.2-C.sub.6 alkenyl, substituted C.sub.2-C.sub.6 alkenyl, C.sub.2-C.sub.6 alkynyl, or substituted C.sub.2-C.sub.6 alkynyl; and [0269] each of R.sub.1 and R.sub.2 is independently selected from among: hydrogen, halogen, substituted or unsubstituted alkoxy, NJ.sub.1J.sub.2, SJ.sub.1, N.sub.3, OC(═X)J.sub.1, OC(═X)NJ.sub.1J.sub.2, NJ.sub.3C(═X)NJ.sub.1J.sub.2, and CN, wherein X is O, S or NJ.sub.1, and each J.sub.1, J.sub.2, and J.sub.3 is, independently, H or C.sub.1-C.sub.6 alkyl.

[0270] In certain embodiments, modified THP nucleosides are provided wherein q.sub.1, q.sub.2, q.sub.3, q.sub.4, q.sub.5, q.sub.6 and q.sub.7 are each H. In certain embodiments, at least one of q.sub.1, q.sub.2, q.sub.3, q.sub.4, q.sub.5, q.sub.6 and q.sub.7 is other than H. In certain embodiments, at least one of q.sub.1, q.sub.2, q.sub.3, q.sub.4, q.sub.5, q.sub.6 and q.sub.7 is methyl. In certain embodiments, modified THP nucleosides are provided wherein one of R.sub.1 and R.sub.2 is F. In certain embodiments, R.sub.1 is F and R.sub.2 is H, in certain embodiments, R.sub.1 is methoxy and R.sub.2 is H, and in certain embodiments, R.sub.1 is methoxyethoxy and R.sub.2 is H.

[0271] In certain embodiments, sugar surrogates comprise rings having more than 5 atoms and more than one heteroatom. For example, nucleosides comprising morpholino sugar moieties and their use in oligonucleotides have been reported (see, e.g., Braasch et al., Biochemistry, 2002, 41, 4503-4510 and Summerton et al., U.S. Pat. No. 5,698,685; Summerton et al., U.S. Pat. No. 5,166,315; Summerton et al., U.S. Pat. No. 5,185,444; and Summerton et al., U.S. Pat. No. 5,034,506). As used here, the term “morpholino” means a sugar surrogate having the following structure:

##STR00004##

In certain embodiments, morpholinos may be modified, for example by adding or altering various substituent groups from the above morpholino structure. Such sugar surrogates are referred to herein as “modified morpholinos.”

[0272] In certain embodiments, sugar surrogates comprise acyclic moieites. Examples of nucleosides and oligonucleotides comprising such acyclic sugar surrogates include but are not limited to: peptide nucleic acid (“PNA”), acyclic butyl nucleic acid (see, e.g., Kumar et al., Org. Biomol. Chem., 2013, 11, 5853-5865), and nucleosides and oligonucleotides described in Manoharan et al., WO2011/133876. In certain embodiments, sugar surrogates comprise acyclic moieties. Examples of nucleosides and oligonucleotides comprising such acyclic sugar surrogates include, but are not limited to: peptide nucleic acid (“PNA”), acyclic butyl nucleic acid (see, e.g., Kumar et al., Org. Biomol. Chem., 2013, 11, 5853-5865), and nucleosides and oligonucleotides described in Manoharan et al., US2013/130378. Representative U.S. patents that teach the preparation of PNA compounds include, but are not limited to, U.S. Pat. Nos. 5,539,082; 5,714,331; and 5,719,262. Additional PNA compounds suitable for use in the RNAi oligonucleotides of the invention are described in, for example, in Nielsen et al., Science, 1991, 254, 1497-1500.

[0273] In certain embodiments, sugar surrogates are the “unlocked” sugar structure of UNA (unlocked nucleic acid) nucleosides. UNA is an unlocked acyclic nucleic acid, wherein any of the bonds of the sugar has been removed, forming an unlocked sugar surrogate. Representative U.S. publications that teach the preparation of UNA include, but are not limited to, U.S. Pat. No. 8,314,227; and US Patent Publication Nos. 2013/0096289; 2013/0011922; and 2011/0313020, the entire contents of each of which are hereby incorporated herein by reference.

[0274] In certain embodiments, sugar surrogates are the glycerol as found in GNA (glycol nucleic acid) nucleosides as depicted below:

##STR00005## [0275] where Bx represents any nucleobase.

[0276] Many other bicyclic and tricyclic sugar and sugar surrogatsare known in the art that can be used in modified nucleosides.

[0277] 2. Certain Modified Nucleobases

[0278] In certain embodiments, modified oligonucleotides comprise one or more nucleoside comprising an unmodified nucleobase. In certain embodiments, modified oligonucleotides comprise one or more nucleoside comprising a modified nucleobase. In certain embodiments, modified oligonucleotides comprise one or more nucleoside that does not comprise a nucleobase, referred to as an abasic nucleoside. In certain embodiments, modified oligonucleotides comprise one or more inosine nucleosides (i.e., nucleosides comprising a hypoxanthine nucleobase).

[0279] In certain embodiments, modified nucleobases are selected from: 5-substituted pyrimidines, 6-azapyrimidines, alkyl or alkynyl substituted pyrimidines, alkyl substituted purines, and N—2, N—6 and 0-6 substituted purines. In certain embodiments, modified nucleobases are selected from: 5-methylcytosine, 2-aminopropyladenine, 5-hydroxymethyl cytosine, xanthine, hypoxanthine, 2-aminoadenine, 6-N-methylguanine, 6-N-methyladenine, 2-propyladenine, 2-thiouracil, 2-thiothymine and 2-thiocytosine, 5-propynyl (—C≡C—CH.sub.3) uracil, 5-propynylcytosine, 6-azouracil, 6-azocytosine, 6-azothymine, 5-ribosyluracil (pseudouracil), 4-thiouracil, 8-halo, 8-amino, 8-thiol, 8-thioalkyl, 8-hydroxyl, 8-aza and other 8-substituted purines, 5-halo, particularly 5-bromo, 5-trifluoromethyl, 5-halouracil, and 5-halocytosine, 7-methylguanine, 7-methyladenine, 2-F-adenine, 2-aminoadenine, 7-deazaguanine, 7-deazaadenine, 3-deazaguanine, 3-deazaadenine, 6-N-benzoyladenine, 2-N-isobutyrylguanine, 4-N-benzoylcytosine, 4-N-benzoyluracil, 5-methyl 4-N-benzoylcytosine, 5-methyl 4-N-benzoyluracil, universal bases, hydrophobic bases, promiscuous bases, size-expanded bases, and fluorinated bases. Further modified nucleobases include tricyclic pyrimidines, such as 1,3-diazaphenoxazine-2-one, 1,3-diazaphenothiazine-2-one and 9-(2-aminoethoxy)-1,3-diazaphenoxazine-2-one (G-clamp). Modified nucleobases may also include those in which the purine or pyrimidine base is replaced with other heterocycles, for example 7-deaza-adenine, 7-deazaguanosine, 2-aminopyridine and 2-pyridone. Further nucleobases include those disclosed in Merigan et al., U.S. Pat. No. 3,687,808, those disclosed in The Concise Encyclopedia Of Polymer Science And Engineering, Kroschwitz, J. I., Ed., John Wiley & Sons, 1990, 858-859; Englisch et al., Angewandte Chemie, International Edition, 1991, 30, 613; Sanghvi, Y. S., Chapter 15, Antisense Research and Applications, Crooke, S. T. and Lebleu, B., Eds., CRC Press, 1993, 273-288; and those disclosed in Chapters 6 and 15, Antisense Drug Technology, Crooke S. T., Ed., CRC Press, 2008, 163-166 and 442-443.

[0280] Publications that teach the preparation of certain of the above noted modified nucleobases as well as other modified nucleobases include without limitation, Manoharan et al., US2003/0158403; Manoharan et al., US2003/0175906; Dinh et al., U.S. Pat. No. 4,845,205; Spielvogel et al., U.S. Pat. No. 5,130,302; Rogers et al., U.S. Pat. No. 5,134,066; Bischofberger et al., U.S. Pat. No. 5,175,273; Urdea et al., U.S. Pat. No. 5,367,066; Benner et al., U.S. Pat. No. 5,432,272; Matteucci et al., U.S. Pat. No. 5,434,257; Gmeiner et al., U.S. Pat. No. 5,457,187; Cook et al., U.S. 5,459,255; Froehler et al., U.S. Pat. No. 5,484,908; Matteucci et al., U.S. Pat. No. 5,502,177; Hawkins et al., U.S. Pat. No. 5,525,711; Haralambidis et al., U.S. Pat. No. 5,552,540; Cook et al., U.S. Pat. No. 5,587,469; Froehler et al., U.S. Pat. No. 5,594,121; Switzer et al., U.S. Pat. No. 5,596,091; Cook et al., U.S. Pat. No. 5,614,617; Froehler et al., U.S. Pat. No. 5,645,985; Cook et al., U.S. Pat. No. 5,681,941; Cook et al., U.S. Pat. No. 5,811,534; Cook et al., U.S. Pat. No. 5,750,692; Cook et al., U.S. Pat. No. 5,948,903; Cook et al., U.S. Pat. No. 5,587,470; Cook et al., U.S. Pat. No. 5,457,191; Matteucci et al., U.S. Pat. No. 5,763,588; Froehler et al., U.S. Pat. No. 5,830,653; Cook et al., U.S. Pat. No. 5,808,027; Cook et al., U.S. Pat. No. 6,166,199; and Matteucci et al., U.S. Pat. No. 6,005,096.

[0281] 3. Certain Modified Internucleoside Linkages

[0282] The naturally occurring internucleoside linkage of RNA and DNA is a 3′ to 5′ phosphodiester linkage. In certain embodiments, nucleosides of modified oligonucleotides may be linked together using one or more modified internucleoside linkages. The two main classes of internucleoside linking groups are defined by the presence or absence of a phosphorus atom. Representative phosphorus-containing internucleoside linkages include but are not limited to phosphates, which contain a phosphodiester bond (“P═O”) (also referred to as unmodified or naturally occurring linkages), phosphotriesters, methylphosphonates, phosphoramidates, and phosphorothioates (“P═S”), and phosphorodithioates (“HS-P═S”). Representative non-phosphorus containing internucleoside linking groups include but are not limited to methylenemethylimino (—CH.sub.2—N(CH.sub.3)—O—CH.sub.2—), thiodiester, thionocarbamate (—O—C(═O)(NH)—S—); siloxane (—O—SiH.sub.2—O—); and N,N′-dimethylhydrazine (—CH.sub.2—N(CH.sub.3)—N(CH.sub.3)—). Modified internucleoside linkages, compared to naturally occurring phosphate linkages, can be used to alter, typically increase, nuclease resistance of the oligonucleotide. In certain embodiments, internucleoside linkages having a chiral atom can be prepared as a racemic mixture, or as separate enantiomers. Methods of preparation of phosphorous-containing and non-phosphorous-containing internucleoside linkages are well known to those skilled in the art.

[0283] Representative internucleoside linkages having a chiral center include but are not limited to alkylphosphonates and phosphorothioates. Modified oligonucleotides comprising internucleoside linkages having a chiral center can be prepared as populations of modified oligonucleotides comprising stereorandom internucleoside linkages, or as populations of modified oligonucleotides comprising phosphorothioate linkages in particular stereochemical configurations. In certain embodiments, populations of modified oligonucleotides comprise phosphorothioate internucleoside linkages wherein all of the phosphorothioate internucleoside linkages are stereorandom. Such modified oligonucleotides can be generated using synthetic methods that result in random selection of the stereochemical configuration of each phosphorothioate linkage. Nonetheless, each individual phosphorothioate of each individual oligonucleotide molecule has a defined stereoconfiguration. In certain embodiments, populations of modified oligonucleotides are enriched for modified oligonucleotides comprising one or more particular phosphorothioate internucleoside linkages in a particular, independently selected stereochemical configuration. In certain embodiments, the particular configuration of the particular phosphorothioate linkage is present in at least 65% of the molecules in the population. In certain embodiments, the particular configuration of the particular phosphorothioate linkage is present in at least 70% of the molecules in the population. In certain embodiments, the particular configuration of the particular phosphorothioate linkage is present in at least 80% of the molecules in the population. In certain embodiments, the particular configuration of the particular phosphorothioate linkage is present in at least 90% of the molecules in the population. In certain embodiments, the particular configuration of the particular phosphorothioate linkage is present in at least 99% of the molecules in the population. Such chirally enriched populations of modified oligonucleotides can be generated using synthetic methods known in the art, e.g., methods described in Oka et al., JACS 125, 8307 (2003), Wan et al. Nuc. Acid. Res. 42, 13456 (2014), and WO 2017/015555. In certain embodiments, a population of modified oligonucleotides is enriched for modified oligonucleotides having at least one indicated phosphorothioate in the (Sp) configuration. In certain embodiments, a population of modified oligonucleotides is enriched for modified oligonucleotides having at least one phosphorothioate in the (Rp) configuration. In certain embodiments, modified oligonucleotides comprising (Rp) and/or (Sp) phosphorothioates comprise one or more of the following formulas, respectively, wherein “B” indicates a nucleobase:

##STR00006##

Unless otherwise indicated, chiral internucleoside linkages of modified oligonucleotides described herein can be stereorandom or in a particular stereochemical configuration.

[0284] Neutral internucleoside linkages include, without limitation, phosphotriesters, methylphosphonates, MMI (3′-CH.sub.2—N(CH.sub.3)—O-5′), amide-3 (3′—CH.sub.2—C(═O)—N(H)-5′), amide-4 (3′-CH.sub.2—N(H)—C(═O)-5′), formacetal (3′-O—CH.sub.2—O-5′), methoxypropyl (MOP), and thioformacetal (3′-S—CH.sub.2—O-5′). Further neutral internucleoside linkages include nonionic linkages comprising siloxane (dialkylsiloxane), carboxylate ester, carboxamide, sulfide, sulfonate ester and amides (See for example: Carbohydrate Modifications in Antisense Research; Y. S. Sanghvi and P. D. Cook, Eds., ACS Symposium Series 580; Chapters 3 and 4, 40-65). Further neutral internucleoside linkages include nonionic linkages comprising mixed N, O, S and CH.sub.2 component parts.

[0285] In certain embodiments, modified oligonucleotides (such as antisense RNAi oligonucleotides and/or sense RNAi oligonucleotides) comprise one or more inverted nucleoside, as shown below:

##STR00007##

wherein each Bx independently represents any nucleobase.

[0286] In certain embodiments, an inverted nucleoside is terminal (i.e., the last nucleoside on one end of an oligonucleotide) and so only one internucleoside linkage depicted above will be present. In certain such embodiments, additional features (such as a conjugate group) may be attached to the inverted nucleoside. Such terminal inverted nucleosides can be attached to either or both ends of an oligonucleotide.

[0287] In certain embodiments, such groups lack a nucleobase and are referred to herein as inverted sugar moieties. In certain embodiments, an inverted sugar moiety is terminal (i.e., attached to the last nucleoside on one end of an oligonucleotide) and so only one internucleoside linkage above will be present. In certain such embodiments, additional features (such as a conjugate group) may be attached to the inverted sugar moiety. Such terminal inverted sugar moieties can be attached to either or both ends of an oligonucleotide.

[0288] In certain embodiments, nucleic acids can be linked 2′ to 5′ rather than the standard 3′ to 5′ linkage. Such a linkage is illustrated below.

##STR00008##

wherein each Bx represents any nucleobase.

[0289] B. Certain Motifs

[0290] In certain embodiments, modified oligonucleotides comprise one or more modified nucleosides comprising a modified sugar moiety. In certain embodiments, modified oligonucleotides comprise one or more modified nucleosides comprising a modified nucleobase. In certain embodiments, modified oligonucleotides comprise one or more modified internucleoside linkage. In such embodiments, the modified, unmodified, and differently modified sugar moieties, nucleobases, and/or internucleoside linkages of a modified oligonucleotide define a pattern or motif. In certain embodiments, the patterns of sugar moieties, nucleobases, and internucleoside linkages are each independent of one another. Thus, a modified oligonucleotide may be described by its sugar motif, nucleobase motif and/or internucleoside linkage motif (as used herein, nucleobase motif describes the modifications to the nucleobases independent of the sequence of nucleobases).

[0291] 1. Certain Sugar Motifs

[0292] In certain embodiments, oligonucleotides comprise one or more type of modified sugar and/or unmodified sugar moiety arranged along the oligonucleotide or region thereof in a defined pattern or sugar motif. In certain instances, such sugar motifs include but are not limited to any of the sugar modifications discussed herein.

Uniformly Modified Oligonucleotides

[0293] In certain embodiments, modified oligonucleotides comprise or consist of a region having a fully modified sugar motif. In such embodiments, each nucleoside of the fully modified region of the modified oligonucleotide comprises a modified sugar moiety. In certain embodiments, each nucleoside of the entire modified oligonucleotide comprises a modified sugar moiety. In certain embodiments, modified oligonucleotides comprise or consist of a region having a fully modified sugar motif, wherein each nucleoside within the fully modified region comprises the same modified sugar moiety, referred to herein as a uniformly modified sugar motif. In certain embodiments, a fully modified oligonucleotide is a uniformly modified oligonucleotide.

Gapmer Oligonucleotides

[0294] In certain embodiments, modified oligonucleotides comprise or consist of a region having a gapmer motif, which is defined by two external regions or “wings” and a central or internal region or “gap.” The three regions of a gapmer motif (the 5′-wing, the gap, and the 3′-wing) form a contiguous sequence of nucleosides wherein at least some of the sugar moieties of the nucleosides of each of the wings differ from at least some of the sugar moieties of the nucleosides of the gap. Specifically, at least the sugar moieties of the nucleosides of each wing that are closest to the gap (the 3′-most nucleoside of the 5′-wing and the 5′-most nucleoside of the 3′-wing) differ from the sugar moiety of the neighboring gap nucleosides, thus defining the boundary between the wings and the gap (i.e., the wing/gap junction). In certain embodiments, the sugar moieties within the gap are the same as one another. In certain embodiments, the gap includes one or more nucleoside having a sugar moiety that differs from the sugar moiety of one or more other nucleosides of the gap. In certain embodiments, the sugar motifs of the two wings are the same as one another (symmetric gapmer). In certain embodiments, the sugar motif of the 5′-wing differs from the sugar motif of the 3′-wing (asymmetric gapmer).

[0295] In certain embodiments, the wings of a gapmer comprise 1-6 nucleosides. In certain embodiments, each nucleoside of each wing of a gapmer comprises a modified sugar moiety. In certain embodiments, at least one nucleoside of each wing of a gapmer comprises a modified sugar moiety. In certain embodiments, at least two nucleosides of each wing of a gapmer comprises a modified sugar moiety. In certain embodiments, at least three nucleosides of each wing of a gapmer comprises a modified sugar moiety. In certain embodiments, at least four nucleosides of each wing of a gapmer comprises a modified sugar moiety.

[0296] In certain embodiments, the gap of a gapmer comprises 7-12 nucleosides. In certain embodiments, each nucleoside of the gap of a gapmer comprises a 2′-β-D-deoxyribosyl sugar moiety. In certain embodiments, at least one nucleoside of the gap of a gapmer comprises a modified sugar moiety.

[0297] In certain embodiments, the gapmer is a deoxy gapmer. In certain embodiments, the nucleosides on the gap side of each wing/gap junction comprise 2′-deoxyribosyl sugar moieties and the nucleosides on the wing sides of each wing/gap junction comprise modified sugar moieties. In certain embodiments, each nucleoside of the gap comprises a 2′-β-D-deoxyribosyl sugar moiety. In certain embodiments, each nucleoside of each wing of a gapmer comprises a modified sugar moiety. In certain embodiments, at least one nucleoside of the gap of a gapmer comprises a modified sugar moiety. In certain embodiments, at least one nucleoside of the gap of a gapmer comprises a 2′-OMe sugar moiety.

[0298] Herein, the lengths (number of nucleosides) of the three regions of a gapmer may be provided using the notation [# of nucleosides in the 5′-wing]—[# of nucleosides in the gap]—[# of nucleosides in the 3′-wing]. Thus, a 3-10-3 gapmer consists of 3 linked nucleosides in each wing and 10 linked nucleosides in the gap. Where such nomenclature is followed by a specific modification, that modification is the modification in each sugar moiety of each wing and the gap nucleosides comprise 2′-β-D-deoxyribosyl sugar moieties. Thus, a 5-10-5 MOE gapmer consists of 5 linked 2′-MOE modified nucleosides in the 5′-wing, 10 linked 2′-β-D-deoxynucleosides in the gap, and 5 linked 2′-MOE modified nucleosides in the 3′-wing. A 3-10-3 cEt gapmer consists of 3 linked cEt nucleosides in the 5′-wing, 10 linked 2′-β-D-deoxynucleosides in the gap, and 3 linked cEt nucleosides in the 3′-wing. A 6-10-4 MOE gapmer consists of 6 linked 2′-MOE modified nucleosides in the 5′-wing, 10 linked 2′-β-D-deoxynucleosides in the gap, and 4 linked 2′-MOE modified nucleosides in the 3′-wing. A 5-8-5 gapmer consists of 5 linked nucleosides comprising a modified sugar moiety in the 5′-wing, 8 linked 2′-β-D-deoxynucleosides in the gap, and 5 linked nucleosides comprising a modified sugar moiety in the 3′-wing. A 5-8-5 mixed gapmer has at least two different modified sugar moieties in the 5′- and/or the 3′-wing.

[0299] In certain embodiments, modified oligonucleotides are 5-10-5 MOE gapmers. In certain embodiments, modified oligonucleotides are 3-10-3 BNA gapmers. In certain embodiments, modified oligonucleotides are 3-10-3 cEt gapmers. In certain embodiments, modified oligonucleotides are 3-10-3 LNA gapmers. In certain embodiments, modified oligonucleotides are 6-10-4 MOE gapmers. In certain embodiments, modified oligonucleotides are 5-8-5 MOE gapmers or 5-8-5 mixed gapmers.

[0300] In certain embodiments, modified oligonucleotides are 5-10-5 MOE gapmers that consist of 5 linked 2′-MOE modified nucleosides in the 5′-wing, 10 linked 2′-β-D-deoxynucleosides in the gap, and 5 linked 2′-MOE modified nucleosides in the 3′-wing. In certain embodiments, modified nucleosides have a sugar motif of eeeeeddddddddddeeeee, where each “e” represents a nucleoside comprising a 2′-MOE modified sugar moiety, and each “d” represents a nucleoside comprising a 2′-β-D-deoxyribosyl sugar moiety.

[0301] In certain embodiments, modified oligonucleotides are 3-10-3 cEt gapmers that consist of 3 linked cEt nucleosides in the 5′-wing, 10 linked 2′-β-D-deoxynucleosides in the gap, and 3 linked cEt nucleosides in the 3′-wing. In certain embodiments, modified nucleosides have a sugar motif of kkkddddddddddkkk, wherein each “k” represents a nucleoside comprising a cEt modified sugar moiety, and each “d” represents a nucleoside comprising a 2′-β-D-deoxyribosyl sugar moiety.

[0302] In certain embodiments, modified oligonucleotides are 6-10-4 MOE gapmers that consist of 6 linked 2′-MOE modified nucleosides in the 5′-wing, 10 linked 2′-β-D-deoxynucleosides in the gap, and 4 linked 2′-MOE modified nucleosides in the 3′-wing. In certain embodiments, modified nucleosides have a sugar motif of eeeeeeddddddddddeeee, where each “e” represents a nucleoside comprising a 2′-MOE modified sugar moiety, and each “d” represents a nucleoside comprising a 2′-β-D-deoxyribosyl sugar moiety.

[0303] In certain embodiments, modified oligonucleotides are 5-8-5 MOE gapmers that consist of 5 linked 2′-MOE modified nucleosides in the 5′-wing, 8 linked 2′-β-D-deoxynucleosides in the gap, and 5 linked 2′-MOE modified nucleosides in the 3′-wing. In certain embodiments, modified nucleosides have a sugar motif of eeeeeddddddddeeeee, where each “e” represents a nucleoside comprising a 2′-MOE modified sugar moiety, and each “d” represents a nucleoside comprising a 2′-β-D-deoxyribosyl sugar moiety.

[0304] In certain embodiments, modified oligonucleotides are 5-8-5 mixed gapmers that consist of 5 linked 2′-MOE modified nucleosides in the 5′-wing, 8 linked 2′-β-D-deoxynucleosides in the gap, and a mixture of cEt and 2′-MOE modified nucleosides in the 3′-wing. In certain embodiments, modified nucleosides have a sugar motif of eeeeeddddddddkkeee, where each “e” represents a nucleoside comprising a 2′-MOE modified sugar moiety, each “d” represents a nucleoside comprising a 2′-β-D-deoxyribosyl sugar moiety, and each “k” represents a nucleoside comprising a cEt modified sugar moiety. In certain embodiments, modified nucleosides have a sugar motif of eeeeeddddddddkeeee, where each “e” represents a nucleoside comprising a 2′-MOE modified sugar moiety, each “d” represents a nucleoside comprising a 2′-β-D-deoxyribosyl sugar moiety, and each “k” represents a nucleoside comprising a cEt modified sugar moiety.

Antisense RNAi Oligonucleotides

[0305] In certain embodiments, the sugar moiety of at least one nucleoside of an antisense RNAi oligonucleotide is a modified sugar moiety.

[0306] In certain such embodiments, at least one nucleoside of the antisense RNAi oligonucleotide comprises a 2′-OMe modified sugar moiety. In certain embodiments, at least 2 nucleosides comprise 2′-OMe modified sugar moieties. In certain embodiments, at least 5 nucleosides comprise 2′-OMe modified sugar moieties. In certain embodiments, at least 8 nucleosides comprise 2′-OMe modified sugar moieties. In certain embodiments, at least 10 nucleosides comprise 2′-OMe modified sugar moieties. In certain embodiments, at least 12 nucleosides comprise 2′-OMe modified sugar moieties. In certain embodiments, at least 14 nucleosides comprise 2′-OMe modified sugar moieties. In certain embodiments, at least 15 nucleosides comprise 2′-OMe modified sugar moieties. In certain embodiments, at least 17 nucleosides comprise 2′-OMe modified sugar moieties. In certain such embodiments, at least 18 nucleosides comprise 2′-OMe modified sugar moieties. In certain such embodiments, at least 20 nucleosides comprise 2′-OMe modified sugar moieties. In certain embodiments, at least 21 nucleosides comprise 2′-OMe modified sugar moieties. In certain such embodiments, the remainder of the nucleosides are 2′-F modified.

[0307] In certain embodiments, at least one nucleoside of the antisense RNAi oligonucleotide comprises a 2′-F modified sugar moiety. In certain embodiments, at least 2 nucleosides comprise 2′-F modified sugar moieties. In certain embodiments, at least 3 nucleosides comprise 2′-F modified sugar moieties. In certain embodiments, at least 4 nucleosides comprise 2′-F modified sugar moieties. In certain embodiments, one, but not more than one nucleoside comprises a 2′-F modified sugar. In certain embodiments, 1 or 2 nucleosides comprise 2′-F modified sugar moieties. In certain embodiments, 1-3 nucleosides comprise 2′-F modified sugar moieties. In certain embodiments, at least 1-4 nucleosides comprise 2′-F modified sugar moieties. In certain embodiments, antisense RNAi oligonucleotides have a block of 2-4 contiguous 2′-F modified nucleosides. In certain embodiments, 4 nucleosides of an antisense RNAi oligonucleotide are 2′-F modified nucleosides and 3 of those 2′-F modified nucleosides are contiguous. In certain such embodiments, the remainder of the nucleosides are 2′-OMe modified.

[0308] In certain embodiments, at least one nucleoside of the antisense RNAi oligonucleotide comprises a 2′-OMe modified sugar moiety and at least one nucleoside comprises a 2′-F modified sugar moiety. In certain embodiments, at least 1, 2, 3, 4, 5, 6, 7, 8, 9 or 10 nucleosides comprises a 2′-OMe modified sugar moiety and at least 1, 2, 3, 4, 5, 6, 7, 8, 9 or 10 nucleosides comprises a 2′-F modified sugar moiety. In certain embodiments, the antisense RNAi oligonucleotide comprises a sugar motif of fyf or yfy, wherein each “f” represents a 2′-F modified sugar moiety and each “y” represents a 2′-OMe modified sugar moiety. In certain embodiments, the antisense RNAi oligonucleotide has a sugar motif of yfyfyfyfyfyfyfyfyfyfyyy, wherein each “f” represents a 2′-F modified sugar moiety and each “y” represents a 2′-OMe modified sugar moiety.

[0309] In certain embodiments, at least one nucleoside of the antisense RNAi oligonucleotide comprises a 2′-MOE modified sugar moiety. In certain embodiments, the antisense RNAi oligonucleotide further comprises one or more 2′-OMe modified sugar moieties and one or more 2′-F modified sugar moieties. In certain embodiments, at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, or 18 nucleosides comprises a 2′-OMe modified sugar moiety. In certain embodiments, at least 1, 2, 3, or 4 nucleosides comprises a 2′-F modified sugar moiety. In certain embodiments, the antisense RNAi oligonucleotide has a sugar motif of efyyyfyyyyyyyfyfyyyyyyy, wherein ‘e’ represents a 2′-MOE modified sugar moiety, each “y” represents a 2′-O-methylribosyl sugar, and each “f” represents a 2′-fluororibosyl sugar.

Sense RNAi Oligonucleotides

[0310] In certain embodiments, the sugar moiety of at least one nucleoside of a sense RNAi oligonucleotides is a modified sugar moiety.

[0311] In certain such embodiments, at least one nucleoside of the sense RNAi oligonucleotide comprises a 2′-OMe modified sugar moiety. In certain embodiments, at least 2 nucleosides comprise 2′-OMe modified sugar moieties. In certain embodiments, at least 5 nucleosides comprise 2′-OMe modified sugar moieties. In certain embodiments, at least 8 nucleosides comprise 2′-OMe modified sugar moieties. In certain embodiments, at least 10 nucleosides comprise 2′-OMe modified sugar moieties. In certain embodiments, at least 12 nucleosides comprise 2′-OMe modified sugar moieties. In certain embodiments, at least 14 nucleosides comprise 2′-OMe modified sugar moieties. In certain embodiments, at least 15 nucleosides comprise 2′-OMe modified sugar moieties. In certain embodiments, at least 17 nucleosides comprise 2′-OMe modified sugar moieties. In certain such embodiments, at least 18 nucleosides comprise 2′-OMe modified sugar moieties. In certain such embodiments, at least 20 nucleosides comprise 2′-OMe modified sugar moieties. In certain such embodiments, at least 21 nucleosides comprise 2′-OMe modified sugar moieties.

[0312] In certain embodiments, at least one nucleoside of the sense RNAi oligonucleotide comprises a 2′-F modified sugar moiety. In certain embodiments, at least 2 nucleosides comprise 2′-F modified sugar moieties. In certain embodiments, at least 3 nucleosides comprise 2′-F modified sugar moieties. In certain embodiments, at least 4 nucleosides comprise 2′-F modified sugar moieties. In certain embodiments, one, but not more than nucleoside comprises a 2′-F modified sugar moiety. In certain embodiments, 1 or 2 nucleosides comprise 2′-F modified sugar moieties. In certain embodiments, 1-3 nucleosides comprise 2′-F modified sugar moieties. In certain embodiments, at least 1-4 nucleosides comprise 2′-F modified sugar moieties. In certain embodiments, sense RNAi oligonucleotides have a block of 2-4 contiguous 2′-F modified nucleosides. In certain embodiments, 4 nucleosides of a sense RNAi oligonucleotide are 2′-F modified nucleosides and 3 of those 2′-F modified nucleosides are contiguous. In certain such embodiments the remainder of the nucleosides are 2′OMe modified.

[0313] In certain embodiments, at least one nucleoside of the sense RNAi oligonucleotide comprises a 2′-OMe modified sugar moiety and at least one nucleoside comprises a 2′-F modified sugar moiety. In certain embodiments, at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, or 17 nucleosides comprises a 2′-OMe modified sugar moiety and at least 1, 2, 3, 4, 5, 6, 7, 8, 9 or 10 nucleosides comprises a 2′-F modified sugar moiety. In certain embodiments, the sense RNAi oligonucleotide comprises a sugar motif of fyf or yfy, wherein each “f” represents a 2′-F modified sugar moiety and each “y” represents a 2′-OMe modified sugar moiety. In certain embodiments, the sense RNAi oligonucleotide has a sugar motif of fyfyfyfyfyfyfyfyfyfyf, wherein each “f” represents a 2′-F modified sugar moiety and each “y” represents a 2′-OMe modified sugar moiety. In certain embodiments, the sense RNAi oligonucleotide has a sugar motif of yyyyyyfyfffyyyyyyyyyy, wherein each “y” represents a 2′-O-methylribosyl sugar, and each “f” represents a 2′-fluororibosyl sugar.

[0314] 2. Certain Nucleobase Motifs

[0315] In certain embodiments, oligonucleotides comprise modified and/or unmodified nucleobases arranged along the oligonucleotide or region thereof in a defined pattern or motif. In certain embodiments, each nucleobase is modified. In certain embodiments, none of the nucleobases are modified. In certain embodiments, each purine or each pyrimidine is modified. In certain embodiments, each adenine is modified. In certain embodiments, each guanine is modified. In certain embodiments, each thymine is modified. In certain embodiments, each uracil is modified. In certain embodiments, each cytosine is modified. In certain embodiments, some or all of the cytosine nucleobases in a modified oligonucleotide are 5-methyl cytosines. In certain embodiments, all of the cytosine nucleobases are 5-methyl cytosines and all of the other nucleobases of the modified oligonucleotide are unmodified nucleobases.

[0316] In certain embodiments, modified oligonucleotides comprise a block of modified nucleobases. In certain such embodiments, the block is at the 3′-end of the oligonucleotide. In certain embodiments the block is within 3 nucleosides of the 3′-end of the oligonucleotide. In certain embodiments, the block is at the 5′-end of the oligonucleotide. In certain embodiments the block is within 3 nucleosides of the 5′-end of the oligonucleotide.

Gapmer Oligonucleotides

[0317] In certain embodiments, oligonucleotides having a gapmer motif comprise a nucleoside comprising a modified nucleobase. In certain such embodiments, one nucleoside comprising a modified nucleobase is in the central gap of an oligonucleotide having a gapmer motif. In certain such embodiments, the sugar moiety of said nucleoside is a 2′-deoxyribosyl sugar moiety. In certain embodiments, the modified nucleobase is selected from: a 2-thiopyrimidine and a 5-propynepyrimidine.

Antisense RNAi Oligonucleotides

[0318] In certain embodiments, one nucleoside of an antisense RNAi oligonucleotide is a UNA. In certain embodiments, one nucleoside of an antisense RNAi oligonucleotide is a GNA. In certain embodiments, 1-4 nucleosides of an antisense RNAi oligonucleotide is/are DNA. In certain such embodiments, the 1-4 DNA nucleosides are at one or both ends of the antisense RNAi oligonucleotide.

Sense RNAi Oligonucleotides

[0319] In certain embodiments, one nucleoside of a sense RNAi oligonucleotide is a UNA. In certain embodiments, one nucleoside of a sense RNAi oligonucleotide is a GNA. In certain embodiments, 1-4 nucleosides of a sense RNAi oligonucleotide is/are DNA. In certain such embodiments, the 1-4 DNA nucleosides are at one or both ends of the sense RNAi oligonucleotide.

[0320] 3. Certain Internucleoside Linkage Motifs

[0321] In certain embodiments, oligonucleotides comprise modified and/or unmodified internucleoside linkages arranged along the oligonucleotide or region thereof in a defined pattern or motif. In certain embodiments, each internucleoside linking group is a phosphodiester internucleoside linkage (P═0). In certain embodiments, each internucleoside linking group of a modified oligonucleotide is a phosphorothioate internucleoside linkage (P═S). In certain embodiments, each internucleoside linkage of a modified oligonucleotide is independently selected from a phosphorothioate internucleoside linkage and phosphodiester internucleoside linkage. In certain embodiments, each phosphorothioate internucleoside linkage is independently selected from a stereorandom phosphorothioate a (Sp) phosphorothioate, and a (Rp) phosphorothioate.

Gapmer Oligonucleotides

[0322] In certain embodiments, the sugar motif of a modified oligonucleotide is a gapmer and the internucleoside linkages within the gap are all modified. In certain embodiments, some or all of the internucleoside linkages in the wings are unmodified phosphodiester internucleoside linkages. In certain embodiments, the terminal internucleoside linkages are modified. In certain embodiments, the sugar motif of a modified oligonucleotide is a gapmer, and the internucleoside linkage motif comprises at least one phosphodiester internucleoside linkage in at least one wing, wherein the at least one phosphodiester linkage is not a terminal internucleoside linkage, and the remaining internucleoside linkages are phosphorothioate internucleoside linkages. In certain embodiments, all of the phosphorothioate linkages are stereorandom. In certain embodiments, all of the phosphorothioate linkages in the wings are (Sp) phosphorothioates, and the gap comprises at least one Sp, Sp, Rp motif. In certain embodiments, populations of modified oligonucleotides are enriched for modified oligonucleotides comprising such internucleoside linkage motifs.

[0323] In certain embodiments, modified nucleotides have an internucleoside linkage motif of sososssssssssosss, wherein each “s” represents a phosphorothioate internucleoside linkage and each “o” represents a phosphodiester internucleoside linkage. In certain embodiments, modified nucleotides have an internucleoside linkage motif of sooosssssssssooss, wherein each “s” represents a phosphorothioate internucleoside linkage and each “o” represents a phosphodiester internucleoside linkage. In certain embodiments, modified nucleotides have an internucleoside linkage motif of sooosssssssssooss, wherein each “s” represents a phosphorothioate internucleoside linkage and each “o” represents a phosphodiester internucleoside linkage. In certain embodiments, modified nucleotides have an internucleoside linkage motif of soossssssssssooss, wherein each “s” represents a phosphorothioate internucleoside linkage and each “o” represents a phosphodiester internucleoside linkage. In certain embodiments, modified nucleotides have an internucleoside linkage motif of soooossssssssssooss, wherein each “s” represents a phosphorothioate internucleoside linkage and each “o” represents a phosphodiester internucleoside linkage. In certain embodiments, modified nucleotides have an internucleoside linkage motif of sossssssssssssssoss, wherein each “s” represents a phosphorothioate internucleoside linkage and each “o” represents a phosphodiester internucleoside linkage. In certain embodiments, modified nucleotides have an internucleoside linkage motif of soossssssssssos, wherein each “s” represents a phosphorothioate internucleoside linkage and each “o” represents a phosphodiester internucleoside linkage. In certain embodiments, modified nucleotides have an internucleoside linkage motif of soosssssssssooss, wherein each “s” represents a phosphorothioate internucleoside linkage and each “o” represents a phosphodiester internucleoside linkage. In certain embodiments, modified nucleotides have an internucleoside linkage motif of sooosssssssssssooss, wherein each “s” represents a phosphorothioate internucleoside linkage and each “o” represents a phosphodiester internucleoside linkage. In certain embodiments, modified nucleotides have an internucleoside linkage motif of sooooossssssssssoss, wherein each “s” represents a phosphorothioate internucleoside linkage and each “o” represents a phosphodiester internucleoside linkage.

Antisense RNAi Oligonucleotides

[0324] In certain embodiments, at least one linkage of the antisense RNAi oligonucleotide is a modified linkage. In certain embodiments, the 5′-most linkage (i.e., linking the first nucleoside from the 5′-end to the second nucleoside from the 5′-end) is modified. In certain embodiments, the two 5′-most linkages are modified. In certain embodiments, the first one or 2 linkages from the 3′-end are modified. In certain such embodiments, the modified linkage is a phosphorothioate linkage. In certain embodiments, the remaining linkages are all unmodified phosphodiester linkages. In certain embodiments, antisense RNAi oligonucleotides have an internucleoside linkage motif of ssooooooooooooooooooss, wherein each “s” represents a phosphorothioate internucleoside linkage and each “o” represents a phosphodiester internucleoside linkage.

[0325] In certain embodiments, at least one linkage of the antisense RNAi oligonucleotide is an inverted linkage.

Sense RNAi Oligonucleotides

[0326] In certain embodiments, at least one linkage of the sense RNAi oligonucleotides is a modified linkage. In certain embodiments, the 5′-most linkage (i.e., linking the first nucleoside from the 5′-end to the second nucleoside from the 5′-end) is modified. In certain embodiments, the two 5′-most linkages are modified. In certain embodiments, the first one or 2 linkages from the 3′-end are modified. In certain such embodiments, the modified linkage is a phosphorothioate linkage. In certain embodiments, the remaining linkages are all unmodified phosphodiester linkages. In certain embodiments, sense RNAi oligonucleotides have an internucleoside linkage motif of ssooooooooooooooooss, wherein each “s” represents a phosphorothioate internucleoside linkage and each “o” represents a phosphodiester internucleoside linkage.

[0327] In certain embodiments, at least one linkage of the sense RNAi oligonucleotides is an inverted linkage.

[0328] C. Certain Lengths

[0329] It is possible to increase or decrease the length of an oligonucleotide without eliminating activity. For example, in Woolf et al. (Proc. Natl. Acad. Sci. USA 89:7305-7309, 1992), a series of oligonucleotides 13-25 nucleobases in length were tested for their ability to induce cleavage of a target RNA in an oocyte injection model. Oligonucleotides 25 nucleobases in length with 8 or 11 mismatch bases near the ends of the oligonucleotides were able to direct specific cleavage of the target RNA, albeit to a lesser extent than the oligonucleotides that contained no mismatches. Similarly, target specific cleavage was achieved using 13 nucleobase oligonucleotides, including those with 1 or 3 mismatches.

[0330] In certain embodiments, oligonucleotides (including modified oligonucleotides) can have any of a variety of ranges of lengths. In certain embodiments, oligonucleotides consist of X to Y linked nucleosides, where X represents the fewest number of nucleosides in the range and Y represents the largest number nucleosides in the range. In certain such embodiments, X and Y are each independently selected from 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, and 50; provided that X<Y. For example, in certain embodiments, oligonucleotides consist of 12 to 13, 12 to 14, 12 to 15, 12 to 16, 12 to 17, 12 to 18, 12 to 19, 12 to 20, 12 to 21, 12 to 22, 12 to 23, 12 to 24, 12 to 25, 12 to 26, 12 to 27, 12 to 28, 12 to 29, 12 to 30, 13 to 14, 13 to 15, 13 to 16, 13 to 17, 13 to 18, 13 to 19, 13 to 20, 13 to 21, 13 to 22, 13 to 23, 13 to 24, 13 to 25, 13 to 26, 13 to 27, 13 to 28, 13 to 29, 13 to 30, 14 to 15, 14 to 16, 14 to 17, 14 to 18, 14 to 19, 14 to 20, 14 to 21, 14 to 22, 14 to 23, 14 to 24, 14 to 25, 14 to 26, 14 to 27, 14 to 28, 14 to 29, 14 to 30, 15 to 16, 15 to 17, 15 to 18, 15 to 19, 15 to 20, 15 to 21, 15 to 22, 15 to 23, 15 to 24, 15 to 25, 15 to 26, 15 to 27, 15 to 28, 15 to 29, 15 to 30, 16 to 17, 16 to 18, 16 to 19, 16 to 20, 16 to 21, 16 to 22, 16 to 23, 16 to 24, 16 to 25, 16 to 26, 16 to 27, 16 to 28, 16 to 29, 16 to 30, 17 to 18, 17 to 19, 17 to 20, 17 to 21, 17 to 22, 17 to 23, 17 to 24, 17 to 25, 17 to 26, 17 to 27, 17 to 28, 17 to 29, 17 to 30, 18 to 19, 18 to 20, 18 to 21, 18 to 22, 18 to 23, 18 to 24, 18 to 25, 18 to 26, 18 to 27, 18 to 28, 18 to 29, 18 to 30, 19 to 20, 19 to 21, 19 to 22, 19 to 23, 19 to 24, 19 to 25, 19 to 26, 19 to 29, 19 to 28, 19 to 29, 19 to 30, 20 to 21, 20 to 22, 20 to 23, 20 to 24, 20 to 25, 20 to 26, 20 to 27, 20 to 28, 20 to 29, 20 to 30, 21 to 22, 21 to 23, 21 to 24, 21 to 25, 21 to 26, 21 to 27, 21 to 28, 21 to 29, 21 to 30, 22 to 23, 22 to 24, 22 to 25, 22 to 26, 22 to 27, 22 to 28, 22 to 29, 22 to 30, 23 to 24, 23 to 25, 23 to 26, 23 to 27, 23 to 28, 23 to 29, 23 to 30, 24 to 25, 24 to 26, 24 to 27, 24 to 28, 24 to 29, 24 to 30, 25 to 26, 25 to 27, 25 to 28, 25 to 29, 25 to 30, 26 to 27, 26 to 28, 26 to 29, 26 to 30, 27 to 28, 27 to 29, 27 to 30, 28 to 29, 28 to 30, or 29 to 30 linked nucleosides.

Antisense RNAi Oligonucleotides

[0331] In certain embodiments, antisense RNAi oligonucleotides consist of 17-30 linked nucleosides. In certain embodiments, antisense RNAi oligonucleotides consist of 17-25 linked nucleosides. In certain embodiments, antisense RNAi oligonucleotides consist of 17-23 linked nucleosides. In certain embodiments, antisense RNAi oligonucleotides consist of 17-21 linked nucleosides. In certain embodiments, antisense RNAi oligonucleotides consist of 18-30 linked nucleosides. In certain embodiments, antisense RNAi oligonucleotides consist of 20-30 linked nucleosides. In certain embodiments, antisense RNAi oligonucleotides consist of 21-30 linked nucleosides. In certain embodiments, antisense RNAi oligonucleotides consist of 23-30 linked nucleosides. In certain embodiments, antisense RNAi oligonucleotides consist of 18-25 linked nucleosides. In certain embodiments, antisense RNAi oligonucleotides consist of 20-22 linked nucleosides. In certain embodiments, antisense RNAi oligonucleotides consist of 21-23 linked nucleosides. In certain embodiments, antisense RNAi oligonucleotides consist of 23-24 linked nucleosides. In certain embodiments, antisense RNAi oligonucleotides consist of 20 linked nucleosides. In certain embodiments, antisense RNAi oligonucleotides consist of 21 linked nucleosides. In certain embodiments, antisense RNAi oligonucleotides consist of 22 linked nucleosides. In certain embodiments, antisense RNAi oligonucleotides consist of 23 linked nucleosides.

Sense RNAi Oligonucleotides

[0332] In certain embodiments, sense RNAi oligonucleotides consist of 17-30 linked nucleosides. In certain embodiments, sense RNAi oligonucleotides consist of 17-25 linked nucleosides. In certain embodiments, sense RNAi oligonucleotides consist of 17-23 linked nucleosides. In certain embodiments, sense RNAi oligonucleotides consist of 17-21 linked nucleosides. In certain embodiments, sense RNAi oligonucleotides consist of 18-30 linked nucleosides. In certain embodiments, sense RNAi oligonucleotides consist of 20-30 linked nucleosides. In certain embodiments, sense RNAi oligonucleotides consist of 21-30 linked nucleosides. In certain embodiments, sense RNAi oligonucleotides consist of 23-30 linked nucleosides. In certain embodiments, sense RNAi oligonucleotides consist of 18-25 linked nucleosides. In certain embodiments, sense RNAi oligonucleotides consist of 20-22 linked nucleosides. In certain embodiments, sense RNAi oligonucleotides consist of 21-23 linked nucleosides. In certain embodiments, sense RNAi oligonucleotides consist of 23-24 linked nucleosides. In certain embodiments, sense RNAi oligonucleotides consist of 20 linked nucleosides. In certain embodiments, sense RNAi oligonucleotides consist of 21 linked nucleosides. In certain embodiments, sense RNAi oligonucleotides consist of 22 linked nucleosides. In certain embodiments, sense RNAi oligonucleotides consist of 23 linked nucleosides.

[0333] D. Certain Modified Oligonucleotides

[0334] In certain embodiments, the above modifications (sugar, nucleobase, internucleoside linkage) are incorporated into a modified oligonucleotide. In certain embodiments, modified oligonucleotides are characterized by their modification motifs and overall lengths. In certain embodiments, such parameters are each independent of one another. Thus, unless otherwise indicated, each internucleoside linkage of an oligonucleotide having a gapmer sugar motif may be modified or unmodified and may or may not follow the gapmer modification pattern of the sugar modifications. For example, the internucleoside linkages within the wing regions of a sugar gapmer may be the same or different from one another and may be the same or different from the internucleoside linkages of the gap region of the sugar motif. Likewise, such sugar gapmer oligonucleotides may comprise one or more modified nucleobase independent of the gapmer pattern of the sugar modifications. Unless otherwise indicated, all modifications are independent of nucleobase sequence.

[0335] E. Certain Populations of Modified Oligonucleotides

[0336] Populations of modified oligonucleotides in which all of the modified oligonucleotides of the population have the same molecular formula can be stereorandom populations or chirally enriched populations. All of the chiral centers of all of the modified oligonucleotides are stereorandom in a stereorandom population. In a chirally enriched population, at least one particular chiral center is not stereorandom in the modified oligonucleotides of the population. In certain embodiments, the modified oligonucleotides of a chirally enriched population are enriched for β-D ribosyl sugar moieties, and all of the phosphorothioate internucleoside linkages are stereorandom. In certain embodiments, the modified oligonucleotides of a chirally enriched population are enriched for both β-D ribosyl sugar moieties and at least one, particular phosphorothioate internucleoside linkage in a particular stereochemical configuration.

[0337] F. Nucleobase Sequence

[0338] In certain embodiments, oligonucleotides (unmodified or modified oligonucleotides) are further described by their nucleobase sequence. In certain embodiments oligonucleotides have a nucleobase sequence that is complementary to a second oligonucleotide or an identified reference nucleic acid, such as a target nucleic acid. In certain such embodiments, a region of an oligonucleotide has a nucleobase sequence that is complementary to a second oligonucleotide or an identified reference nucleic acid, such as a target nucleic acid. In certain embodiments, the nucleobase sequence of a region or entire length of an oligonucleotide is at least 50%, at least 60%, at least 70%, at least 80%, at least 85%, at least 90%, at least 95%, or 100% complementary to the second oligonucleotide or nucleic acid, such as a target nucleic acid.

[0339] II. Certain Oligomeric Compounds

[0340] In certain embodiments, provided herein are oligomeric compounds, which consist of an oligonucleotide (modified or unmodified) and optionally one or more conjugate groups and/or terminal groups. Conjugate groups consist of one or more conjugate moiety and a conjugate linker which links the conjugate moiety to the oligonucleotide. Conjugate groups may be attached to either or both ends of an oligonucleotide and/or at any internal position. In certain embodiments, conjugate groups are attached to the 2′-position of a nucleoside of a modified oligonucleotide. In certain embodiments, conjugate groups that are attached to either or both ends of an oligonucleotide are terminal groups. In certain such embodiments, conjugate groups or terminal groups are attached at the 3′ and/or 5′-end of oligonucleotides. In certain such embodiments, conjugate groups (or terminal groups) are attached at the 3′-end of oligonucleotides. In certain embodiments, conjugate groups are attached near the 3′-end of oligonucleotides. In certain embodiments, conjugate groups (or terminal groups) are attached at the 5′-end of oligonucleotides. In certain embodiments, conjugate groups are attached near the 5′-end of oligonucleotides.

[0341] Examples of terminal groups include but are not limited to conjugate groups, capping groups, phosphate moieties, protecting groups, modified or unmodified nucleosides, and two or more nucleosides that are independently modified or unmodified.

[0342] A. Certain RNAi Agents

[0343] RNAi agents comprise an antisense RNAi oligonucleotide and optionally a sense RNAi oligonucleotide. RNAi agents may also comprise terminal groups and/or conjugate groups which may be attached to the antisense RNAi oligonucleotide or the sense RNAi oligonucleotide (when present).

[0344] Duplexes

[0345] RNAi agents comprising an antisense RNAi oligonucleotide and a sense RNAi oligonucleotide form a duplex, because the sense RNAi oligonucleotide comprises an antisense-hybridizing region that is complementary to the antisense RNAi oligonucleotide. In certain embodiments, each nucleobase of the antisense RNAi oligonucleotide and the sense RNAi oligonucleotide are complementary to one another. In certain embodiments, the two RNAi oligonucleotides have at least one mismatch relative to one another.

[0346] In certain embodiments, the antisense hybridizing region constitutes the entire length of the sense RNAi oligonucleotide and the antisense RNAi oligonucleotide. In certain embodiments, one or both of the antisense RNAi oligonucleotide and the sense RNAi oligonucleotide comprise additional nucleosides at one or both ends that do not hybridize (overhanging nucleosides). In certain embodiments, overhanging nucleosides are DNA. In certain embodiments, overhanging nucleosides are linked to each other (where there is more than one) and to the first non-overhanging nucleoside with phosphorothioate linkages.

[0347] B. Certain Conjugate Groups

[0348] In certain embodiments, oligonucleotides are covalently attached to one or more conjugate groups. In certain embodiments, conjugate groups modify one or more properties of the attached oligonucleotide, including but not limited to pharmacodynamics, pharmacokinetics, stability, binding, absorption, tissue distribution, cellular distribution, cellular uptake, charge and clearance.

[0349] In certain embodiments, conjugation of one or more carbohydrate moieties to a modified oligonucleotide can optimize one or more properties of the modified oligonucleotide. In certain embodiments, the carbohydrate moiety is attached to a modified subunit of the modified oligonucleotide. For example, the ribose sugar of one or more ribonucleotide subunits of a modified oligonucleotide can be replaced with another moiety, e.g. a non-carbohydrate (preferably cyclic) carrier to which is attached a carbohydrate ligand. A ribonucleotide subunit in which the ribose sugar of the subunit has been so replaced is referred to herein as a ribose replacement modification subunit (RRMS), which is a modified sugar moiety. A cyclic carrier may be a carbocyclic ring system, i.e., one or more ring atoms may be a heteroatom, e.g., nitrogen, oxygen, sulphur. The cyclic carrier may be a monocyclic ring system, or may contain two or more rings, e.g. fused rings. The cyclic carrier may be a fully saturated ring system, or it may contain one or more double bonds. In certain embodiments, the modified oligonucleotide is a gapmer. In certain embodiments, the modified oligonucleotide is an antisense RNAi oligonucleotide. In certain embodiments, the modified oligonucleotide is a sense RNAi oligonucleotide.

[0350] In certain embodiments, conjugate groups impart a new property on the attached oligonucleotide, e.g., fluorophores or reporter groups that enable detection of the oligonucleotide. Certain conjugate groups and conjugate moieties have been described previously, for example: cholesterol moiety (Letsinger et al., Proc. Natl. Acad. Sci. USA, 1989, 86, 6553-6556), cholic acid (Manoharan et al., Bioorg. Med. Chem. Lett., 1994, 4, 1053-1060), a thioether, e.g., hexyl-S-tritylthiol (Manoharan et al., Ann. N.Y. Acad. Sci., 1992, 660, 306-309; Manoharan et al., Bioorg. Med. Chem. Lett., 1993, 3, 2765-2770), a thiocholesterol (Oberhauser et al., Nucl. Acids Res., 1992, 20, 533-538), an aliphatic chain, e.g., do-decan-diol or undecyl residues (Saison-Behmoaras et al., EMBO 1, 1991, 10, 1111-1118; Kabanov et al., FEBS Lett., 1990, 259, 327-330; Svinarchuk et al., Biochimie, 1993, 75, 49-54), a phospholipid, e.g., di-hexadecyl-rac-glycerol or triethyl-ammonium 1,2-di-O-hexadecyl-rac-glycero-3-H-phosphonate (Manoharan et al., Tetrahedron Lett., 1995, 36, 3651-3654; Shea et al., Nucl. Acids Res., 1990, 18, 3777-3783), a polyamine or a polyethylene glycol chain (Manoharan et al., Nucleosides & Nucleotides, 1995, 14, 969-973), or adamantane acetic acid a palmityl moiety (Mishra et al., Biochim. Biophys. Acta, 1995, 1264, 229-237), an octadecylamine or hexylamino-carbonyl-oxycholesterol moiety (Crooke et al., J. Pharmacol. Exp. Ther., 1996, 277, 923-937), a tocopherol group (Nishina et al., Molecular Therapy Nucleic Acids, 2015, 4, e220; and Nishina et al., Molecular Therapy, 2008, 16, 734-740), or a GalNAc cluster (e.g., WO2014/179620).

[0351] In certain embodiments, conjugate groups may be selected from any of a C22 alkyl, C20 alkyl, C16 alkyl, C10 alkyl, C21 alkyl, C19 alkyl, C18 alkyl, C15 alkyl, C14 alkyl, C13 alkyl, C12 alkyl, C11 alkyl, C9 alkyl, C8 alkyl, C7 alkyl, C6 alkyl, C5 alkyl, C22 alkenyl, C20 alkenyl, C16 alkenyl, C10 alkenyl, C21 alkenyl, C19 alkenyl, C18 alkenyl, C15 alkenyl, C14 alkenyl, C13 alkenyl, C12 alkenyl, C11 alkenyl, C9 alkenyl, C8 alkenyl, C7 alkenyl, C6 alkenyl, or C5 alkenyl.

[0352] In certain embodiments, conjugate groups may be selected from any of C22 alkyl, C20 alkyl, C16 alkyl, C10 alkyl, C21 alkyl, C19 alkyl, C18 alkyl, C15 alkyl, C14 alkyl, C13 alkyl, C12 alkyl, C11 alkyl, C9 alkyl, C8 alkyl, C7 alkyl, C6 alkyl, and C5 alkyl, where the alkyl chain has one or more unsaturated bonds.

[0353] In certain embodiments, a conjugate group is a lipid having the following structure:

##STR00009##

[0354] In certain embodiments, a conjugate group is a lipid having the following structure:

##STR00010##

which is also referred to herein as 3nC7-C16. “3nC7-C16” represents a palmitate moiety linked to a 3′-C7 amino modifier and is attached to the 3′-nucleoside of an RNAi oligonucleotide (e.g., the 3′-nucleoside of a sense oligonucleotide or the antisense oligonucleotide) via a phosphodiester linkage.

[0355] 1. Conjugate Moieties

[0356] Conjugate moieties include, without limitation, intercalators, reporter molecules, polyamines, polyamides, peptides, carbohydrates (e.g., GalNAc), vitamin moieties, polyethylene glycols, thioethers, polyethers, cholesterols, thiocholesterols, cholic acid moieties, folate, lipids, phospholipids, biotin, phenazine, phenanthridine, anthraquinone, adamantane, acridine, fluoresceins, rhodamines, coumarins, fluorophores, and dyes.

[0357] In certain embodiments, a conjugate moiety comprises an active drug substance, for example, aspirin, warfarin, phenylbutazone, ibuprofen, suprofen, fen-bufen, ketoprofen, (S)-(+)-pranoprofen, carprofen, dansylsarcosine, 2,3,5-triiodobenzoic acid, fingolimod, flufenamic acid, folinic acid, a benzothiadiazide, chlorothiazide, a diazepine, indo-methicin, a barbiturate, a cephalosporin, a sulfa drug, an antidiabetic, an antibacterial or an antibiotic.

[0358] 2. Conjugate Linkers

[0359] Conjugate moieties are attached to oligonucleotides through conjugate linkers. In certain oligomeric compounds, the conjugate linker is a single chemical bond (i.e., the conjugate moiety is attached directly to an oligonucleotide through a single bond). In certain embodiments, the conjugate linker comprises a chain structure, such as a hydrocarbyl chain, or an oligomer of repeating units such as ethylene glycol, nucleosides, or amino acid units.

[0360] In certain embodiments, a conjugate linker comprises pyrrolidine.

[0361] In certain embodiments, a conjugate linker comprises one or more groups selected from alkyl, amino, oxo, amide, disulfide, polyethylene glycol, ether, thioether, and hydroxylamino. In certain such embodiments, the conjugate linker comprises groups selected from alkyl, amino, oxo, amide and ether groups. In certain embodiments, the conjugate linker comprises groups selected from alkyl and amide groups. In certain embodiments, the conjugate linker comprises groups selected from alkyl and ether groups. In certain embodiments, the conjugate linker comprises at least one phosphorus moiety. In certain embodiments, the conjugate linker comprises at least one phosphate group. In certain embodiments, the conjugate linker includes at least one neutral linking group.

[0362] In certain embodiments, conjugate linkers, including the conjugate linkers described above, are bifunctional linking moieties, e.g., those known in the art to be useful for attaching conjugate groups to compounds, such as the oligonucleotides provided herein. In general, a bifunctional linking moiety comprises at least two functional groups. One of the functional groups is selected to bind to a particular site on a compound and the other is selected to bind to a conjugate group. Examples of functional groups used in a bifunctional linking moiety include but are not limited to electrophiles for reacting with nucleophilic groups and nucleophiles for reacting with electrophilic groups. In certain embodiments, bifunctional linking moieties comprise one or more groups selected from amino, hydroxyl, carboxylic acid, thiol, alkyl, alkenyl, and alkynyl.

[0363] Examples of conjugate linkers include but are not limited to pyrrolidine, 8-amino-3,6-dioxaoctanoic acid (ADO), succinimidyl 4-(N-maleimidomethyl) cyclohexane-1-carboxylate (SMCC) and 6-aminohexanoic acid (AHEX or AHA). Other conjugate linkers include but are not limited to substituted or unsubstituted C.sub.1-C.sub.10 alkyl, substituted or unsubstituted C.sub.2-C.sub.10 alkenyl or substituted or unsubstituted C.sub.2-C.sub.10 alkynyl, wherein a nonlimiting list of preferred substituent groups includes hydroxyl, amino, alkoxy, carboxy, benzyl, phenyl, nitro, thiol, thioalkoxy, halogen, alkyl, aryl, alkenyl and alkynyl.

[0364] In certain embodiments, conjugate linkers comprise 1-10 linker-nucleosides. In certain embodiments, conjugate linkers comprise 2-5 linker-nucleosides. In certain embodiments, conjugate linkers comprise exactly 3 linker-nucleosides. In certain embodiments, conjugate linkers comprise the TCA motif. In certain embodiments, such linker-nucleosides are modified nucleosides. In certain embodiments such linker-nucleosides comprise a modified sugar moiety. In certain embodiments, linker-nucleosides are unmodified. In certain embodiments, linker-nucleosides comprise an optionally protected heterocyclic base selected from a purine, substituted purine, pyrimidine or substituted pyrimidine. In certain embodiments, a cleavable moiety is a nucleoside selected from uracil, thymine, cytosine, 4-N-benzoylcytosine, 5-methyl cytosine, 4-N-benzoyl-5-methyl cytosine, adenine, 6-N-benzoyladenine, guanine and 2-N-isobutyrylguanine. It is typically desirable for linker-nucleosides to be cleaved from the oligomeric compound after it reaches a target tissue. Accordingly, linker-nucleosides are typically linked to one another and to the remainder of the oligomeric compound through cleavable bonds. In certain embodiments, such cleavable bonds are phosphodiester bonds.

[0365] Herein, linker-nucleosides are not considered to be part of the oligonucleotide. Accordingly, in embodiments in which an oligomeric compound comprises an oligonucleotide consisting of a specified number or range of linked nucleosides and/or a specified percent complementarity to a reference nucleic acid and the oligomeric compound also comprises a conjugate group comprising a conjugate linker comprising linker-nucleosides, those linker-nucleosides are not counted toward the length of the oligonucleotide and are not used in determining the percent complementarity of the oligonucleotide for the reference nucleic acid. For example, an oligomeric compound may comprise (1) a modified oligonucleotide consisting of 8-30 nucleosides and (2) a conjugate group comprising 1-10 linker-nucleosides that are contiguous with the nucleosides of the modified oligonucleotide. The total number of contiguous linked nucleosides in such an oligomeric compound is more than 30. Alternatively, an oligomeric compound may comprise a modified oligonucleotide consisting of 8-30 nucleosides and no conjugate group. The total number of contiguous linked nucleosides in such an oligomeric compound is no more than 30. Unless otherwise indicated conjugate linkers comprise no more than 10 linker-nucleosides. In certain embodiments, conjugate linkers comprise no more than 5 linker-nucleosides. In certain embodiments, conjugate linkers comprise no more than 3 linker-nucleosides. In certain embodiments, conjugate linkers comprise no more than 2 linker-nucleosides. In certain embodiments, conjugate linkers comprise no more than 1 linker-nucleoside.

[0366] In certain embodiments, it is desirable for a conjugate group to be cleaved from the oligonucleotide. For example, in certain circumstances oligomeric compounds comprising a particular conjugate moiety are better taken up by a particular cell type, but once the oligomeric compound has been taken up, it is desirable that the conjugate group be cleaved to release the unconjugated or parent oligonucleotide. Thus, certain conjugate linkers may comprise one or more cleavable moieties. In certain embodiments, a cleavable moiety is a cleavable bond. In certain embodiments, a cleavable moiety is a group of atoms comprising at least one cleavable bond. In certain embodiments, a cleavable moiety comprises a group of atoms having one, two, three, four, or more than four cleavable bonds. In certain embodiments, a cleavable moiety is selectively cleaved inside a cell or subcellular compartment, such as a lysosome. In certain embodiments, a cleavable moiety is selectively cleaved by endogenous enzymes, such as nucleases.

[0367] In certain embodiments, a cleavable bond is selected from among: an amide, an ester, an ether, one or both esters of a phosphodiester, a phosphate ester, a carbamate, or a disulfide. In certain embodiments, a cleavable bond is one or both of the esters of a phosphodiester. In certain embodiments, a cleavable moiety comprises a phosphate or phosphodiester. In certain embodiments, the cleavable moiety is a phosphate linkage between an oligonucleotide and a conjugate moiety or conjugate group.

[0368] In certain embodiments, a cleavable moiety comprises or consists of one or more linker-nucleosides. In certain such embodiments, the one or more linker-nucleosides are linked to one another and/or to the remainder of the oligomeric compound through cleavable bonds. In certain embodiments, such cleavable bonds are unmodified phosphodiester bonds. In certain embodiments, a cleavable moiety is 2′-deoxynucleoside that is attached to either the 3′ or 5′-terminal nucleoside of an oligonucleotide by a phosphodiester internucleoside linkage and covalently attached to the remainder of the conjugate linker or conjugate moiety by a phosphodiester or phosphorothioate linkage. In certain such embodiments, the cleavable moiety is 2′-deoxyadenosine.

[0369] 3. Cell-Targeting Moieties

[0370] In certain embodiments, a conjugate group comprises a cell-targeting moiety. In certain embodiments, a conjugate group has the general formula:

##STR00011##

[0371] wherein n is from 1 to about 3, m is 0 when n is 1, m is 1 when n is 2 or greater, j is 1 or 0, and k is 1 or O.

[0372] In certain embodiments, n is 1, j is 1 and k is 0. In certain embodiments, n is 1, j is 0 and k is 1. In certain embodiments, n is 1, j is 1 and k is 1. In certain embodiments, n is 2, j is 1 and k is 0. In certain embodiments, n is 2, j is 0 and k is 1. In certain embodiments, n is 2, j is 1 and k is 1. In certain embodiments, n is 3, j is 1 and k is 0. In certain embodiments, n is 3, j is 0 and k is 1. In certain embodiments, n is 3, j is 1 and k is 1.

[0373] In certain embodiments, conjugate groups comprise cell-targeting moieties that have at least one tethered ligand. In certain embodiments, cell-targeting moieties comprise two tethered ligands covalently attached to a branching group. In certain embodiments, cell-targeting moieties comprise three tethered ligands covalently attached to a branching group.

[0374] In certain embodiments, each ligand of a cell-targeting moiety has an affinity for at least one type of receptor on a target cell. In certain embodiments, each ligand has an affinity for at least one type of receptor on the surface of a mammalian liver cell. In certain embodiments, each ligand has an affinity for the hepatic asialoglycoprotein receptor (ASGP-R). In certain embodiments, each ligand is a carbohydrate.

[0375] In certain embodiments, the cell-targeting moiety targets neurons. In certain embodiments, the cell-targeting moiety targets a neurotransmitter receptor. In certain embodiments, the cell targeting moiety targets a neurotransmitter transporter. In certain embodiments, the cell targeting moiety targets a GABA transporter. See e.g., WO 2011/131693, WO 2014/064257.

[0376] C. Certain Terminal Groups

[0377] In certain embodiments, oligomeric compounds comprise one or more terminal groups. In certain such embodiments, modified oligonucleotides comprise a phosphorus-containing group at the 5′-end of the modified oligonucleotide. In certain embodiments, the phosphorus-containing group is at the 5′-end of the antisense RNAi oligonucleotide and/or the sense RNAi oligonucleotide. In certain embodiments, the terminal group is a phosphate stabilized phosphate group. The 5′-end phosphorus-containing group can be 5′-end phosphate (5′-P), 5′-end phosphorothioate (5′-PS), 5′-end phosphorodithioate (5′-PS.sub.2), 5′-end vinylphosphonate (5′-VP), 5′-end methylphosphonate (MePhos) or 5′-deoxy-5′-C-malonyl. When the 5′-end phosphorus-containing group is 5′-end vinylphosphonate, the 5′VP can be either 5′-E-VP isomer (i.e., trans-vinylphosphonate), 5′-Z-VP isomer (i.e., cis-vinylphosphonate), or mixtures thereof. Although such phosphate group can be attached to any modified oligonucleotide, it has particularly been shown that attachment of such a group to an antisense RNAi oligonucleotide improves activity of certain RNAi agents. See, e.g., Prakash et al., Nucleic Acids Res., 43(6):2993-3011, 2015; Elkayam, et al., Nucleic Acids Res., 45(6):3528-3536, 2017; Parmar, et al. ChemBioChem, 17(11)985-989; 2016; Harastzi, et al., Nucleic Acids Res., 45(13):7581-7592, 2017. In certain embodiments, the phosphate stabilizing group is 5′-cyclopropyl phosphonate. See e.g., WO/2018/027106.

[0378] In certain embodiments, terminal groups comprise one or more abasic nucleosides and/or inverted nucleosides. In certain embodiments, terminal groups comprise one or more 2′-linked nucleosides. In certain such embodiments, the 2′-linked nucleoside is an abasic nucleoside.

[0379] D. Certain Specific RNAi Motifs

[0380] RNAi agents can be described by motif or by specific features.

[0381] In certain embodiments, the RNAi agents described herein comprise: [0382] (a) a sense RNAi oligonucleotide having: [0383] (i) a length of 21 nucleotides; [0384] (ii) a conjugate attached to the 3′-end; and [0385] (iii) 2′-F modifications at positions 1, 3, 5, 7, 9 to 11, 13, 17, 19, and 21, and 2′-OMe modifications at positions 2, 4, 6, 8, 12, 14 to 16, 18, and 20 (counting from the 5′ end); [0386] and [0387] (b) an antisense RNAi oligonucleotide having: [0388] (i) a length of 23 nucleotides; [0389] (ii) 2′-OMe modifications at positions 1, 3, 5, 9, 11 to 13, 15, 17, 19, 21, and 23, and 2′F modifications at positions 2, 4, 6 to 8, 10, 14, 16, 18, 20, and 22 (counting from the 5′ end); and [0390] (iii) phosphorothioate internucleoside linkages between nucleoside positions 21 and 22, and between nucleoside positions 22 and 23 (counting from the 5′ end); [0391] wherein the two nucleotides at the 3′end of the antisense RNAi oligonucleotide are overhanging nucleosides, and the end of the RNAi agent duplex constituting the 5′-end of the antisense RNAi oligonucleotide and the 3′-end of the sense RNAi oligonucleotide is blunt (i.e., neither oligonucleotide has overhang nucleoside at that end and instead the hybridizing region of the sense RNAi oligonucleotide includes the 3′-most nucleoside of the sense RNAi oligonucleotide and that nucleoside hybridizes with the 5′-most nucleoside of the antisense oligonucleotide).

[0392] In certain embodiments, the RNAi agents described herein comprise: [0393] (a) a sense RNAi oligonucleotide having: [0394] (i) a length of 21 nucleotides; [0395] (ii) a conjugate attached to the 3′-end; [0396] (iii) 2′-F modifications at positions 1, 3, 5, 7, 9 to 11, 13, 17, 19, and 21, and 2′-OMe modifications at positions 2, 4, 6, 8, 12, 14, 16, 18, and 20 (counting from the 5′ end); and [0397] (iv) phosphorothioate internucleoside linkages between nucleoside positions 1 and 2, and between nucleoside positions 2 and 3 (counting from the 5′ end); [0398] and [0399] (b) an antisense RNAi oligonucleotide having: [0400] (i) a length of 23 nucleotides; [0401] (ii) 2′-OMe modifications at positions 1, 3, 5, 7, 9, 11 to 13, 15, 17, 19, and 21 to 23, and 2′F modifications at positions 2, 4, 6, 8, 10, 14, 16, 18, and 20 (counting from the 5′ end); and [0402] (iii) phosphorothioate internucleoside linkages between nucleoside positions 1 and 2, between nucleoside positions 2 and 3, between nucleoside positions 21 and 22, and between nucleoside positions 22 and 23 (counting from the 5′ end); [0403] wherein the RNAi duplex includes a two nucleotide overhang at the 3′end of the antisense RNAi oligonucleotide, and a blunt end at the 5′-end of the antisense RNAi oligonucleotide.

[0404] In certain embodiments, the RNAi agents described herein comprise: [0405] (a) a sense RNAi oligonucleotide having: [0406] (i) a length of 21 nucleotides; [0407] (ii) a conjugate attached to the 3′-end; [0408] (iii) 2′-OMe modifications at positions 1 to 6, 8, 10, and 12 to 21, and 2′-F modifications at positions 7 and 9, and a deoxynucleotide at position 11 (counting from the 5′ end); and [0409] (iv) phosphorothioate internucleoside linkages between nucleoside positions 1 and 2, and between nucleoside positions 2 and 3 (counting from the 5′ end); [0410] and [0411] (b) an antisense RNAi oligonucleotide having: [0412] (i) a length of 23 nucleotides; [0413] (ii) 2′-OMe modifications at positions 1, 3, 7, 9, 11, 13, 15, 17, and 19 to 23, and 2′F modifications at positions 2, 4 to 6, 8, 10, 12, 14, 16, and 18 (counting from the 5′ end); and [0414] (iii) phosphorothioate internucleoside linkages between nucleoside positions 1 and 2, between nucleoside positions 2 and 3, between nucleoside positions 21 and 22, and between nucleoside positions 22 and 23 (counting from the 5′ end); [0415] wherein the RNAi duplex has a two nucleotide overhang at the 3′end of the antisense RNAi oligonucleotide, and a blunt end at the 5′-end of the antisense RNAi oligonucleotide.

[0416] In certain embodiments, the RNAi agents described herein comprise: [0417] (a) a sense RNAi oligonucleotide having: [0418] (i) a length of 21 nucleotides; [0419] (ii) a conjugate attached to the 3′-end; [0420] (iii) 2′-OMe modifications at positions 1 to 6, 8, and 12 to 21, and 2′-F modifications at positions 7, and 9 to 11; and [0421] (iv) phosphorothioate internucleoside linkages between nucleoside positions 1 and 2, and between nucleoside positions 2 and 3 (counting from the 5′ end); [0422] and [0423] (b) an antisense RNAi oligonucleotide having: [0424] (i) a length of 23 nucleotides; [0425] (ii) 2′-OMe modifications at positions 1, 3 to 5, 7, 8, 10 to 13, 15, and 17 to 23, and 2′F modifications at positions 2, 6, 9, 14, and 16 (counting from the 5′ end); and [0426] (iii) phosphorothioate internucleoside linkages between nucleoside positions 1 and 2, between nucleoside positions 2 and 3, between nucleoside positions 21 and 22, and between nucleoside positions 22 and 23 (counting from the 5′ end); [0427] wherein the RNAi duplex has a two nucleotide overhang at the 3′end of the antisense RNAi oligonucleotide, and a blunt end at the 5′-end of the antisense RNAi oligonucleotide.

[0428] In certain embodiments, the RNAi agents described herein comprise: [0429] (a) a sense RNAi oligonucleotide having: [0430] (i) a length of 21 nucleotides; [0431] (ii) a conjugate attached to the 3′-end; [0432] (iii) 2′-OMe modifications at positions 1 to 6, 8, and 12 to 21, and 2′-F modifications at positions 7, and 9 to 11; and [0433] (iv) phosphorothioate internucleoside linkages between nucleoside positions 1 and 2, and between nucleoside positions 2 and 3 (counting from the 5′ end); [0434] and [0435] (b) an antisense RNAi oligonucleotide having: [0436] (i) a length of 23 nucleotides; [0437] (ii) 2′-OMe modifications at positions 1, 3 to 5, 7, 10 to 13, 15, and 17 to 23, and 2′F modifications at positions 2, 6, 8, 9, 14, and 16 (counting from the 5′ end); and [0438] (iii) phosphorothioate internucleoside linkages between nucleoside positions 1 and 2, between nucleoside positions 2 and 3, between nucleoside positions 21 and 22, and between nucleoside positions 22 and 23 (counting from the 5′ end); [0439] wherein the RNAi duplex has a two nucleotide overhang at the 3′end of the antisense RNAi oligonucleotide, and a blunt end at the 5′-end of the antisense RNAi oligonucleotide.

[0440] In certain embodiments, the RNAi agents described herein comprise: [0441] (a) a sense RNAi oligonucleotide having: [0442] (i) a length of 19 nucleotides; [0443] (ii) a conjugate attached to the 3′-end; [0444] (iii) 2′-OMe modifications at positions 1 to 4, 6, and 10 to 19, and 2′-F modifications at positions 5, and 7 to 9; and [0445] (iv) phosphorothioate internucleoside linkages between nucleoside positions 1 and 2, and between nucleoside positions 2 and 3 (counting from the 5′ end); [0446] and [0447] (b) an antisense RNAi oligonucleotide having: [0448] (i) a length of 21 nucleotides; [0449] (ii) 2′-OMe modifications at positions 1, 3 to 5, 7, 10 to 13, 15, and 17 to 21, and 2′F modifications at positions 2, 6, 8, 9, 14, and 16 (counting from the 5′ end); and [0450] (iii) phosphorothioate internucleoside linkages between nucleoside positions 1 and 2, between nucleoside positions 2 and 3, between nucleoside positions 19 and 20, and between nucleoside positions 20 and 21 (counting from the 5′ end); [0451] wherein the RNAi duplex has a two nucleotide overhang at the 3′end of the antisense RNAi oligonucleotide, and a blunt end at the 5′-end of the antisense RNAi oligonucleotide.

[0452] In certain embodiments, the RNAi agents described herein comprise: [0453] (a) a sense RNAi oligonucleotide having: [0454] (i) a length of 21 nucleotides; [0455] (ii) a conjugate attached at position 6 (counting from the 5′ end); [0456] (iii) 2′-F modifications at positions 7 and 9 to 11, and 2′-OMe modifications at positions 1 to 5, 8, and 12 to 21 (counting from the 5′ end); and [0457] (iv) phosphorothioate internucleoside linkages between nucleoside positions 1 and 2, between nucleoside positions 2 and 3, between nucleoside positions 19 and 20, and between nucleoside positions 20 and 21 (counting from the 5′ end); [0458] and [0459] (b) an antisense RNAi oligonucleotide having: [0460] (i) a length of 23 nucleotides; [0461] (ii) 2′-OMe modifications at positions 1, 3 to 5, 7, 10 to 13, 15, and 17 to 23, and 2′F modifications at positions 2, 6, 8, 9, 14, and 16 (counting from the 5′ end); [0462] (iii) phosphorothioate internucleoside linkages between nucleoside positions 1 and 2, between nucleoside positions 2 and 3, between nucleoside positions 21 and 22, and between nucleoside positions 22 and 23 (counting from the 5′ end); and [0463] (iv) a stabilized phosphate group attached to the 5′ position of the 5′-most nucleoside; [0464] wherein the RNAi duplex includes a two nucleotide overhang at the 3′end of the antisense RNAi oligonucleotide, and a blunt end at the 5′-end of the antisense RNAi oligonucleotide.

[0465] In certain embodiments, the RNAi agents described herein comprise: [0466] (a) a sense RNAi oligonucleotide having: [0467] (i) a length of 21 nucleotides; [0468] (ii) a conjugate attached to the 3′-end; [0469] (iii) 2′-F modifications at positions 7 and 9 to 11, and 2′-OMe modifications at positions 1 to 6, 8, and 12 to 21 (counting from the 5′ end); [0470] (iv) phosphorothioate internucleoside linkages between nucleoside positions 1 and 2 and between nucleoside positions 2 and 3 (counting from the 5′ end); [0471] and [0472] (b) an antisense RNAi oligonucleotide having: [0473] (i) a length of 23 nucleotides; [0474] (ii) 2′-OMe modifications at positions 1, 3 to 5, 7 to 13, 15, and 17 to 23 an (S)-GNA modification at position 6, and 2′F modifications at positions 2, 14, and 16 (counting from the 5′ end); and [0475] (iii) phosphorothioate internucleoside linkages between nucleoside positions 1 and 2, between nucleoside positions 2 and 3, between nucleoside positions 21 and 22, and between nucleoside positions 22 and 23 (counting from the 5′ end); [0476] wherein the RNAi duplex includes a two nucleotide overhang at the 3′end of the antisense RNAi oligonucleotide, and a blunt end at the 5′-end of the antisense RNAi oligonucleotide.

[0477] In certain embodiments, the RNAi agents described herein comprise: [0478] (a) a sense RNAi oligonucleotide having: [0479] (i) a length of 21 nucleotides; [0480] (ii) a conjugate attached to the 3′-end; [0481] (iii) 2′-F modifications at positions 7 and 9 to 11, and 2′-OMe modifications at positions 1 to 6, 8, and 12 to 21 (counting from the 5′ end); [0482] (iv) phosphorothioate internucleoside linkages between nucleoside positions 1 and 2 and between nucleoside positions 2 and 3 (counting from the 5′ end); [0483] and [0484] (b) an antisense RNAi oligonucleotide having: [0485] (i) a length of 23 nucleotides; [0486] (ii) 2′-OMe modifications at positions 1, 3 to 6, 8 to 13, 15, and 17 to 23 an (S)-GNA modification at position 7, and 2′F modifications at positions 2, 14, and 16 (counting from the 5′ end); and [0487] (iii) phosphorothioate internucleoside linkages between nucleoside positions 1 and 2, between nucleoside positions 2 and 3, between nucleoside positions 21 and 22, and between nucleoside positions 22 and 23 (counting from the 5′ end); [0488] wherein the RNAi duplex includes a two nucleotide overhang at the 3′end of the antisense RNAi oligonucleotide, and a blunt end at the 5′-end of the antisense RNAi oligonucleotide.

[0489] In certain embodiments, the RNAi agents described herein comprise: [0490] (a) a sense RNAi oligonucleotide having: [0491] (i) a length of 21 nucleotides; [0492] (ii) a conjugate attached at position 6 (counting from the 5′ end); and [0493] (iii) 2′-F modifications at positions 7 and 9 to 11, and 2′-OMe modifications at positions 1 to 5, 8, and 12 to 21 (counting from the 5′ end); [0494] (iv) phosphorothioate internucleoside linkages between nucleoside positions 1 and 2, between nucleoside positions 2 and 3, between nucleoside positions 19 and 20, and between nucleoside positions 20 and 21 (counting from the 5′ end); [0495] and [0496] (b) an antisense RNAi oligonucleotide having: [0497] (i) a length of 23 nucleotides; [0498] (ii) 2′-OMe modifications at positions 1, 3 to 5, 7 to 13, 15, and 17 to 23 an (S)-GNA modification at position 6, and 2′F modifications at positions 2, 14, and 16 (counting from the 5′ end); [0499] (iii) phosphorothioate internucleoside linkages between nucleoside positions 1 and 2, between nucleoside positions 2 and 3, between nucleoside positions 21 and 22, and between nucleoside positions 22 and 23 (counting from the 5′ end); and [0500] (iv) a stabilized phosphate group attached to the 5′ position of the 5′-most nucleoside; [0501] wherein the RNAi duplex includes a two nucleotide overhang at the 3′end of the antisense RNAi oligonucleotide, and a blunt end at the 5′-end of the antisense RNAi oligonucleotide.

[0502] In certain embodiments, the RNAi agents described herein comprise: [0503] (a) a sense RNAi oligonucleotide having: [0504] (i) a length of 21 nucleotides; [0505] (ii) a conjugate attached at position 6 (counting from the 5′ end); [0506] (iii) 2′-F modifications at positions 7 and 9 to 11, and 2′-OMe modifications at positions 1 to 5, 8, and 12 to 21 (counting from the 5′ end); and [0507] (iv) phosphorothioate internucleoside linkages between nucleoside positions 1 and 2, between nucleoside positions 2 and 3, between nucleoside positions 19 and 20, and between nucleoside positions 20 and 21 (counting from the 5′ end); [0508] and [0509] (b) an antisense RNAi oligonucleotide having: [0510] (i) a length of 23 nucleotides; [0511] (ii) 2′-OMe modifications at positions 1, 3 to 6, 8 to 13, 15, and 17 to 23 an (S)-GNA modification at position 7, and 2′F modifications at positions 2, 14, and 16 (counting from the 5′ end); [0512] (iii) phosphorothioate internucleoside linkages between nucleoside positions 1 and 2, between nucleoside positions 2 and 3, between nucleoside positions 21 and 22, and between nucleoside positions 22 and 23 (counting from the 5′ end); and [0513] (iv) a stabilized phosphate group attached to the 5′ position of the 5′-most nucleoside; [0514] wherein the two nucleotides at the 3′end of the antisense RNAi oligonucleotide are overhanging nucleosides, and the end of the RNAi agent duplex constituting the 5′-end of the antisense RNAi oligonucleotide and the 3′-end of the sense RNAi oligonucleotide is blunt (i.e., neither oligonucleotide has overhang nucleoside at that end and instead the hybridizing region of the sense RNAi oligonucleotide includes the 3′-most nucleoside of the sense RNAi oligonucleotide and that nucleoside hybridizes with the 5′-most nucleoside of the antisense oligonucleotide).

[0515] In certain embodiments, the RNAi agents described herein comprise: [0516] (a) a sense RNAi oligonucleotide having: [0517] (i) a length of 21 nucleotides; [0518] (ii) a conjugate attached to the 5′-end; [0519] (iii) 2′-OMe modifications at positions 1 to 8, and 12 to 21, and 2′-F modifications at positions 9 to 11; and [0520] (iv) inverted abasic sugar moieties attached to both the 5′-most and 3′-most nucleosides; [0521] and [0522] (b) an antisense RNAi oligonucleotide having: [0523] (i) a length of 21 nucleotides; [0524] (ii) 2′-OMe modifications at positions 1, 3, 5, 7, 9, 11, 13, 15, 17, 19, and 21, and 2′F modifications at positions 2, 4, 6, 8, 10, 12, 14, 16, 18, and 20 (counting from the 5′ end); and [0525] (iii) phosphorothioate internucleoside linkages between nucleoside positions 1 and 2, between nucleoside positions 2 and 3, between nucleoside positions 3 and 4, and between nucleoside positions 20 and 21 (counting from the 5′ end).

[0526] In certain embodiments, the RNAi agents described herein comprise: [0527] (a) a sense RNAi oligonucleotide having: [0528] (i) a length of 21 nucleotides; [0529] (ii) a conjugate attached to the 5′-end; [0530] (iii) 2′-OMe modifications at positions 1 to 8, and 12 to 21, and 2′-F modifications at positions 9 to 11; [0531] (iv) a phosphorothioate internucleoside linkage between nucleoside positions 1 and 2 (counting from the 5′ end); and [0532] (v) an inverted abasic sugar moiety attached to the 3′-most nucleoside; [0533] and [0534] (b) an antisense RNAi oligonucleotide having: [0535] (i) a length of 21 nucleotides; [0536] (ii) 2′-OMe modifications at positions 1, 3, 5, 7, 9, 11, 13, 15, 17, 19, and 21, and 2′F modifications at positions 2, 4, 6, 8, 10, 12, 14, 16, 18, and 20 (counting from the 5′ end); and [0537] (iii) phosphorothioate internucleoside linkages between nucleoside positions 1 and 2, between nucleoside positions 2 and 3, between nucleoside positions 3 and 4, and between nucleoside positions 20 and 21 (counting from the 5′ end).

[0538] In certain embodiments, the RNAi agents described herein comprise: [0539] (a) a sense RNAi oligonucleotide having: [0540] (i) a length of 19 nucleotides; [0541] (ii) a conjugate attached to the 5′-end; [0542] (iii) 2′-OMe modifications at positions 2, 4, 6, 8, 10, 12, 14, 16, 18, and 20, and 2′-F modifications at positions 1, 3, 5, 7, 9, 11, 13, 15, 17, 19, and 21; and [0543] (iv) phosphorothioate internucleoside linkages between nucleoside positions 17 and 18, and between nucleoside positions 18 and 19 (counting from the 5′ end); [0544] and [0545] (b) an antisense RNAi oligonucleotide having: [0546] (i) a length of 19 nucleotides; [0547] (ii) 2′-OMe modifications at positions 1, 3, 5, 7, 9, 11, 13, 15, 17, 19, and 21, and 2′F modifications at positions 2, 4, 6, 8, 10, 12, 14, 16, 18, and 20 (counting from the 5′ end); and [0548] (iii) phosphorothioate internucleoside linkages between nucleoside positions 1 and 2, between nucleoside positions 2 and 3, between nucleoside positions 17 and 18, and between nucleoside positions 18 and 19 (counting from the 5′ end).

[0549] In any of the above embodiments, the conjugate at the 3′-end of the sense RNAi oligonucleotide may comprise a targeting moiety. In certain embodiments, the targeting moiety targets a neurotransmitter receptor. In certain embodiments, the cell targeting moiety targets a neurotransmitter transporter. In certain embodiments, the cell targeting moiety targets a GABA transporter. See e.g., WO 2011/131693, WO 2014/064257.

[0550] In certain embodiments, the RNAi agent comprises a 21 nucleotide sense RNAi oligonucleotide and a 23 nucleotide antisense RNAi oligonucleotide, wherein the sense RNAi oligonucleotide contains at least one motif of three contiguous 2′-F modified nucleosides at positions 9, 10, 11 from the 5′-end; the antisense RNAi oligonucleotide contains at least one motif of three 2′-O-methyl modifications on three consecutive nucleotides at positions 11, 12, 13 from the 5′ end, wherein one end of the RNAi agent is blunt, while the other end comprises a 2 nucleotide overhang. Preferably, the 2 nucleotide overhang is at the 3′-end of the antisense RNAi oligonucleotide.

[0551] In certain embodiments, when the 2 nucleotide overhang is at the 3′-end of the antisense RNAi oligonucleotide, there may be two phosphorothioate internucleoside linkages between the terminal three nucleotides, wherein two of the three nucleotides are the overhang nucleotides, and the third nucleotide is a paired nucleotide next to the overhang nucleotide. In certain embodiments, the RNAi agent additionally has two phosphorothioate internucleoside linkages between the terminal three nucleotides at both the 5′-end of the sense RNAi oligonucleotide and at the 5′-end of the antisense RNAi oligonucleotide. In certain embodiments, every nucleotide in the sense RNAi oligonucleotide and the antisense RNAi oligonucleotide of the RNAi agent is a modified nucleotide. In certain embodiments, each nucleotide is independently modified with a 2′-O-methyl or 3′-fluoro, e.g. in an alternating motif. Optionally, the RNAi agent comprises a conjugate.

[0552] In certain embodiments, every nucleotide in the sense RNAi oligonucleotide and antisense RNAi oligonucleotide of the RNAi agent, including the nucleotides that are part of the motifs, may be modified. Each nucleotide may be modified with the same or different modification, which can include one or more alteration of one or both of the non-linking phosphate oxygens; alteration of a constituent of the ribose sugar, e.g., of the 2′ hydroxyl on the ribose sugar; wholesale replacement of the phosphate moiety with “dephospho” linkers; modification or replacement of a naturally occurring base; and replacement or modification of the ribose-phosphate backbone.

[0553] In certain embodiments, each nucleoside of the sense RNAi oligonucleotide and antisense RNAi oligonucleotide is independently modified with LNA, cEt, UNA, HNA, CeNA, 2′-MOE, 2′-OMe, 2′-O-allyl, 2′-C-allyl, 2′-deoxy, 2′-hydroxyl, or 2′-fluoro. The RNAi agent can contain more than one modification. In certain embodiments, each nucleoside of the sense RNAi oligonucleotide and antisense RNAi oligonucleotide is independently modified with 2′-O-methyl or 2′-F. In certain embodiments, the modification is a 2′-NMA modification.

[0554] The term “alternating motif” as used herein refers to a motif having one or more modifications, each modification occurring on alternating nucleotides of one RNAi oligonucleotide. The alternating nucleotide may refer to one per every other nucleotide or one per every three nucleotides, or a similar pattern. For example, if A, B and C each represent one type of modification to the nucleotide, the alternating motif can be “ABABABABABAB . . . ,” “AABBAABBAABB . . . ,” “AABAABAABAAB . . . ,” “AAABAAABAAAB . . . ,” “AAABBBAAABBB . . . ,” or “ABCABCABCABC . . . ,” etc.

[0555] The type of modifications contained in the alternating motif may be the same or different. For example, if A, B, C, D each represent one type of modification on the nucleotide, the alternating pattern, i.e., modifications on every other nucleotide, may be the same, but each of the sense RNAi oligonucleotide or antisense RNAi oligonucleotide can be selected from several possibilities of modifications within the alternating motif such as “ABABAB . . . ”, “ACACAC . . . ” “BDBDBD . . . ” or “CDCDCD . . . ,” etc.

[0556] In certain embodiments, the modification pattern for the alternating motif on the sense RNAi oligonucleotide relative to the modification pattern for the alternating motif on the antisense RNAi oligonucleotide is shifted. The shift may be such that the group of modified nucleotides of the sense RNAi oligonucleotide corresponds to a group of differently modified nucleotides of the antisense RNAi oligonucleotide and vice versa. For example, the sense RNAi oligonucleotide when paired with the antisense RNAi oligonucleotide in the RNAi duplex, the alternating motif in the sense RNAi oligonucleotide may start with “ABABAB” from 5′-3′ of the RNAi oligonucleotide and the alternating motif in the antisense RNAi oligonucleotide may start with “BABABA” from 5′-3 ‘of the RNAi oligonucleotide within the duplex region. As another example, the alternating motif in the sense RNAi oligonucleotide may start with “AABBAABB” from 5’-3′ of the RNAi oligonucleotide and the alternating motif in the antisense RNAi oligonucleotide may start with “BBAABBAA” from 5′-3′ of the RNAi oligonucleotide within the duplex region, so that there is a complete or partial shift of the modification 10 patterns between the sense RNAi oligonucleotide and the antisense RNAi oligonucleotide.

[0557] In certain embodiments, the RNAi agent comprising the pattern of the alternating motif of 2′-O-methyl modification and 2′-F modification on the sense RNAi oligonucleotide initially has a shift relative to the pattern of the alternating motif of 2′-O-methyl modification and 2′-F modification on the antisense RNAi oligonucleotide initially, i.e., the 2′-O-methyl modified nucleotide on the sense RNAi oligonucleotide base pairs with a 2′-F modified nucleotides on the antisense RNAi oligonucleotide and vice versa. The 1 position of the sense RNAi oligonucleotide may start with the 2′-F modification, and the 1 position of the antisense RNAi oligonucleotide may start with a 2′-O-methyl modification.

[0558] The introduction of one or more motifs of three identical modifications on three consecutive nucleotides to the sense RNAi oligonucleotide and/or antisense RNAi oligonucleotide interrupts the initial modification pattern present in the sense RNAi oligonucleotide and/or antisense RNAi oligonucleotide. This interruption of the modification pattern of the sense and/or antisense RNAi oligonucleotide by introducing one or more motifs of three identical modifications on three consecutive nucleotides to the sense and/or antisense RNAi oligonucleotide surprisingly enhances the gene silencing activity to the target gene. In one embodiment, when the motif of three identical modifications on three consecutive 25 nucleotides is introduced to any of the RNAi oligonucleotide s, the modification of the nucleotide next to the motif is a different modification than the modification of the motif. For example, the portion of the sequence containing the motif is “ . . . NaYYYNb . . . ,” where “Y” represents the modification of the motif of three identical modifications on three consecutive nucleotide, and “Na” and “Nb” represent a modification to the nucleotide next to the motif “YYY” that is different than the modification of Y, and where Na and Nb can be the same or different modifications. Alternatively, Na and/or Nb may be present or absent when there is a wing modification present.

[0559] In certain embodiments, the sense RNAi oligonucleotide may be represented by formula (I):

5′n.sub.p-N.sub.a—(XXX)i-N.sub.b—YYY—N.sub.b—(ZZZ).sub.rN.sub.a-n.sub.q3′  (I) [0560] wherein: [0561] i and j are each independently 0 or 1; [0562] p and q are each independently 0-6; [0563] each N.sub.a independently represents 0-25 linked nucleosides comprising at least two differently modified nucleosides; [0564] each N.sub.b independently represents 0-10 linked nucleosides; [0565] each n.sub.p and n.sub.q independently represent an overhanging nucleoside; [0566] wherein N.sub.b and Y do not have the same modification; and [0567] XXX, YYY, and ZZZ each independently represent modified nucleosides where each X nucleoside has the same modification; each Y nucleoside has the same modification; and each Z nucleoside has the same modification. In certain embodiments, each Y comprises a 2′-F modification.

[0568] In certain embodiments, the N.sub.a and N.sub.b comprise modifications of alternating patterns.

[0569] In certain embodiments, the YYY motif occurs at or near the cleavage site of the target nucleic acid. For example, when the RNAi agent has a duplex region of 17-23 nucleotides in length, the YYY motif can occur at or near the vicinity of the cleavage site (e.g., can occur at positions 6, 7, 8; 7, 8, 9; 8, 9, 10; 9, 10, 11; 10, 11, 12; or 11, 12, 13) of the sense RNAi oligonucleotide, the count starting from the 1.sup.st nucleotide from the 5′-end; or optionally, the count starting at the 1.sup.st paired nucleotide within the duplex region, from the 5′-end.

[0570] In certain embodiments, the antisense RNAi oligonucleotide of the RNAi may be represented by the formula:

5′n.sub.q-N.sub.a′—(Z′Z′Z′).sub.k—N.sub.b′—Y′Y′Y′—N.sub.b′—(X′X′X′).sub.l—N′.sub.a-n.sub.p3′  (II) [0571] wherein: [0572] k and l are each independently 0 or 1; [0573] p′ and q′ are each independently 0-6; [0574] each N.sub.a′ independently represents 0-25 linked nucleotides comprising at least two differently modified nucleotides; [0575] each N.sub.b′ independently represents 0-10 linked nucleotides; [0576] each n.sub.p′ and n.sub.q′ independently represent an overhanging nucleoside; [0577] wherein N.sub.b′ and Y′ do not have the same modification; and [0578] X′X′X′, Y′Y′Y′, and Z′Z′Z′ each independently represent modified nucleosides where each X′ nucleoside has the same modification; each Y′ nucleoside has the same modification; and each Z′ nucleoside has the same modification. In certain embodiments, each Y′ comprises a 2′-F modification. In certain embodiments, each Y′ comprises a 2′-OMe modification.

[0579] In certain embodiments, the N.sub.a′ and/or N.sub.b′ comprise modifications of alternating patterns.

[0580] In certain embodiments, the Y′Y′Y′ motif occurs at or near the cleavage site of the target nucleic acid. For example, when the RNAi agent has a duplex region of 17-23 nucleotides in length, the Y′Y′Y′ motif can occur at positions 9, 10, 11; 10, 11, 12; 11, 12, 13; 12, 13, 14; or 13, 14, 15 of the antisense RNAi oligonucleotide, with the count starting from the 1.sup.st nucleotide from the 5′-end; or, optionally, the count starting at the 1.sup.st paired nucleotide within the duplex region, from the 5′-end. Preferably, the Y′Y′Y′ motif occurs at positions 11, 12, 13.

[0581] In certain embodiments, k is 1 and l is 0, or k is 0 and l is 1, or both k and l are 1.

[0582] The antisense RNAi oligonucleotide can therefore be represented by the following formulas:

5′n.sub.q′—N.sub.a′—Z′Z′Z′—N.sub.b′—Y′Y′Y′—N.sub.a′-n.sub.p′3′  (IIb);

5′n.sub.q′—N.sub.a′—Y′Y′Y′—N.sub.b′—X′X′X′-n.sub.p′3′  (IIc); or

5′n.sub.q′—N.sub.a′—Z′Z′Z′—N.sub.b′—Y′Y′Y′—N.sub.b′—X′X′X′—N.sub.a′-n.sub.p′3′  (IId).

[0583] When the antisense RNAi oligonucleotide is represented by formula IIb, N.sub.b′ represents 0-10, 0-7, 0-5, 0-4, 0-2, or 0 linked nucleosides. Each N.sub.a′ independently represents 2-20, 2-15, or 2-10 linked nucleosides.

[0584] When the antisense RNAi oligonucleotide is represented by formula IIc, N.sub.b′ represents 0-10, 0-7, 0-5, 0-4, 0-2, or 0 linked nucleosides. Each N.sub.a′ independently represents 2-20, 2-15, or 2-10 linked nucleosides.

[0585] When the antisense RNAi oligonucleotide is represented by formula IId, N.sub.b′ represents 0-10, 0-7, 0-5, 0-4, 0-2, or 0 linked nucleosides. Each N.sub.a′ independently represents 2-20, 2-15, or 2-10 linked nucleosides. Preferably, N.sub.b′ is 0, 1, 2, 3, 4, 5, or 6.

[0586] In certain embodiments, k is 0 and 1 is 0 and the antisense RNAi oligonucleotide may be represented by the formula:

5′n.sub.p′—N.sub.a′—Y′Y′Y′—N.sub.a′-n.sub.q′3′  (Ia).

[0587] When the antisense RNAi oligonucleotide is represented by formula IIa, each N.sub.a′ independently represents 2-20, 2-15, or 2-10 linked nucleosides.

[0588] Each X′, Y′, and Z′ may be the same or different from each other.

[0589] Each nucleotide of the sense RNAi oligonucleotide and antisense RNAi oligonucleotide may be independently modified with LNA, UNA, cEt, HNA, CeNA, 2′-methoxyethyl, 2′-O-allyl, 2′-C-allyl, 2′-hydroxyl, or 2′-fluoro. For example, each nucleotide of the sense RNAi oligonucleotide and antisense RNAi oligonucleotide is independently modified with, 2′-O-methyl or 2′-fluoro. Each X, Y, Z, X′, Y′, and Z′, in particular, may represent a 2′-O-methyl modification or 2′-fluoro modification. In certain embodiments, the modification is a 2′-NMA modification.

[0590] In certain embodiments, the sense RNAi oligonucleotide of the RNAi agent may contain YYY motif occurring at 9, 10, and 11 positions of the RNAi oligonucleotide when the duplex region is 21 nucleotides, the count starting from the 1.sup.st nucleotide from the 5′-end, or optionally, the count starting at the 1.sup.st paired nucleotide within the duplex region, from the 5′-end; and Y represents 2′-F modification. The sense RNAi oligonucleotide may additionally contain XXX motif or ZZZ motifs as wing modifications at the opposite end of the duplex region; and XXX and ZZZ each independently represents a 2′-O-methyl modification or 2′-fluoro modification.

[0591] In certain embodiments, the antisense RNAi oligonucleotide may contain Y′Y′Y′ motif occurring at positions 11, 12, 13 of the RNAi oligonucleotide, the count starting from the 1.sup.st nucleotide from the 5′-end, or optionally, the count starting at the 1.sup.st paired nucleotide within the duplex region, from the 5′-end; and Y′ represents 2′-O-methyl modification. The antisense RNAi oligonucleotide may additionally contain X′X′X′ motif or Z′Z′Z′ motif as wing modifications at the opposite end of the duplex region; and X′X′X′ or Z′Z′Z′ each independently represents a 2′-O-methyl modification or 2′-fluoro modification.

[0592] The sense RNAi oligonucleotide represented by any one of the above formulas Ia, Ib, Ic, and Id forms a duplex with an antisense RNAi oligonucleotide being represented by any one of the formulas IIa, IIb, IIc, and Hd, respectively.

[0593] Accordingly, the RNAi agents described herein may comprise a sense RNAi oligonucleotide and an antisense RNAi oligonucleotide, each RNAi oligonucleotide having 14 to 30 nucleotides, the RNAi duplex represented by formula (III):

Sense: 5′n.sub.p-N.sub.a—(XXX).sub.i—N.sub.b—YYY—N.sub.b—(ZZZ).sub.j—N.sub.a-n.sub.q3′

Antisense: 3′n.sub.p′—N.sub.a′—(X′X′X′).sub.k—N.sub.b′—Y′Y′Y′—N.sub.b′—(Z′Z′Z′).sub.i—N.sub.a′-n.sub.q′5′ [0594] wherein: [0595] j, k, and l are each independently 0 or 1; [0596] p, p′, q, and q′ are each independently 0-6; [0597] each N.sub.a and N.sub.a′ independently represents 0-25 linked nucleosides, each sequence comprising at least two differently modified nucleotides; [0598] each N.sub.b and N.sub.b′ independently represents 0-10 linked nucleosides; [0599] wherein each n.sub.p′, n.sub.p, n.sub.q′ and n.sub.q, each of which may or may not be present, independently represents an overhang nucleotide; and [0600] XXX, YYY, X′X′X′, Y′Y′Y′, and Z′Z′Z′ each independently represent one motif of three identical modifications on three consecutive nucleotides.

[0601] In certain embodiments, i is 0 and j is 0; or i is 1 and j is 0; ori is 0 and j is 1; or both i and j are 0; or both i and j are 1. In another embodiment, k is 0 and l is 0; or k is 1 and l is 0, or k is 0 and l is 1; or both k and l are 0; or both k and l are 1.

[0602] Exemplary combinations of the sense RNAi oligonucleotide and antisense RNAi oligonucleotide forming a RNAi duplex include the formulas below:

5′n.sub.p-N.sub.a—YYY—N.sub.a-n.sub.q3′

3′np′—N.sub.a′—Y′Y′Y′—N.sub.a′n.sub.q′5′   (IIIa)

5′n.sub.p-N.sub.a—YYY—N.sub.b—ZZZ—N.sub.a-n.sub.q3′

3′n.sub.p′-N.sub.a′—Y′Y′Y′—N.sub.b′—Z′Z′Z′—N.sub.a′n.sub.q′5′   (IIIb)

5′n.sub.p-N.sub.a—XXX—N.sub.b—YYY—N.sub.a-n.sub.q3′

3′n.sub.p′—N.sub.a′—X′X′X′—N.sub.b′—Y′Y′Y′—N.sub.a′-n.sub.q′5′   (IIIc)

5′n.sub.p-N.sub.a—XXX—N.sub.b—YYY—N.sub.b—ZZZ—N.sub.a-n.sub.q3′

3′n.sub.p′—N.sub.a—X′X′X′—N.sub.b′—Y′Y′Y′—N.sub.b′—Z′Z′Z′—N.sub.a-n.sub.q′5′   (IIId)

[0603] When the RNAi agent is represented with formula IIIa, each N.sub.a independently represents 2-20, 2-15, or 2-10 linked nucleosides.

[0604] When the RNAi agent is represented with formula IIIb, each N.sub.b independently represents 1-10, 1-7, 1-5, or 1-4 linked nucleosides. Each N.sub.a independently represents 2-20, 2-15, or 2-10 linked nucleosides.

[0605] When the RNAi agent is represented with formula IIIc, each N.sub.b, N.sub.b′ independently represents 0-10, 0-7, 0-10, 0-7, 0-5, 0-4, 0-2, or 0 linked nucleosides. Each N.sub.a independently represents 2-20, 2-15, or 2-10 linked nucleosides.

[0606] When the RNAi agent is represented with formula IIId, each N.sub.b, N.sub.b′ independently represents 0-10, 0-7, 0-10, 0-7, 0-5, 0-4, 0-2, or 0 linked nucleosides. Each N.sub.a, N.sub.a′ independently 2-20, 2-15, or 2-10 linked nucleosides. Each N.sub.a, N.sub.a′, N.sub.b, N.sub.b′ independently comprises modifications of alternating pattern.

[0607] Each of X, Y, and Z in formulas III, IIIa, IIIb, IIIc, and IIId may be the same or different from each other.

[0608] When the RNAi agent is represented by formula III, IIIa, IIIb, IIIc, and/or IIId, at least one of the Y nucleotides may form a base pair with one of the Y′ nucleotides. Alternatively, at least two of the Y nucleotides may form base pairs with the corresponding Y′ nucleotides; or all three of the Y nucleotides may form base pairs with the corresponding Y′ nucleotides.

[0609] When the RNAi agent is represented by formula IIIb or IIId, at least one of the Z nucleotides may form a base pair with one of the Z′ nucleotides. Alternatively, at least two of the Z nucleotides may form base pairs with the corresponding Z′ nucleotides; or all three of the Z nucleotides may form base pairs with the corresponding Z′ nucleotides.

[0610] When the RNAi agent is represented by formula IIIc or IIId, at least one of the X nucleotides may form a base pair with one of the X′ nucleotides. Alternatively, at least two of the X nucleotides may form base pairs with the corresponding X′ nucleotides; or all three of the X nucleotides may form base pairs with the corresponding X′ nucleotides.

[0611] In certain embodiments, the modification of the Y nucleotide is different than the modification on the Y′ nucleotide, the modification on the Z nucleotide is different than the modification on the Z′ nucleotide, and/or the modification on the X nucleotide is different than the modification on the X′ nucleotide.

[0612] In certain embodiments, when the RNAi agent is represented by the formula IIId, the N.sub.a modifications are 2′-O-methyl or 2′-fluoro modifications. In another embodiment, when the RNAi agent is represented by formula IIId, the N.sub.a modifications are 2′-O-methyl or 2′-fluoro modifications and n.sub.p′>0 and at least one n.sub.p′ is linked to a neighboring nucleotide via phosphorothioate linkage. In other embodiments, when the RNAi agent is represented by formula IIId, the N.sub.a modifications are 2′-O-methyl or 2′-fluoro modifications, n.sub.p′>0 and at least one n.sub.p′ is linked to a neighboring nucleotide via phosphorothioate linkage, and the sense RNAi oligonucleotide is conjugated to one or more cell targeting group attached through a bivalent or trivalent branched linker. In certain embodiments, when the RNAi agent is represented by formula Hid, the N.sub.a modifications are 2′-O-methyl or 2′-fluoro modifications, n.sub.p′>0 and at least one n.sub.p′ is linked to a neighboring nucleotide via phosphorothioate linkage, the sense RNAi oligonucleotide comprises at least one phosphorothioate linkage and the sense RNAi oligonucleotide is conjugated to one or more cell targeting group attached through a bivalent or trivalent branched linker.

[0613] In certain embodiments, when the RNAi agent is represented by the formula IIIa, the N.sub.a modifications are 2′-O-methyl or 2′-fluoro modifications and n.sub.p′>0 and at least one n.sub.p′ is linked to a neighboring nucleotide via phosphorothioate linkage, the sense RNAi oligonucleotide comprises at least one phosphorothioate linkage and the sense RNAi oligonucleotide is conjugated to one or more cell targeting group attached through a bivalent or trivalent branched linker.

[0614] In certain embodiments, the modification is a 2′-NMA modification.

[0615] In certain embodiments, the antisense strand may comprise a stabilized phosphate group attached to the 5′ position of the 5′-most nucleoside. In certain embodiments, the stabilized phosphate group comprises an (E)-vinyl phosphonate. In certain embodiments, the stabilized phosphate group comprises a cyclopropyl phosphonate.

[0616] In certain embodiments, the antisense strand may comprise a seed-pairing destabilizing modification. In certain embodiments, the seed-pairing destabilizing modification is located at position 6 (counting from the 5′ end). In certain embodiments, the seed-pairing destabilizing modification is located at position 7 (counting from the 5′ end). In certain embodiments, the seed-pairing destabilizing modification is a GNA sugar surrogate. In certain embodiments, the seed-pairing destabilizing modification is an (S)-GNA. In certain embodiments, the seed-pairing destabilizing modification is a UNA. In certain embodiments, the seed-pairing destabilizing modification is a morpholino.

[0617] In certain embodiments, the sense strand may comprise an inverted abasic sugar moiety attached to the 5′-most nucleoside. In certain embodiments, the sense strand may comprise an inverted abasic sugar moiety attached to the 3′-most nucleoside. In certain embodiments, the sense strand may comprise inverted abasic sugar moieties attached to both the 5′-most and 3′-most nucleosides.

[0618] In certain embodiments, the sense strand may comprise a conjugate attached at position 6 (counting from the 5′ end). In certain embodiments, the conjugate is attached at the 2′ position of the nucleoside. In certain embodiments the conjugate is a C.sub.16 lipid conjugate. In certain embodiments, the modified nucleoside at position 6 of the sense strand has a 2′-O-hexadecyl modified sugar moiety.

[0619] IV. Antisense Activity

[0620] In certain embodiments, oligomeric compounds and oligomeric duplexes are capable of hybridizing to a target nucleic acid, resulting in at least one antisense activity; such oligomeric compounds and oligomeric duplexes are antisense compounds. In certain embodiments, antisense compounds have antisense activity when they reduce or inhibit the amount or activity of a target nucleic acid by 25% or more in a standard in vitro assay. In certain embodiments, antisense compounds selectively affect one or more target nucleic acid. Such antisense compounds comprise a nucleobase sequence that hybridizes to one or more target nucleic acid, resulting in one or more desired antisense activity and does not hybridize to one or more non-target nucleic acid or does not hybridize to one or more non-target nucleic acid in such a way that results in significant undesired antisense activity.

[0621] In certain antisense activities, hybridization of an antisense compound to a target nucleic acid results in recruitment of a protein that cleaves the target nucleic acid. For example, certain antisense compounds result in RNase H mediated cleavage of the target nucleic acid. RNase H is a cellular endonuclease that cleaves the RNA strand of an RNA:DNA duplex. The DNA in such an RNA:DNA duplex need not be unmodified DNA. In certain embodiments, described herein are antisense compounds that are sufficiently “DNA-like” to elicit RNase H activity. In certain embodiments, one or more non-DNA-like nucleoside in the gap of a gapmer is tolerated.

[0622] In certain antisense activities, an antisense compound or a portion of an antisense compound is loaded into an RNA-induced silencing complex (RISC), ultimately resulting in cleavage of the target nucleic acid. For example, certain antisense compounds result in cleavage of the target nucleic acid by Argonaute. Antisense compounds that are loaded into RISC are RNAi agents. RNAi agents may be double-stranded (siRNA or dsRNAi) or single-stranded (ssRNA).

[0623] In certain embodiments, hybridization of an antisense compound to a target nucleic acid does not result in recruitment of a protein that cleaves that target nucleic acid. In certain embodiments, hybridization of the antisense compound to the target nucleic acid results in alteration of splicing of the target nucleic acid. In certain embodiments, hybridization of an antisense compound to a target nucleic acid results in inhibition of a binding interaction between the target nucleic acid and a protein or other nucleic acid. In certain embodiments, hybridization of an antisense compound to a target nucleic acid results in alteration of translation of the target nucleic acid.

[0624] Antisense activities may be observed directly or indirectly. In certain embodiments, observation or detection of an antisense activity involves observation or detection of a change in an amount of a target nucleic acid or protein encoded by such target nucleic acid, a change in the ratio of splice variants of a nucleic acid or protein and/or a phenotypic change in a cell or animal.

[0625] V. Certain Target Nucleic Acids

[0626] In certain embodiments, oligomeric compounds comprise or consist of an oligonucleotide comprising a region that is complementary to a target nucleic acid. In certain embodiments, the target nucleic acid is an endogenous RNA molecule. In certain embodiments, the target nucleic acid encodes a protein. In certain such embodiments, the target nucleic acid is selected from: a mature mRNA and a pre-mRNA, including intronic, exonic and untranslated regions. In certain embodiments, the target RNA is a mature mRNA. In certain embodiments, the target nucleic acid is a pre-mRNA. In certain embodiments, the target region is entirely within an intron. In certain embodiments, the target region spans an intron/exon junction. In certain embodiments, the target region is at least 50% within an intron. In certain embodiments, the target nucleic acid is the RNA transcriptional product of a retrogene. In certain embodiments, the target nucleic acid is a non-coding RNA. In certain embodiments, the target non-coding RNA is selected from: a long non-coding RNA, a short non-coding RNA, an intronic RNA molecule.

[0627] A. Complementarity/Mismatches to the Target Nucleic Acid and Duplex Complementarity

[0628] In certain embodiments, oligonucleotides are complementary to the target nucleic acid over the entire length of the oligonucleotide. In certain embodiments, oligonucleotides are 99%, 95%, 90%, 85%, or 80% complementary to the target nucleic acid. In certain embodiments, oligonucleotides are at least 80% complementary to the target nucleic acid over the entire length of the oligonucleotide and comprise a region that is 100% or fully complementary to a target nucleic acid. In certain embodiments, the region of full complementarity is from 6 to 20, 10 to 18, or 18 to 20 nucleobases in length.

Gapmer Oligonucleotides

[0629] It is possible to introduce mismatch bases without eliminating activity. For example, Gautschi et al (J. Natl. Cancer Inst. 93:463-471, March 2001) demonstrated the ability of an oligonucleotide having 100% complementarity to the bcl-2 mRNA and having 3 mismatches to the bcl-xL mRNA to reduce the expression of both bcl-2 and bcl-xL in vitro and in vivo. Furthermore, this oligonucleotide demonstrated potent anti-tumor activity in vivo. Maher and Dolnick (Nuc. Acid. Res. 16:3341-3358, 1988) tested a series of tandem 14 nucleobase oligonucleotides, and 28 and 42 nucleobase oligonucleotides comprised of the sequence of two or three of the tandem oligonucleotides, respectively, for their ability to arrest translation of human DHFR in a rabbit reticulocyte assay. Each of the three 14 nucleobase oligonucleotides alone was able to inhibit translation, albeit at a more modest level than the 28 or 42 nucleobase oligonucleotides.

[0630] In certain embodiments, oligonucleotides comprise one or more mismatched nucleobases relative to the target nucleic acid. In certain embodiments, antisense activity against the target is reduced by such mismatch, but activity against a non-target is reduced by a greater amount. Thus, in certain embodiments selectivity of the oligonucleotide is improved. In certain embodiments, the mismatch is specifically positioned within an oligonucleotide having a gapmer motif. In certain embodiments, the mismatch is at position 1, 2, 3, 4, 5, 6, 7, or 8 from the 5′-end of the gap region. In certain embodiments, the mismatch is at position 9, 8, 7, 6, 5, 4, 3, 2, 1 from the 3′-end of the gap region. In certain embodiments, the mismatch is at position 1, 2, 3, or 4 from the 5′-end of the wing region. In certain embodiments, the mismatch is at position 4, 3, 2, or 1 from the 3′-end of the wing region.

Antisense RNAi Oligonucleotides

[0631] In certain embodiments, antisense RNAi oligonucleotides comprise one or more mismatched nucleobases relative to the target nucleic acid. In certain embodiments, RNAi activity against the target is reduced by such mismatch, but activity against a non-target is reduced by a greater amount. Thus, in certain embodiments selectivity of the antisense RNAi oligonucleotides is improved.

[0632] In certain embodiments, antisense RNAi oligonucleotides comprise a targeting region complementary to the target nucleic acid. In certain embodiments, the targeting region comprises or consists of at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, at least 23, at least 24, or at least 25 contiguous nucleotides. In certain embodiments, the targeting region constitutes 70%, 80%, 85%, 90%, or 95% of the nucleosides of the antisense RNAi oligonucleotide. In certain embodiments, the targeting region constitutes all of the nucleosides of the antisense RNAi oligonucleotide. In certain embodiments, the targeting region of the antisense RNAi oligonucleotide is at least 99%, 95%, 90%, 85%, or 80% complementary to the target nucleic acid. In certain embodiments, the targeting region of the antisense RNAi oligonucleotide is 100% complementary to the target nucleic acid.

Sense RNAi Oligonucleotides

[0633] In certain embodiments, RNAi agents comprise a sense RNAi oligonucleotide. In such embodiments, sense RNAi oligonucleotides comprise an antisense hybridizing region complementary to the antisense RNAi oligonucleotide. In certain embodiments, the antisense hybridizing region comprises or consists of at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, at least 23, at least 24, or at least 25 contiguous nucleotides. In certain embodiments, the antisense hybridizing region constitutes 70%, 80%, 85%, 90%, or 95% of the nucleosides of the sense RNAi oligonucleotide. In certain embodiments, the antisense hybridizing region constitutes all of the nucleosides of the sense RNAi oligonucleotide. In certain embodiments, the antisense hybridizing region of the sense RNAi oligonucleotide is at least 99%, 95%, 90%, 85%, or 80% complementary to the antisense RNAi oligonucleotide. In certain embodiments, the antisense hybridizing region of the sense RNAi oligonucleotide is 100% complementary to the antisense RNAi oligonucleotide.

[0634] The hybridizing region of a sense RNAi oligonucleotide hybridizes with the antisense RNAi oligonucleotide to form a duplex region. In certain embodiments, such duplex region consists of 7 hybridized pairs of nucleosides (one of each pair being on the antisense RNAi oligonucleotide and the other of each pair bien on the sense RNAi oligonucleotide). In certain embodiments, a duplex region comprises least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, at least 23, at least 24, or at least 25 hybridized pairs. In certain embodiments, each nucleoside of antisense RNAi oligonucleotide is paired in the duplex region (i.e., the antisense RNAi oligonucleotide has no overhanging nucleosides). In certain embodiments, the antisense RNAi oligonucleotide includes unpaired nucleosides at the 3′-end and/or the 5′end (overhanging nucleosides). In certain embodiments, each nucleoside of sense RNAi oligonucleotide is paired in the duplex region (i.e., the sense RNAi oligonucleotide has no overhanging nucleosides). In certain embodiments, the sense RNAi oligonucleotide includes unpaired nucleosides at the 3′-end and/or the 5′end (overhanging nucleosides). In certain embodiments, duplexes formed by the antisense RNAi oligonucleotide and the sense RNAi oligonucleotide do not include any overhangs at one or both ends. Such ends without overhangs are referred to as blunt. In certain embodiments wherein the antisense RNAi oligonucleotide has overhanging nucleosides, one or more of those overhanging nucleosides are complementary to the target nucleic acid. In certain embodiments wherein the antisense RNAi oligonucleotide has overhanging nucleosides, one or more of those overhanging nucleosides are not complementary to the target nucleic acid.

[0635] B. APOE

[0636] In certain embodiments, oligomeric compounds comprise or consist of an oligonucleotide comprising a region that is complementary to a target nucleic acid, wherein the target nucleic acid is an APOE nucleic acid. In certain embodiments, the APOE nucleic acid has the sequence set forth as SEQ ID NO: 1 (GENBANK Accession No. NC_000019.10, truncated from nucleotides 44903001 to 44912000). In certain embodiments, the APOE nucleic acid has the sequence set forth as SEQ ID NO: 2 (GENBANK Accession No. NM_001302688.1). In certain embodiments, the APOE nucleic acid has the sequence set forth as SEQ ID NO: 3 (GENBANK Accession No. AU126799.1). In certain embodiments, the APOE nucleic acid has the sequence set forth as SEQ ID NO: 4 (GENBANK Accession No. BI602495.1). In certain embodiments, the APOE nucleic acid has the sequence set forth as SEQ ID NO: 5 (the complement of GENBANK Accession No. CA306379.1). In certain embodiments, the APOE nucleic acid has the sequence set forth as SEQ ID NO: 6 (GENBANK Accession No. NM_000041.2 with T-->C at pos 471 to result in APOE4 mutant mRNA).

[0637] In certain embodiments, contacting a cell with an oligomeric compound complementary to SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, or SEQ ID NO: 5 reduces the amount of APOE RNA, and in certain embodiments reduces the amount of APOE protein in the cell. In certain embodiments, administering an oligomeric compound complementary to SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, or SEQ ID NO: 5 to a subject in need thereof results in reduced amyloid plaques and/or reduced neurofibrillary tangles in the brain of the subject as compared to the amount of amyloid plaques and/or neurofibrillary tangles in the brain of the subject before administering. In certain embodiments, administering an oligomeric compound complementary to SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, or SEQ ID NO: 5 to a subject in need thereof results in less amyloid plaques and/or less neurofibrillary tangles in the brain of the subject as compared to the amount of amyloid plaques and/or neurofibrillary tangles in the brain of a control subject not receiving the oligomeric compound. In certain embodiments, the oligomeric compound consists of a modified oligonucleotide. In certain embodiments, the oligomeric compound consists of a modified oligonucleotide and a conjugate group. In certain embodiments, the oligomeric compound is paired with an additional oligomeric compound in an oligomeric duplex. In certain embodiments, the oligomeric duplex comprises a conjugate group.

[0638] C. Certain Target Nucleic Acids in Certain Tissues

[0639] In certain embodiments, oligomeric compounds comprise or consist of an oligonucleotide comprising a region that is complementary to a target nucleic acid, wherein the target nucleic acid is expressed in a pharmacologically relevant tissue. In certain embodiments, the pharmacologically relevant tissues are the cells and tissues that comprise the central nervous system. Such tissues include the brain, cortex, spinal cord, and the hippocampus.

[0640] VI. Certain Pharmaceutical Compositions

[0641] In certain embodiments, described herein are pharmaceutical compositions comprising one or more oligomeric compounds. In certain embodiments, the one or more oligomeric compounds each consists of a modified oligonucleotide. In certain embodiments, the pharmaceutical composition comprises a pharmaceutically acceptable diluent or carrier. In certain embodiments, a pharmaceutical composition comprises or consists of a sterile saline solution and one or more oligomeric compound. In certain embodiments, the sterile saline is pharmaceutical grade saline. In certain embodiments, a pharmaceutical composition comprises or consists of one or more oligomeric compound and sterile water. In certain embodiments, the sterile water is pharmaceutical grade water. In certain embodiments, a pharmaceutical composition comprises or consists of one or more oligomeric compound and phosphate-buffered saline (PBS). In certain embodiments, the sterile PBS is pharmaceutical grade PBS. In certain embodiments, a pharmaceutical composition comprises or consists of one or more oligomeric compound and artificial cerebrospinal fluid. In certain embodiments, the artificial cerebrospinal fluid is pharmaceutical grade.

[0642] In certain embodiments, a pharmaceutical composition comprises a modified oligonucleotide and artificial cerebrospinal fluid (aCSF). In certain embodiments, a pharmaceutical composition consists of a modified oligonucleotide and artificial cerebrospinal fluid. In certain embodiments, a pharmaceutical composition consists essentially of a modified oligonucleotide and artificial cerebrospinal fluid. In certain embodiments, the artificial cerebrospinal fluid is pharmaceutical grade.

[0643] In certain embodiments, aCSF comprises sodium chloride, potassium chloride, sodium dihydrogen phosphate dihydrate, sodium phosphate dibasic anhydrous, calcium chloride dihydrate, and magnesium chloride hexahydrate. In certain embodiments, the pH of an aCSF solution is modulated with a suitable pH-adjusting agent, for example, with acids such as hydrochloric acid and alkalis such as sodium hydroxide, to a range of from about 7.1-7.3, or to about 7.2.

[0644] In certain embodiments, pharmaceutical compositions comprise one or more oligomeric compound and one or more excipients. In certain embodiments, excipients are selected from water, salt solutions, alcohol, polyethylene glycols, gelatin, lactose, amylase, magnesium stearate, talc, silicic acid, viscous paraffin, hydroxymethylcellulose and polyvinylpyrrolidone.

[0645] In certain embodiments, oligomeric compounds may be admixed with pharmaceutically acceptable active and/or inert substances for the preparation of pharmaceutical compositions or formulations. Compositions and methods for the formulation of pharmaceutical compositions depend on a number of criteria, including, but not limited to, route of administration, extent of disease, or dose to be administered.

[0646] In certain embodiments, pharmaceutical compositions comprising an oligomeric compound encompass any pharmaceutically acceptable salts of the oligomeric compound, esters of the oligomeric compound, or salts of such esters. In certain embodiments, pharmaceutical compositions comprising oligomeric compounds comprising one or more oligonucleotide, upon administration to an animal, including a human, are capable of providing (directly or indirectly) the biologically active metabolite or residue thereof. Accordingly, for example, the disclosure is also drawn to pharmaceutically acceptable salts of oligomeric compounds, prodrugs, pharmaceutically acceptable salts of such prodrugs, and other bioequivalents. In certain embodiments, pharmaceutically acceptable salts comprise inorganic salts, such as monovalent or divalent inorganic salts. Suitable pharmaceutically acceptable salts include, but are not limited to, sodium, potassium, calcium, and magnesium salts. In certain embodiments, prodrugs comprise one or more conjugate group attached to an oligonucleotide, wherein the conjugate group is cleaved by endogenous nucleases within the body.

[0647] In certain embodiments, oligomeric compounds are lyophilized and isolated as sodium salts. In certain embodiments, the sodium salt of an oligomeric compound is mixed with a pharmaceutically acceptable diluent. In certain embodiments, the pharmaceutically acceptable diluent comprises sterile saline, sterile water, PBS, or aCSF. In certain embodiments, the sodium salt of an oligomeric compound is mixed with PBS. In certain embodiments, the sodium salt of an oligomeric compound is mixed with aCSF.

[0648] Lipid moieties have been used in nucleic acid therapies in a variety of methods. In certain such methods, the nucleic acid, such as an oligomeric compound, is introduced into preformed liposomes or lipoplexes made of mixtures of cationic lipids and neutral lipids. In certain methods, DNA complexes with mono- or poly-cationic lipids are formed without the presence of a neutral lipid. In certain embodiments, a lipid moiety is selected to increase distribution of a pharmaceutical agent to a particular cell or tissue. In certain embodiments, a lipid moiety is selected to increase distribution of a pharmaceutical agent to fat tissue. In certain embodiments, a lipid moiety is selected to increase distribution of a pharmaceutical agent to muscle tissue.

[0649] In certain embodiments, pharmaceutical compositions comprise a delivery system. Examples of delivery systems include, but are not limited to, liposomes and emulsions. Certain delivery systems are useful for preparing certain pharmaceutical compositions including those comprising hydrophobic compounds. In certain embodiments, certain organic solvents such as dimethylsulfoxide are used.

[0650] In certain embodiments, pharmaceutical compositions comprise one or more tissue-specific delivery molecules designed to deliver the one or more pharmaceutical agents of the present invention to specific tissues or cell types. For example, in certain embodiments, pharmaceutical compositions include liposomes coated with a tissue-specific antibody.

[0651] In certain embodiments, pharmaceutical compositions comprise a co-solvent system. Certain of such co-solvent systems comprise, for example, benzyl alcohol, a nonpolar surfactant, a water-miscible organic polymer, and an aqueous phase. In certain embodiments, such co-solvent systems are used for hydrophobic compounds. A non-limiting example of such a co-solvent system is the VPD co-solvent system, which is a solution of absolute ethanol comprising 3% w/v benzyl alcohol, 8% w/v of the nonpolar surfactant Polysorbate 80™ and 65% w/v polyethylene glycol 300. The proportions of such co-solvent systems may be varied considerably without significantly altering their solubility and toxicity characteristics. Furthermore, the identity of co-solvent components may be varied: for example, other surfactants may be used instead of Polysorbate 80™; the fraction size of polyethylene glycol may be varied; other biocompatible polymers may replace polyethylene glycol, e.g., polyvinyl pyrrolidone; and other sugars or polysaccharides may substitute for dextrose.

[0652] In certain embodiments, pharmaceutical compositions are prepared for oral administration. In certain embodiments, pharmaceutical compositions are prepared for buccal administration. In certain embodiments, a pharmaceutical composition is prepared for administration by injection (e.g., intravenous, subcutaneous, intramuscular, intrathecal (IT), intracerebroventricular (ICV), etc.). In certain of such embodiments, a pharmaceutical composition comprises a carrier and is formulated in aqueous solution, such as water or physiologically compatible buffers such as Hanks's solution, Ringer's solution, or physiological saline buffer. In certain embodiments, other ingredients are included (e.g., ingredients that aid in solubility or serve as preservatives). In certain embodiments, injectable suspensions are prepared using appropriate liquid carriers, suspending agents and the like. Certain pharmaceutical compositions for injection are presented in unit dosage form, e.g., in ampoules or in multi-dose containers. Certain pharmaceutical compositions for injection are suspensions, solutions or emulsions in oily or aqueous vehicles, and may contain formulatory agents such as suspending, stabilizing and/or dispersing agents. Certain solvents suitable for use in pharmaceutical compositions for injection include, but are not limited to, lipophilic solvents and fatty oils, such as sesame oil, synthetic fatty acid esters, such as ethyl oleate or triglycerides, and liposomes.

[0653] Under certain conditions, certain compounds disclosed herein act as acids. Although such compounds may be drawn or described in protonated (free acid) form, or ionized and in association with a cation (salt) form, aqueous solutions of such compounds exist in equilibrium among such forms. For example, a phosphodiester linkage of an oligonucleotide in aqueous solution exists in equilibrium among free acid, anion and salt forms. Unless otherwise indicated, compounds described herein are intended to include all such forms. Moreover, certain oligonucleotides have several such linkages, each of which is in equilibrium. Thus, oligonucleotides in solution exist in an ensemble of forms at multiple positions all at equilibrium. The term “oligonucleotide” is intended to include all such forms. Drawn structures necessarily depict a single form. Nevertheless, unless otherwise indicated, such drawings are likewise intended to include corresponding forms. Herein, a structure depicting the free acid of a compound followed by the term “or a pharmaceutically acceptable salt thereof” expressly includes all such forms that may be fully or partially protonated/de-protonated/in association with a cation or a combination of cations. In certain embodiments, one or more specific cation is identified. The cations include, but are not limited to, sodium, potassium, calcium, and magnesium. In certain embodiments, a structure depicting the free acid of a compound followed by the term “or a pharmaceutically acceptable salt thereof” expressly includes all such forms that may be fully or partially protonated/de-protonated/in association with one or more cations selected from sodium, potassium, calcium, and magnesium.

[0654] In certain embodiments, modified oligonucleotides or oligomeric compounds are in aqueous solution with sodium. In certain embodiments, modified oligonucleotides or oligomeric compounds are in aqueous solution with potassium. In certain embodiments, modified oligonucleotides or oligomeric compounds are in PBS. In certain embodiments, modified oligonucleotides or oligomeric compounds are in water. In certain such embodiments, the pH of the solution is adjusted with NaOH and/or HCl to achieve a desired pH.

[0655] Herein, certain specific doses are described. A dose may be in the form of a dosage unit. For clarity, a dose (or dosage unit) of a modified oligonucleotide or an oligomeric compound in milligrams indicates the mass of the free acid form of the modified oligonucleotide or oligomeric compound. As described above, in aqueous solution, the free acid is in equilibrium with anionic and salt forms. However, for the purpose of calculating dose, it is assumed that the modified oligonucleotide or oligomeric compound exists as a solvent-free, sodium-acetate free, anhydrous, free acid.

[0656] In certain embodiments, where a modified oligonucleotide or an oligomeric compound is in solution comprising sodium (e.g., saline), the modified oligonucleotide or oligomeric compound may be partially or fully de-protonated and in association with sodium ions. However, the mass of the protons is nevertheless counted toward the weight of the dose, and the mass of the sodium ions is not counted toward the weight of the dose. Thus, for example, a dose, or dosage unit, of 10 mg of a number of fully protonated molecules that weighs 10 mg. This would be equivalent to 10.58 mg of solvent-free, sodium acetate-free, anhydrous sodiated Compound No. 699467 or 10.65 mg of solvent-free, sodium acetate-free, anhydrous sodiated Compound No. 1381709.

[0657] In certain embodiments, where a modified oligonucleotide or oligomeric compound is in a solution, such as aCSF, comprising sodium, potassium, calcium, and magnesium, the modified oligonucleotide or oligomeric compound may be partially or fully de-protonated and in association with sodium, potassium, calcium, and/or magnesium. However, the mass of the protons is nevertheless counted toward the weight of the dose, and the mass of the sodium, potassium, calcium, and magnesium ions is not counted toward the weight of the dose.

[0658] In certain embodiments, when an oligomeric compound comprises a conjugate group, the mass of the conjugate group is included in calculating the dose of such oligomeric compound. If the conjugate group also has an acid, the conjugate group is likewise assumed to be fully protonated for the purpose of calculating dose.

[0659] VII. Certain Hotspot Regions

[0660] 1. Nucleobases 1155-1178 of SEQ ID NO: 2

[0661] In certain embodiments, nucleobases 1155-1178 of SEQ ID NO: 2 comprise a hotspot region. In certain embodiments, modified oligonucleotides are complementary to a portion of nucleobases 1155-1178 of SEQ ID NO: 2. In certain embodiments, the modified oligonucleotides are 16 to 20 nucleobases in length. In certain embodiments, modified oligonucleotides are gapmers. In certain embodiments, the gapmers are cEt gapmers. In certain embodiments, the gapmers are MOE gapmers. In certain embodiments, the internucleoside linkages of the modified nucleotides are phosphorothioate internucleoside linkages and phosphodiester linkages, of a combination thereof.

[0662] The nucleobase sequences of SEQ ID NOs: 70, 71, 169, 170, 447, 448, 543, 552, 553, 919, 1061, 1132, 1938, 1991, 2066, 2154, 2226, 2259, 2324, 2417, and 2486 are complementary to nucleobases 1155-1178 of SEQ ID NO: 2.

[0663] The nucleobase sequences of Compound NOs: 426048, 426049, 689013, 689014, 689015, 689016, 689118, 708021, 708022, 729682, 729683, 942586, 942587, 942588, 1516539, 1516559, 1516570, 1516656, 1516771, 1516839, 1516862, 1516866, and 1516877 are complementary to nucleobases 1155-1178 of SEQ ID NO: 2.

[0664] In certain embodiments, modified oligonucleotides complementary to a portion of nucleobases 1155-1178 of SEQ ID NO: 2 achieve at least 46% reduction of APOE RNA in a standard in vitro assay. In certain embodiments, modified oligonucleotides complementary to a portion of nucleobases 1155-1178 of SEQ ID NO: 2 achieve an average of 83.4% reduction of APOE RNA in a standard in vitro assay.

[0665] 2. Nucleobases 1207-1230 of SEQ ID NO: 2

[0666] In certain embodiments, nucleobases 1207-1230 of SEQ ID NO: 2 comprise a hotspot region. In certain embodiments, modified oligonucleotides are complementary to a portion of nucleobases 1207-1230 of SEQ ID NO: 2. In certain embodiments, the modified oligonucleotides are 16 to 20 nucleobases in length. In certain embodiments, modified oligonucleotides are gapmers. In certain embodiments, the gapmers are cEt gapmers. In certain embodiments, the gapmers are MOE gapmers. In certain embodiments, the internucleoside linkages of the modified nucleotides are phosphorothioate internucleoside linkages and phosphodiester linkages, of a combination thereof.

[0667] The nucleobase sequences of SEQ ID NOs: 460, 461, 462, 563, 564, 565, 566, 990, 1469, 1572, 1653, 1746, 1914, 1955, 2026, 2110, 2211, 2247, 2344, 2393, and 2481 are complementary to nucleobases 1207-1230 of SEQ ID NO: 2.

[0668] The nucleobase sequences of Compound NOs: 689028, 689029, 689030, 729693, 729694, 729695, 729696, 942591, 1516614, 1516652, 1516784, 1516831, 1516890, 1516931, 1516936, 1516973, 1517107, 1517281, 1517604, 1517622, and 1517806 are complementary to nucleobases 1207-1230 of SEQ ID NO: 2.

[0669] In certain embodiments, modified oligonucleotides complementary to a portion of nucleobases 1207-1230 of SEQ ID NO: 2 achieve at least 30% reduction of APOE RNA in a standard in vitro assay. In certain embodiments, modified oligonucleotides complementary to a portion of nucleobases 1207-1230 of SEQ ID NO: 2 achieve an average of 60.9% reduction of APOE RNA in a standard in vitro assay.

[0670] 3. Nucleobases 1259-1295 of SEQ ID NO: 2

[0671] In certain embodiments, nucleobases 1259-1295 of SEQ ID NO: 2 comprise a hotspot region. In certain embodiments, modified oligonucleotides are complementary to a portion of nucleobases 1259-1295 of SEQ ID NO: 2. In certain embodiments, the modified oligonucleotides are 16 to 20 nucleobases in length. In certain embodiments, modified oligonucleotides are gapmers. In certain embodiments, the gapmers are cEt gapmers. In certain embodiments, the gapmers are MOE gapmers. In certain embodiments, the internucleoside linkages of the modified nucleotides are phosphorothioate internucleoside linkages and phosphodiester linkages, of a combination thereof.

[0672] The nucleobase sequences of SEQ ID NOs: 77, 475, 476, 477, 478, 479, 480, 481, 482, 483, 578, 579, 580, 581, 582, 622, 623, 624, 625, 626, 627, 1063, 1193, 1231, 1232, 1300, 1305, 1378, 1409, 1493, 1526, 1564, 1576, 1678, 1679, 1695, 1827, 1870, 1921, 1928, 1950, 1982, 2012, 2046, 2051, 2074, 2088, 2118, 2158, 2169, 2208, 2223, 2232, 2255, 2321, 2343, 2380, 2436, 2449, and 2451 are complementary to nucleobases 1259-1295 of SEQ ID NO: 2.

[0673] The nucleobase sequences of Compound NOs: 689043, 689044, 689045, 689046, 689047, 689048, 689049, 689050, 689051, 708024, 729709, 729710, 729711, 729712, 729713, 729714, 729715, 729716, 729717, 729718, 729719, 942598, 1516533, 1516549, 1516553, 1516613, 1516617, 1516658, 1516672, 1516681, 1516726, 1516740, 1516743, 1516758, 1516778, 1516834, 1516921, 1516932, 1516974, 1517003, 1517024, 1517063, 1517082, 1517130, 1517220, 1517383, 1517427, 1517508, 1517519, 1517578, 1517652, 1517770, 1517837, 1517841, 1517842, 1517849, 1517853, 1517874, 1517885, and 1517891 are complementary to nucleobases 1259-1295 of SEQ ID NO: 2.

[0674] In certain embodiments, modified oligonucleotides complementary to a portion of nucleobases 1259-1295 of SEQ ID NO: 2 achieve at least 29% reduction of APOE RNA in a standard in vitro assay. In certain embodiments, modified oligonucleotides complementary to a portion of nucleobases 1259-1295 of SEQ ID NO: 2 achieve an average of 72.4% reduction of APOE RNA in a standard in vitro assay.

[0675] 4. Nucleobases 1135-1166 of SEQ ID NO: 2

[0676] In certain embodiments, nucleobases 1135-1166 of SEQ ID NO: 2 comprise a hotspot region. In certain embodiments, oligomeric compounds or oligomeric duplexes comprise modified oligonucleotides that are complementary within nucleobases 1135-1166 of SEQ ID NO: 2. In certain embodiments, modified oligonucleotides are 23 nucleobases in length. In certain embodiments, modified oligonucleotides are antisense RNAi oligonucleotides. In certain embodiments, the antisense RNAi oligonucleotide has a sugar motif (from 5′ to 3′) of: mfinfmfmfinfinfmfinfmfinfmmm; wherein “m” represents a 2′-O methylribosyl sugar, and the “f” represents a 2′-fluororibosyl sugar; and a linkage motif (from 5′ to 3′) of: ssoooooooooooooooooss; wherein ‘o’ represents a phosphodiester internucleoside linkage and ‘s’ represents a phosphorothioate internucleoside linkage.

[0677] The nucleobase sequences of SEQ ID NOs: 2600, 2601, 2604, 2605, 2606, 2607, 2608, 2609, 2610, and 2613 are complementary within nucleobases 1135-1166 of SEQ ID NO: 2.

[0678] RNAi compounds 1518282, 1518283, 1518286, 1518299, 1518300, 1518301, 1518302, 1518303, 1518304, and 1518319 comprise an antisense RNAi oligonucleotide that is complementary within nucleobases 1135-1166 of SEQ ID NO: 2.

[0679] In certain embodiments, modified oligonucleotides complementary within nucleobases 1135-1166 of SEQ ID NO: 2 achieve at least 45% reduction of APOE RNA in a standard in vitro assay. In certain embodiments, modified oligonucleotides complementary within nucleobases 1135-1166 of SEQ ID NO: 2 achieve an average of 73.1% reduction of APOE RNA in a standard in vitro assay.

[0680] 5. Nucleobases 1255-1294 of SEQ ID NO: 2

[0681] In certain embodiments, nucleobases 1255-1294 of SEQ ID NO: 2 comprise a hotspot region. In certain embodiments, oligomeric compounds or oligomeric duplexes comprise modified oligonucleotides that are complementary within nucleobases 1255-1294 of SEQ ID NO: 2. In certain embodiments, modified oligonucleotides are 23 nucleobases in length. In certain embodiments, modified oligonucleotides are antisense RNAi oligonucleotides. In certain embodiments, the antisense RNAi oligonucleotide has a sugar motif (from 5′ to 3′) of: mfmfmfmfmfmfmfmfmfmfmmm; wherein “m” represents a 2′-O methylribosyl sugar, and the “f” represents a 2′-fluororibosyl sugar; and a linkage motif (from 5′ to 3′) of: ssooooooooooooooooooss; wherein ‘o’ represents a phosphodiester internucleoside linkage and ‘s’ represents a phosphorothioate internucleoside linkage.

[0682] The nucleobase sequences of SEQ ID NOs: 2720, 2721, 2722, 2726, 2727, 2729, 2730, 2731, 2732, 2733, 2734, 2735, 2736, 2737, 2738, and 2740 are complementary within nucleobases 1255-1294 of SEQ ID NO: 2.

[0683] RNAi compounds 1518642, 1518643, 1518644, 1518659, 1518660, 1518661, 1518663, 1518664, 1518677, 1518678, 1518679, 1518680, 1518681, 1518682, 1518695, 1518697, and 1518699 comprise an antisense RNAi oligonucleotide that is complementary within nucleobases 1255-1294 of SEQ ID NO: 2.

[0684] In certain embodiments, modified oligonucleotides complementary within nucleobases 1255-1294 of SEQ ID NO: 2 achieve at least 88% reduction of APOE RNA in a standard in vitro assay. In certain embodiments, modified oligonucleotides complementary within nucleobases 1255-1294 of SEQ ID NO: 2 achieve an average of 94.9% reduction of APOE RNA in a standard in vitro assay.

[0685] 6. Nucleobases 1255-1295 of SEQ ID NO: 2

[0686] In certain embodiments, nucleobases 1255-1295 of SEQ ID NO: 2 comprise a hotspot region. In certain embodiments, oligomeric compounds or oligomeric duplexes comprise modified oligonucleotides that are complementary within nucleobases 1255-1295 of SEQ ID NO: 2.

[0687] In certain embodiments, modified oligonucleotides are 23 nucleobases in length. In certain embodiments, modified oligonucleotides are antisense RNAi oligonucleotides. In certain embodiments, the antisense RNAi oligonucleotide has a sugar motif (from 5′ to 3′) of: mfmfmfmfmfmfmfmfmfmfmmm; wherein “m” represents a 2′-O methylribosyl sugar, and the “f” represents a 2′-fluororibosyl sugar; and a linkage motif (from 5′ to 3′) of: ssooooooooooooooooooss; wherein ‘o’ represents a phosphodiester internucleoside linkage and ‘s’ represents a phosphorothioate internucleoside linkage. In certain embodiments, the antisense RNAi oligonucleotide has a sugar motif (from 5′ to 3′) of: efmmmfmmmmmmmfmfmmmmmmm; wherein ‘e’ represents a 2′-MOE modified sugar moiety, each “m” represents a 2′-O-methylribosyl sugar, and each “f” represents a 2′-fluororibosyl sugar; and an internucleoside linkage motif (from 5′ to 3′) of: ssooooooooooooooooooss; wherein ‘o’ represents a phosphodiester internucleoside linkage and ‘s’ represents a phosphorothioate internucleoside linkage.

[0688] In certain embodiments, the modified oligonucleotides are 16 to 20 nucleobases in length. In certain embodiments, modified oligonucleotides are gapmers. In certain embodiments, the gapmers are cEt gapmers. In certain embodiments, the gapmers are MOE gapmers. In certain embodiments, the internucleoside linkages of the modified nucleotides are phosphorothioate internucleoside linkages and phosphodiester linkages, of a combination thereof.

[0689] The nucleobase sequences of SEQ ID NOs: 76, 77, 473, 474, 475, 476, 477, 478, 479, 480, 481, 482, 483, 576, 578, 579, 580, 581, 582, 622, 623, 624, 625, 626, 627, 1063, 1193, 1231, 1232, 1300, 1305, 1378, 1409, 1493, 1526, 1564, 1576, 1678, 1679, 1695, 1701, 1792, 1827, 1870, 1886, 1906, 1921, 1928, 1950, 1982, 2012, 2046, 2051, 2074, 2088, 2118, 2158, 2169, 2208, 2223, 2232, 2255, 2321, 2343, 2370, 2380, 2436, 2449, 2490, 2451, 2720, 2721, 2722, 2725, 2726, 2727, 2729, 2730, 2731, 2732, 2733, 2734, 2735, 2736, 2737, 2738, 2740, 2935, or 2936 are complementary within nucleobases 1255-1294 of SEQ ID NO: 2.

[0690] RNAi compounds 1518642, 1518643, 1518644, 1518659, 1518660, 1518661, 1518663, 1518664, 1518677, 1518678, 1518679, 1518680, 1518681, 1518682, 1518695, 1518697, and 1518699 comprise an antisense RNAi oligonucleotide that is complementary within nucleobases 1255-1294 of SEQ ID NO: 2. The nucleobase sequences of Compound Nos: 689043, 689044, 689045, 689046, 689047, 689048, 689049, 689050, 689051, 708024, 729709, 729710, 729711, 729712, 729713, 729714, 729715, 729716, 729717, 729718, 729719, 942598, 1516533, 1516549, 1516553, 1516613, 1516617, 1516658, 1516672, 1516681, 1516726, 1516740, 1516743, 1516758, 1516778, 1516834, 1516921, 1516932, 1516974, 1517003, 1517024, 1517063, 1517082, 1517130, 1517220, 1517383, 1517427, 1517508, 1517519, 1517578, 1517652, 1517770, 1517837, 1517841, 1517842, 1517849, 1517853, 1517874, 1517885, 1517891, 1642901, and 1644690 are complementary to nucleobases 1259-1295 of SEQ ID NO: 2.

[0691] In certain embodiments, modified oligonucleotides complementary within nucleobases 1255-1295 of SEQ ID NO: 2 achieve at least 37% reduction of APOE RNA in a standard in vitro assay. In certain embodiments, modified oligonucleotides complementary within nucleobases 1255-1295 of SEQ ID NO: 2 achieve an average of 70% reduction of APOE RNA in a standard in vitro assay.

Nonlimiting Disclosure and Incorporation by Reference

[0692] Each of the literature and patent publications listed herein is incorporated by reference in its entirety.

[0693] While certain compounds, compositions and methods described herein have been described with specificity in accordance with certain embodiments, the following examples serve only to illustrate the compounds described herein and are not intended to limit the same. Each of the references, GenBank accession numbers, ENSEMBL identifiers, and the like recited in the present application is incorporated herein by reference in its entirety.

[0694] Although the sequence listing accompanying this filing identifies each sequence as either “RNA” or “DNA” as required, in reality, those sequences may be modified with any combination of chemical modifications. One of skill in the art will readily appreciate that such designation as “RNA” or “DNA” to describe modified oligonucleotides is, in certain instances, arbitrary. For example, an oligonucleotide comprising a nucleoside comprising a 2′-OH sugar moiety and a thymine base could be described as a DNA having a modified sugar (2′-OH in place of one 2′-H of DNA) or as an RNA having a modified base (thymine (methylated uracil) in place of an uracil of RNA). Accordingly, nucleic acid sequences provided herein, including, but not limited to those in the sequence listing, are intended to encompass nucleic acids containing any combination of natural or modified RNA and/or DNA, including, but not limited to such nucleic acids having modified nucleobases. By way of further example and without limitation, an oligomeric compound having the nucleobase sequence “ATCGATCG” encompasses any oligomeric compounds having such nucleobase sequence, whether modified or unmodified, including, but not limited to, such compounds comprising RNA bases, such as those having sequence “AUCGAUCG” and those having some DNA bases and some RNA bases such as “AUCGATCG” and oligomeric compounds having other modified nucleobases, such as “AT.sup.mCGAUCG,” wherein .sup.mC indicates a cytosine base comprising a methyl group at the 5-position.

[0695] Certain compounds described herein (e.g., modified oligonucleotides) have one or more asymmetric center and thus give rise to enantiomers, diastereomers, and other stereoisomeric configurations that may be defined, in terms of absolute stereochemistry, as (R) or (S), as a or 13 such as for sugar anomers, or as (D) or (L), such as for amino acids, etc. Compounds provided herein that are drawn or described as having certain stereoisomeric configurations include only the indicated compounds. Compounds provided herein that are drawn or described with undefined stereochemistry include all such possible isomers, including their stereorandom and optically pure forms, unless specified otherwise. Likewise, tautomeric forms of the compounds herein are also included unless otherwise indicated. Unless otherwise indicated, compounds described herein are intended to include corresponding salt forms.

[0696] The compounds described herein include variations in which one or more atoms are replaced with a non-radioactive isotope or radioactive isotope of the indicated element. For example, compounds herein that comprise hydrogen atoms encompass all possible deuterium substitutions for each of the .sup.1H hydrogen atoms. Isotopic substitutions encompassed by the compounds herein include but are not limited to: .sup.2H or .sup.3H in place of .sup.1H, .sup.13C or .sup.14C in place of .sup.12C, .sup.15N in place of .sup.14N, .sup.17O or .sup.18O in place of .sup.16O, and .sup.33S, .sup.34S, .sup.35S, or .sup.36S in place of .sup.32S. In certain embodiments, non-radioactive isotopic substitutions may impart new properties on the oligomeric compound that are beneficial for use as a therapeutic or research tool. In certain embodiments, radioactive isotopic substitutions may make the compound suitable for research or diagnostic purposes such as imaging.

EXAMPLES

[0697] The following examples illustrate certain embodiments of the present disclosure and are not limiting. Moreover, where specific embodiments are provided, the inventors have contemplated generic application of those specific embodiments. For example, disclosure of an oligonucleotide having a particular motif provides reasonable support for additional oligonucleotides having the same or similar motif. And, for example, where a particular high-affinity modification appears at a particular position, other high-affinity modifications at the same position are considered suitable, unless otherwise indicated.

Example 1: Effect of 5-10-5 MOE Full Phosphorothioate Modified Oligonucleotides on Human APOE RNA In Vitro, Single Dose

[0698] Modified oligonucleotides complementary to human APOE nucleic acid were designed and tested for their single dose effects on APOE RNA in vitro. The modified oligonucleotides were tested in a series of experiments that had the same culture conditions.

[0699] The modified oligonucleotides in the table below are 5-10-5 MOE gapmers with full phosphorothioate internucleoside linkages. The gapmers are 20 nucleosides in length, wherein the central gap segment consists of ten 2′-β-D-deoxynucleosides, and wherein the 5′ and 3′ wing segments each consist of five 2′-MOE modified nucleosides. The sugar motif for the gapmers is (from 5′ to 3′): eeeeeddddddddddeeeee; wherein ‘d’ represents a 2′-β-D-deoxyribosyl sugar, and ‘e’ represents a 2′-MOE modified sugar moiety. The internucleoside linkage motif for the gapmers is (from 5′ to 3′): sssssssssssssssssss; wherein each ‘s’ represents a phosphorothioate internucleoside linkage. Each cytosine residue is a 5-methyl cytosine.

[0700] “Start site” indicates the 5′-most nucleoside to which the modified oligonucleotide is complementary in the target nucleic acid sequence. “Stop site” indicates the 3′-most nucleoside to which the modified oligonucleotide is complementary in the target nucleic acid sequence. Each modified oligonucleotide listed in the tables below is 100% complementary to SEQ ID NO: 1 (GENBANK Accession No. NC_000019.10, truncated from nucleotides 44903001 to 44912000), to SEQ ID NO: 2 (GENBANK Accession No. NM_001302688.1), to SEQ ID NO: 3 (GENBANK Accession No. AU126799.1), to SEQ ID NO: 4 (GENBANK Accession No. BI602495.1), to SEQ ID NO: 5 (the complement of GENBANK Accession No. CA306379.1), or to any combination of these SEQ ID NOs. ‘N/A’ indicates that the modified oligonucleotide is not 100% complementary to that particular target nucleic acid sequence.

[0701] Cultured HepG2 cells were treated with modified oligonucleotide at a concentration of 100 nM using Lipofectin at a density of 10,000 cells per well. After a treatment period of approximately 24 hours, total RNA was isolated from the cells and APOE RNA levels were measured by quantitative real-time RTPCR. APOE RNA levels were measured by human primer-probe set RTS3073 (forward sequence TGGGTCGCTTTTGGGATTAC, designated herein as SEQ ID NO: 10; reverse sequence CCATCAGCGCCCTCAGTT, designated herein as SEQ ID NO: 11; probe sequence CTGCTCAGCTCCCAGGTCACCCA, designated herein as SEQ ID NO: 12). APOE RNA levels were normalized to total RNA content, as measured by RIBOGREEN®. Results are presented in the tables below as percent APOE RNA relative to untreated control cells (% UTC). Each table represents results from an individual assay plate. The values marked with an “†” indicate that the modified oligonucleotide is complementary to the amplicon region of the primer probe set. Additional assays may be used to measure the potency and efficacy of the modified oligonucleotides complementary to the amplicon region.

TABLE-US-00001 TABLE 1 Reduction of APOE RNA by 5-10-5 MOE gapmers with full phosphorothioate internucleoside linkages at a concentration of 100 nM in HepG2 cells plated at 10,000 cells per well SEQ ID SEQ ID SEQ ID SEQ ID No: 1 No: 1 No: 2 No: 2 APOE Compound Start Stop Start Stop (% SEQ ID Number Site Site Site Site Sequence (5′ to 3′) UTC) NO 425997 2782 2801   34   53 GAGTAGGACTCAAGGATCCC 108 20 425999 3625 3644  199  218 GCAGCCCACAGAACCTTCAT 122 21 426000 3628 3647  202  221 AACGCAGCCCACAGAACCTT  88 22 426001 3636 3655  210  229 TGACCAGCAACGCAGCCCAC  79 23 426002 3642 3661  216  235 GGAATGTGACCAGCAACGCA  66 24 426003 3649 3668  223  242 CCTGCCAGGAATGTGACCAG  26 25 426004 N/A N/A  226  245 CATCCTGCCAGGAATGTGAC  72 26 426005 N/A N/A  235  254 TTGGCCTGGCATCCTGCCAG  81 27 426006 4759 4778  241  260 TCCACCTTGGCCTGGCATCC  84 28 426007 4844 4863  326  345 ACCCAGTGCCAGTTCCCAGC  79† 29 426008 4854 4873  336  355 CCCAAAAGCGACCCAGTGCC  73† 30 426009 4861 4880  343  362 AGGTAATCCCAAAAGCGACC  60† 31 426010 4864 4883  346  365 CGCAGGTAATCCCAAAAGCG  47† 32 426011 4872 4891  354  373 GCACCCAGCGCAGGTAATCC  33† 33 426012 4875 4894  357  376 TCTGCACCCAGCGCAGGTAA  53† 34 426013 4879 4898  361  380 AGTGTCTGCACCCAGCGCAG  14† 35 426014 4886 4905  368  387 CTCAGACAGTGTCTGCACCC  62† 36 426015 4893 4912  375  394 GCACCTGCTCAGACAGTGTC  57† 37 426016 4921 4940  403  422 GTGACCTGGGAGCTGAGCAG  42† 38 426017 4932 4951  414  433 TCAGTTCCTGGGTGACCTGG  19† 39 426018 N/A N/A  419  438 CGCCCTCAGTTCCTGGGTGA  68† 40 426019 5559 5578  461  480 CGATTTGTAGGCCTTCAACT  32 41 426020 5565 5584  467  486 CAGTTCCGATTTGTAGGCCT  25 42 426021 5618 5637  520  539 TCCTTGGACAGCCGTGCCCG  56 43 426022 5682 5701  584  603 CTGCACCAGGCGGCCGCACA  66 44 426023 5688 5707  590  609 GCGGTACTGCACCAGGCGGC 116 45 426024 5691 5710  593  612 GCCGCGGTACTGCACCAGGC  60 46 426025 5715 5734  617  636 CTGGCCGAGCATGGCCTGCA  96 47 426026 5765 5784  667  686 CGCAGCTTGCGCAGGTGGGA  82 48 426027 5775 5794  677  696 GAGCCGCTTACGCAGCTTGC  76 49 426028 5799 5818  701  720 CTGCAGGTCATCGGCATCGC  24 50 426029 5804 5823  706  725 CGCTTCTGCAGGTCATCGGC  35 51 426030 5825 5844  727  746 CCGGCCTGGTACACTGCCAG  75 52 426031 5828 5847  730  749 GCCCCGGCCTGGTACACTGC  70 53 426032 5832 5851  734  753 GCGGGCCCCGGCCTGGTACA  87 54 426033 5919 5938  821  840 GCCCACAGTGGCGGCCCGCA  84 55 426034 5922 5941  824  843 GGAGCCCACAGTGGCGGCCC 115 56 426035 5925 5944  827  846 CAGGGAGCCCACAGTGGCGG 106 57 426036 5928 5947  830  849 GGCCAGGGAGCCCACAGTGG  97 58 426037 5934 5953  836  855 CTGGCCGGCCAGGGAGCCCA 111 59 426038 6009 6028  911  930 GCGGGTCCGGCTGCCCATCT  61 60 426039 6062 6081  964  983 TCCAGCTTGGCGCGCACCTC  37 61 426040 6103 6122 1005 1024 GGAAGGCCTCGGCCTGCAGG  92 62 426041 6118 6137 1020 1039 TCTTGAGGCGGGCCTGGAAG  91 63 426042 6127 6146 1029 1048 CGAACCAGCTCTTGAGGCGG 117 64 426043 6150 6169 1052 1071 CTGCATGTCTTCCACCAGGG  37 65 426044 6153 6172 1055 1074 GCGCTGCATGTCTTCCACCA  50 66 426045 6197 6216 1099 1118 GTGCCCACGGCAGCCTGCAC  90 67 426046 6230 6249 1132 1151 CAGTGATTGTCGCTGGGCAC 136 68 426047 6234 6253 1136 1155 CGTTCAGTGATTGTCGCTGG  31 69 426048 6254 6273 1156 1175 CGCATGGCTGCAGGCTTCGG   5 70 426049 6257 6276 1159 1178 GGTCGCATGGCTGCAGGCTT  10 71 426050 6336 6355 1238 1257 ACCCCAGGAGGACGGCTGGG  32 72 426051 6340 6359 1242 1261 GTCCACCCCAGGAGGACGGC  69 73 426052 6343 6362 1245 1264 AGGGTCCACCCCAGGAGGAC  37 74 426053 6347 6366 1249 1268 AACTAGGGTCCACCCCAGGA 214 75 426054 6353 6372 1255 1274 TTATTAAACTAGGGTCCACC  56 76 426055 6371 6390 1273 1292 GTGAAACTTGGTGAATCTTT  30 77 426062 2888 2907  140  159 CCCAGGGTCCCAGCTCTTTC 163 78 426067 2892 2911  144  163 GGTTCCCAGGGTCCCAGCTC  87 79 426068 2912 2931 N/A N/A GAGACTACCTGGAGGCCAGG  96 80 426069 3167 3186 N/A N/A ACCGTGTCGCTGCCCCTGGC  99 81 426070 3656 3675 N/A N/A CCCCATACCTGCCAGGAATG 130 82 426071 4272 4291 N/A N/A TGTGTGCCCCAGGCAGGGCT 113 83 426072 4937 4956 N/A N/A TCACCTCAGTTCCTGGGTGA  91† 84 426073 4976 4995 N/A N/A GCCGCCCACCAGGAGGGTCA 105† 85 426074 7222 7241 N/A N/A GCAGGCCGGGCTCGGAGCCC 107 86

TABLE-US-00002 TABLE 2 Reduction of APOE RNA by 5-10-5 MOE gapmers with full phosphorothioate internucleoside linkages at a concentration of 100 nM in HepG2 cells plated at 10,000 cells per well SEQ SEQ SEQ SEQ SEQ SEQ ID No: ID No: ID No: ID No: ID No: ID No: APOE Compound 3 Start 3 Stop 4 Start 4 Stop 5 Start 5 Stop Sequence (% SEQ Number Site Site Site Site Site Site (5′ to 3′) UTC) ID NO 425998  40  59 N/A N/A N/A N/A TGTGATTGGC  85 87 CAGTCGGCTC 426056 103 122 N/A N/A N/A N/A TGGCTGGCAT 106 88 CCTGCCAGGA 426057 534 553 N/A N/A N/A N/A TACGCAGTTG 123 89 CGCAGGTGGG 426058 543 562 N/A N/A N/A N/A AGGAGCCGTT 109 90 ACGCAGTTGC 426060 731 750 N/A N/A N/A N/A ATTAAACTTA 133 91 GGGTCCACTC 426061 734 753 N/A N/A N/A N/A TTTATTAAACT  73 92 TAGGGTCCA 426063 N/A N/A 747 766 N/A N/A TGTTCCACCA 125 93 GGGCCCCAGG 426064 N/A N/A 777 796 N/A N/A GGAGCCCACA 135 94 GTGCCGGCCG 426065 N/A N/A N/A N/A  98 117 CACTTCTGCA  67 95 GGTCATCGGC 426066 N/A N/A N/A N/A 103 122 CCAGGCACTT 121 96 CTGCAGGTCA

Example 2: Effect of 5-8-5 MOE Mixed Backbone Modified Oligonucleotides on Human APOE RNA In Vitro, Single Dose

[0702] Modified oligonucleotides complementary to human APOE nucleic acid were designed and tested for their single dose effects on APOE RNA in vitro. The modified oligonucleotides were tested in a series of experiments that had similar culture conditions. The modified oligonucleotides in the tables below are 5-8-5 MOE gapmers with mixed PO/PS internucleoside linkages. The gapmers are 18 nucleosides in length, wherein the central gap segment consists of eight 2′-β-D-deoxynucleosides, and wherein the 5′ and 3′ wing segments each consist of five 2′-MOE modified nucleosides. The sugar motif for the gapmers is (from 5′ to 3′): eeeeeddddddddeeeee; wherein ‘d’ represents a 2′-β-D-deoxyribosyl sugar, and ‘e’ represents a 2′-MOE modified sugar moiety. The internucleoside linkage motif for the gapmers is (from 5′ to 3′): soossssssssssooss; wherein each ‘o’ represents a phosphodiester internucleoside linkage and each ‘s’ represents a phosphorothioate internucleoside linkage. Each cytosine residue is a 5-methyl cytosine.

[0703] “Start site” indicates the 5′-most nucleoside to which the modified oligonucleotide is complementary in the target nucleic acid sequence. “Stop site” indicates the 3′-most nucleoside to which the modified oligonucleotide is complementary in the target nucleic acid sequence. Each modified oligonucleotide listed in the tables below is 100% complementary to SEQ ID NO: 1 (described herein above), to SEQ ID NO: 2 (described herein above), to SEQ ID NO: 3 (described herein above), to SEQ ID NO: 4 (described herein above), to SEQ ID NO: 5 (described herein above), to SEQ ID NO: 6 (GENBANK Accession No. NM_000041.2 with T-->C at pos 471 to result in APOE4 mutant mRNA), or to any combination of these SEQ ID NOs. ‘N/A’ indicates that the modified oligonucleotide is not 100% complementary to that particular target nucleic acid sequence.

[0704] Cultured Hep3B or HepG2 cells were treated with modified oligonucleotide at a concentration of 2000 or 4000 nM by electroporation at a density of either 5,000 or 20,000 cells per well, as indicated in the tables below. After a treatment period of approximately 24 hours, total RNA was isolated from the cells and APOE RNA levels were measured by quantitative real-time RTPCR. APOE RNA levels were measured by human primer-probe set RTS3073 (described herein in Example 1). APOE RNA levels were normalized to total RNA content, as measured by RIBOGREEN®. Results are presented in the tables below as percent APOE RNA relative to untreated control cells (% UTC). Each table represents results from an individual assay plate. The values marked with an “†” indicate that the modified oligonucleotide is complementary to the amplicon region of the primer probe set. Additional assays may be used to measure the potency and efficacy of the modified oligonucleotides complementary to the amplicon region. In Tables 3-8 below, Compound 426048 (described herein above) was included as a reference.

TABLE-US-00003 TABLE 3 Reduction of APOE RNA by 5-8-5 MOE gapmers with mixed PO/PS internucleoside linkages at a concentration of 4000 nM in Hep3B cells plated at 20,000 cells per well SEQ ID SEQ ID SEQ ID SEQ ID No: 1 No: 1 No: 2 No: 2 APOE Compound Start Stop Start Stop (% SEQ ID Number Site Site Site Site Sequence (5′ to 3′) UTC) NO 426048 6254 6273 1156 1175 CGCATGGCTGCAGGCTTCGG  42  70 688661 2783 2800   35   52 AGTAGGACTCAAGGATCC 103  97 688662 2785 2802   37   54 TGAGTAGGACTCAAGGAT 108  98 688663 2787 2804   39   56 GCTGAGTAGGACTCAAGG 108  99 688664 2789 2806   41   58 GGGCTGAGTAGGACTCAA 108 100 688665 2805 2822   57   74 TCCTTCACCTCCGCTGGG 120 101 688666 2807 2824   59   76 CGTCCTTCACCTCCGCTG 109 102 688671 3601 3618  175  192 GCCTGTGATTGGCCAGTC  92 103 688672 3603 3620  177  194 CTGCCTGTGATTGGCCAG  70 104 688673 3605 3622  179  196 TCCTGCCTGTGATTGGCC  96 105 688674 3607 3624  181  198 CTTCCTGCCTGTGATTGG  96 106 688675 3609 3626  183  200 ATCTTCCTGCCTGTGATT 100 107 688676 3613 3630  187  204 CTTCATCTTCCTGCCTGT  95 108 688677 3615 3632  189  206 ACCTTCATCTTCCTGCCT 110 109 688678 3617 3634  191  208 GAACCTTCATCTTCCTGC  93 110 688679 3619 3636  193  210 CAGAACCTTCATCTTCCT  96 111 688680 3621 3638  195  212 CACAGAACCTTCATCTTC  88 112 688681 3623 3640  197  214 CCCACAGAACCTTCATCT  78 113 688682 3625 3642  199  216 AGCCCACAGAACCTTCAT  80 114 688683 3627 3644  201  218 GCAGCCCACAGAACCTTC 101 115 688684 3629 3646  203  220 ACGCAGCCCACAGAACCT  97 116 688685 3631 3648  205  222 CAACGCAGCCCACAGAAC 102 117 688686 3633 3650  207  224 AGCAACGCAGCCCACAGA  94 118 688687 3635 3652  209  226 CCAGCAACGCAGCCCACA  68 119 688688 3637 3654  211  228 GACCAGCAACGCAGCCCA  80 120 688689 3639 3656  213  230 GTGACCAGCAACGCAGCC 109 121 688690 3641 3658  215  232 ATGTGACCAGCAACGCAG 113 122 688691 3645 3662  219  236 AGGAATGTGACCAGCAAC  93 123 688692 3647 3664  221  238 CCAGGAATGTGACCAGCA 100 124 688693 3649 3666  223  240 TGCCAGGAATGTGACCAG 105 125 688694 3651 3668  225  242 CCTGCCAGGAATGTGACC 123 126 688695 N/A N/A  227  244 ATCCTGCCAGGAATGTGA 122 127 688696 N/A N/A  229  246 GCATCCTGCCAGGAATGT 112 128 688697 N/A N/A  231  248 TGGCATCCTGCCAGGAAT 112 129 688698 N/A N/A  233  250 CCTGGCATCCTGCCAGGA  99 130 688699 N/A N/A  235  252 GGCCTGGCATCCTGCCAG  90 131 688700 4757 4774  239  256 CCTTGGCCTGGCATCCTG 105 132 688701 4759 4776  241  258 CACCTTGGCCTGGCATCC 132 133 688702 4761 4778  243  260 TCCACCTTGGCCTGGCAT 132 134 688703 4763 4780  245  262 GCTCCACCTTGGCCTGGC 121 135 688704 4765 4782  247  264 TTGCTCCACCTTGGCCTG 112 136 688705 4767 4784  249  266 GCTTGCTCCACCTTGGCC 119 137 688706 4769 4786  251  268 CCGCTTGCTCCACCTTGG 111 138 688707 4773 4790  255  272 TCCACCGCTTGCTCCACC 118 139 688708 4775 4792  257  274 TCTCCACCGCTTGCTCCA 120 140 688709 4777 4794  259  276 TGTCTCCACCGCTTGCTC 155 141 688710 4779 4796  261  278 TCTGTCTCCACCGCTTGC 104 142 688711 4781 4798  263  280 GCTCTGTCTCCACCGCTT  53 143 688712 4783 4800  265  282 CGGCTCTGTCTCCACCGC  68 144 688713 4785 4802  267  284 TCCGGCTCTGTCTCCACC  81 145 688714 4787 4804  269  286 GCTCCGGCTCTGTCTCCA  71 146 688715 4791 4808  273  290 TCGGGCTCCGGCTCTGTC 110 147 688716 4794 4811  276  293 AGCTCGGGCTCCGGCTCT  83 148 688717 4796 4813  278  295 GCAGCTCGGGCTCCGGCT  88 149 688718 4798 4815  280  297 GCGCAGCTCGGGCTCCGG 134 150 688719 4800 4817  282  299 TGGCGCAGCTCGGGCTCC  90 151 688720 4802 4819  284  301 GCTGGCGCAGCTCGGGCT  98 152 688721 4804 4821  286  303 CTGCTGGCGCAGCTCGGG  86 153 688722 4806 4823  288  305 GTCTGCTGGCGCAGCTCG 113 154 688723 4808 4825  290  307 CGGTCTGCTGGCGCAGCT  97 155 688724 4810 4827  292  309 CTCGGTCTGCTGGCGCAG 103 156 688725 4812 4829  294  311 CACTCGGTCTGCTGGCGC  96 157 688726 4814 4831  296  313 GCCACTCGGTCTGCTGGC 100 158 688727 4816 4833  298  315 CTGCCACTCGGTCTGCTG 112 159 688728 4818 4835  300  317 CTCTGCCACTCGGTCTGC  75 160 688729 4820 4837  302  319 CGCTCTGCCACTCGGTCT  98 161 688730 4822 4839  304  321 GCCGCTCTGCCACTCGGT  86 162 688731 4824 4841  306  323 TGGCCGCTCTGCCACTCG 100 163 688732 4826 4843  308  325 GCTGGCCGCTCTGCCACT 109 164 688733 4828 4845  310  327 GCGCTGGCCGCTCTGCCA 125 165 688734 4842 4859  324  341 AGTGCCAGTTCCCAGCGC 127† 166 688735 4844 4861  326  343 CCAGTGCCAGTTCCCAGC 136† 167 688736 4848 4865  330  347 CGACCCAGTGCCAGTTCC  79† 168 689014 6255 6272 1157 1174 GCATGGCTGCAGGCTTCG  38 169 689016 6258 6275 1160 1177 GTCGCATGGCTGCAGGCT  28 170

TABLE-US-00004 TABLE 4 Reduction of APOE RNA by 5-8-5 MOE gapmers with mixed PO/PS internucleoside linkages at a concentration of 4000 nM in Hep3B cells plated at 20,000 cells per well SEQ ID SEQ ID SEQ ID SEQ ID No: 1 No: 1 No: 2 No: 2 APOE Compound Start Stop Start Stop (% SEQ ID Number Site Site Site Site Sequence (5′ to 3′) UTC) NO 426048 6254 6273 1156 1175 CGCATGGCTGCAGGCTTCGG  36  70 688737 4850 4867  332  349 AGCGACCCAGTGCCAGTT  42† 171 688738 4852 4869  334  351 AAAGCGACCCAGTGCCAG  59† 172 688739 4854 4871  336  353 CAAAAGCGACCCAGTGCC  60† 173 688740 4856 4873  338  355 CCCAAAAGCGACCCAGTG  32† 174 688741 4858 4875  340  357 ATCCCAAAAGCGACCCAG  39† 175 688742 4860 4877  342  359 TAATCCCAAAAGCGACCC  51† 176 688743 4862 4879  344  361 GGTAATCCCAAAAGCGAC  44† 177 688744 4866 4883  348  365 CGCAGGTAATCCCAAAAG  31† 178 688745 4868 4885  350  367 AGCGCAGGTAATCCCAAA  32† 179 688746 4870 4887  352  369 CCAGCGCAGGTAATCCCA  17† 180 688747 4872 4889  354  371 ACCCAGCGCAGGTAATCC  13† 181 688748 4874 4891  356  373 GCACCCAGCGCAGGTAAT  43† 182 688749 4876 4893  358  375 CTGCACCCAGCGCAGGTA  28† 183 688750 4878 4895  360  377 GTCTGCACCCAGCGCAGG  24† 184 688751 4881 4898  363  380 AGTGTCTGCACCCAGCGC  24† 185 688752 4882 4899  364  381 CAGTGTCTGCACCCAGCG  41† 186 688753 4884 4901  366  383 GACAGTGTCTGCACCCAG  42† 187 688754 4886 4903  368  385 CAGACAGTGTCTGCACCC  81† 188 688755 4888 4905  370  387 CTCAGACAGTGTCTGCAC  49† 189 688756 4890 4907  372  389 TGCTCAGACAGTGTCTGC  57† 190 688757 4894 4911  376  393 CACCTGCTCAGACAGTGT  43† 191 688758 4896 4913  378  395 TGCACCTGCTCAGACAGT  40† 192 688759 4898 4915  380  397 CCTGCACCTGCTCAGACA  12† 193 688760 4900 4917  382  399 CTCCTGCACCTGCTCAGA  17† 194 688761 4902 4919  384  401 TCCTCCTGCACCTGCTCA  11† 195 688762 4904 4921  386  403 GCTCCTCCTGCACCTGCT  16† 196 688763 4906 4923  388  405 CAGCTCCTCCTGCACCTG  13† 197 688764 4908 4925  390  407 AGCAGCTCCTCCTGCACC  46† 198 688765 4912 4929  394  411 GCTGAGCAGCTCCTCCTG  21† 199 688766 4914 4931  396  413 GAGCTGAGCAGCTCCTCC  52† 200 688767 4916 4933  398  415 GGGAGCTGAGCAGCTCCT  76† 201 688768 4918 4935  400  417 CTGGGAGCTGAGCAGCTC  31† 202 688769 4922 4939  404  421 TGACCTGGGAGCTGAGCA  51† 203 688770 4924 4941  406  423 GGTGACCTGGGAGCTGAG  20† 204 688771 4932 4949  414  431 AGTTCCTGGGTGACCTGG  43† 205 688772 4934 4951  416  433 TCAGTTCCTGGGTGACCT  82† 206 688773 4936 4953  418  435 CCTCAGTTCCTGGGTGAC  61† 207 688774 N/A N/A  420  437 GCCCTCAGTTCCTGGGTG  35† 208 688775 N/A N/A  422  439 GCGCCCTCAGTTCCTGGG  10† 209 688776 5545 5562  447  464 AACTCCTTCATGGTCTCG  85 210 688777 5549 5566  451  468 CTTCAACTCCTTCATGGT 115 211 688778 5551 5568  453  470 GCCTTCAACTCCTTCATG 101 212 688779 5553 5570  455  472 AGGCCTTCAACTCCTTCA  67 213 688780 5555 5572  457  474 GTAGGCCTTCAACTCCTT  84 214 688781 5559 5576  461  478 ATTTGTAGGCCTTCAACT  72 215 688782 5561 5578  463  480 CGATTTGTAGGCCTTCAA  45 216 688783 5563 5580  465  482 TCCGATTTGTAGGCCTTC  51 217 688784 5565 5582  467  484 GTTCCGATTTGTAGGCCT  57 218 688785 5567 5584  469  486 CAGTTCCGATTTGTAGGC  98 219 688786 5569 5586  471  488 TCCAGTTCCGATTTGTAG 102 220 688787 5571 5588  473  490 CCTCCAGTTCCGATTTGT  51 221 688788 5573 5590  475  492 TTCCTCCAGTTCCGATTT  68 222 688789 5575 5592  477  494 TGTTCCTCCAGTTCCGAT  83 223 688790 5577 5594  479  496 GTTGTTCCTCCAGTTCCG  70 224 688791 5579 5596  481  498 CAGTTGTTCCTCCAGTTC 115 225 688792 5581 5598  483  500 GTCAGTTGTTCCTCCAGT  82 226 688793 5583 5600  485  502 GGGTCAGTTGTTCCTCCA  62 227 688794 5599 5616  501  518 GTCTCCTCCGCCACCGGG  89 228 688795 5616 5633  518  535 TGGACAGCCGTGCCCGCG  58 229 688796 5618 5635  520  537 CTTGGACAGCCGTGCCCG  79 230 688797 5620 5637  522  539 TCCTTGGACAGCCGTGCC  80 231 688798 5622 5639  524  541 GCTCCTTGGACAGCCGTG  58 232 688799 5624 5641  526  543 CAGCTCCTTGGACAGCCG  92 233 688800 5626 5643  528  545 TGCAGCTCCTTGGACAGC  80 234 688801 5628 5645  530  547 CCTGCAGCTCCTTGGACA  92 235 688802 5632 5649  534  551 GCCGCCTGCAGCTCCTTG  69 236 688803 5634 5651  536  553 GCGCCGCCTGCAGCTCCT  80 237 688804 5636 5653  538  555 CTGCGCCGCCTGCAGCTC  71 238 688805 5638 5655  540  557 GCCTGCGCCGCCTGCAGC  99 239 688806 5640 5657  542  559 GGGCCTGCGCCGCCTGCA  81 240 688807 5642 5659  544  561 CCGGGCCTGCGCCGCCTG  88 241 688808 5644 5661  546  563 AGCCGGGCCTGCGCCGCC  67 242 688809 5648 5665  550  567 GCCCAGCCGGGCCTGCGC 114 243 688810 5650 5667  552  569 GCGCCCAGCCGGGCCTGC  65 244 688811 5652 5669  554  571 CCGCGCCCAGCCGGGCCT  58 245 688812 5654 5671  556  573 GTCCGCGCCCAGCCGGGC  75 246 689014 6255 6272 1157 1174 GCATGGCTGCAGGCTTCG  44 169 689016 6258 6275 1160 1177 GTCGCATGGCTGCAGGCT  27 170

TABLE-US-00005 TABLE 5 Reduction of APOE RNA by 5-8-5 MOE gapmers with mixed PO/PS internucleoside linkages at a concentration of 2000 nM in HepG2 cells plated at 20,000 cells per well SEQ ID SEQ ID SEQ ID SEQ ID No: 1 No: 1 No: 2 No: 2 APOE Compound Start Stop Start Stop (% SEQ ID Number Site Site Site Site Sequence (5′ to 3′) UTC) NO 426048 6254 6273 1156 1175 CGCATGGCTGCAGGCTTCGG  21  70 688813 5656 5673  558  575 ATGTCCGCGCCCAGCCGG 144 247 688814 5658 5675  560  577 CCATGTCCGCGCCCAGCC 112 248 688815 5660 5677  562  579 CTCCATGTCCGCGCCCAG  98 249 688816 5662 5679  564  581 TCCTCCATGTCCGCGCCC 102 250 688817 5664 5681  566  583 CGTCCTCCATGTCCGCGC 122 251 688818 5680 5697  582  599 ACCAGGCGGCCGCACACG  73 252 688819 5682 5699  584  601 GCACCAGGCGGCCGCACA  67 253 688820 5684 5701  586  603 CTGCACCAGGCGGCCGCA 126 254 688821 5686 5703  588  605 TACTGCACCAGGCGGCCG 131 255 688822 5688 5705  590  607 GGTACTGCACCAGGCGGC 119 256 688823 5690 5707  592  609 GCGGTACTGCACCAGGCG 108 257 688824 5692 5709  594  611 CCGCGGTACTGCACCAGG  89 258 688825 5694 5711  596  613 CGCCGCGGTACTGCACCA  79 259 688826 5698 5715  600  617 ACCTCGCCGCGGTACTGC 114 260 688827 5700 5717  602  619 GCACCTCGCCGCGGTACT 124 261 688828 5704 5721  606  623 GCCTGCACCTCGCCGCGG 110 262 688829 5706 5723  608  625 TGGCCTGCACCTCGCCGC 163 263 688830 5708 5725  610  627 CATGGCCTGCACCTCGCC  74 264 688831 5710 5727  612  629 AGCATGGCCTGCACCTCG  63 265 688832 5712 5729  614  631 CGAGCATGGCCTGCACCT  68 266 688833 5714 5731  616  633 GCCGAGCATGGCCTGCAC  86 267 688834 5716 5733  618  635 TGGCCGAGCATGGCCTGC 142 268 688835 5720 5737  622  639 GCTCTGGCCGAGCATGGC 112 269 688836 5722 5739  624  641 GTGCTCTGGCCGAGCATG  94 270 688837 5724 5741  626  643 CGGTGCTCTGGCCGAGCA 128 271 688838 5726 5743  628  645 CTCGGTGCTCTGGCCGAG  74 272 688839 5728 5745  630  647 TCCTCGGTGCTCTGGCCG 127 273 688840 5730 5747  632  649 GCTCCTCGGTGCTCTGGC  98 274 688841 5732 5749  634  651 CAGCTCCTCGGTGCTCTG 147 275 688842 5734 5751  636  653 CGCAGCTCCTCGGTGCTC 134 276 688843 5736 5753  638  655 CCCGCAGCTCCTCGGTGC 104 277 688844 5738 5755  640  657 CACCCGCAGCTCCTCGGT  92 278 688845 5740 5757  642  659 CGCACCCGCAGCTCCTCG 110 279 688846 5742 5759  644  661 GGCGCACCCGCAGCTCCT  84 280 688847 5744 5761  646  663 GAGGCGCACCCGCAGCTC 102 281 688848 5746 5763  648  665 GCGAGGCGCACCCGCAGC  61 282 688849 5748 5765  650  667 AGGCGAGGCGCACCCGCA 125 283 688850 5750 5767  652  669 GGAGGCGAGGCGCACCCG  93 284 688851 5752 5769  654  671 TGGGAGGCGAGGCGCACC 126 285 688852 5754 5771  656  673 GGTGGGAGGCGAGGCGCA 113 286 688853 5756 5773  658  675 CAGGTGGGAGGCGAGGCG 114 287 688854 5758 5775  660  677 CGCAGGTGGGAGGCGAGG 133 288 688855 5762 5779  664  681 CTTGCGCAGGTGGGAGGC  78 289 688856 5764 5781  666  683 AGCTTGCGCAGGTGGGAG 131 290 688857 5768 5785  670  687 ACGCAGCTTGCGCAGGTG  71 291 688858 5770 5787  672  689 TTACGCAGCTTGCGCAGG 120 292 688859 5772 5789  674  691 GCTTACGCAGCTTGCGCA  78 293 688860 5774 5791  676  693 CCGCTTACGCAGCTTGCG 143 294 688861 5776 5793  678  695 AGCCGCTTACGCAGCTTG  79 295 688862 5778 5795  680  697 GGAGCCGCTTACGCAGCT 131 296 688863 5782 5799  684  701 CGGAGGAGCCGCTTACGC 131 297 688864 5784 5801  686  703 CGCGGAGGAGCCGCTTAC  96 298 688865 5786 5803  688  705 ATCGCGGAGGAGCCGCTT 109 299 688866 5788 5805  690  707 GCATCGCGGAGGAGCCGC 107 300 688867 5790 5807  692  709 CGGCATCGCGGAGGAGCC  82 301 688868 5792 5809  694  711 ATCGGCATCGCGGAGGAG 122 302 688869 5796 5813  698  715 GGTCATCGGCATCGCGGA 131 303 688870 5798 5815  700  717 CAGGTCATCGGCATCGCG 104 304 688871 5801 5818  703  720 CTGCAGGTCATCGGCATC 123 305 688872 5802 5819  704  721 TCTGCAGGTCATCGGCAT  91 306 688873 5804 5821  706  723 CTTCTGCAGGTCATCGGC 102 307 688874 5806 5823  708  725 CGCTTCTGCAGGTCATCG 101 308 688875 5821 5838  723  740 TGGTACACTGCCAGGCGC  87 309 688876 5823 5840  725  742 CCTGGTACACTGCCAGGC 148 310 688877 5825 5842  727  744 GGCCTGGTACACTGCCAG 104 311 688878 5827 5844  729  746 CCGGCCTGGTACACTGCC 137 312 688879 5829 5846  731  748 CCCCGGCCTGGTACACTG  81 313 688880 5831 5848  733  750 GGCCCCGGCCTGGTACAC  81 314 688881 5833 5850  735  752 CGGGCCCCGGCCTGGTAC  87 315 688882 5835 5852  737  754 CGCGGGCCCCGGCCTGGT 104 316 688883 5837 5854  739  756 CTCGCGGGCCCCGGCCTG 105 317 688884 5839 5856  741  758 CCCTCGCGGGCCCCGGCC 126 318 688885 5841 5858  743  760 CGCCCTCGCGGGCCCCGG  88 319 688886 5856 5873  758  775 TGAGGCCGCGCTCGGCGC  62 320 688887 5858 5875  760  777 GCTGAGGCCGCGCTCGGC 100 321 688888 5860 5877  762  779 GCGCTGAGGCCGCGCTCG  87 322 689014 6255 6272 1157 1174 GCATGGCTGCAGGCTTCG  13 169 689016 6258 6275 1160 1177 GTCGCATGGCTGCAGGCT  15 170

TABLE-US-00006 TABLE 6 Reduction of APOE RNA by 5-8-5 MOE gapmers with mixed PO/PS internucleoside linkages at a concentration of 2000 nM in HepG2 cells plated at 20,000 cells per well SEQ ID SEQ ID SEQ ID SEQ ID No: 1 No: 1 No: 2 No: 2 APOE Compound Start Stop Start Stop (% SEQ ID Number Site Site Site Site Sequence (5′ to 3′) UTC) NO 426048 6254 6273 1156 1175 CGCATGGCTGCAGGCTTCGG  23  70 688889 5898 5915  800  817 GGCCCTGTTCCACCAGGG 145 323 688890 5900 5917  802  819 GCGGCCCTGTTCCACCAG 149 324 688891 5902 5919  804  821 ACGCGGCCCTGTTCCACC  98 325 688892 5904 5921  806  823 GCACGCGGCCCTGTTCCA 107 326 688893 5906 5923  808  825 CCGCACGCGGCCCTGTTC 163 327 688894 5908 5925  810  827 GCCCGCACGCGGCCCTGT 128 328 688895 5910 5927  812  829 CGGCCCGCACGCGGCCCT  79 329 688896 5912 5929  814  831 GGCGGCCCGCACGCGGCC 103 330 688897 5914 5931  816  833 GTGGCGGCCCGCACGCGG 118 331 688898 5916 5933  818  835 CAGTGGCGGCCCGCACGC 143 332 688899 5918 5935  820  837 CACAGTGGCGGCCCGCAC  97 333 688900 5920 5937  822  839 CCCACAGTGGCGGCCCGC  65 334 688901 5922 5939  824  841 AGCCCACAGTGGCGGCCC  96 335 688902 5924 5941  826  843 GGAGCCCACAGTGGCGGC  92 336 688903 5928 5945  830  847 CCAGGGAGCCCACAGTGG  87 337 688904 5930 5947  832  849 GGCCAGGGAGCCCACAGT 114 338 688905 5932 5949  834  851 CCGGCCAGGGAGCCCACA 125 339 688906 5934 5951  836  853 GGCCGGCCAGGGAGCCCA  72 340 688907 5936 5953  838  855 CTGGCCGGCCAGGGAGCC 128 341 688908 5938 5955  840  857 GGCTGGCCGGCCAGGGAG  95 342 688909 5941 5958  843  860 AGCGGCTGGCCGGCCAGG  64 343 688910 5943 5960  845  862 GTAGCGGCTGGCCGGCCA 105 344 688911 5945 5962  847  864 CTGTAGCGGCTGGCCGGC 117 345 688912 5947 5964  849  866 TCCTGTAGCGGCTGGCCG 110 346 688913 5949 5966  851  868 GCTCCTGTAGCGGCTGGC  63 347 688914 5951 5968  853  870 CCGCTCCTGTAGCGGCTG 109 348 688915 5955 5972  857  874 GGGCCCGCTCCTGTAGCG  90 349 688916 5957 5974  859  876 CTGGGCCCGCTCCTGTAG 148 350 688917 5959 5976  861  878 GCCTGGGCCCGCTCCTGT  98 351 688918 5961 5978  863  880 AGGCCTGGGCCCGCTCCT 111 352 688919 5963 5980  865  882 CCAGGCCTGGGCCCGCTC 137 353 688920 5965 5982  867  884 CCCCAGGCCTGGGCCCGC 111 354 688921 5967 5984  869  886 CGCCCCAGGCCTGGGCCC 102 355 688922 5971 5988  873  890 CGCTCGCCCCAGGCCTGG 117 356 688923 5973 5990  875  892 GCCGCTCGCCCCAGGCCT  90 357 688924 5975 5992  877  894 CAGCCGCTCGCCCCAGGC 108 358 688925 5977 5994  879  896 CGCAGCCGCTCGCCCCAG 108 359 688926 5979 5996  881  898 CGCGCAGCCGCTCGCCCC  63 360 688927 5981 5998  883  900 CGCGCGCAGCCGCTCGCC 129 361 688928 5983 6000  885  902 CGCGCGCGCAGCCGCTCG 102 362 688929 5985 6002  887  904 TCCGCGCGCGCAGCCGCT  67 363 688930 5987 6004  889  906 CATCCGCGCGCGCAGCCG  74 364 688931 5989 6006  891  908 TCCATCCGCGCGCGCAGC 106 365 688932 5991 6008  893  910 CCTCCATCCGCGCGCGCA 119 366 688933 5993 6010  895  912 CTCCTCCATCCGCGCGCG 104 367 688934 5995 6012  897  914 ATCTCCTCCATCCGCGCG 118 368 688935 5997 6014  899  916 CCATCTCCTCCATCCGCG 114 369 688936 5999 6016  901  918 GCCCATCTCCTCCATCCG 103 370 688937 6003 6020  905  922 GGCTGCCCATCTCCTCCA 101 371 688938 6005 6022  907  924 CCGGCTGCCCATCTCCTC  83 372 688939 6007 6024  909  926 GTCCGGCTGCCCATCTCC  68 373 688940 6009 6026  911  928 GGGTCCGGCTGCCCATCT 101 374 688941 6011 6028  913  930 GCGGGTCCGGCTGCCCAT 106 375 688942 6013 6030  915  932 TCGCGGGTCCGGCTGCCC 133 376 688943 6015 6032  917  934 GGTCGCGGGTCCGGCTGC 134 377 688944 6017 6034  919  936 GCGGTCGCGGGTCCGGCT  88 378 688945 6019 6036  921  938 AGGCGGTCGCGGGTCCGG 105 379 688946 6021 6038  923  940 CCAGGCGGTCGCGGGTCC 102 380 688947 6023 6040  925  942 GTCCAGGCGGTCGCGGGT  64 381 688948 6040 6057  942  959 ACCTGCTCCTTCACCTCG  94 382 688949 6042 6059  944  961 CCACCTGCTCCTTCACCT 129 383 688950 6044 6061  946  963 CGCCACCTGCTCCTTCAC  99 384 688951 6046 6063  948  965 TCCGCCACCTGCTCCTTC 168 385 688952 6048 6065  950  967 CCTCCGCCACCTGCTCCT  69 386 688953 6050 6067  952  969 CACCTCCGCCACCTGCTC 130 387 688954 6052 6069  954  971 CGCACCTCCGCCACCTGC  59 388 688955 6054 6071  956  973 CGCGCACCTCCGCCACCT  88 389 688956 6056 6073  958  975 GGCGCGCACCTCCGCCAC  86 390 688957 6058 6075  960  977 TTGGCGCGCACCTCCGCC 122 391 688958 6060 6077  962  979 GCTTGGCGCGCACCTCCG 115 392 688959 6062 6079  964  981 CAGCTTGGCGCGCACCTC  83 393 688960 6066 6083  968  985 CCTCCAGCTTGGCGCGCA 138 394 688961 6068 6085  970  987 CTCCTCCAGCTTGGCGCG  53 395 688962 6070 6087  972  989 TGCTCCTCCAGCTTGGCG  83 396 688963 6072 6089  974  991 CCTGCTCCTCCAGCTTGG  55 397 688964 6074 6091  976  993 GGCCTGCTCCTCCAGCTT  84 398 689014 6255 6272 1157 1174 GCATGGCTGCAGGCTTCG  21 169 689016 6258 6275 1160 1177 GTCGCATGGCTGCAGGCT  21 170

TABLE-US-00007 TABLE 7 Reduction of APOE RNA by 5-8-5 MOE gapmers with mixed PO/PS internucleoside linkages at a concentration of 2000 nM in Hep3B cells plated at 20,000 cells per well SEQ ID SEQ ID SEQ ID SEQ ID No: 1 No: 1 No: 2 No: 2 APOE Compound Start Stop Start Stop (% SEQ ID Number Site Site Site Site Sequence (5′ to 3′) UTC) NO 426048 6254 6273 1156 1175 CGCATGGCTGCAGGCTTCGG  19  70 688965 6076 6093  978  995 TGGGCCTGCTCCTCCAGC  92 399 688966 6078 6095  980  997 GCTGGGCCTGCTCCTCCA  76 400 688967 6080 6097  982  999 CTGCTGGGCCTGCTCCTC  90 401 688968 6082 6099  984 1001 ATCTGCTGGGCCTGCTCC  90 402 688969 6084 6101  986 1003 GTATCTGCTGGGCCTGCT  79 403 688970 6101 6118 1003 1020 GGCCTCGGCCTGCAGGCG  84 404 688971 6103 6120 1005 1022 AAGGCCTCGGCCTGCAGG  92 405 688972 6105 6122 1007 1024 GGAAGGCCTCGGCCTGCA  96 406 688973 6107 6124 1009 1026 CTGGAAGGCCTCGGCCTG  88 407 688974 6109 6126 1011 1028 GCCTGGAAGGCCTCGGCC  78 408 688975 6111 6128 1013 1030 GGGCCTGGAAGGCCTCGG  82 409 688976 6113 6130 1015 1032 GCGGGCCTGGAAGGCCTC  75 410 688977 6115 6132 1017 1034 AGGCGGGCCTGGAAGGCC  77 411 688978 6117 6134 1019 1036 TGAGGCGGGCCTGGAAGG  81 412 688979 6119 6136 1021 1038 CTTGAGGCGGGCCTGGAA  79 413 688980 6123 6140 1025 1042 AGCTCTTGAGGCGGGCCT  78 414 688981 6125 6142 1027 1044 CCAGCTCTTGAGGCGGGC  84 415 688982 6127 6144 1029 1046 AACCAGCTCTTGAGGCGG  85 416 688983 6129 6146 1031 1048 CGAACCAGCTCTTGAGGC 117 417 688984 6131 6148 1033 1050 CTCGAACCAGCTCTTGAG  66 418 688985 6133 6150 1035 1052 GGCTCGAACCAGCTCTTG  76 419 688986 6150 6167 1052 1069 GCATGTCTTCCACCAGGG  72 420 688987 6152 6169 1054 1071 CTGCATGTCTTCCACCAG  80 421 688988 6154 6171 1056 1073 CGCTGCATGTCTTCCACC  69 422 688989 6169 6186 1071 1088 AGCCCGGCCCACTGGCGC  76 423 688990 6171 6188 1073 1090 CCAGCCCGGCCCACTGGC  82 424 688991 6173 6190 1075 1092 CACCAGCCCGGCCCACTG  74 425 688992 6175 6192 1077 1094 TCCACCAGCCCGGCCCAC 108 426 688993 6177 6194 1079 1096 TCTCCACCAGCCCGGCCC 223 427 688994 6179 6196 1081 1098 CTTCTCCACCAGCCCGGC  75 428 688995 6181 6198 1083 1100 ACCTTCTCCACCAGCCCG 101 429 688996 6185 6202 1087 1104 CTGCACCTTCTCCACCAG  99 430 688997 6187 6204 1089 1106 GCCTGCACCTTCTCCACC  89 431 688998 6189 6206 1091 1108 CAGCCTGCACCTTCTCCA  80 432 688999 6191 6208 1093 1110 GGCAGCCTGCACCTTCTC  57 433 689000 6193 6210 1095 1112 ACGGCAGCCTGCACCTTC  90 434 689001 6195 6212 1097 1114 CCACGGCAGCCTGCACCT  74 435 689002 6197 6214 1099 1116 GCCCACGGCAGCCTGCAC  93 436 689003 6199 6216 1101 1118 GTGCCCACGGCAGCCTGC  51 437 689004 6201 6218 1103 1120 TGGTGCCCACGGCAGCCT  79 438 689005 6203 6220 1105 1122 GCTGGTGCCCACGGCAGC  78 439 689006 6205 6222 1107 1124 GCGCTGGTGCCCACGGCA  61 440 689007 6227 6244 1129 1146 ATTGTCGCTGGGCACAGG  88 441 689008 6229 6246 1131 1148 TGATTGTCGCTGGGCACA  83 442 689009 6231 6248 1133 1150 AGTGATTGTCGCTGGGCA  56 443 689010 6233 6250 1135 1152 TCAGTGATTGTCGCTGGG 100 444 689011 6235 6252 1137 1154 GTTCAGTGATTGTCGCTG  91 445 689012 6252 6269 1154 1171 TGGCTGCAGGCTTCGGCG  72 446 689013 6254 6271 1156 1173 CATGGCTGCAGGCTTCGG  32 447 689014 6255 6272 1157 1174 GCATGGCTGCAGGCTTCG  50 169 689015 6257 6274 1159 1176 TCGCATGGCTGCAGGCTT  19 448 689016 6258 6275 1160 1177 GTCGCATGGCTGCAGGCT  33 170 689017 6260 6277 1162 1179 GGGTCGCATGGCTGCAGG  41 449 689018 6286 6303 1188 1205 GGAGGCAGGAGGCACGGG  91 450 689019 6288 6305 1190 1207 GCGGAGGCAGGAGGCACG  82 451 689020 6290 6307 1192 1209 GCGCGGAGGCAGGAGGCA  65 452 689021 6292 6309 1194 1211 CTGCGCGGAGGCAGGAGG  69 453 689022 6294 6311 1196 1213 GGCTGCGCGGAGGCAGGA  86 454 689023 6296 6313 1198 1215 CAGGCTGCGCGGAGGCAG  56 455 689024 6298 6315 1200 1217 TGCAGGCTGCGCGGAGGC  92 456 689025 6300 6317 1202 1219 GCTGCAGGCTGCGCGGAG  75 457 689026 6302 6319 1204 1221 CCGCTGCAGGCTGCGCGG  78 458 689027 6304 6321 1206 1223 TCCCGCTGCAGGCTGCGC  53 459 689028 6306 6323 1208 1225 TCTCCCGCTGCAGGCTGC  37 460 689029 6308 6325 1210 1227 GGTCTCCCGCTGCAGGCT  42 461 689030 6310 6327 1212 1229 AGGGTCTCCCGCTGCAGG  70 462 689031 6312 6329 1214 1231 ACAGGGTCTCCCGCTGCA  68 463 689032 6314 6331 1216 1233 GGACAGGGTCTCCCGCTG  61 464 689033 6336 6353 1238 1255 CCCAGGAGGACGGCTGGG  86 465 689034 6338 6355 1240 1257 ACCCCAGGAGGACGGCTG 105 466 689035 6340 6357 1242 1259 CCACCCCAGGAGGACGGC  80 467 689036 6342 6359 1244 1261 GTCCACCCCAGGAGGACG  82 468 689037 6344 6361 1246 1263 GGGTCCACCCCAGGAGGA  97 469 689038 6346 6363 1248 1265 TAGGGTCCACCCCAGGAG  66 470 689039 6348 6365 1250 1267 ACTAGGGTCCACCCCAGG  79 471 689040 6352 6369 1254 1271 TTAAACTAGGGTCCACCC  61 472 689041 6354 6371 1256 1273 TATTAAACTAGGGTCCAC  79 473 689042 6356 6373 1258 1275 TTTATTAAACTAGGGTCC  58 474

TABLE-US-00008 TABLE 8 Reduction of APOE RNA by 5-8-5 MOE gapmers with mixed PO/PS internucleoside linkages at a concentration of 2000 nM in HepG2 cells plated at 20,000 cells per well SEQ ID SEQ ID SEQ ID SEQ ID No: 1 No: 1 No: 2 No: 2 APOE Compound Start Stop Start Stop (% SEQ ID Number Site Site Site Site Sequence (5′ to 3′) UTC) NO 426048 6254 6273 1156 1175 CGCATGGCTGCAGGCTTCGG  37  70 689014 6255 6272 1157 1174 GCATGGCTGCAGGCTTCG  33 169 689016 6258 6275 1160 1177 GTCGCATGGCTGCAGGCT  14 170 689043 6358 6375 1260 1277 TCTTTATTAAACTAGGGT  23 475 689044 6360 6377 1262 1279 AATCTTTATTAAACTAGG  39 476 689045 6362 6379 1264 1281 TGAATCTTTATTAAACTA 103 477 689046 6364 6381 1266 1283 GGTGAATCTTTATTAAAC  12 478 689047 6366 6383 1268 1285 TTGGTGAATCTTTATTAA  33 479 689048 6368 6385 1270 1287 ACTTGGTGAATCTTTATT  28 480 689049 6370 6387 1272 1289 AAACTTGGTGAATCTTTA  41 481 689050 6372 6389 1274 1291 TGAAACTTGGTGAATCTT  29 482 689051 6374 6391 1276 1293 CGTGAAACTTGGTGAATC  22 483 689052 3652 3669 N/A N/A ACCTGCCAGGAATGTGAC 113 484 689053 3667 3684 N/A N/A AAGCCCCGCCCCCATACC  69 485 689054 3708 3725 N/A N/A TGAGGTGAGGATGAGAGG 101 486 689055 3737 3754 N/A N/A CAGGGTCTGCCTGAATGG 101 487 689056 3759 3776 N/A N/A AGAAGCCTCAGAAGAGGG 116 488 689057 3774 3791 N/A N/A GCCAGGAAGCAGCACAGA 130 489 689058 3789 3806 N/A N/A AAATCGCTGTTCAGAGCC 107 490 689059 3809 3826 N/A N/A ACCGAGGCCCAGAGAGCG 128 491 689060 3831 3848 N/A N/A TCCTATCTCAAGGATGGG 125 492 689061 3846 3863 N/A N/A AAAACAACTTCTAACTCC 102 493 689062 4119 4136 N/A N/A TCGAAACGGGCAGATCAC  56 494 689063 4172 4189 N/A N/A AACTCCCAGCCAGGTGCG 117 495 689064 4187 4204 N/A N/A GCATTAGAAACCTCTAAC 101 496 689065 4202 4219 N/A N/A CTATCTGCCTGCAATGCA  82 497 689066 4232 4249 N/A N/A AGATCACAGCTGCCCCGT 109 498 689067 4247 4264 N/A N/A GGTGATGGAGAATAAAGA 118 499 689068 4266 4283 N/A N/A CCAGGCAGGGCTGTGTGG  89 500 689069 4281 4298 N/A N/A GTGTCCTTGTGTGCCCCA  54 501 689070 4296 4313 N/A N/A AAAAGCATGTATTGAGTG  56 502 689071 4460 4477 N/A N/A GCACAGGTGTGTGGCACC  70 503 689072 4536 4553 N/A N/A CTGAACATGGTTCACTGC 103 504 689073 4586 4603 N/A N/A GTATTTATAAACAGGGTC  96 505 689074 4601 4618 N/A N/A CTTGGAAAGCATTATGTA 130 506 689075 4616 4633 N/A N/A GAGTCGGTTTAATCACTT  85 507 689076 4643 4660 N/A N/A GGAGCCATGGTGGGCAGG  69 508 689077 4658 4675 N/A N/A CACAAATGCTTCTTTGGA  68 509 689078 4673 4690 N/A N/A ACACAGAAGGTGCTCCAC 111 510 689079 4693 4710 N/A N/A GGCATCTAGTACCTAGGG  81 511 689080 4708 4725 N/A N/A TTCTGACCCCGTCCAGGC  65 512 689081 4730 4747 N/A N/A AGTTCAAGGTGGGTCAGG  83 513 689082 4745 4762 N/A N/A ATCCTGTGTGGAACAAGT  77 514 689083 4937 4954 N/A N/A ACCTCAGTTCCTGGGTGA  76† 515 689084 4963 4980 N/A N/A GGTCAAGGGCCAGGATGG  93† 516 689085 4978 4995 N/A N/A GCCGCCCACCAGGAGGGT 132† 517 689086 5004 5021 N/A N/A ATGAAACCTGGACCTGGG 126† 518 689087 5027 5044 N/A N/A CAAGACTTAGCGACAGGG 110† 519 689088 5042 5059 N/A N/A GAGACCCAGGCCCCCCAA 120† 520 689089 5057 5074 N/A N/A AAGCTAGAACCAGCAGAG  82† 521 689090 5073 5090 N/A N/A CAGAAATGGGAAGAGGAA  46† 522 689091 5088 5105 N/A N/A GCTAAAGCCAGGAGTCAG 116† 523 689092 5103 5120 N/A N/A AGAGAATTCCAGAGAGCT 100† 524 689093 5118 5135 N/A N/A AGACAAAGCTGAGAGAGA 103† 525 689094 5136 5153 N/A N/A TCAGAAGGGAAGAGAGAG  95† 526 689095 5151 5168 N/A N/A GTGTGAGAGACTGAGTCA 102† 527 689096 5166 5183 N/A N/A ACAGAGCCAGGACGAGTG  65† 528 689097 5181 5198 N/A N/A TAGGGAAGGACAGAGACA  75† 529 689098 5196 5213 N/A N/A TCTATATAAAAGAGCTAG 108† 530 689099 5213 5230 N/A N/A GACCCCATCTCTCTGTCT  56† 531 689100 5323 5340 N/A N/A TAGGAGGCCGGGCAAGGT  88† 532 689101 5338 5355 N/A N/A AGACGAAGAAGGAGCTAG  99† 533 689102 5353 5370 N/A N/A AGAGGGCAGAGGCAGAGA  42† 534 689103 5368 5385 N/A N/A GCAGAGAGCAGATGCAGA  80† 535 689104 5392 5409 N/A N/A CGAGAGAAGGAGACAGAG 104† 536 689105 5436 5453 N/A N/A GAGCCAGAGAGACCCAAG 102† 537 689106 5490 5507 N/A N/A TCGCACAGTGGGAGGCGG  61† 538 689107 5515 5532 N/A N/A CTGCGGCCGAGAGGGCGG  90† 539 689108 2831 2848   83  100 TTCTCACCGGCTCCTGGG  99 540 689109 2864 2881  116  133 CCCCTGAGCTCATCCCCG 128 541 689117 6236 6253 1138 1155 CGTTCAGTGATTGTCGCT  86 542 689118 6256 6273 1158 1175 CGCATGGCTGCAGGCTTC   8 543

TABLE-US-00009 TABLE 9 Reduction of APOE RNA by 5-8-5 MOE gapmers with mixed PO/PS internucleoside linkages at a concentration of 4000 nM in Hep3B cells plated at 20,000 cells per well SEQ ID SEQ ID SEQ ID SEQ ID No: 1 No: 1 No: 2 No: 2 APOE Compound Start Stop Start Stop (% SEQ ID Number Site Site Site Site Sequence (5′ to 3′) UTC) NO 689014 6255 6272 1157 1174 GCATGGCTGCAGGCTTCG  43 169 689015 6257 6274 1159 1176 TCGCATGGCTGCAGGCTT  34 448 689046 6364 6381 1266 1283 GGTGAATCTTTATTAAAC  27 478 689047 6366 6383 1268 1285 TTGGTGAATCTTTATTAA  65 479 689048 6368 6385 1270 1287 ACTTGGTGAATCTTTATT  35 480 689049 6370 6387 1272 1289 AAACTTGGTGAATCTTTA  36 481 689050 6372 6389 1274 1291 TGAAACTTGGTGAATCTT  37 482 689051 6374 6391 1276 1293 CGTGAAACTTGGTGAATC  40 483 729667 6237 6254 1139 1156 GCGTTCAGTGATTGTCGC  77 544 729669 6239 6256 1141 1158 CGGCGTTCAGTGATTGTC  61 545 729671 6241 6258 1143 1160 TTCGGCGTTCAGTGATTG  86 546 729673 6243 6260 1145 1162 GCTTCGGCGTTCAGTGAT  77 547 729675 6245 6262 1147 1164 AGGCTTCGGCGTTCAGTG  83 548 729677 6247 6264 1149 1166 GCAGGCTTCGGCGTTCAG  72 549 729679 6249 6266 1151 1168 CTGCAGGCTTCGGCGTTC  70 550 729681 6251 6268 1153 1170 GGCTGCAGGCTTCGGCGT 105 551 729682 6253 6270 1155 1172 ATGGCTGCAGGCTTCGGC  52 552 729683 6259 6276 1161 1178 GGTCGCATGGCTGCAGGC  54 553 729684 6287 6304 1189 1206 CGGAGGCAGGAGGCACGG  83 554 729685 6289 6306 1191 1208 CGCGGAGGCAGGAGGCAC  75 555 729686 6291 6308 1193 1210 TGCGCGGAGGCAGGAGGC  82 556 729687 6293 6310 1195 1212 GCTGCGCGGAGGCAGGAG  78 557 729688 6295 6312 1197 1214 AGGCTGCGCGGAGGCAGG  64 558 729689 6297 6314 1199 1216 GCAGGCTGCGCGGAGGCA  72 559 729690 6299 6316 1201 1218 CTGCAGGCTGCGCGGAGG  85 560 729691 6301 6318 1203 1220 CGCTGCAGGCTGCGCGGA  83 561 729692 6303 6320 1205 1222 CCCGCTGCAGGCTGCGCG  83 562 729693 6305 6322 1207 1224 CTCCCGCTGCAGGCTGCG  59 563 729694 6307 6324 1209 1226 GTCTCCCGCTGCAGGCTG  56 564 729695 6309 6326 1211 1228 GGGTCTCCCGCTGCAGGC  67 565 729696 6311 6328 1213 1230 CAGGGTCTCCCGCTGCAG  63 566 729697 6313 6330 1215 1232 GACAGGGTCTCCCGCTGC  69 567 729698 6337 6354 1239 1256 CCCCAGGAGGACGGCTGG  85 568 729699 6339 6356 1241 1258 CACCCCAGGAGGACGGCT  95 569 729700 6341 6358 1243 1260 TCCACCCCAGGAGGACGG  96 570 729701 6343 6360 1245 1262 GGTCCACCCCAGGAGGAC 101 571 729702 6345 6362 1247 1264 AGGGTCCACCCCAGGAGG  87 572 729703 6347 6364 1249 1266 CTAGGGTCCACCCCAGGA  92 573 729704 6349 6366 1251 1268 AACTAGGGTCCACCCCAG  73 574 729706 6351 6368 1253 1270 TAAACTAGGGTCCACCCC  84 575 729707 6353 6370 1255 1272 ATTAAACTAGGGTCCACC  63 576 729708 6355 6372 1257 1274 TTATTAAACTAGGGTCCA  59 577 729709 6357 6374 1259 1276 CTTTATTAAACTAGGGTC  30 578 729710 6359 6376 1261 1278 ATCTTTATTAAACTAGGG  46 579 729711 6361 6378 1263 1280 GAATCTTTATTAAACTAG  36 580 729712 6363 6380 1265 1282 GTGAATCTTTATTAAACT  45 581 729719 6376 6393 1278 1295 TGCGTGAAACTTGGTGAA  45 582 1517923 6263 6280 1165 1182 GTGGGGTCGCATGGCTGC  62 583 1517925 6321 6338 1223 1240 GGGGCGGGGACAGGGTCT  98 584 1517934 6273 6290 1175 1192 ACGGGGTGGCGTGGGGTC 103 585 1517936 6333 6350 1235 1252 AGGAGGACGGCTGGGGCG 117 586 1517938 6329 6346 1231 1248 GGACGGCTGGGGCGGGGA 107 587 1517940 3338 3355 N/A N/A CAAATTCCATCCCCCCAC 102 588 1517958 3431 3448 N/A N/A CCCATTCCCTATTTAACT  97 589 1517963 6279 6296 1181 1198 GGAGGCACGGGGTGGCGT 101 590 1517974 3517 3534 N/A N/A CCGGCCTCACCCCAGGTT  99 591 1517975 3425 3442 N/A N/A CCCTATTTAACTCCCTCC  94 592 1517981 3271 3288 N/A N/A TCTCCCTTCACATTCTAA  92 593 1517986 6315 6332 1217 1234 GGGACAGGGTCTCCCGCT  74 594 1517987 6277 6294 1179 1196 AGGCACGGGGTGGCGTGG  88 595 1517997 6325 6342 1227 1244 GGCTGGGGCGGGGACAGG 100 596 1518001 6267 6284 1169 1186 TGGCGTGGGGTCGCATGG  66 597 1518004 3284 3301 N/A N/A TCGCATTCCTCATTCTCC  96 598 1518008 6323 6340 1225 1242 CTGGGGCGGGGACAGGGT 108 599 1518010 6335 6352 1237 1254 CCAGGAGGACGGCTGGGG  96 600 1518014 6317 6334 1219 1236 CGGGGACAGGGTCTCCCG 103 601 1518029 6269 6286 1171 1188 GGTGGCGTGGGGTCGCAT  79 602 1518030 6265 6282 1167 1184 GCGTGGGGTCGCATGGCT  49 603 1518039 6261 6278 1163 1180 GGGGTCGCATGGCTGCAG  69 604 1518041 6285 6302 1187 1204 GAGGCAGGAGGCACGGGG  99 605 1518046 6271 6288 1173 1190 GGGGTGGCGTGGGGTCGC  67 606 1518050 6283 6300 1185 1202 GGCAGGAGGCACGGGGTG 101 607 1518052 6319 6336 1221 1238 GGCGGGGACAGGGTCTCC  88 608 1518056 6327 6344 1229 1246 ACGGCTGGGGCGGGGACA  96 609 1518059 5552 5569  454  471 GGCCTTCAACTCCTTCAT  88 610 1518061 6275 6292 1177 1194 GCACGGGGTGGCGTGGGG  95 611 1518063 6281 6298 1183 1200 CAGGAGGCACGGGGTGGC  89 612 1518064 6331 6348 1233 1250 GAGGACGGCTGGGGCGGG 102 613

TABLE-US-00010 TABLE 10 Reduction of APOE RNA by 5-8-5 MOE gapmers with mixed PO/PS internucleoside linkages at a concentration of 4000 nM in Hep3B cells plated at 20,000 cells per well SEQ ID SEQ ID SEQ ID SEQ ID No: 1 No: 1 No: 2 No: 2 APOE Compound Start Stop Start Stop (% SEQ ID Number Site Site Site Site Sequence (5′ to 3′) UTC) NO  689012 6252 6269 1154 1171 TGGCTGCAGGCTTCGGCG  89 446  689013 6254 6271 1156 1173 CATGGCTGCAGGCTTCGG  39 447  689016 6258 6275 1160 1177 GTCGCATGGCTGCAGGCT  39 170  689017 6260 6277 1162 1179 GGGTCGCATGGCTGCAGG  64 449  689018 6286 6303 1188 1205 GGAGGCAGGAGGCACGGG  80 450  689019 6288 6305 1190 1207 GCGGAGGCAGGAGGCACG  78 451  689020 6290 6307 1192 1209 GCGCGGAGGCAGGAGGCA  90 452  689021 6292 6309 1194 1211 CTGCGCGGAGGCAGGAGG  82 453  689022 6294 6311 1196 1213 GGCTGCGCGGAGGCAGGA  71 454  689023 6296 6313 1198 1215 CAGGCTGCGCGGAGGCAG  80 455  689024 6298 6315 1200 1217 TGCAGGCTGCGCGGAGGC  85 456  689025 6300 6317 1202 1219 GCTGCAGGCTGCGCGGAG  80 457  689026 6302 6319 1204 1221 CCGCTGCAGGCTGCGCGG  97 458  689027 6304 6321 1206 1223 TCCCGCTGCAGGCTGCGC  59 459  689028 6306 6323 1208 1225 TCTCCCGCTGCAGGCTGC  63 460  689029 6308 6325 1210 1227 GGTCTCCCGCTGCAGGCT  64 461  689030 6310 6327 1212 1229 AGGGTCTCCCGCTGCAGG  73 462  689031 6312 6329 1214 1231 ACAGGGTCTCCCGCTGCA  78 463  689032 6314 6331 1216 1233 GGACAGGGTCTCCCGCTG  73 464  689033 6336 6353 1238 1255 CCCAGGAGGACGGCTGGG 102 465  689034 6338 6355 1240 1257 ACCCCAGGAGGACGGCTG  92 466  689035 6340 6357 1242 1259 CCACCCCAGGAGGACGGC  95 467  689036 6342 6359 1244 1261 GTCCACCCCAGGAGGACG  98 468  689037 6344 6361 1246 1263 GGGTCCACCCCAGGAGGA  99 469  689038 6346 6363 1248 1265 TAGGGTCCACCCCAGGAG  96 470  689039 6348 6365 1250 1267 ACTAGGGTCCACCCCAGG  90 471  689040 6352 6369 1254 1271 TTAAACTAGGGTCCACCC  83 472  689041 6354 6371 1256 1273 TATTAAACTAGGGTCCAC  57 473  689042 6356 6373 1258 1275 TTTATTAAACTAGGGTCC  81 474  689043 6358 6375 1260 1277 TCTTTATTAAACTAGGGT  29 475  689044 6360 6377 1262 1279 AATCTTTATTAAACTAGG  46 476  689045 6362 6379 1264 1281 TGAATCTTTATTAAACTA  71 477  689046 6364 6381 1266 1283 GGTGAATCTTTATTAAAC  35 478  689117 6236 6253 1138 1155 CGTTCAGTGATTGTCGCT  81 542  689118 6256 6273 1158 1175 CGCATGGCTGCAGGCTTC  32 543  729668 6238 6255 1140 1157 GGCGTTCAGTGATTGTCG  70 614  729670 6240 6257 1142 1159 TCGGCGTTCAGTGATTGT  81 615  729672 6242 6259 1144 1161 CTTCGGCGTTCAGTGATT  81 616  729674 6244 6261 1146 1163 GGCTTCGGCGTTCAGTGA  73 617  729676 6246 6263 1148 1165 CAGGCTTCGGCGTTCAGT  80 618  729678 6248 6265 1150 1167 TGCAGGCTTCGGCGTTCA  73 619  729680 6250 6267 1152 1169 GCTGCAGGCTTCGGCGTT  83 620  729705 6350 6367 1252 1269 AAACTAGGGTCCACCCCA  93 621  729713 6365 6382 1267 1284 TGGTGAATCTTTATTAAA  58 622  729714 6367 6384 1269 1286 CTTGGTGAATCTTTATTA  36 623  729715 6369 6386 1271 1288 AACTTGGTGAATCTTTAT  50 624  729716 6371 6388 1273 1290 GAAACTTGGTGAATCTTT  48 625  729717 6373 6390 1275 1292 GTGAAACTTGGTGAATCT  41 626  729718 6375 6392 1277 1294 GCGTGAAACTTGGTGAAT  42 627 1517913 6278 6295 1180 1197 GAGGCACGGGGTGGCGTG  89 628 1517914 6328 6345 1230 1247 GACGGCTGGGGCGGGGAC 101 629 1517915 6316 6333 1218 1235 GGGGACAGGGTCTCCCGC  88 630 1517919 6272 6289 1174 1191 CGGGGTGGCGTGGGGTCG 105 631 1517931 3066 3083 N/A N/A ATGGCTTACATCCCAGTC 107 632 1517933 6282 6299 1184 1201 GCAGGAGGCACGGGGTGG  80 633 1517945 6334 6351 1236 1253 CAGGAGGACGGCTGGGGC 114 634 1517947 3340 3357 N/A N/A TTCAAATTCCATCCCCCC  99 635 1517955 6274 6291 1176 1193 CACGGGGTGGCGTGGGGT  94 636 1517960 6326 6343 1228 1245 CGGCTGGGGCGGGGACAG 119 637 1517965 6318 6335 1220 1237 GCGGGGACAGGGTCTCCC  88 638 1517968 6276 6293 1178 1195 GGCACGGGGTGGCGTGGG  83 639 1517971 6280 6297 1182 1199 AGGAGGCACGGGGTGGCG  96 640 1517973 6284 6301 1186 1203 AGGCAGGAGGCACGGGGT  98 641 1517990 6262 6279 1164 1181 TGGGGTCGCATGGCTGCA  58 642 1518000 6268 6285 1170 1187 GTGGCGTGGGGTCGCATG  87 643 1518002 6330 6347 1232 1249 AGGACGGCTGGGGCGGGG 105 644 1518006 6270 6287 1172 1189 GGGTGGCGTGGGGTCGCA  61 645 1518011 6266 6283 1168 1185 GGCGTGGGGTCGCATGGC  56 646 1518015 3429 3446 N/A N/A CATTCCCTATTTAACTCC  89 647 1518019 6320 6337 1222 1239 GGGCGGGGACAGGGTCTC  80 648 1518023 3283 3300 N/A N/A CGCATTCCTCATTCTCCC  95 649 1518024 3842 3859 N/A N/A CAACTTCTAACTCCTATC 119 650 1518032 3307 3324 N/A N/A CCGGTTCCATCTCAGTCC 124 651 1518036 6264 6281 1166 1183 CGTGGGGTCGCATGGCTG  81 652 1518043 6332 6349 1234 1251 GGAGGACGGCTGGGGCGG 113 653 1518045 6322 6339 1224 1241 TGGGGCGGGGACAGGGTC  99 654 1518057 3457 3474 N/A N/A CAGCACATTTACCAAGCC 111 655 1518062 6324 6341 1226 1243 GCTGGGGCGGGGACAGGG  90 656

TABLE-US-00011 TABLE 11 Reduction of APOE RNA by 5-8-5 MOE gapmers with mixed PO/PS internucleoside linkages at a concentration of 4000 nM in Hep3B cells plated at 5000 cells per well SEQ ID SEQ ID SEQ ID SEQ ID No: 1 No: 1 No: 2 No: 2 APOE Compound Start Stop Start Stop (% SEQ ID Number Site Site Site Site Sequence (5′ to 3′) UTC) NO 426048 6254 6273 1156 1175 CGCATGGCTGCAGGCTTCGG  56  70 688818 5680 5697  582  599 ACCAGGCGGCCGCACACG  83 252 688819 5682 5699  584  601 GCACCAGGCGGCCGCACA 120 253 688820 5684 5701  586  603 CTGCACCAGGCGGCCGCA 124 254 688874 5806 5823  708  725 CGCTTCTGCAGGTCATCG  83 308 688875 5821 5838  723  740 TGGTACACTGCCAGGCGC 117 309 689014 6255 6272 1157 1174 GCATGGCTGCAGGCTTCG  63 169 689015 6257 6274 1159 1176 TCGCATGGCTGCAGGCTT  49 448 689017 6260 6277 1162 1179 GGGTCGCATGGCTGCAGG  87 449 689029 6308 6325 1210 1227 GGTCTCCCGCTGCAGGCT  53 461 689046 6364 6381 1266 1283 GGTGAATCTTTATTAAAC  31 478 689118 6256 6273 1158 1175 CGCATGGCTGCAGGCTTC  11 543 693761 5667 5684  569  586 ACACGTCCTCCATGTCCG  81 657 693762 5668 5685  570  587 CACACGTCCTCCATGTCC  87 658 693763 5669 5686  571  588 GCACACGTCCTCCATGTC 104 659 693764 5670 5687  572  589 CGCACACGTCCTCCATGT  74 660 693765 5671 5688  573  590 CCGCACACGTCCTCCATG  89 661 693766 5672 5689  574  591 GCCGCACACGTCCTCCAT  74 662 693767 5673 5690  575  592 GGCCGCACACGTCCTCCA  85 663 693768 5674 5691  576  593 CGGCCGCACACGTCCTCC  66 664 693769 5675 5692  577  594 GCGGCCGCACACGTCCTC  66 665 693770 5676 5693  578  595 GGCGGCCGCACACGTCCT  69 666 693771 5677 5694  579  596 AGGCGGCCGCACACGTCC  94 667 693772 5678 5695  580  597 CAGGCGGCCGCACACGTC 106 668 693773 5679 5696  581  598 CCAGGCGGCCGCACACGT 101 669 693774 5681 5698  583  600 CACCAGGCGGCCGCACAC  85 670 693775 5683 5700  585  602 TGCACCAGGCGGCCGCAC 137 671 693776 5805 5822  707  724 GCTTCTGCAGGTCATCGG  85 672 693777 5807 5824  709  726 GCGCTTCTGCAGGTCATC 111 673 693778 5808 5825  710  727 GGCGCTTCTGCAGGTCAT 134 674 693779 5809 5826  711  728 AGGCGCTTCTGCAGGTCA  86 675 693780 5810 5827  712  729 CAGGCGCTTCTGCAGGTC  93 676 693781 5811 5828  713  730 CCAGGCGCTTCTGCAGGT 113 677 693782 5812 5829  714  731 GCCAGGCGCTTCTGCAGG  88 678 693783 5813 5830  715  732 TGCCAGGCGCTTCTGCAG 100 679 693784 5814 5831  716  733 CTGCCAGGCGCTTCTGCA 105 680 693785 5815 5832  717  734 ACTGCCAGGCGCTTCTGC  91 681 693786 5816 5833  718  735 CACTGCCAGGCGCTTCTG  95 682 693787 5817 5834  719  736 ACACTGCCAGGCGCTTCT 101 683 693788 5818 5835  720  737 TACACTGCCAGGCGCTTC  81 684 693789 5819 5836  721  738 GTACACTGCCAGGCGCTT 100 685 693790 5820 5837  722  739 GGTACACTGCCAGGCGCT  81 686 693791 5822 5839  724  741 CTGGTACACTGCCAGGCG 107 687

TABLE-US-00012 TABLE 12 Reduction of APOE RNA by 5-8-5 MOE gapmers   with mixed PO/PS internucleoside linkages  at a concentration of 4000 nM in Hep3B cells plated at 5000 cells per well SEQ  SEQ  SEQ  SEQ    ID ID ID ID No: No: No: No: Com- 5 5 6 6 APOE SEQ pound Start Stop Start Stop Sequence (% ID Number Site Site Site Site (5′ to 3′) UTC) NO 693792 N/A N/A 454 471 GCACGTCCTCCAT  98 688 GTCCG 693793 N/A N/A 455 472 CGCACGTCCTCCA 136 689 TGTCC 693794 N/A N/A 456 473 GCGCACGTCCTCC  99 690 ATGTC 693795 N/A N/A 457 474 CGCGCACGTCCTC  81 691 CATGT 693796 N/A N/A 458 475 CCGCGCACGTCCT 112 692 CCATG 693797 N/A N/A 459 476 GCCGCGCACGTCC 104 693 TCCAT 693798 N/A N/A 460 477 GGCCGCGCACGTC  77 694 CTCCA 693799 N/A N/A 461 478 CGGCCGCGCACGT  98 695 CCTCC 693800 N/A N/A 462 479 GCGGCCGCGCACG  71 696 TCCTC 693801 N/A N/A 463 480 GGCGGCCGCGCAC 100 697 GTCCT 693802 N/A N/A 464 481 AGGCGGCCGCGCA 136 698 CGTCC 693803 N/A N/A 465 482 CAGGCGGCCGCGC  74 699 ACGTC 693804 N/A N/A 466 483 CCAGGCGGCCGCG 120 700 CACGT 693805 N/A N/A 467 484 ACCAGGCGGCCGC 103 701 GCACG 693806 N/A N/A 468 485 CACCAGGCGGCCG 105 702 CGCAC 693807 N/A N/A 469 486 GCACCAGGCGGCC  97 703 GCGCA 693808 N/A N/A 470 487 TGCACCAGGCGGC  78 704 CGCGC 693809 N/A N/A 471 488 CTGCACCAGGCGG  83 705 CCGCG 693810  99 116 N/A N/A ACTTCTGCAGGTC 104 706 ATCGG 693811 100 117 N/A N/A CACTTCTGCAGGT  80 707 CATCG 693812 101 118 N/A N/A GCACTTCTGCAGG 111 708 TCATC 693813 102 119 N/A N/A GGCACTTCTGCAG 112 709 GTCAT 693814 103 120 N/A N/A AGGCACTTCTGCA  82 710 GGTCA 693815 104 121 N/A N/A CAGGCACTTCTGC  89 711 AGGTC 693816 105 122 N/A N/A CCAGGCACTTCTG 102 712 CAGGT 693817 106 123 N/A N/A GCCAGGCACTTCT  76 713 GCAGG 693818 107 124 N/A N/A TGCCAGGCACTTC 141 714 TGCAG 693819 108 125 N/A N/A CTGCCAGGCACTT 121 715 CTGCA 693820 109 126 N/A N/A ACTGCCAGGCACT  98 716 TCTGC 693821 110 127 N/A N/A CACTGCCAGGCAC  98 717 TTCTG 693822 111 128 N/A N/A ACACTGCCAGGCA 119 718 CTTCT 693823 112 129 N/A N/A TACACTGCCAGGC  87 719 ACTTC 693824 113 130 N/A N/A GTACACTGCCAGG 369 720 CACTT 693825 114 131 N/A N/A GGTACACTGCCAG  81 721 GCACT 693826 115 132 N/A N/A TGGTACACTGCCA  86 722 GGCAC 693827 116 133 N/A N/A CTGGTACACTGCC  73 723 AGGCA

TABLE-US-00013 TABLE 13 Reduction of APOE RNA by 5-8-5 MOE gapmers  with mixed PO/PS internucleoside linkages  at a concentration of 4000 nM in Hep3B  cells plated at 20,000 cells per well SEQ SEQ ID  ID  No: No: Com- 3 3 APOE SEQ pound Start Stop Sequence  (% ID Number Site Site (5′ to 3′) UTC) NO 688667 35 52 GGCCAGTCGGCTCCTGGG  75 724 688668 39 56 GATTGGCCAGTCGGCTCC 100 725 688669 41 58 GTGATTGGCCAGTCGGCT  78 726 688670 43 60 CTGTGATTGGCCAGTCGG 121 727

TABLE-US-00014 TABLE 14 Reduction of APOE RNA by 5-8-5 MOE gapmers  with mixed PO/PS internucleoside linkages  at a concentration of 2000 nM in HepG2 cells plated at 20,000 cells per well SEQ SEQ SEQ SEQ ID  ID  ID  ID  No: No: No: No: Com- 3 3 4 4 Sequence  APOE  SEQ pound Start Stop Start Stop (5′ to (% ID Number Site Site Site Site 3′) UTC) NO 689110 N/A N/A 768 785 TGCCGGCCG  50 728 CACCCGGCC 689111 N/A N/A 801 818 TGTAGCGGC  53 729 TGGCCCGGC 689112 N/A N/A 854 871 CATTTCTCTC  84 730 CATCCGCG 689113 N/A N/A 866 883 GGTCCCGCT  95 731 GCCCATTTC 689114 155 172 N/A N/A TCTGTGGCG  56 732 CAGCTCGGG 689115 257 274 N/A N/A GAGCAGCTC  68 733 CTCTGCACT 689116 729 746 N/A N/A AACTTAGGG 121 734 TCCACTCCT

Example 3: Effect of 5-10-5 MOE Mixed Backbone Modified Oligonucleotides on Human APOE RNA In Vitro, Single Dose

[0705] Modified oligonucleotides complementary to human APOE nucleic acid were designed and tested for their single dose effects on APOE RNA in vitro. The modified oligonucleotides were tested in a series of experiments under the culture conditions indicated in the tables below.

[0706] The modified oligonucleotides in the tables below are 5-10-5 MOE gapmers with mixed PO/PS internucleoside linkages. The gapmers are 20 nucleosides in length, wherein the central gap segment consists often 2′-β-D-deoxynucleosides, and wherein the 5′ and 3′ wing segments each consist of five 2′-MOE modified nucleosides. The sugar motif for the gapmers is (from 5′ to 3′): eeeeeddddddddddeeeee; wherein ‘d’ represents a 2′-β-D-deoxyribosyl sugar, and ‘e’ represents a 2′-MOE modified sugar moiety. The internucleoside linkage motif for the gapmers is (from 5′ to 3′): sooosssssssssssooss; wherein each ‘o’ represents a phosphodiester internucleoside linkage and each ‘s’ represents a phosphorothioate internucleoside linkage. Each cytosine residue is a 5-methyl cytosine.

[0707] “Start site” indicates the 5′-most nucleoside to which the modified oligonucleotide is complementary in the target nucleic acid sequence. “Stop site” indicates the 3′-most nucleoside to which the modified oligonucleotide is complementary in the target nucleic acid sequence. Each modified oligonucleotide listed in the tables below is 100% complementary to SEQ ID NO: 1 (described herein above), to SEQ ID NO: 2 (described herein above), or to both. ‘N/A’ indicates that the modified oligonucleotide is not 100% complementary to that particular target nucleic acid sequence.

[0708] The modified oligonucleotides were tested either in cultured Hep3B cells or in primary transgenic mouse hepatocytes as indicated in the tables below. A transgenic mouse model was obtained from Taconic (model #1549). The transgenic mouse model has a C.sub.57BL/6 genetic background and expresses the human apolipoprotein E4 isoform. Primary mouse hepatocytes were isolated from transgenic mouse livers and were treated with modified oligonucleotide at a concentration of 5000 nM by free uptake at a density of 15,000 cells per well. After a treatment period of approximately 24 hours, total RNA was isolated from the cells and APOE RNA levels were measured by quantitative real-time RTPCR. In the case of the experiments carried out on cultured Hep3B cells, the cells were treated with modified oligonucleotide at a concentration of 4000 nM by electroporation at a density of 20,000 cells per well. After a treatment period of approximately 24 hours, total RNA was isolated from the cells and APOE RNA levels were measured by quantitative real-time RTPCR.

[0709] APOE RNA levels were measured by human primer-probe set RTS3073 (described herein in Example 1). APOE RNA levels were normalized to total RNA content, as measured by RIBOGREEN®. Results are presented in the tables below as percent APOE RNA relative to untreated control cells (% UTC). Each table represents results from an individual assay plate. The values marked with an “t” indicate that the modified oligonucleotide is complementary to the amplicon region of the primer probe set. Additional assays may be used to measure the potency and efficacy of the modified oligonucleotides complementary to the amplicon region. In Tables 15-20 below, Compound 689046 (described herein above) was included for reference.

TABLE-US-00015 TABLE 15 Reduction of APOE RNA by 5-10-5 MOE gapmers  with mixed PO/PS internucleoside linkages  at a concentration of 5000 nM in transgenic primary mouse hepatocytes plated at 15,000  cells per well SEQ SEQ SEQ SEQ ID ID ID ID No: No: No: No: Com- 1 1 2 2 APOE SEQ pound Start Stop Start Stop Sequence  (% ID Number Site Site Site Site (5′ to 3′) UTC) NO 689046 6364 6381 1266 1283 GGTGAATCTTTA   8 478 TTAAAC 708022 6257 6276 1159 1178 GGTCGCATGGCT  10  71 GCAGGCTT 708024 6371 6390 1273 1292 GTGAAACTTGGT  16  77 GAATCTTT 708027 6234 6253 1136 1155 CGTTCAGTGATT  40  69 GTCGCTGG 942333 2749 2768    1   20 TATAGGGCTCCC 111 735 CCTGTCCC 942339 2755 2774    7   26 TCCAATTATAGG  98 736 GCTCCCCC 942345 2762 2781   14   33 AGACTTGTCCAA 109 737 TTATAGGG 942351 2805 2824   57   76 CGTCCTTCACCT  82 738 CCGCTGGG 942357 3638 3657  212  231 TGTGACCAGCAA  75 739 CGCAGCCC 942363 3644 3663  218  237 CAGGAATGTGAC  70 740 CAGCAACG 942369 4806 4825  288  307 CGGTCTGCTGGC  84 741 GCAGCTCG 942375 4812 4831  294  313 GCCACTCGGTCT  93 742 GCTGGCGC 942381 4850 4869  332  351 AAAGCGACCCAG  49† 743 TGCCAGTT 942387 4857 4876  339  358 AATCCCAAAAGC  28† 744 GACCCAGT 942393 4863 4882  345  364 GCAGGTAATCCC  38† 745 AAAAGCGA 942398 4869 4888  351  370 CCCAGCGCAGGT  18† 746 AATCCCAA 942403 4876 4895  358  377 GTCTGCACCCAG  18† 747 CGCAGGTA 942407 5562 5581  464  483 TTCCGATTTGTA  79 748 GGCCTTCA 942412 5568 5587  470  489 CTCCAGTTCCGA  71 749 TTTGTAGG 942418 5575 5594  477  496 GTTGTTCCTCCA  76 750 GTTCCGAT 942424 5618 5637  520  539 TCCTTGGACAGC 120  43 CGTGCCCG 942430 5662 5681  564  583 CGTCCTCCATGT  72 751 CCGCGCCC 942436 5686 5705  588  607 GGTACTGCACCA 130 752 GGCGGCCG 942442 5692 5711  594  613 CGCCGCGGTACT  91 753 GCACCAGG 942448 5718 5737  620  639 GCTCTGGCCGAG  84 754 CATGGCCT 942454 5725 5744  627  646 CCTCGGTGCTCT  77 755 GGCCGAGC 942460 5747 5766  649  668 GAGGCGAGGCGC 100 756 ACCCGCAG 942466 5765 5784  667  686 CGCAGCTTGCGC  87  48 AGGTGGGA 942472 5772 5791  674  693 CCGCTTACGCAG  53 757 CTTGCGCA 942478 5778 5797  680  699 GAGGAGCCGCTT  91 758 ACGCAGCT 942484 5784 5803  686  705 ATCGCGGAGGAG  91 759 CCGCTTAC 942490 5791 5810  693  712 CATCGGCATCGC  67 760 GGAGGAGC 942496 5797 5816  699  718 GCAGGTCATCGG  66 761 CATCGCGG 942501 5826 5845  728  747 CCCGGCCTGGTA  81 762 CACTGCCA 942507 5833 5852  735  754 CGCGGGCCCCGG  83 763 CCTGGTAC 942513 5902 5921  804  823 GCACGCGGCCCT  88 764 GTTCCACC 942519 5908 5927  810  829 CGGCCCGCACGC  95 765 GGCCCTGT 942525 5915 5934  817  836 ACAGTGGCGGCC 137 766 CGCACGCG 942531 5921 5940  823  842 GAGCCCACAGTG 105 767 GCGGCCCG 942537 5948 5967  850  869 CGCTCCTGTAGC  91 768 GGCTGGCC 942543 5978 5997  880  899 GCGCGCAGCCGC  96 769 TCGCCCCA 942549 6010 6029  912  931 CGCGGGTCCGGC  96 770 TGCCCATC 942555 6016 6035  918  937 GGCGGTCGCGGG  86 771 TCCGGCTG 942561 6056 6075  958  977 TTGGCGCGCACC  96 772 TCCGCCAC 942567 6063 6082  965  984 CTCCAGCTTGGC  83 773 GCGCACCT 942573 6125 6144 1027 1046 AACCAGCTCTTG  76 774 AGGCGGGC 942579 6131 6150 1033 1052 GGCTCGAACCAG  90 775 CTCTTGAG 942594 6349 6368 1251 1270 TAAACTAGGGTC  44 776 CACCCCAG 942600 2833 2852   85  104 GCGCTTCTCACC 101 777 GGCTCCTG 942606 2840 2859   92  111 CCCGACTGCGCT 114 778 TCTCACCG 942612 2846 2865   98  117 CGTGCCCCCGAC 100 779 TGCGCTTC 942618 2855 2874  107  126 GCTCATCCCCGT  59 780 GCCCCCGA 942624 3448 3467 N/A N/A TTTACCAAGCCG 108 781 CCCCCAAC 942630 3454 3473 N/A N/A AGCACATTTACC  78 782 AAGCCGCC 942636 3495 3514 N/A N/A CCTTCCAAGCCT 101 783 TGTTGCAT 942642 2926 2945 N/A N/A CGAGTAGCTCTC  85 784 CTGAGACT 942648 2932 2951 N/A N/A CGACCCCGAGTA  73 785 GCTCTCCT 942654 2938 2957 N/A N/A CAAGCCCGACCC  79 786 CGAGTAGC 942660 3067 3086 N/A N/A GCTATGGCTTAC 104 787 ATCCCAGT 942666 3096 3115 N/A N/A TAAATGATAGTG  75 788 ACAACTCG 942672 3171 3190 N/A N/A AGCTACCGTGTC  84 789 GCTGCCCC 942678 3177 3196 N/A N/A ACGGCTAGCTAC  78 790 CGTGTCGC 942684 3191 3210 N/A N/A AAGTTCTCCAAT  70 791 CGACGGCT 942690 3232 3251 N/A N/A GCGCCGTGTTCC 108 792 ATTTATGA 942696 3306 3325 N/A N/A GCCGGTTCCATC 109 793 TCAGTCCC 942702 3313 3332 N/A N/A CCCCACCGCCGG 101 794 TTCCATCT 942708 3384 3403 N/A N/A TCCCCAGGTCGG  87 795 CCTCCATA 942714 3557 3576 N/A N/A ACCGCCAGTGAG  96 796 GACTCCTC 942720 3572 3591 N/A N/A AGAAACTGTCAA  73 797 TCAACCGC 942726 3789 3808 N/A N/A TCAAATCGCTGT 121 798 TCAGAGCC 942732 4220 4239 N/A N/A TGCCCCGTGTCT  88 799 GGTATTCA 942738 4290 4309 N/A N/A GCATGTATTGAG 111 800 TGTCCTTG 942744 4614 4633 N/A N/A GAGTCGGTTTAA  80 801 TCACTTGG 942750 4700 4719 N/A N/A CCCCGTCCAGGC 117 802 ATCTAGTA 942756 4710 4729 N/A N/A GTCCTTCTGACC  89 803 CCGTCCAG 942762 4738 4757 N/A N/A GTGTGGAACAAG  81 804 TTCAAGGT 942768 4980 4999 N/A N/A TATAGCCGCCCA 108† 805 CCAGGAGG 942774 4986 5005 N/A N/A GGGAGGTATAGC  62† 806 CGCCCACC 942780 5158 5177 N/A N/A CCAGGACGAGTG 113† 807 TGAGAGAC

TABLE-US-00016 TABLE 16 Reduction of APOE RNA by 5-10-5 MOE gapmers   with mixed PO/PS internucleoside linkages at  a concentration of 5000 nM in transgenic   primary mouse hepatocytes plated at 15,000  cells per well SEQ  SEQ SEQ SEQ   ID ID ID ID No:  No: No: No: Com- 1 1  2 2 APOE SEQ pound Start Stop Start Stop Sequence  (% ID Number Site Site Site Site (5′ to 3′) UTC) NO 689046 6364 6381 1266 1283 GGTGAATCTTTA   6 478 TTAAAC 708024 6371 6390 1273 1292 GTGAAACTTGGT  14  77 GAATCTTT 708026 4879 4898  361  380 AGTGTCTGCACC   7†  35 CAGCGCAG 708030 4864 4883  346  365 CGCAGGTAATCC  58†  32 CAAAAGCG 942334 2750 2769    2   21 TTATAGGGCTCC 110 808 CCCTGTCC 942340 2756 2775    8   27 GTCCAATTATAG 115 809 GGCTCCCC 942346 2763 2782   15   34 CAGACTTGTCCA  91 810 ATTATAGG 942352 3628 3647  202  221 AACGCAGCCCAC  81  22 AGAACCTT 942358 3639 3658  213  232 ATGTGACCAGCA  52 811 ACGCAGCC 942364 4768 4787  250  269 ACCGCTTGCTCC  58 812 ACCTTGGC 942370 4807 4826  289  308 TCGGTCTGCTGG 120 813 CGCAGCTC 942376 4813 4832  295  314 TGCCACTCGGTC 185 814 TGCTGGCG 942382 4851 4870  333  352 AAAAGCGACCCA 147† 815 GTGCCAGT 942388 4858 4877  340  359 TAATCCCAAAAG  33† 816 CGACCCAG 942399 4870 4889  352  371 ACCCAGCGCAGG   9† 817 TAATCCCA 942408 5563 5582  465  484 GTTCCGATTTGT  64 818 AGGCCTTC 942413 5569 5588  471  490 CCTCCAGTTCCG  69 819 ATTTGTAG 942419 5576 5595  478  497 AGTTGTTCCTCC  77 820 AGTTCCGA 942425 5620 5639  522  541 GCTCCTTGGACA  62 821 GCCGTGCC 942431 5680 5699  582  601 GCACCAGGCGGC  92 822 CGCACACG 942437 5687 5706  589  608 CGGTACTGCACC  80 823 AGGCGGCC 942443 5693 5712  595  614 TCGCCGCGGTAC 107 824 TGCACCAG 942449 5719 5738  621  640 TGCTCTGGCCGA  84 825 GCATGGCC 942455 5726 5745  628  647 TCCTCGGTGCTC 105 826 TGGCCGAG 942461 5748 5767  650  669 GGAGGCGAGGCG  83 827 CACCCGCA 942467 5766 5785  668  687 ACGCAGCTTGCG  98 828 CAGGTGGG 942473 5773 5792  675  694 GCCGCTTACGCA  78 829 GCTTGCGC 942479 5779 5798  681  700 GGAGGAGCCGCT  75 830 TACGCAGC 942485 5785 5804  687  706 CATCGCGGAGGA  79 831 GCCGCTTA 942491 5792 5811  694  713 TCATCGGCATCG 106 832 CGGAGGAG 942497 5798 5817  700  719 TGCAGGTCATCG  51 833 GCATCGCG 942502 5828 5847  730  749 GCCCCGGCCTGG  59  53 TACACTGC 942508 5834 5853  736  755 TCGCGGGCCCCG  79 834 GCCTGGTA 942514 5903 5922  805  824 CGCACGCGGCCC  54 835 TGTTCCAC 942520 5910 5929  812  831 GGCGGCCCGCAC  57 836 GCGGCCCT 942526 5916 5935  818  837 CACAGTGGCGGC  81 837 CCGCACGC 942532 5943 5962  845  864 CTGTAGCGGCTG  87 838 GCCGGCCA 942538 5949 5968  851  870 CCGCTCCTGTAG  82 839 CGGCTGGC 942544 5993 6012  895  914 ATCTCCTCCATC  74 840 CGCGCGCG 942550 6011 6030  913  932 TCGCGGGTCCGG  82 841 CTGCCCAT 942556 6017 6036  919  938 AGGCGGTCGCGG  91 842 GTCCGGCT 942562 6057 6076  959  978 CTTGGCGCGCAC  86 843 CTCCGCCA 942568 6064 6083  966  985 CCTCCAGCTTGG  58 844 CGCGCACC 942574 6126 6145 1028 1047 GAACCAGCTCTT  79 845 GAGGCGGG 942580 6132 6151 1034 1053 GGGCTCGAACCA 111 846 GCTCTTGA 942585 6252 6271 1154 1173 CATGGCTGCAGG  16 847 CTTCGGCG 942589 6301 6320 1203 1222 CCCGCTGCAGGC  84 848 TGCGCGGA 942595 6350 6369 1252 1271 TTAAACTAGGGT  47 849 CCACCCCA 942601 2834 2853   86  105 TGCGCTTCTCAC  64 850 CGGCTCCT 942607 2841 2860   93  112 CCCCGACTGCGC  75 851 TTCTCACC 942613 2847 2866   99  118 CCGTGCCCCCGA  75 852 CTGCGCTT 942619 2856 2875  108  127 AGCTCATCCCCG  35 853 TGCCCCCG 942625 3449 3468 N/A N/A ATTTACCAAGCC  94 854 GCCCCCAA 942631 3455 3474 N/A N/A CAGCACATTTAC  81 855 CAAGCCGC 942637 3497 3516 N/A N/A AGCCTTCCAAGC 105 856 CTTGTTGC 942643 2927 2946 N/A N/A CCGAGTAGCTCT 142 857 CCTGAGAC 942649 2933 2952 N/A N/A CCGACCCCGAGT  56 858 AGCTCTCC 942655 3030 3049 N/A N/A CCCACCTTCTAG  84 859 CGGGTCGG 942661 3071 3090 N/A N/A TCCTGCTATGGC 123 860 TTACATCC 942667 3149 3168 N/A N/A GCTCCCCAGTTA  64 861 TGGAGATC 942673 3172 3191 N/A N/A TAGCTACCGTGT  95 862 CGCTGCCC 942679 3178 3197 N/A N/A GACGGCTAGCTA  67 863 CCGTGTCG 942685 3192 3211 N/A N/A AAAGTTCTCCAA  74 864 TCGACGGC 942691 3248 3267 N/A N/A CCAACCTCACAG  81 865 TTAAGCGC 942697 3307 3326 N/A N/A CGCCGGTTCCAT  93 866 CTCAGTCC 942703 3314 3333 N/A N/A TCCCCACCGCCG  60 867 GTTCCATC 942709 3385 3404 N/A N/A ATCCCCAGGTCG  59 868 GCCTCCAT 942715 3558 3577 N/A N/A AACCGCCAGTGA  61 869 GGACTCCT 942721 3652 3671 N/A N/A ATACCTGCCAGG  87 870 AATGTGAC 942727 4198 4217 N/A N/A ATCTGCCTGCAA  68 871 TGCATTAG 942733 4222 4241 N/A N/A GCTGCCCCGTGT  78 872 CTGGTATT 942739 4298 4317 N/A N/A GCGGAAAAGCAT  65 873 GTATTGAG 942745 4616 4635 N/A N/A GGGAGTCGGTTT  71 874 AATCACTT 942751 4701 4720 N/A N/A ACCCCGTCCAGG 175 875 CATCTAGT 942757 4711 4730 N/A N/A GGTCCTTCTGAC  79 876 CCCGTCCA 942763 4974 4993 N/A N/A CGCCCACCAGGA  82† 877 GGGTCAAG 942769 4981 5000 N/A N/A GTATAGCCGCCC  96† 878 ACCAGGAG 942775 5030 5049 N/A N/A CCCCCCAAGACT 121† 879 TAGCGACA 942781 5490 5509 N/A N/A TGTCGCACAGTG  75† 880 GGAGGCGG

TABLE-US-00017 TABLE 17 Reduction of APOE RNA by 5-10-5 MOE gapmers   with mixed PO/PS internucleoside linkages at  a concentration of 5000 nM in transgenic primary mouse hepatocytes plated at 15,000  cells per well SEQ SEQ SEQ SEQ   ID ID ID ID No: No: No: No: Com- 1 1 2 2 APOE SEQ pound Start Stop Start Stop Sequence (% ID Number Site Site Site Site (5′ to 3′) UTC) NO 689046 6364 6381 1266 1283 GGTGAATCTTTA  10 478 TTAAAC 708023 5799 5818  701  720 CTGCAGGTCATC  86  50 GGCATCGC 708024 6371 6390 1273 1292 GTGAAACTTGGT  11  77 GAATCTTT 708028 4932 4951  414  433 TCAGTTCCTGGG  41†  39 TGACCTGG 942335 2751 2770    3   22 ATTATAGGGCTC  81 881 CCCCTGTC 942341 2757 2776    9   28 TGTCCAATTATA  91 882 GGGCTCCC 942347 2768 2787   20   39 GATCCCAGACTT  91 883 GTCCAATT 942353 3630 3649  204  223 GCAACGCAGCCC  63 884 ACAGAACC 942359 3640 3659  214  233 AATGTGACCAGC  55 885 AACGCAGC 942365 4769 4788  251  270 CACCGCTTGCTC  88 886 CACCTTGG 942371 4808 4827  290  309 CTCGGTCTGCTG 101 887 GCGCAGCT 942377 4846 4865  328  347 CGACCCAGTGCC  69† 888 AGTTCCCA 942383 4853 4872  335  354 CCAAAAGCGACC  47† 889 CAGTGCCA 942389 4859 4878  341  360 GTAATCCCAAAA  43† 890 GCGACCCA 942394 4865 4884  347  366 GCGCAGGTAATC  22† 891 CCAAAAGC 942400 4871 4890  353  372 CACCCAGCGCAG  24† 892 GTAATCCC 942409 5564 5583  466  485 AGTTCCGATTTG  65 893 TAGGCCTT 942414 5570 5589  472  491 TCCTCCAGTTCC  55 894 GATTTGTA 942420 5577 5596  479  498 CAGTTGTTCCTC  54 895 CAGTTCCG 942426 5621 5640  523  542 AGCTCCTTGGAC  91 896 AGCCGTGC 942432 5681 5700  583  602 TGCACCAGGCGG  81 897 CCGCACAC 942438 5688 5707  590  609 GCGGTACTGCAC  72  45 CAGGCGGC 942444 5694 5713  596  615 CTCGCCGCGGTA  75 898 CTGCACCA 942450 5720 5739  622  641 GTGCTCTGGCCG  76 899 AGCATGGC 942456 5727 5746  629  648 CTCCTCGGTGCT  64 900 CTGGCCGA 942462 5749 5768  651  670 GGGAGGCGAGGC 114 901 GCACCCGC 942468 5767 5786  669  688 TACGCAGCTTGC  65 902 GCAGGTGG 942474 5774 5793  676  695 AGCCGCTTACGC  87 903 AGCTTGCG 942480 5780 5799  682  701 CGGAGGAGCCGC  64 904 TTACGCAG 942486 5786 5805  688  707 GCATCGCGGAGG 100 905 AGCCGCTT 942492 5793 5812  695  714 GTCATCGGCATC  83 906 GCGGAGGA 942503 5829 5848  731  750 GGCCCCGGCCTG  93 907 GTACACTG 942509 5857 5876  759  778 CGCTGAGGCCGC  81 908 GCTCGGCG 942515 5904 5923  806  825 CCGCACGCGGCC  63 909 CTGTTCCA 942521 5911 5930  813  832 TGGCGGCCCGCA  80 910 CGCGGCCC 942527 5917 5936  819  838 CCACAGTGGCGG  62 911 CCCGCACG 942533 5944 5963  846  865 CCTGTAGCGGCT  72 912 GGCCGGCC 942539 5952 5971  854  873 GGCCCGCTCCT  94 913 GTAGCGGCT 942545 5994 6013  896  915 CATCTCCTCCAT  64 914 CCGCGCGC 942551 6012 6031  914  933 GTCGCGGGTCCG  80 915 GCTGCCCA 942557 6018 6037  920  939 CAGGCGGTCGCG  90 916 GGTCCGGC 942563 6058 6077  960  979 GCTTGGCGCGCA  70 917 CCTCCGCC 942569 6065 6084  967  986 TCCTCCAGCTTG  82 918 GCGCGCAC 942575 6127 6146 1029 1048 CGAACCAGCTCT  70  64 TGAGGCGG 942581 6230 6249 1132 1151 CAGTGATTGTCG  89  68 CTGGGCAC 942586 6253 6272 1155 1174 GCATGGCTGCAG   6 919 GCTTCGGC 942590 6302 6321 1204 1223 TCCCGCTGCAGG  54 920 CTGCGCGG 942596 6351 6370 1253 1272 ATTAAACTAGGG  42 921 TCCACCCC 942602 2836 2855   88  107 ACTGCGCTTCTC 102 922 ACCGGCTC 942608 2842 2861   94  113 CCCCCGACTGCG  82 923 CTTCTCAC 942614 2848 2867  100  119 CCCGTGCCCCCG 137 924 ACTGCGCT 942620 3421 3440 N/A N/A CTATTTAACTCC  67 925 CTCCTGGT 942626 3450 3469 N/A N/A CATTTACCAAGC  74 926 CGCCCCCA 942632 3456 3475 N/A N/A CCAGCACATTTA 108 927 CCAAGCCG 942638 3498 3517 N/A N/A TAGCCTTCCAAG  74 928 CCTTGTTG 942644 2928 2947 N/A N/A CCCGAGTAGCTC  95 929 TCCTGAGA 942650 2934 2953 N/A N/A CCCGACCCCGAG  71 930 TAGCTCTC 942656 3031 3050 N/A N/A CCCCACCTTCTA  75 931 GCGGGTCG 942662 3073 3092 N/A N/A AGTCCTGCTATG  97 932 GCTTACAT 942668 3167 3186 N/A N/A ACCGTGTCGCTG  86  81 CCCCTGGC 942674 3173 3192 N/A N/A CTAGCTACCGTG  93 933 TCGCTGCC 942680 3179 3198 N/A N/A CGACGGCTAGCT 124 934 ACCGTGTC 942686 3195 3214 N/A N/A TTTAAAGTTCTC  78 935 CAATCGAC 942692 3292 3311 N/A N/A AGTCCCAGTCTC  73 936 GCATTCCT 942698 3308 3327 N/A N/A CCGCCGGTTCCA  74 937 TCTCAGTC 942704 3375 3394 N/A N/A CGGCCTCCATAG 108 938 AAAATTCC 942710 3509 3528 N/A N/A TCACCCCAGGTT  85 939 AGCCTTCC 942716 3559 3578 N/A N/A CAACCGCCAGTG  78 940 AGGACTCC 942722 3674 3693 N/A N/A GAACCGAGCAAG  72 941 CCCCGCCC 942728 4212 4231 N/A N/A GTCTGGTATTCA 102 942 CTATCTGC 942734 4223 4242 N/A N/A AGCTGCCCCGTG  79 943 TCTGGTAT 942740 4303 4322 N/A N/A GCCCAGCGGAAA  85 944 AGCATGTA 942746 4694 4713 N/A N/A CCAGGCATCTAG  99 945 TACCTAGG 942752 4702 4721 N/A N/A GACCCCGTCCAG  78 946 GCATCTAG 942758 4712 4731 N/A N/A GGGTCCTTCTGA 121 947 CCCCGTCC 942764 4975 4994 N/A N/A CCGCCCACCAGG  87† 948 AGGGTCAA 942770 4982 5001 N/A N/A GGTATAGCCGCC 120† 949 CACCAGGA 942776 5031 5050 N/A N/A GCCCCCCAAGAC  60† 950 TTAGCGAC 942782 5491 5510 N/A N/A GTGTCGCACAGT 110† 951 GGGAGGCG

TABLE-US-00018 TABLE 18 Reduction of APOE RNA by 5-10-5 MOE gapmers  with mixed PO/PS internucleoside linkages at  a concentration of 5000 nM in transgenic primary mouse hepatocytes plated at 15,000  cells per well SEQ SEQ SEQ SEQ ID ID ID ID No: No: No: No: Com- 1 1 2 2 APOE SEQ pound Start Stop Start Stop Sequence  (% ID Number Site Site Site Site (5′ to 3′) UTC) NO 689046 6364 6381 1266 1283 GGTGAATCTTTA   3  478 TTAAAC 708021 6254 6273 1156 1175 CGCATGGCTGCA   5   70 GGCTTCGG 708024 6371 6390 1273 1292 GTGAAACTTGGT   9   77 GAATCTTT 708025 5565 5584  467  486 CAGTTCCGATTT  70   42 GTAGGCCT 708029 4872 4891  354  373 GCACCCAGCGCA   6†   33 GGTAATCC 942336 2752 2771    4   23 AATTATAGGGCT 112  952 CCCCCTGT 942342 2759 2778   11   30 CTTGTCCAATTA 142  953 TAGGGCTC 942348 2769 2788   21   40 GGATCCCAGACT 105  954 TGTCCAAT 942354 3635 3654  209  228 GACCAGCAACGC  51  955 AGCCCACA 942360 3641 3660  215  234 GAATGTGACCAG  65  956 CAACGCAG 942366 4774 4793  256  275 GTCTCCACCGCT 114  957 TGCTCCAC 942372 4809 4828  291  310 ACTCGGTCTGCT 113  958 GGCGCAGC 942378 4847 4866  329  348 GCGACCCAGTGC  61†  959 CAGTTCCC 942384 4854 4873  336  355 CCCAAAAGCGAC  17†   30 CCAGTGCC 942390 4860 4879  342  361 GGTAATCCCAAA  32†  960 AGCGACCC 942395 4866 4885  348  367 AGCGCAGGTAAT  42†  961 CCCAAAAG 942404 5559 5578  461  480 CGATTTGTAGGC 136   41 CTTCAACT 942415 5571 5590  473  492 TTCCTCCAGTTC  82  962 CGATTTGT 942421 5581 5600  483  502 GGGTCAGTTGTT  78  963 CCTCCAGT 942427 5657 5676  559  578 TCCATGTCCGCG  55  964 CCCAGCCG 942433 5683 5702  585  604 ACTGCACCAGGC  56  965 GGCCGCAC 942439 5689 5708  591  610 CGCGGTACTGCA  84  966 CCAGGCGG 942445 5695 5714  597  616 CCTCGCCGCGGT  64  967 ACTGCACC 942451 5722 5741  624  643 CGGTGCTCTGGC  89  968 CGAGCATG 942457 5738 5757  640  659 CGCACCCGCAGC  63  969 TCCTCGGT 942463 5750 5769  652  671 TGGGAGGCGAGG 123  970 CGCACCCG 942469 5768 5787  670  689 TTACGCAGCTTG  83  971 CGCAGGTG 942475 5775 5794  677  696 GAGCCGCTTACG 100   49 CAGCTTGC 942481 5781 5800  683  702 GCGGAGGAGCCG  77  972 CTTACGCA 942487 5787 5806  689  708 GGCATCGCGGAG  83  973 GAGCCGCT 942493 5794 5813  696  715 GGTCATCGGCAT  64  974 CGCGGAGG 942498 5800 5819  702  721 TCTGCAGGTCAT  63  975 CGGCATCG 942504 5830 5849  732  751 GGGCCCCGGCCT  64  976 GGTACACT 942510 5858 5877  760  779 GCGCTGAGGCCG 127  977 CGCTCGGC 942516 5905 5924  807  826 CCCGCACGCGGC 100  978 CCTGTTCC 942522 5912 5931  814  833 GTGGCGGCCCGC  98  979 ACGCGGCC 942528 5918 5937  820  839 CCCACAGTGGCG  70  980 GCCCGCAC 942534 5945 5964  847  866 TCCTGTAGCGGC 115  981 TGGCCGGC 942540 5953 5972  855  874 GGGCCCGCTCCT  79  982 GTAGCGGC 942546 5995 6014  897  916 CCATCTCCTCCA  55  983 TCCGCGCG 942552 6013 6032  915  934 GGTCGCGGGTCC  45  984 GGCTGCCC 942558 6019 6038  921  940 CCAGGCGGTCGC 100  985 GGGTCCGG 942564 6059 6078  961  980 AGCTTGGCGCGC  50  986 ACCTCCGC 942570 6119 6138 1021 1040 CTCTTGAGGCGG  87  987 GCCTGGAA 942576 6128 6147 1030 1049 TCGAACCAGCTC  76  988 TTGAGGCG 942582 6231 6250 1133 1152 TCAGTGATTGTC  53  989 GCTGGGCA 942591 6305 6324 1207 1226 GTCTCCCGCTGC  21  990 AGGCTGCG 942597 6353 6372 1255 1274 TTATTAAACTAG  34   76 GGTCCACC 942603 2837 2856   89  108 GACTGCGCTTCT  86  991 CACCGGCT 942609 2843 2862   95  114 GCCCCCGACTGC  59  992 GCTTCTCA 942615 2850 2869  102  121 TCCCCGTGCCCC  65  993 CGACTGCG 942621 3442 3461 N/A N/A AAGCCGCCCCCA  55  994 ACCCATTC 942627 3451 3470 N/A N/A ACATTTACCAAG  41  995 CCGCCCCC 942633 3474 3493 N/A N/A ATCTGCAACAGC 151  996 CTAATCCC 942639 3500 3519 N/A N/A GTTAGCCTTCCA  99  997 AGCCTTGT 942645 2929 2948 N/A N/A CCCCGAGTAGCT  87  998 CTCCTGAG 942651 2935 2954 N/A N/A GCCCGACCCCGA  56  999 GTAGCTCT 942657 3032 3051 N/A N/A ACCCCACCTTCT  62 1000 AGCGGGTC 942663 3075 3094 N/A N/A GGAGTCCTGCTA 113 1001 TGGCTTAC 942669 3168 3187 N/A N/A TACCGTGTCGCT  88 1002 GCCCCTGG 942675 3174 3193 N/A N/A GCTAGCTACCGT  59 1003 GTCGCTGC 942681 3180 3199 N/A N/A TCGACGGCTAGC 108 1004 TACCGTGT 942687 3228 3247 N/A N/A CGTGTTCCATTT  79 1005 ATGAGCTA 942693 3293 3312 N/A N/A CAGTCCCAGTCT 101 1006 CGCATTCC 942699 3309 3328 N/A N/A ACCGCCGGTTCC  58 1007 ATCTCAGT 942705 3379 3398 N/A N/A AGGTCGGCCTCC  70 1008 ATAGAAAA 942711 3514 3533 N/A N/A CGGCCTCACCCC  70 1009 AGGTTAGC 942717 3562 3581 N/A N/A AATCAACCGCCA  73 1010 GTGAGGAC 942723 3675 3694 N/A N/A GGAACCGAGCAA 102 1011 GCCCCGCC 942729 4216 4235 N/A N/A CCGTGTCTGGTA  83 1012 TTCACTAT 942735 4229 4248 N/A N/A GATCACAGCTGC  72 1013 CCCGTGTC 942741 4305 4324 N/A N/A GCGCCCAGCGGA  72 1014 AAAGCATG 942747 4696 4715 N/A N/A GTCCAGGCATCT 136 1015 AGTACCTA 942753 4703 4722 N/A N/A TGACCCCGTCCA  73 1016 GGCATCTA 942759 4714 4733 N/A N/A CAGGGTCCTTCT  67 1017 GACCCCGT 942765 4977 4996 N/A N/A AGCCGCCCACCA  44† 1018 GGAGGGTC 942771 4983 5002 N/A N/A AGGTATAGCCGC 128† 1019 CCACCAGG 942777 5032 5051 N/A N/A GGCCCCCCAAGA  61† 1020 CTTAGCGA 942783 5516 5535 N/A N/A GCCCTGCGGCCG 105† 1021 AGAGGGCG

TABLE-US-00019 TABLE 19 Reduction of APOE RNA by 5-10-5 MOE gapmers  with mixed PO/PS internucleoside linkages at a concentration of 5000 nM in transgenic  primary mouse hepatocytes plated at 15,000  cells per well SEQ SEQ SEQ SEQ ID ID ID ID No: No: No: No: Com- 1 1 2 2 APOE SEQ pound Start Stop Start Stop Sequence  (% ID Number Site Site Site Site (5′ to 3′) UTC) NO 689046 6364 6381 1266 1283 GGTGAATCTT   6  478 TATTAAAC 708024 6371 6390 1273 1292 GTGAAACTTG  21   77 GTGAATCTTT 942337 2753 2772    5   24 CAATTATAGG  83 1022 GCTCCCCCTG 942343 2760 2779   12   31 ACTTGTCCAA  94 1023 TTATAGGGCT 942349 2783 2802   35   54 TGAGTAGGAC  99 1024 TCAAGGATCC 942355 3636 3655  210  229 TGACCAGCAA 123   23 CGCAGCCCAC 942361 3642 3661  216  235 GGAATGTGAC 126   24 CAGCAACGCA 942367 4804 4823  286  305 GTCTGCTGGC 105 1025 GCAGCTCGGG 942373 4810 4829  292  311 CACTCGGTCT 100 1026 GCTGGCGCAG 942379 4848 4867  330  349 AGCGACCCAG  45† 1027 TGCCAGTTCC 942385 4855 4874  337  356 TCCCAAAAGC  25† 1028 GACCCAGTGC 942391 4861 4880  343  362 AGGTAATCCC  26†   31 AAAAGCGACC 942396 4867 4886  349  368 CAGCGCAGGT  33† 1029 AATCCCAAAA 942401 4873 4892  355  374 TGCACCCAGC  22† 1030 GCAGGTAATC 942405 5560 5579  462  481 CCGATTTGTA 124 1031 GGCCTTCAAC 942410 5566 5585  468  487 CCAGTTCCGA  85 1032 TTTGTAGGCC 942416 5572 5591  474  493 GTTCCTCCAG  73 1033 TTCCGATTTG 942422 5616 5635  518  537 CTTGGACAGC  97 1034 CGTGCCCGCG 942428 5660 5679  562  581 TCCTCCATGT  81 1035 CCGCGCCCAG 942434 5684 5703  586  605 TACTGCACCA  92 1036 GGCGGCCGCA 942440 5690 5709  592  611 CCGCGGTACT  87 1037 GCACCAGGCG 942446 5696 5715  598  617 ACCTCGCCGC  95 1038 GGTACTGCAC 942452 5723 5742  625  644 TCGGTGCTCT  90 1039 GGCCGAGCAT 942458 5744 5763  646  665 GCGAGGCGCA  77 1040 CCCGCAGCTC 942464 5759 5778  661  680 TTGCGCAGGT 144 1041 GGGAGGCGAG 942470 5769 5788  671  690 CTTACGCAGC 135 1042 TTGCGCAGGT 942476 5776 5795  678  697 GGAGCCGCTT  94 1043 ACGCAGCTTG 942482 5782 5801  684  703 CGCGGAGGAG  77 1044 CCGCTTACGC 942488 5789 5808  691  710 TCGGCATCGC  99 1045 GGAGGAGCCG 942494 5795 5814  697  716 AGGTCATCGG  90 1046 CATCGCGGAG 942499 5824 5843  726  745 CGGCCTGGTA  62 1047 CACTGCCAGG 942505 5831 5850  733  752 CGGGCCCCGG  89 1048 CCTGGTACAC 942511 5900 5919  802  821 ACGCGGCCCT  98 1049 GTTCCACCAG 942517 5906 5925  808  827 GCCCGCACGC  68 1050 GGCCCTGTTC 942523 5913 5932  815  834 AGTGGCGGCC 125 1051 CGCACGCGGC 942529 5919 5938  821  840 GCCCACAGTG  91   55 GCGGCCCGCA 942535 5946 5965  848  867 CTCCTGTAGC  92 1052 GGCTGGCCGG 942541 5954 5973  856  875 TGGGCCCGCT  82 1053 CCTGTAGCGG 942547 6008 6027  910  929 CGGGTCCGGC  76 1054 TGCCCATCTC 942553 6014 6033  916  935 CGGTCGCGGG  92 1055 TCCGGCTGCC 942559 6020 6039  922  941 TCCAGGCGGT  87 1056 CGCGGGTCCG 942565 6060 6079  962  981 CAGCTTGGCG  82 1057 CGCACCTCCG 942571 6120 6139 1022 1041 GCTCTTGAGG 110 1058 CGGGCCTGGA 942577 6129 6148 1031 1050 CTCGAACCAG 101 1059 CTCTTGAGGC 942583 6232 6251 1134 1153 TTCAGTGATT  78 1060 GTCGCTGGGC 942587 6255 6274 1157 1176 TCGCATGGCT  10 1061 GCAGGCTTCG 942592 6341 6360 1243 1262 GGTCCACCCC  80 1062 AGGAGGACGG 942598 6372 6391 1274 1293 CGTGAAACTT  15 1063 GGTGAATCTT 942604 2838 2857   90  109 CGACTGCGCT  64 1064 TCTCACCGGC 942610 2844 2863   96  115 TGCCCCCGAC  68 1065 TGCGCTTCTC 942616 2851 2870  103  122 ATCCCCGTGC  69 1066 CCCCGACTGC 942622 3443 3462 N/A N/A CAAGCCGCCC  76 1067 CCAACCCATT 942628 3452 3471 N/A N/A CACATTTACC  94 1068 AAGCCGCCCC 942634 3490 3509 N/A N/A CAAGCCTTGT 104 1069 TGCATTATCT 942640 3501 3520 N/A N/A GGTTAGCCTT  87 1070 CCAAGCCTTG 942646 2930 2949 N/A N/A ACCCCGAGTA 126 1071 GCTCTCCTGA 942652 2936 2955 N/A N/A AGCCCGACCC  85 1072 CGAGTAGCTC 942658 3033 3052 N/A N/A CACCCCACCT  92 1073 TCTAGCGGGT 942664 3076 3095 N/A N/A TGGAGTCCTG  90 1074 CTATGGCTTA 942670 3169 3188 N/A N/A CTACCGTGTC  64 1075 GCTGCCCCTG 942676 3175 3194 N/A N/A GGCTAGCTAC  73 1076 CGTGTCGCTG 942682 3184 3203 N/A N/A CCAATCGACG  97 1077 GCTAGCTACC 942688 3230 3249 N/A N/A GCCGTGTTCC  69 1078 ATTTATGAGC 942694 3296 3315 N/A N/A TCTCAGTCCC  89 1079 AGTCTCGCAT 942700 3310 3329 N/A N/A CACCGCCGGT  76 1080 TCCATCTCAG 942706 3381 3400 N/A N/A CCAGGTCGGC  68 1081 CTCCATAGAA 942712 3515 3534 N/A N/A CCGGCCTCAC  87 1082 CCCAGGTTAG 942718 3564 3583 N/A N/A TCAATCAACC 102 1083 GCCAGTGAGG 942724 3676 3695 N/A N/A GGGAACCGAG  67 1084 CAAGCCCCGC 942730 4218 4237 N/A N/A CCCCGTGTCT  98 1085 GGTATTCACT 942736 4230 4249 N/A N/A AGATCACAGC 117 1086 TGCCCCGTGT 942742 4610 4629 N/A N/A CGGTTTAATC  91 1087 ACTTGGAAAG 942748 4698 4717 N/A N/A CCGTCCAGGC 153 1088 ATCTAGTACC 942754 4705 4724 N/A N/A TCTGACCCCG  95 1089 TCCAGGCATC 942760 4715 4734 N/A N/A TCAGGGTCCT  87 1090 TCTGACCCCG 942766 4978 4997 N/A N/A TAGCCGCCCA  87† 1091 CCAGGAGGGT 942772 4984 5003 N/A N/A GAGGTATAGC  91† 1092 CGCCCACCAG 942778 5033 5052 N/A N/A AGGCCCCCCA  65† 1093 AGACTTAGCG 942784 5517 5536 N/A N/A CGCCCTGCGG  98† 1094 CCGAGAGGGC

TABLE-US-00020 TABLE 20 Reduction of APOE RNA by 5-10-5 MOE gapmers  with mixed PO/PS internucleoside linkages at  a concentration of 5000 nM in transgenic primary mouse hepatocytes plated at 15,000  cells per well SEQ SEQ SEQ SEQ ID ID ID ID No: No: No: No: Com- 1 1 2 2 APOE SEQ pound Start Stop Start Stop Sequence  (% ID Number Site Site Site Site (5′ to 3′) UTC) NO 689046 6364 6381 1266 1283 GGTGAATCTT   9  478 TATTAAAC 708024 6371 6390 1273 1292 GTGAAACTTG  24   77 GTGAATCTTT 942338 2754 2773    6   25 CCAATTATAG  75 1095 GGCTCCCCCT 942344 2761 2780   13   32 GACTTGTCCA  69 1096 ATTATAGGGC 942350 2784 2803   36   55 CTGAGTAGGA  99 1097 CTCAAGGATC 942356 3637 3656  211  230 GTGACCAGCA 103 1098 ACGCAGCCCA 942362 3643 3662  217  236 AGGAATGTGA  71 1099 CCAGCAACGC 942368 4805 4824  287  306 GGTCTGCTGG  82 1100 CGCAGCTCGG 942374 4811 4830  293  312 CCACTCGGTC  70 1101 TGCTGGCGCA 942380 4849 4868  331  350 AAGCGACCCA  43† 1102 GTGCCAGTTC 942386 4856 4875  338  357 ATCCCAAAAG  31† 1103 CGACCCAGTG 942392 4862 4881  344  363 CAGGTAATCC  39† 1104 CAAAAGCGAC 942397 4868 4887  350  369 CCAGCGCAGG  12† 1105 TAATCCCAAA 942402 4875 4894  357  376 TCTGCACCCA  22†   34 GCGCAGGTAA 942406 5561 5580  463  482 TCCGATTTGT  81 1106 AGGCCTTCAA 942411 5567 5586  469  488 TCCAGTTCCG  95 1107 ATTTGTAGGC 942417 5574 5593  476  495 TTGTTCCTCC  79 1108 AGTTCCGATT 942423 5617 5636  519  538 CCTTGGACAG  59 1109 CCGTGCCCGC 942429 5661 5680  563  582 GTCCTCCATG  87 1110 TCCGCGCCCA 942435 5685 5704  587  606 GTACTGCACC 100 1111 AGGCGGCCGC 942441 5691 5710  593  612 GCCGCGGTAC  79   46 TGCACCAGGC 942447 5716 5735  618  637 TCTGGCCGAG 130 1112 CATGGCCTGC 942453 5724 5743  626  645 CTCGGTGCTC  72 1113 TGGCCGAGCA 942459 5746 5765  648  667 AGGCGAGGCG  81 1114 CACCCGCAGC 942465 5760 5779  662  681 CTTGCGCAGG  86 1115 TGGGAGGCGA 942471 5771 5790  673  692 CGCTTACGCA  87 1116 GCTTGCGCAG 942477 5777 5796  679  698 AGGAGCCGCT  95 1117 TACGCAGCTT 942483 5783 5802  685  704 TCGCGGAGGA  72 1118 GCCGCTTACG 942489 5790 5809  692  711 ATCGGCATCG 118 1119 CGGAGGAGCC 942495 5796 5815  698  717 CAGGTCATCG  76 1120 GCATCGCGGA 942500 5825 5844  727  746 CCGGCCTGGT  97   52 ACACTGCCAG 942506 5832 5851  734  753 GCGGGCCCCG  87   54 GCCTGGTACA 942512 5901 5920  803  822 CACGCGGCCC  54 1121 TGTTCCACCA 942518 5907 5926  809  828 GGCCCGCACG  87 1122 CGGCCCTGTT 942524 5914 5933  816  835 CAGTGGCGGC  81 1123 CCGCACGCGG 942530 5920 5939  822  841 AGCCCACAGT 122 1124 GGCGGCCCGC 942536 5947 5966  849  868 GCTCCTGTAG  83 1125 CGGCTGGCCG 942542 5955 5974  857  876 CTGGGCCCGC  65 1126 TCCTGTAGCG 942548 6009 6028  911  930 GCGGGTCCGG  73   60 CTGCCCATCT 942554 6015 6034  917  936 GCGGTCGCGG  83 1127 GTCCGGCTGC 942560 6021 6040  923  942 GTCCAGGCGG  69 1128 TCGCGGGTCC 942566 6062 6081  964  983 TCCAGCTTGG  68   61 CGCGCACCTC 942572 6124 6143 1026 1045 ACCAGCTCTT  82 1129 GAGGCGGGCC 942578 6130 6149 1032 1051 GCTCGAACCA  97 1130 GCTCTTGAGG 942584 6233 6252 1135 1154 GTTCAGTGAT  71 1131 TGTCGCTGGG 942588 6256 6275 1158 1177 GTCGCATGGC   9 1132 TGCAGGCTTC 942593 6347 6366 1249 1268 AACTAGGGTC  52   75 CACCCCAGGA 942599 2832 2851   84  103 CGCTTCTCAC  80 1133 CGGCTCCTGG 942605 2839 2858   91  110 CCGACTGCGC 103 1134 TTCTCACCGG 942611 2845 2864   97  116 GTGCCCCCGA  86 1135 CTGCGCTTCT 942617 2853 2872  105  124 TCATCCCCGT  52 1136 GCCCCCGACT 942623 3447 3466 N/A N/A TTACCAAGCC  96 1137 GCCCCCAACC 942629 3453 3472 N/A N/A GCACATTTAC  65 1138 CAAGCCGCCC 942635 3491 3510 N/A N/A CCAAGCCTTG  76 1139 TTGCATTATC 942641 2923 2942 N/A N/A GTAGCTCTCC 117 1140 TGAGACTACC 942647 2931 2950 N/A N/A GACCCCGAGT  98 1141 AGCTCTCCTG 942653 2937 2956 N/A N/A AAGCCCGACC  75 1142 CCGAGTAGCT 942659 3065 3084 N/A N/A TATGGCTTAC  96 1143 ATCCCAGTCC 942665 3078 3097 N/A N/A CGTGGAGTCC  66 1144 TGCTATGGCT 942671 3170 3189 N/A N/A GCTACCGTGT  73 1145 CGCTGCCCCT 942677 3176 3195 N/A N/A CGGCTAGCTA  99 1146 CCGTGTCGCT 942683 3187 3206 N/A N/A TCTCCAATCG 108 1147 ACGGCTAGCT 942689 3231 3250 N/A N/A CGCCGTGTTC  68 1148 CATTTATGAG 942695 3305 3324 N/A N/A CCGGTTCCAT  79 1149 CTCAGTCCCA 942701 3311 3330 N/A N/A CCACCGCCGG  81 1150 TTCCATCTCA 942707 3383 3402 N/A N/A CCCCAGGTCG  78 1151 GCCTCCATAG 942713 3556 3575 N/A N/A CCGCCAGTGA  77 1152 GGACTCCTCC 942719 3567 3586 N/A N/A CTGTCAATCA  88 1153 ACCGCCAGTG 942725 3785 3804 N/A N/A ATCGCTGTTC  92 1154 AGAGCCAGGA 942731 4219 4238 N/A N/A GCCCCGTGTC  73 1155 TGGTATTCAC 942737 4233 4252 N/A N/A TAAAGATCAC  82 1156 AGCTGCCCCG 942743 4612 4631 N/A N/A GTCGGTTTAA  73 1157 TCACTTGGAA 942749 4699 4718 N/A N/A CCCGTCCAGG  74 1158 CATCTAGTAC 942755 4706 4725 N/A N/A TTCTGACCCC 108 1159 GTCCAGGCAT 942761 4733 4752 N/A N/A GAACAAGTTC  98 1160 AAGGTGGGTC 942767 4979 4998 N/A N/A ATAGCCGCCC  75† 1161 ACCAGGAGGG 942773 4985 5004 N/A N/A GGAGGTATAG  87† 1162 CCGCCCACCA 942779 5152 5171 N/A N/A CGAGTGTGAG  87† 1163 AGACTGAGTC 942785 5518 5537 N/A N/A GCGCCCTGCG  75† 1164 GCCGAGAGGG

TABLE-US-00021 TABLE 21 Reduction of APOE RNA by 5-10-5 MOE gapmers  with mixed PO/PS internucleoside linkages at  a concentration of 4000 nM in Hep3B cells   plated at 20,000 cells per well SEQ SEQ SEQ SEQ ID ID ID ID No: No: No:  No: Com- 1 1 2 2 APOE SEQ pound Start Stop Start Stop Sequence  (% ID Number Site Site Site Site (5′ to 3′) UTC) NO  942584 6233 6252 1135 1154 GTTCAGTGAT  43 1131 TGTCGCTGGG  942586 6253 6272 1155 1174 GCATGGCTGC  14  919 AGGCTTCGGC  942597 6353 6372 1255 1274 TTATTAAACT  48   76 AGGGTCCACC 1517142 3368 3387 N/A N/A CATAGAAAAT  76 1165 TCCATCTTCC 1517148 3219 3238 N/A N/A TTTATGAGCT  60 1166 AATTCAGTCC 1517167 4819 4838  301  320 CCGCTCTGCC  63 1167 ACTCGGTCTG 1517173 4210 4229 N/A N/A CTGGTATTCA  82 1168 CTATCTGCCT 1517183 3446 3465 N/A N/A TACCAAGCCG  62 1169 CCCCCAACCC 1517210 3005 3024 N/A N/A CTCTGCTGCC  89 1170 CAGCCCTTCC 1517234 4782 4801  264  283 CCGGCTCTGT  59 1171 CTCCACCGCT 1517246 3062 3081 N/A N/A GGCTTACATC  68 1172 CCAGTCCAGC 1517253 5044 5063 N/A N/A AGCAGAGACC  76† 1173 CAGGCCCCCC 1517272 3850 3869 N/A N/A AACAACAAAA  81 1174 CAACTTCTAA 1517280 6173 6192 1075 1094 TCCACCAGCC  82 1175 CGGCCCACTG 1517287 3629 3648  203  222 CAACGCAGCC  62 1176 CACAGAACCT 1517293 3398 3417 N/A N/A CTCTTATCTC  67 1177 CCCATCCCCA 1517308 3295 3314 N/A N/A CTCAGTCCCA  62 1178 GTCTCGCATT 1517316 4613 4632 N/A N/A AGTCGGTTTA  73 1179 ATCACTTGGA 1517317 3434 3453 N/A N/A CCCAACCCAT  79 1180 TCCCTATTTA 1517318 3254 3273 N/A N/A TAAGCTCCAA  68 1181 CCTCACAGTT 1517322 4594 4613 N/A N/A AAAGCATTAT  92 1182 GTATTTATAA 1517333 6213 6232 1115 1134 CACAGGGGCG  88 1183 GCGCTGGTGC 1517341 4766 4785  248  267 CGCTTGCTCC 106 1184 ACCTTGGCCT 1517343 3466 3485 N/A N/A CAGCCTAATC  79 1185 CCAGCACATT 1517345 4887 4906  369  388 GCTCAGACAG  38† 1186 TGTCTGCACC 1517347 3527 3546 N/A N/A CCCGGCCCCA 110 1187 ACCCGGCCTC 1517356 3266 3285 N/A N/A CCCTTCACAT  84 1188 TCTAAGCTCC 1517365 3617 3636  191  210 CAGAACCTTC  52 1189 ATCTTCCTGC 1517378 3410 3429 N/A N/A CCTCCTGGTC  68 1190 TTCTCTTATC 1517392 3341 3360 N/A N/A GGGTTCAAAT  72 1191 TCCATCCCCC 1517396 6333 6352 1235 1254 CCAGGAGGAC  77 1192 GGCTGGGGCG 1517427 6363 6382 1265 1284 TGGTGAATCT  18 1193 TTATTAAACT 1517441 5009 5028 N/A N/A GGGCAGAATG  85† 1194 AAACCTGGAC 1517447 3513 3532 N/A N/A GGCCTCACCC  84 1195 CAGGTTAGCC 1517456 3319 3338 N/A N/A CCCCCTCCCC  67 1196 ACCGCCGGTT 1517459 3424 3443 N/A N/A TCCCTATTTA  90 1197 ACTCCCTCCT 1517464 3667 3686 N/A N/A GCAAGCCCCG  71 1198 CCCCCATACC 1517483 3105 3124 N/A N/A GGTGCTCGAT  82 1199 AAATGATAGT 1517492 4540 4559 N/A N/A AGCGGCCTGA  94 1200 ACATGGTTCA 1517493 3768 3787 N/A N/A GGAAGCAGCA  65 1201 CAGAAGCCTC 1517510 3571 3590 N/A N/A GAAACTGTCA  80 1202 ATCAACCGCC 1517512 2881 2900  133  152 TCCCAGCTCT  84 1203 TTCTAGAGGC 1517531 4707 4726 N/A N/A CTTCTGACCC  81 1204 CGTCCAGGCA 1517535 6263 6282 1165 1184 GCGTGGGGTC  23 1205 GCATGGCTGC 1517548 3206 3225 N/A N/A TCAGTCCTCA  81 1206 TTTTAAAGTT 1517555 6303 6322 1205 1224 CTCCCGCTGC  33 1207 AGGCTGCGCG 1517556 3551 3570 N/A N/A AGTGAGGACT  76 1208 CCTCCCACCC 1517558 6153 6172 1055 1074 GCGCTGCATG  55   66 TCTTCCACCA 1517560 6273 6292 1175 1194 GCACGGGGTG  59 1209 GCGTGGGGTC 1517561 3050 3069 N/A N/A AGTCCAGCTG  69 1210 CTCTCCCCAC 1517581 5056 5075 N/A N/A GAAGCTAGAA  82† 1211 CCAGCAGAGA 1517601 2864 2883  116  135 GGCCCCTGAG  82 1212 CTCATCCCCG 1517603 2988 3007 N/A N/A TCCCAGGTCC  91 1213 AGTCCCCTGC 1517612 3193 3212 N/A N/A TAAAGTTCTC  65 1214 CAATCGACGG 1517617 6133 6152 1035 1054 GGGGCTCGAA  81 1215 CCAGCTCTTG 1517646 2962 2981 N/A N/A CCTCACCCCC 117 1216 GCTCCTCCTC 1517648 6243 6262 1145 1164 AGGCTTCGGC  63 1217 GTTCAGTGAT 1517660 3380 3399 N/A N/A CAGGTCGGCC  83 1218 TCCATAGAAA 1517677 3283 3302 N/A N/A CTCGCATTCC  52 1219 TCATTCTCCC 1517688 6193 6212 1095 1114 CCACGGCAGC  64 1220 CTGCACCTTC 1517714 4194 4213 N/A N/A GCCTGCAATG  78 1221 CATTAGAAAC 1517743 4242 4261 N/A N/A GATGGAGAAT  81 1222 AAAGATCACA 1517751 3494 3513 N/A N/A CTTCCAAGCC  85 1223 TTGTTGCATT 1517755 6313 6332 1215 1234 GGGACAGGGT  46 1224 CTCCCGCTGC 1517766 6343 6362 1245 1264 AGGGTCCACC  87   74 CCAGGAGGAC 1517773 3840 3859 N/A N/A CAACTTCTAA  91 1225 CTCCTATCTC 1517790 6283 6302 1185 1204 GAGGCAGGAG  86 1226 GCACGGGGTG 1517796 3658 3677 N/A N/A GCCCCCATAC  91 1227 CTGCCAGGAA 1517814 4909 4928  391  410 CTGAGCAGCT  44† 1228 CCTCCTGCAC 1517817 6293 6312 1195 1214 AGGCTGCGCG  45 1229 GAGGCAGGAG 1517834 2972 2991 N/A N/A CTGCTGCTTG  76 1230 CCTCACCCCC 1517849 6374 6393 1276 1295 TGCGTGAAAC  19 1231 TTGGTGAATC 1517853 6364 6383 1266 1285 TTGGTGAATC  22 1232 TTTATTAAAC 1517860 2948 2967 N/A N/A CTCCTCTCCC  79 1233 CAAGCCCGAC 1517894 6323 6342 1225 1244 GGCTGGGGCG 116 1234 GGGACAGGGT 1517897 2919 2938 N/A N/A CTCTCCTGAG  63 1235 ACTACCTGGA 1517902 4184 4203 N/A N/A CATTAGAAAC 104 1236 CTCTAACTCC 1517905 3477 3496 N/A N/A ATTATCTGCA  75 1237 ACAGCCTAAT

TABLE-US-00022 TABLE 22 Reduction of APOE RNA by 5-10-5 MOE gapmers  with mixed PO/PS internucleoside linkages at  a concentration of 4000 nM in Hep3B cells   plated at 20,000 cells per well SEQ SEQ SEQ SEQ ID ID ID ID No: No: No: No: Com- 1 1 2 2 APOE SEQ pound Start Stop Start Stop Sequence  (% ID Number Site Site Site Site (5′ to 3′) UTC) NO  942582 6231 6250 1133 1152 TCAGTGATTG  61  989 TCGCTGGGCA  942585 6252 6271 1154 1173 CATGGCTGCA  36  847 GGCTTCGGCG  942590 6302 6321 1204 1223 TCCCGCTGCA  83  920 GGCTGCGCGG 1517150 3409 3428 N/A N/A CTCCTGGTCT  71 1238 TCTCTTATCT 1517180 6312 6331 1214 1233 GGACAGGGTC  26 1239 TCCCGCTGCA 1517187 4193 4212 N/A N/A CCTGCAATGC  78 1240 ATTAGAAACC 1517192 4208 4227 N/A N/A GGTATTCACT  77 1241 ATCTGCCTGC 1517199 3253 3272 N/A N/A AAGCTCCAAC  82 1242 CTCACAGTTA 1517200 3340 3359 N/A N/A GGTTCAAATT  75 1243 CCATCCCCCC 1517201 3004 3023 N/A N/A TCTGCTGCCC  78 1244 AGCCCTTCCC 1517227 3205 3224 N/A N/A CAGTCCTCAT  74 1245 TTTAAAGTTC 1517232 5008 5027 N/A N/A GGCAGAATGA  72† 1246 AACCTGGACC 1517235 4697 4716 N/A N/A CGTCCAGGCA  67 1247 TCTAGTACCT 1517236 3422 3441 N/A N/A CCTATTTAAC  74 1248 TCCCTCCTGG 1517245 3378 3397 N/A N/A GGTCGGCCTC  50 1249 CATAGAAAAT 1517252 3190 3209 N/A N/A AGTTCTCCAA  91 1250 TCGACGGCTA 1517289 2961 2980 N/A N/A CTCACCCCCG 103 1251 CTCCTCCTCT 1517290 6151 6170 1053 1072 GCTGCATGTC  71 1252 TTCCACCAGG 1517294 6272 6291 1174 1193 CACGGGGTGG  84 1253 CGTGGGGTCG 1517328 3061 3080 N/A N/A GCTTACATCC  72 1254 CAGTCCAGCT 1517370 N/A N/A  232  251 GCCTGGCATC  88 1255 CTGCCAGGAA 1517371 2971 2990 N/A N/A TGCTGCTTGC  86 1256 CTCACCCCCG 1517412 4240 4259 N/A N/A TGGAGAATAA  71 1257 AGATCACAGC 1517426 4183 4202 N/A N/A ATTAGAAACC  90 1258 TCTAACTCCC 1517427 6363 6382 1265 1284 TGGTGAATCT  14 1193 TTATTAAACT 1517428 4765 4784  247  266 GCTTGCTCCA 164 1259 CCTTGGCCTG 1517430 3849 3868 N/A N/A ACAACAAAAC  76 1260 AACTTCTAAC 1517438 3616 3635  190  209 AGAACCTTCA  85 1261 TCTTCCTGCC 1517450 3282 3301 N/A N/A TCGCATTCCT  69 1262 CATTCTCCCT 1517460 3627 3646  201  220 ACGCAGCCCA  61 1263 CAGAACCTTC 1517461 3666 3685 N/A N/A CAAGCCCCGC  66 1264 CCCCATACCT 1517477 6262 6281 1164 1183 CGTGGGGTCG  32 1265 CATGGCTGCA 1517485 3218 3237 N/A N/A TTATGAGCTA  63 1266 ATTCAGTCCT 1517487 3839 3858 N/A N/A AACTTCTAAC  85 1267 TCCTATCTCA 1517494 5042 5061 N/A N/A CAGAGACCCA  82† 1268 GGCCCCCCAA 1517498 6292 6311 1194 1213 GGCTGCGCGG  39 1269 AGGCAGGAGG 1517504 4593 4612 N/A N/A AAGCATTATG  84 1270 TATTTATAAA 1517506 6282 6301 1184 1203 AGGCAGGAGG  81 1271 CACGGGGTGG 1517522 4611 4630 N/A N/A TCGGTTTAAT 108 1272 CACTTGGAAA 1517542 3476 3495 N/A N/A TTATCTGCAA  76 1273 CAGCCTAATC 1517554 5055 5074 N/A N/A AAGCTAGAAC  93† 1274 CAGCAGAGAC 1517557 4539 4558 N/A N/A GCGGCCTGAA  79 1275 CATGGTTCAC 1517559 6342 6361 1244 1263 GGGTCCACCC  69 1276 CAGGAGGACG 1517569 3294 3313 N/A N/A TCAGTCCCAG  88 1277 TCTCGCATTC 1517583 2916 2935 N/A N/A TCCTGAGACT  86 1278 ACCTGGAGGC 1517586 3526 3545 N/A N/A CCGGCCCCAA 100 1279 CCCGGCCTCA 1517600 3512 3531 N/A N/A GCCTCACCCC  95 1280 AGGTTAGCCT 1517605 3465 3484 N/A N/A AGCCTAATCC  81 1281 CAGCACATTT 1517606 3570 3589 N/A N/A AAACTGTCAA 101 1282 TCAACCGCCA 1517614 3264 3283 N/A N/A CTTCACATTC  74 1283 TAAGCTCCAA 1517620 5102 5121 N/A N/A GAGAGAATTC  84† 1284 CAGAGAGCTA 1517626 6211 6230 1113 1132 CAGGGGCGGC  88 1285 GCTGGTGCCC 1517631 6322 6341 1224 1243 GCTGGGGCGG  89 1286 GGACAGGGTC 1517679 3367 3386 N/A N/A ATAGAAAATT  78 1287 CCATCTTCCT 1517697 6352 6371 1254 1273 TATTAAACTA  49 1288 GGGTCCACCC 1517698 6191 6210 1093 1112 ACGGCAGCCT  70 1289 GCACCTTCTC 1517700 2947 2966 N/A N/A TCCTCTCCCC  76 1290 AAGCCCGACC 1517710 3048 3067 N/A N/A TCCAGCTGCT  75 1291 CTCCCCACCC 1517711 4908 4927  390  409 TGAGCAGCTC  41† 1292 CTCCTGCACC 1517716 2863 2882  115  134 GCCCCTGAGC  93 1293 TCATCCCCGT 1517717 3550 3569 N/A N/A GTGAGGACTC  75 1294 CTCCCACCCC 1517728 3493 3512 N/A N/A TTCCAAGCCT  78 1295 TGTTGCATTA 1517738 3433 3452 N/A N/A CCAACCCATT  87 1296 CCCTATTTAA 1517752 3103 3122 N/A N/A TGCTCGATAA  73 1297 ATGATAGTGA 1517754 4781 4800  263  282 CGGCTCTGTC  61 1298 TCCACCGCTT 1517756 2987 3006 N/A N/A CCCAGGTCCA  78 1299 GTCCCCTGCT 1517770 6362 6381 1264 1283 GGTGAATCTT   8 1300 TATTAAACTA 1517785 3318 3337 N/A N/A CCCCTCCCCA  80 1301 CCGCCGGTTC 1517801 6171 6190 1073 1092 CACCAGCCCG  89 1302 GCCCACTGGC 1517807 4881 4900  363  382 ACAGTGTCTG  19† 1303 CACCCAGCGC 1517831 3767 3786 N/A N/A GAAGCAGCAC  90 1304 AGAAGCCTCA 1517837 6373 6392 1275 1294 GCGTGAAACT  25 1305 TGGTGAATCT 1517856 3397 3416 N/A N/A TCTTATCTCC  69 1306 CCATCCCCAG 1517865 4818 4837  300  319 CGCTCTGCCA 107 1307 CTCGGTCTGC 1517866 3445 3464 N/A N/A ACCAAGCCGC  77 1308 CCCCAACCCA 1517869 6332 6351 1234 1253 CAGGAGGACG  90 1309 GCTGGGGCGG 1517870 2880 2899  132  151 CCCAGCTCTT  77 1310 TCTAGAGGCC 1517882 6242 6261 1144 1163 GGCTTCGGCG  56 1311 TTCAGTGATT

TABLE-US-00023 TABLE 23 Reduction of APOE RNA by 5-10-5 MOE gapmers  with mixed PO/PS internucleoside linkages   at a concentration of 4000 nM in Hep3B  cells plated at 20,000 cells per well SEQ SEQ SEQ SEQ ID ID ID ID No: No: No: No: Com- 1 1 2 2 APOE SEQ pound Start Stop Start Stop Sequence  (% ID Number Site Site Site Site (5′ to 3′) UTC) NO  942589 6301 6320 1203 1222 CCCGCTGCAG  51  848 GCTGCGCGGA  942592 6341 6360 1243 1262 GGTCCACCCC  74 1062 AGGAGGACGG  942596 6351 6370 1253 1272 ATTAAACTAG  54  921 GGTCCACCCC  942598 6372 6391 1274 1293 CGTGAAACTT  30 1063 GGTGAATCTT 1517149 6241 6260 1143 1162 GCTTCGGCGT  70 1312 TCAGTGATTG 1517168 3444 3463 N/A N/A CCAAGCCGCC  87 1313 CCCAACCCAT 1517169 3102 3121 N/A N/A GCTCGATAAA  91 1314 TGATAGTGAC 1517170 6281 6300 1183 1202 GGCAGGAGGC  49 1315 ACGGGGTGGC 1517178 3204 3223 N/A N/A AGTCCTCATT  78 1316 TTAAAGTTCT 1517191 6251 6270 1153 1172 ATGGCTGCAG  49 1317 GCTTCGGCGT 1517194 2985 3004 N/A N/A CAGGTCCAGT  89 1318 CCCCTGCTGC 1517197 6149 6168 1051 1070 TGCATGTCTT  78 1319 CCACCAGGGG 1517226 3281 3300 N/A N/A CGCATTCCTC  63 1320 ATTCTCCCTT 1517229 5040 5059 N/A N/A GAGACCCAGG  98† 1321 CCCCCCAAGA 1517276 3408 3427 N/A N/A TCCTGGTCTT  84 1322 CTCTTATCTC 1517291 3525 3544 N/A N/A CGGCCCCAAC 107 1323 CCGGCCTCAC 1517304 4608 4627 N/A N/A GTTTAATCAC  77 1324 TTGGAAAGCA 1517306 3549 3568 N/A N/A TGAGGACTCC  80 1325 TCCCACCCCC 1517309 6331 6350 1233 1252 AGGAGGACGG  90 1326 CTGGGGCGGG 1517311 4880 4899  362 381 CAGTGTCTGC  36† 1327 ACCCAGCGCA 1517336 3464 3483 N/A N/A GCCTAATCCC  86 1328 AGCACATTTA 1517337 3047 3066 N/A N/A CCAGCTGCTC  74 1329 TCCCCACCCC 1517379 3252 3271 N/A N/A AGCTCCAACC  73 1330 TCACAGTTAA 1517388 6321 6340 1223 1242 CTGGGGCGGG  94 1331 GACAGGGTCT 1517401 3366 3385 N/A N/A TAGAAAATTC  96 1332 CATCTTCCTC 1517406 6169 6188 1071 1090 CCAGCCCGGC  79 1333 CCACTGGCGC 1517427 6363 6382 1265 1284 TGGTGAATCT  25 1193 TTATTAAACT 1517448 4192 4211 N/A N/A CTGCAATGCA  89 1334 TTAGAAACCT 1517454 3420 3439 N/A N/A TATTTAACTC  91 1335 CCTCCTGGTC 1517455 3003 3022 N/A N/A CTGCTGCCCA  74 1336 GCCCTTCCCA 1517458 3838 3857 N/A N/A ACTTCTAACT  79 1337 CCTATCTCAA 1517463 4665 4684 N/A N/A AAGGTGCTCC  92 1338 ACAAATGCTT 1517472 3848 3867 N/A N/A CAACAAAACA  86 1339 ACTTCTAACT 1517474 3487 3506 N/A N/A GCCTTGTTGC  96 1340 ATTATCTGCA 1517486 4779 4798  261  280 GCTCTGTCTC  84 1341 CACCGCTTGC 1517489 3263 3282 N/A N/A TTCACATTCT  70 1342 AAGCTCCAAC 1517491 3291 3310 N/A N/A GTCCCAGTCT  71 1343 CGCATTCCTC 1517495 4239 4258 N/A N/A GGAGAATAAA  63 1344 GATCACAGCT 1517511 3339 3358 N/A N/A GTTCAAATTC  75 1345 CATCCCCCCA 1517523 3626 3645  200  219 CGCAGCCCAC  80 1346 AGAACCTTCA 1517528 4817 4836  299  318 GCTCTGCCAC 106 1347 TCGGTCTGCT 1517538 2861 2880  113  132 CCCTGAGCTC  80 1348 ATCCCCGTGC 1517546 4591 4610 N/A N/A GCATTATGTA  92 1349 TTTATAAACA 1517566 3217 3236 N/A N/A TATGAGCTAA  87 1350 TTCAGTCCTC 1517587 6189 6208 1091 1110 GGCAGCCTGC  67 1351 ACCTTCTCCA 1517619 2960 2979 N/A N/A TCACCCCCGC  78 1352 TCCTCCTCTC 1517628 3511 3530 N/A N/A CCTCACCCCA  92 1353 GGTTAGCCTT 1517629 3317 3336 N/A N/A CCCTCCCCAC  99 1354 CGCCGGTTCC 1517632 6261 6280 1163 1182 GTGGGGTCGC  41 1355 ATGGCTGCAG 1517636 6291 6310 1193 1212 GCTGCGCGGA  32 1356 GGCAGGAGGC 1517653 2946 2965 N/A N/A CCTCTCCCCA  91 1357 AGCCCGACCC 1517657 4182 4201 N/A N/A TTAGAAACCT  83 1358 CTAACTCCCA 1517672 5007 5026 N/A N/A GCAGAATGAA  73† 1359 ACCTGGACCT 1517673 3396 3415 N/A N/A CTTATCTCCC  90 1360 CATCCCCAGG 1517682 3764 3783 N/A N/A GCAGCACAGA  66 1361 AGCCTCAGAA 1517683 6229 6248 1131 1150 AGTGATTGTC  57 1362 GCTGGGCACA 1517712 3377 3396 N/A N/A GTCGGCCTCC  93 1363 ATAGAAAATT 1517713 6271 6290 1173 1192 ACGGGGTGGC  67 1364 GTGGGGTCGC 1517721 4763 4782  245  264 TTGCTCCACC  96 1365 TTGGCCTGGC 1517725 3569 3588 N/A N/A AACTGTCAAT  84 1366 CAACCGCCAG 1517746 4907 4926  389  408 GAGCAGCTCC  28† 1367 TCCTGCACCT 1517765 3615 3634  189  208 GAACCTTCAT  74 1368 CTTCCTGCCT 1517767 3475 3494 N/A N/A TATCTGCAAC 104 1369 AGCCTAATCC 1517802 3059 3078 N/A N/A TTACATCCCA  73 1370 GTCCAGCTGC 1517804 3665 3684 N/A N/A AAGCCCCGCC  82 1371 CCCATACCTG 1517819 2879 2898  131  150 CCAGCTCTTT  75 1372 CTAGAGGCCC 1517823 6311 6330 1213 1232 GACAGGGTCT  32 1373 CCCGCTGCAG 1517828 4534 4553 N/A N/A CTGAACATGG  75 1374 TTCACTGCAA 1517852 5054 5073 N/A N/A AGCTAGAACC  74† 1375 AGCAGAGACC 1517862 2970 2989 N/A N/A GCTGCTTGCC  79 1376 TCACCCCCGC 1517884 2915 2934 N/A N/A CCTGAGACTA  87 1377 CCTGGAGGCC 1517885 6361 6380 1263 1282 GTGAATCTTT  24 1378 ATTAAACTAG 1517887 6209 6228 1111 1130 GGGGCGGCGC  89 1379 TGGTGCCCAC 1517893 3657 3676 N/A N/A CCCCCATACC  78 1380 TGCCAGGAAT 1517898 5097 5116 N/A N/A AATTCCAGAG  80† 1381 AGCTAAAGCC 1517903 3432 3451 N/A N/A CAACCCATTC  85 1382 CCTATTTAAC 1517904 3165 3184 N/A N/A CGTGTCGCTG  84 1383 CCCCTGGCTC 1517910 4207 4226 N/A N/A GTATTCACTA  78 1384 TCTGCCTGCA

TABLE-US-00024 TABLE 24 Reduction of APOE RNA by 5-10-5 MOE gapmers with mixed PO/PS internucleoside linkages at a concentration of 4000 nM in Hep3B cells plated at 20,000 cells per well SEQ ID SEQ ID SEQ ID SEQ ID No: 1 No: 1 No: 2 No: 2 APOE Compound Start Stop Start Stop (% SEQ ID Number Site Site Site Site Sequence (5′ to 3′) UTC) NO  708024 6371 6390 1273 1292 GTGAAACTTGGTGAATCTTT  25   77  942595 6350 6369 1252 1271 TTAAACTAGGGTCCACCCCA  50  849 1517155 4206 4225 N/A N/A TATTCACTATCTGCCTGCAA  73 1385 1517157 6300 6319 1202 1221 CCGCTGCAGGCTGCGCGGAG  89 1386 1517158 6270 6289 1172 1191 CGGGGTGGCGTGGGGTCGCA  49 1387 1517160 6147 6166 1049 1068 CATGTCTTCCACCAGGGGCT  85 1388 1517162 4800 4819  282  301 GCTGGCGCAGCTCGGGCTCC  85 1389 1517166 3613 3632  187  206 ACCTTCATCTTCCTGCCTGT  61 1390 1517171 3473 3492 N/A N/A TCTGCAACAGCCTAATCCCA  71 1391 1517172 3216 3235 N/A N/A ATGAGCTAATTCAGTCCTCA  75 1392 1517175 6280 6299 1182 1201 GCAGGAGGCACGGGGTGGCG  49 1393 1517212 5096 5115 N/A N/A ATTCCAGAGAGCTAAAGCCA  72† 1394 1517230 6207 6226 1109 1128 GGCGGCGCTGGTGCCCACGG  67 1395 1517255 4762 4781  244  263 TGCTCCACCTTGGCCTGGCA  96 1396 1517257 3847 3866 N/A N/A AACAAAACAACTTCTAACTC 102 1397 1517263 4606 4625 N/A N/A TTAATCACTTGGAAAGCATT  64 1398 1517270 3164 3183 N/A N/A GTGTCGCTGCCCCTGGCTCC  71 1399 1517312 4191 4210 N/A N/A TGCAATGCATTAGAAACCTC  62 1400 1517315 4976 4995 N/A N/A GCCGCCCACCAGGAGGGTCA  83†   85 1517323 3376 3395 N/A N/A TCGGCCTCCATAGAAAATTC  76 1401 1517325 3365 3384 N/A N/A AGAAAATTCCATCTTCCTCT  77 1402 1517348 2959 2978 N/A N/A CACCCCCGCTCCTCCTCTCC  80 1403 1517358 3290 3309 N/A N/A TCCCAGTCTCGCATTCCTCA  70 1404 1517363 3441 3460 N/A N/A AGCCGCCCCCAACCCATTCC  69 1405 1517367 6260 6279 1162 1181 TGGGGTCGCATGGCTGCAGG  35 1406 1517372 3203 3222 N/A N/A GTCCTCATTTTAAAGTTCTC  77 1407 1517375 3431 3450 N/A N/A AACCCATTCCCTATTTAACT  87 1408 1517383 6360 6379 1262 1281 TGAATCTTTATTAAACTAGG  16 1409 1517390 2984 3003 N/A N /A AGGTCCAGTCCCCTGCTGCT  75 1410 1517404 3250 3269 N/A N/A CTCCAACCTCACAGTTAAGC  79 1411 1517410 3664 3683 N/A N/A AGCCCCGCCCCCATACCTGC  91 1412 1517424 6240 6259 1142 1161 CTTCGGCGTTCAGTGATTGT  54 1413 1517427 6363 6382 1265 1284 TGGTGAATCTTTATTAAACT  28 1193 1517432 6330 6349 1232 1251 GGAGGACGGCTGGGGCGGGG  76 1414 1517434 6227 6246 1129 1148 TGATTGTCGCTGGGCACAGG  67 1415 1517440 N/A N/A  231  250 CCTGGCATCCTGCCAGGAAT  90 1416 1517443 3568 3587 N/A N/A ACTGTCAATCAACCGCCAGT  98 1417 1517468 3507 3526 N/A N/A ACCCCAGGTTAGCCTTCCAA  85 1418 1517473 3101 3120 N/A N/A CTCGATAAATGATAGTGACA  53 1419 1517497 3625 3644  199  218 GCAGCCCACAGAACCTTCAT  58   21 1517513 3548 3567 N/A N/A GAGGACTCCTCCCACCCCCA 103 1420 1517529 4902 4921  384  403 GCTCCTCCTGCACCTGCTCA  14† 1421 1517536 2945 2964 N/A N/A CTCTCCCCAAGCCCGACCCC  87 1422 1517539 3058 3077 N/A N/A TACATCCCAGTCCAGCTGCT  87 1423 1517549 6187 6206 1089 1108 CAGCCTGCACCTTCTCCACC  66 1424 1517574 6310 6329 1212 1231 ACAGGGTCTCCCGCTGCAGG  24 1425 1517577 3837 3856 N/A N/A CTTCTAACTCCTATCTCAAG  83 1426 1517592 3463 3482 N/A N/A CCTAATCCCAGCACATTTAC  89 1427 1517607 4590 4609 N/A N/A CATTATGTATTTATAAACAG  72 1428 1517616 3395 3414 N/A N/A TTATCTCCCCATCCCCAGGT  72 1429 1517621 5039 5058 N/A N/A AGACCCAGGCCCCCCAAGAC  78† 1430 1517645 2999 3018 N/A N/A TGCCCAGCCCTTCCCAGGTC  90 1431 1517649 3407 3426 N/A N/A CCTGGTCTTCTCTTATCTCC  96 1432 1517654 2878 2897  130  149 CAGCTCTTTCTAGAGGCCCC  65 1433 1517684 3042 3061 N/A N/A TGCTCTCCCCACCCCACCTT  77 1434 1517693 2914 2933 N/A N/A CTGAGACTACCTGGAGGCCA  81 1435 1517702 4181 4200 N/A N/A TAGAAACCTCTAACTCCCAG  96 1436 1517705 3338 3357 N/A N/A TTCAAATTCCATCCCCCCAC  75 1437 1517706 6340 6359 1242 1261 GTCCACCCCAGGAGGACGGC  86   73 1517720 4237 4256 N/A N/A AGAATAAAGATCACAGCTGC  67 1438 1517730 4778 4797  260  279 CTCTGTCTCCACCGCTTGCT  89 1439 1517736 4874 4893  356  375 CTGCACCCAGCGCAGGTAAT  28† 1440 1517740 6250 6269 1152 1171 TGGCTGCAGGCTTCGGCGTT  49 1441 1517744 6320 6339 1222 1241 TGGGGCGGGGACAGGGTCTC  77 1442 1517749 3316 3335 N/A N/A CCTCCCCACCGCCGGTTCCA  71 1443 1517750 6290 6309 1192 1211 CTGCGCGGAGGCAGGAGGCA  61 1444 1517762 3486 3505 N/A N/A CCTTGTTGCATTATCTGCAA  92 1445 1517763 2860 2879  112  131 CCTGAGCTCATCCCCGTGCC  65 1446 1517772 2969 2988 N/A N/A CTGCTTGCCTCACCCCCGCT  74 1447 1517775 3419 3438 N/A N/A ATTTAACTCCCTCCTGGTCT  73 1448 1517789 5053 5072 N/A N/A GCTAGAACCAGCAGAGACCC  69† 1449 1517803 3274 3293 N/A N/A CTCATTCTCCCTTCACATTC  78 1450 1517840 3262 3281 N/A N/A TCACATTCTAAGCTCCAACC  86 1451 1517844 6167 6186 1069 1088 AGCCCGGCCCACTGGCGCTG  70 1452 1517851 4664 4683 N/A N/A AGGTGCTCCACAAATGCTTC  67 1453 1517883 4307 4326 N/A N/A CCGCGCCCAGCGGAAAAGCA  73 1454 1517900 3759 3778 N/A N/A ACAGAAGCCTCAGAAGAGGG  77 1455 1517909 3523 3542 N/A N/A GCCCCAACCCGGCCTCACCC  91 1456

TABLE-US-00025 TABLE 25 Reduction of APOE RNA by 5-10-5 MOE gapmers with mixed PO/PS internucleoside linkages at a concentration of 4000 nM in Hep3B cells plated at 20,000 cells per well SEQ ID SEQ ID SEQ ID SEQ ID No: 1 No: 1 No: 2 No: 2 APOE Compound Start Stop Start Stop (% SEQ ID Number Site Site Site Site Sequence (5′ to 3′) UTC) NO  942594 6349 6368 1251 1270 TAAACTAGGGTCCACCCCAG  79  776 1517154 3202 3221 N/A N/A TCCTCATTTTAAAGTTCTCC  80 1457 1517156 5052 5071 N/A N/A CTAGAACCAGCAGAGACCCA  76† 1458 1517164 6319 6338 1221 1240 GGGGCGGGGACAGGGTCTCC 124 1459 1517182 6299 6318 1201 1220 CGCTGCAGGCTGCGCGGAGG  52 1460 1517208 6269 6288 1171 1190 GGGGTGGCGTGGGGTCGCAT  26 1461 1517238 3430 3449 N/A N/A ACCCATTCCCTATTTAACTC 103 1462 1517249 3505 3524 N/A N/A CCCAGGTTAGCCTTCCAAGC  81 1463 1517250 3057 3076 N/A N/A ACATCCCAGTCCAGCTGCTC  90 1464 1517261 3289 3308 N/A N/A CCCAGTCTCGCATTCCTCAT  80 1465 1517274 6279 6298 1181 1200 CAGGAGGCACGGGGTGGCGT  59 1466 1517275 6289 6308 1191 1210 TGCGCGGAGGCAGGAGGCAC  76 1467 1517277 2859 2878  111  130 CTGAGCTCATCCCCGTGCCC 113 1468 1517281 6309 6328 1211 1230 CAGGGTCTCCCGCTGCAGGC  30 1469 1517288 3163 3182 N/A N/A TGTCGCTGCCCCTGGCTCCC  89 1470 1517301 3836 3855 N/A N/A TTCTAACTCCTATCTCAAGG 108 1471 1517307 4777 4796  259  278 TCTGTCTCCACCGCTTGCTC 115 1472 1517329 3394 3413 N/A N/A TATCTCCCCATCCCCAGGTC 106 1473 1517338 4944 4963 N/A N/A GGGACACTCACCTCAGTTCC  98† 1474 1517339 3663 3682 N/A N/A GCCCCGCCCCCATACCTGCC 105 1475 1517344 3374 3393 N/A N/A GGCCTCCATAGAAAATTCCA 110 1476 1517346 3337 3356 N/A N/A TCAAATTCCATCCCCCCACC  94 1477 1517349 4302 4321 N/A N/A CCCAGCGGAAAAGCATGTAT 108 1478 1517368 3846 3865 N/A N/A ACAAAACAACTTCTAACTCC 123 1479 1517382 3418 3437 N/A N/A TTTAACTCCCTCCTGGTCTT  99 1480 1517386 3485 3504 N/A N/A CTTGTTGCATTATCTGCAAC 111 1481 1517408 3566 3585 N/A N/A TGTCAATCAACCGCCAGTGA 106 1482 1517411 2955 2974 N/A N/A CCCGCTCCTCCTCTCCCCAA 111 1483 1517417 2968 2987 N/A N/A TGCTTGCCTCACCCCCGCTC 110 1484 1517425 3611 3630  185  204 CTTCATCTTCCTGCCTGTGA  78 1485 1517427 6363 6382 1265 1284 TGGTGAATCTTTATTAAACT  18 1193 1517436 6145 6164 1047 1066 TGTCTTCCACCAGGGGCTCG 104 1486 1517449 5038 5057 N/A N/A GACCCAGGCCCCCCAAGACT 103† 1487 1517452 4796 4815  278  297 GCGCAGCTCGGGCTCCGGCT 126 1488 1517462 3249 3268 N/A N/A TCCAACCTCACAGTTAAGCG  83 1489 1517471 2943 2962 N/A N/A CTCCCCAAGCCCGACCCCGA  92 1490 1517478 6165 6184 1067 1086 CCCGGCCCACTGGCGCTGCA  91 1491 1517503 3522 3541 N/A N/A CCCCAACCCGGCCTCACCCC 101 1492 1517508 6359 6378 1261 1280 GAATCTTTATTAAACTAGGG  18 1493 1517518 3462 3481 N/A N/A CTAATCCCAGCACATTTACC  83 1494 1517550 4180 4199 N/A N/A AGAAACCTCTAACTCCCAGC  77 1495 1517552 N/A N/A  226  245 CATCCTGCCAGGAATGTGAC 102   26 1517564 4663 4682 N/A N/A GGTGCTCCACAAATGCTTCT 107 1496 1517568 4236 4255 N/A N/A GAATAAAGATCACAGCTGCC  93 1497 1517570 6185 6204 1087 1106 GCCTGCACCTTCTCCACCAG  79 1498 1517585 3406 3425 N/A N/A CTGGTCTTCTCTTATCTCCC  99 1499 1517591 3472 3491 N/A N/A CTGCAACAGCCTAATCCCAG 102 1500 1517611 2998 3017 N/A N/A GCCCAGCCCTTCCCAGGTCC 101 1501 1517624 2891 2910  143  162 GTTCCCAGGGTCCCAGCTCT 112 1502 1517638 3213 3232 N/A N/A AGCTAATTCAGTCCTCATTT  88 1503 1517640 2983 3002 N/A N/A GGTCCAGTCCCCTGCTGCTT 102 1504 1517671 5093 5112 N/A N/A CCAGAGAGCTAAAGCCAGGA  93† 1505 1517708 3542 3561 N/A N/A TCCTCCCACCCCCAGCCCGG 110 1506 1517729 6249 6268 1151 1170 GGCTGCAGGCTTCGGCGTTC  31 1507 1517739 6339 6358 1241 1260 TCCACCCCAGGAGGACGGCT  99 1508 1517742 3364 3383 N/A N/A GAAAATTCCATCTTCCTCTC  77 1509 1517747 6205 6224 1107 1126 CGGCGCTGGTGCCCACGGCA  91 1510 1517764 3312 3331 N/A N/A CCCACCGCCGGTTCCATCTC 105 1511 1517768 6239 6258 1141 1160 TTCGGCGTTCAGTGATTGTC  65 1512 1517769 4601 4620 N/A N/A CACTTGGAAAGCATTATGTA  91 1513 1517777 3623 3642  197  216 AGCCCACAGAACCTTCATCT  72 1514 1517778 3673 3692 N/A N/A AACCGAGCAAGCCCCGCCCC 104 1515 1517795 6329 6348 1231 1250 GAGGACGGCTGGGGCGGGGA 109 1516 1517799 2872 2891  124  143 TTTCTAGAGGCCCCTGAGCT 101 1517 1517810 3037 3056 N/A N/A TCCCCACCCCACCTTCTAGC 101 1518 1517818 6225 6244 1127 1146 ATTGTCGCTGGGCACAGGGG  87 1519 1517833 3440 3459 N/A N/A GCCGCCCCCAACCCATTCCC 108 1520 1517838 3261 3280 N/A N/A CACATTCTAAGCTCCAACCT  87 1521 1517839 4190 4209 N/A N/A GCAATGCATTAGAAACCTCT  87 1522 1517843 4205 4224 N/A N/A ATTCACTATCTGCCTGCAAT  97 1523 1517850 3273 3292 N/A N/A TCATTCTCCCTTCACATTCT  90 1524 1517863 4900 4919  382  401 TCCTCCTGCACCTGCTCAGA  17† 1525 1517874 6370 6389 1272 1291 TGAAACTTGGTGAATCTTTA  23 1526 1517877 6259 6278 1161 1180 GGGGTCGCATGGCTGCAGGC  64 1527 1517889 4842 4861  324  343 CCAGTGCCAGTTCCCAGCGC 135† 1528 1517896 4760 4779  242  261 CTCCACCTTGGCCTGGCATC 120 1529 1517899 4587 4606 N/A N/A TATGTATTTATAAACAGGGT 110 1530 1517907 3077 3096 N/A N/A GTGGAGTCCTGCTATGGCTT 100 1531

TABLE-US-00026 TABLE 26 Reduction of APOE RNA by 5-10-5 MOE gapmers with mixed PO/PS internucleoside linkages at a concentration of 4000 nM in Hep3B cells plated at 20,000 cells per well SEQ ID SEQ ID SEQ ID SEQ ID No: 1 No: 1 No: 2 No: 2 APOE Compound Start Stop Start Stop (% SEQ ID Number Site Site Site Site Sequence (5′ to 3′) UTC) NO 1517176 4586 4605 N/A N/A ATGTATTTATAAACAGGGTC  94 1532 1517184 3260 3279 N/A N/A ACATTCTAAGCTCCAACCTC  98 1533 1517185 4235 4254 N/A N/A AATAAAGATCACAGCTGCCC  81 1534 1517186 6278 6297 1180 1199 AGGAGGCACGGGGTGGCGTG 104 1535 1517215 3504 3523 N/A N/A CCAGGTTAGCCTTCCAAGCC  91 1536 1517221 4600 4619 N/A N/A ACTTGGAAAGCATTATGTAT  97 1537 1517240 6223 6242 1125 1144 TGTCGCTGGGCACAGGGGCG 103 1538 1517259 3200 3219 N/A N/A CTCATTTTAAAGTTCTCCAA  89 1539 1517279 6298 6317 1200 1219 GCTGCAGGCTGCGCGGAGGC  52 1540 1517282 6258 6277 1160 1179 GGGTCGCATGGCTGCAGGCT  72 1541 1517299 6143 6162 1045 1064 TCTTCCACCAGGGGCTCGAA 107 1542 1517314 3212 3231 N/A N/A GCTAATTCAGTCCTCATTTT  99 1543 1517330 3672 3691 N/A N/A ACCGAGCAAGCCCCGCCCCC  75 1544 1517332 3373 3392 N/A N/A GCCTCCATAGAAAATTCCAT 107 1545 1517334 3835 3854 N/A N/A TCTAACTCCTATCTCAAGGA  93 1546 1517384 2858 2877  110  129 TGAGCTCATCCCCGTGCCCC 111 1547 1517387 5037 5056 N/A N/A ACCCAGGCCCCCCAAGACTT  99† 1548 1517400 6348 6367 1250 1269 AAACTAGGGTCCACCCCAGG  90 1549 1517403 3610 3629  184  203 TTCATCTTCCTGCCTGTGAT  85 1550 1517413 2997 3016 N/A N/A CCCAGCCCTTCCCAGGTCCA 111 1551 1517415 3302 3321 N/A N/A GTTCCATCTCAGTCCCAGTC  95 1552 1517416 3393 3412 N/A N/A ATCTCCCCATCCCCAGGTCG  94 1553 1517427 6363 6382 1265 1284 TGGTGAATCTTTATTAAACT  44 1193 1517431 4826 4845  308  327 GCGCTGGCCGCTCTGCCACT 166 1554 1517433 6203 6222 1105 1124 GCGCTGGTGCCCACGGCAGC 100 1555 1517437 4899 4918  381  400 CCTCCTGCACCTGCTCAGAC  20† 1556 1517439 4662 4681 N/A N/A GTGCTCCACAAATGCTTCTT 113 1557 1517457 2954 2973 N/A N/A CCGCTCCTCCTCTCCCCAAG 114 1558 1517475 2871 2890  123  142 TTCTAGAGGCCCCTGAGCTC 101 1559 1517490 3461 3480 N/A N/A TAATCCCAGCACATTTACCA  90 1560 1517496 3288 3307 N/A N/A CCAGTCTCGCATTCCTCATT 117 1561 1517507 6238 6257 1140 1159 TCGGCGTTCAGTGATTGTCG  92 1562 1517517 3158 3177 N/A N/A CTGCCCCTGGCTCCCCAGTT 102 1563 1517519 6369 6388 1271 1290 GAAACTTGGTGAATCTTTAT  30 1564 1517540 3417 3436 N/A N/A TTAACTCCCTCCTGGTCTTC 111 1565 1517541 3845 3864 N/A N/A CAAAACAACTTCTAACTCCT  92 1566 1517553 3336 3355 N/A N/A CAAATTCCATCCCCCCACCC  98 1567 1517580 4179 4198 N/A N/A GAAACCTCTAACTCCCAGCC  93 1568 1517593 6163 6182 1065 1084 CGGCCCACTGGCGCTGCATG  94 1569 1517602 3363 3382 N/A N/A AAAATTCCATCTTCCTCTCC  91 1570 1517608 6288 6307 1190 1209 GCGCGGAGGCAGGAGGCACG  70 1571 1517622 6308 6327 1210 1229 AGGGTCTCCCGCTGCAGGCT  52 1572 1517623 4201 4220 N/A N/A ACTATCTGCCTGCAATGCAT  84 1573 1517627 4776 4795  258  277 CTGTCTCCACCGCTTGCTCC 121 1574 1517647 2941 2960 N/A N/A CCCCAAGCCCGACCCCGAGT  96 1575 1517652 6358 6377 1260 1279 AATCTTTATTAAACTAGGGT  41 1576 1517658 4790 4809  272  291 CTCGGGCTCCGGCTCTGTCT 119 1577 1517668 3429 3448 N/A N/A CCCATTCCCTATTTAACTCC  94 1578 1517676 6183 6202 1085 1104 CTGCACCTTCTCCACCAGCC  86 1579 1517689 3560 3579 N/A N/A TCAACCGCCAGTGAGGACTC 100 1580 1517703 3056 3075 N/A N/A CATCCCAGTCCAGCTGCTCT 100 1581 1517707 3036 3055 N/A N/A CCCCACCCCACCTTCTAGCG  77 1582 1517709 2980 2999 N/A N/A CCAGTCCCCTGCTGCTTGCC  99 1583 1517715 6338 6357 1240 1259 CCACCCCAGGAGGACGGCTG  91 1584 1517723 3229 3248 N/A N/A CCGTGTTCCATTTATGAGCT  83 1585 1517727 3405 3424 N/A N/A TGGTCTTCTCTTATCTCCCC 101 1586 1517748 4189 4208 N/A N/A CAATGCATTAGAAACCTCTA  86 1587 1517784 2967 2986 N/A N/A GCTTGCCTCACCCCCGCTCC  95 1588 1517788 2889 2908  141  160 TCCCAGGGTCCCAGCTCTTT 114 1589 1517793 6248 6267 1150 1169 GCTGCAGGCTTCGGCGTTCA  53 1590 1517805 4754 4773 N/A N/A CTTGGCCTGGCATCCTGTGT  98 1591 1517808 3662 3681 N/A N/A CCCCGCCCCCATACCTGCCA 113 1592 1517815 3622 3641  196  215 GCCCACAGAACCTTCATCTT  88 1593 1517822 3534 3553 N/A N/A CCCCCAGCCCGGCCCCAACC 145 1594 1517835 3484 3503 N/A N/A TTGTTGCATTATCTGCAACA  99 1595 1517836 3521 3540 N/A N/A CCCAACCCGGCCTCACCCCA  89 1596 1517847 5049 5068 N/A N/A GAACCAGCAGAGACCCAGGC 102† 1597 1517854 3072 3091 N/A N/A GTCCTGCTATGGCTTACATC 101 1598 1517858 4301 4320 N/A N/A CCAGCGGAAAAGCATGTATT 100 1599 1517861 6268 6287 1170 1189 GGGTGGCGTGGGGTCGCATG  77 1600 1517867 3471 3490 N/A N/A TGCAACAGCCTAATCCCAGC 108 1601 1517875 3651 3670 N/A N/A TACCTGCCAGGAATGTGACC 107 1602 1517878 6318 6337 1220 1239 GGGCGGGGACAGGGTCTCCC  67 1603 1517886 4943 4962 N/A N/A GGACACTCACCTCAGTTCCT 125† 1604 1517890 3272 3291 N/A N/A CATTCTCCCTTCACATTCTA 110 1605 1517892 3439 3458 N/A N/A CCGCCCCCAACCCATTCCCT 133 1606 1517901 6328 6347 1230 1249 AGGACGGCTGGGGCGGGGAC 150 1607 1517911 5091 5110 N/A N/A AGAGAGCTAAAGCCAGGAGT 115† 1608

TABLE-US-00027 TABLE 27 Reduction of APOE RNA by 5-10-5 MOE gapmers with mixed PO/PS internucleoside linkages at a concentration of 4000 nM in Hep3B cells plated at 20,000 cells per well SEQ ID SEQ ID SEQ ID SEQ ID No: 1 No: 1 No: 2 No: 2 APOE Compound Start Stop Start Stop (% SEQ ID Number Site Site Site Site Sequence (5′ to 3′) UTC) NO  708022 6257 6276 1159 1178 GGTCGCATGGCTGCAGGCTT  36   71  942593 6347 6366 1249 1268 AACTAGGGTCCACCCCAGGA  45   75 1517144 4200 4219 N/A N/A CTATCTGCCTGCAATGCATT  75 1609 1517147 2940 2959 N/A N/A CCCAAGCCCGACCCCGAGTA 108 1610 1517193 6267 6286 1169 1188 GGTGGCGTGGGGTCGCATGG  54 1611 1517203 2888 2907  140  159 CCCAGGGTCCCAGCTCTTTC  65   78 1517206 4272 4291 N/A N/A TGTGTGCCCCAGGCAGGGCT 112   83 1517217 3519 3538 N/A N/A CAACCCGGCCTCACCCCAGG 103 1612 1517218 2953 2972 N/A N/A CGCTCCTCCTCTCCCCAAGC  92 1613 1517223 3391 3410 N/A N/A CTCCCCATCCCCAGGTCGGC  82 1614 1517224 3259 3278 N/A N/A CATTCTAAGCTCCAACCTCA  80 1615 1517243 N/A N/A  225  244 ATCCTGCCAGGAATGTGACC  97 1616 1517265 3362 3381 N/A N/A AAATTCCATCTTCCTCTCCC  95 1617 1517267 2996 3015 N/A N/A CCAGCCCTTCCCAGGTCCAG  83 1618 1517268 5090 5109 N/A N/A GAGAGCTAAAGCCAGGAGTC  83† 1619 1517269 4898 4917  380  399 CTCCTGCACCTGCTCAGACA  15† 1620 1517271 4234 4253 N/A N/A ATAAAGATCACAGCTGCCCC  90 1621 1517283 3301 3320 N/A N/A TTCCATCTCAGTCCCAGTCT  74 1622 1517302 2857 2876  109  128 GAGCTCATCCCCGTGCCCCC  79 1623 1517303 4941 4960 N/A N/A ACACTCACCTCAGTTCCTGG  94† 1624 1517319 5048 5067 N/A N/A AACCAGCAGAGACCCAGGCC 101† 1625 1517340 4789 4808  271  290 TCGGGCTCCGGCTCTGTCTC  91 1626 1517359 6247 6266 1149 1168 CTGCAGGCTTCGGCGTTCAG  63 1627 1517364 6287 6306 1189 1208 CGCGGAGGCAGGAGGCACGG  61 1628 1517374 3671 3690 N/A N/A CCGAGCAAGCCCCGCCCCCA  77 1629 1517381 3211 3230 N/A N/A CTAATTCAGTCCTCATTTTA  85 1630 1517389 4717 4736 N/A N/A GGTCAGGGTCCTTCTGACCC 104 1631 1517394 3482 3501 N/A N/A GTTGCATTATCTGCAACAGC  86 1632 1517407 6237 6256 1139 1158 CGGCGTTCAGTGATTGTCGC  66 1633 1517409 2870 2889  122  141 TCTAGAGGCCCCTGAGCTCA 102 1634 1517427 6363 6382 1265 1284 TGGTGAATCTTTATTAAACT  20 1193 1517429 3225 3244 N/A N/A GTTCCATTTATGAGCTAATT  78 1635 1517444 4824 4843  306  325 GCTGGCCGCTCTGCCACTCG  96 1636 1517451 4188 4207 N/A N/A AATGCATTAGAAACCTCTAA  92 1637 1517453 3199 3218 N/A N/A TCATTTTAAAGTTCTCCAAT  77 1638 1517480 3428 3447 N/A N/A CCATTCCCTATTTAACTCCC  82 1639 1517499 3503 3522 N/A N/A CAGGTTAGCCTTCCAAGCCT  84 1640 1517502 3035 3054 N/A N/A CCCACCCCACCTTCTAGCGG  77 1641 1517520 3834 3853 N/A N/A CTAACTCCTATCTCAAGGAT  94 1642 1517534 3844 3863 N/A N/A AAAACAACTTCTAACTCCTA  81 1643 1517547 3460 3479 N/A N/A AATCCCAGCACATTTACCAA  89 1644 1517551 6141 6160 1043 1062 TTCCACCAGGGGCTCGAACC  95 1645 1517567 4599 4618 N/A N/A CTTGGAAAGCATTATGTATT  87 1646 1517575 4775 4794  257  276 TGTCTCCACCGCTTGCTCCA 109 1647 1517576 3157 3176 N/A N/A TGCCCCTGGCTCCCCAGTTA 103 1648 1517590 3287 3306 N/A N/A CAGTCTCGCATTCCTCATTC  86 1649 1517596 6337 6356 1239 1258 CACCCCAGGAGGACGGCTGG 105 1650 1517597 4585 4604 N/A N/A TGTATTTATAAACAGGGTCT  83 1651 1517599 3438 3457 N/A N/A CGCCCCCAACCCATTCCCTA  85 1652 1517604 6307 6326 1209 1228 GGGTCTCCCGCTGCAGGCTG  29 1653 1517610 6201 6220 1103 1122 GCTGGTGCCCACGGCAGCCT  94 1654 1517639 3532 3551 N/A N/A CCCAGCCCGGCCCCAACCCG  85 1655 1517641 4661 4680 N/A N/A TGCTCCACAAATGCTTCTTT  86 1656 1517643 3416 3435 N/A N/A TAACTCCCTCCTGGTCTTCT  91 1657 1517650 3555 3574 N/A N/A CGCCAGTGAGGACTCCTCCC  97 1658 1517651 3621 3640  195  214 CCCACAGAACCTTCATCTTC  37 1659 1517656 6327 6346 1229 1248 GGACGGCTGGGGCGGGGACA  97 1660 1517661 3271 3290 N/A N/A ATTCTCCCTTCACATTCTAA  86 1661 1517663 3372 3391 N/A N/A CCTCCATAGAAAATTCCATC  59 1662 1517674 3055 3074 N/A N/A ATCCCAGTCCAGCTGCTCTC  90 1663 1517680 4178 4197 N/A N/A AAACCTCTAACTCCCAGCCA  81 1664 1517690 6317 6336 1219 1238 GGCGGGGACAGGGTCTCCCG  64 1665 1517692 6221 6240 1123 1142 TCGCTGGGCACAGGGGCGGC  82 1666 1517699 2966 2985 N/A N/A CTTGCCTCACCCCCGCTCCT  88 1667 1517726 6161 6180 1063 1082 GCCCACTGGCGCTGCATGTC  56 1668 1517732 3070 3089 N/A N/A CCTGCTATGGCTTACATCCC  84 1669 1517753 5036 5055 N/A N/A CCCAGGCCCCCCAAGACTTA  99† 1670 1517776 3470 3489 N/A N/A GCAACAGCCTAATCCCAGCA  82 1671 1517780 N/A N/A  236  255 CTTGGCCTGGCATCCTGCCA 103 1672 1517791 3609 3628  183  202 TCATCTTCCTGCCTGTGATT  78 1673 1517812 6297 6316 1199 1218 CTGCAGGCTGCGCGGAGGCA  41 1674 1517821 6277 6296 1179 1198 GGAGGCACGGGGTGGCGTGG  92 1675 1517826 6181 6200 1083 1102 GCACCTTCTCCACCAGCCCG  93 1676 1517832 3332 3351 N/A N/A TTCCATCCCCCCACCCCCTC  85 1677 1517841 6357 6376 1259 1278 ATCTTTATTAAACTAGGGTC  24 1678 1517842 6368 6387 1270 1289 AAACTTGGTGAATCTTTATT  32 1679 1517846 2979 2998 N/A N/A CAGTCCCCTGCTGCTTGCCT  89 1680 1517857 3404 3423 N/A N/A GGTCTTCTCTTATCTCCCCA  92 1681

TABLE-US-00028 TABLE 28 Reduction of APOE RNA by 5-10-5 MOE gapmers with mixed PO/PS internucleoside linkages at a concentration of 4000 nM in Hep3B cells plated at 20,000 cells per well SEQ ID SEQ ID SEQ ID SEQ ID No: 1 No: 1 No: 2 No: 2 APOE Compound Start Stop Start Stop (% SEQ ID Number Site Site Site Site Sequence (5′ to 3′) UTC) NO  942588 6256 6275 1158 1177 GTCGCATGGCTGCAGGCTTC  23 1132 1517141 4939 4958 N/A N/A ACTCACCTCAGTTCCTGGGT  92† 1682 1517146 6236 6255 1138 1157 GGCGTTCAGTGATTGTCGCT  73 1683 1517153 3286 3305 N/A N/A AGTCTCGCATTCCTCATTCT  79 1684 1517159 4598 4617 N/A N/A TTGGAAAGCATTATGTATTT 115 1685 1517181 3481 3500 N/A N/A TTGCATTATCTGCAACAGCC  80 1686 1517189 3403 3422 N/A N/A GTCTTCTCTTATCTCCCCAT  87 1687 1517190 2965 2984 N/A N/A TTGCCTCACCCCCGCTCCTC 102 1688 1517198 3620 3639  194  213 CCACAGAACCTTCATCTTCC  65 1689 1517202 6286 6305 1188 1207 GCGGAGGCAGGAGGCACGGG  73 1690 1517204 3661 3680 N/A N/A CCCGCCCCCATACCTGCCAG 104 1691 1517205 3518 3537 N/A N/A AACCCGGCCTCACCCCAGGT  87 1692 1517213 6199 6218 1101 1120 TGGTGCCCACGGCAGCCTGC  99 1693 1517216 3069 3088 N/A N/A CTGCTATGGCTTACATCCCA  82 1694 1517220 6367 6386 1269 1288 AACTTGGTGAATCTTTATTA  23 1695 1517225 3502 3521 N/A N/A AGGTTAGCCTTCCAAGCCTT  93 1696 1517228 4187 4206 N/A N/A ATGCATTAGAAACCTCTAAC  92 1697 1517231 3198 3217 N/A N/A CATTTTAAAGTTCTCCAATC  78 1698 1517237 5079 5098 N/A N/A CCAGGAGTCAGAAATGGGAA  74† 1699 1517241 3650 3669 N/A N/A ACCTGCCAGGAATGTGACCA  83 1700 1517254 6356 6375 1258 1277 TCTTTATTAAACTAGGGTCC  31 1701 1517256 4822 4841  304  323 TGGCCGCTCTGCCACTCGGT  72 1702 1517273 2978 2997 N/A N/A AGTCCCCTGCTGCTTGCCTC  92 1703 1517285 4177 4196 N/A N/A AACCTCTAACTCCCAGCCAG  78 1704 1517292 3269 3288 N/A N/A TCTCCCTTCACATTCTAAGC 102 1705 1517296 5035 5054 N/A N/A CCAGGCCCCCCAAGACTTAG  91† 1706 1517320 2887 2906  139  158 CCAGGGTCCCAGCTCTTTCT  95 1707 1517326 4894 4913  376  395 TGCACCTGCTCAGACAGTGT  49† 1708 1517331 4786 4805  268  287 GGCTCCGGCTCTGTCTCCAC  67 1709 1517351 2993 3012 N/A N/A GCCCTTCCCAGGTCCAGTCC  79 1710 1517355 3210 3229 N/A N/A TAATTCAGTCCTCATTTTAA  88 1711 1517360 5047 5066 N/A N/A ACCAGCAGAGACCCAGGCCC 100† 1712 1517377 6296 6315 1198 1217 TGCAGGCTGCGCGGAGGCAG  35 1713 1517397 3554 3573 N/A N/A GCCAGTGAGGACTCCTCCCA  98 1714 1517419 6139 6158 1041 1060 CCACCAGGGGCTCGAACCAG  84 1715 1517420 4584 4603 N/A N/A GTATTTATAAACAGGGTCTT  87 1716 1517427 6363 6382 1265 1284 TGGTGAATCTTTATTAAACT  20 1193 1517465 6326 6345 1228 1247 GACGGCTGGGGCGGGGACAG  89 1717 1517466 3414 3433 N/A N/A ACTCCCTCCTGGTCTTCTCT 106 1718 1517470 3670 3689 N/A N/A CGAGCAAGCCCCGCCCCCAT 113 1719 1517476 6159 6178 1061 1080 CCACTGGCGCTGCATGTCTT  69 1720 1517509 4245 4264 N/A N/A GGTGATGGAGAATAAAGATC  93 1721 1517515 6219 6238 1121 1140 GCTGGGCACAGGGGCGGCGC 100 1722 1517527 3053 3072 N/A N/A CCCAGTCCAGCTGCTCTCCC  97 1723 1517530 3459 3478 N/A N/A ATCCCAGCACATTTACCAAG  90 1724 1517544 3361 3380 N/A N/A AATTCCATCTTCCTCTCCCG  98 1725 1517565 6276 6295 1178 1197 GAGGCACGGGGTGGCGTGGG  57 1726 1517572 3258 3277 N/A N/A ATTCTAAGCTCCAACCTCAC  84 1727 1517579 4716 4735 N/A N/A GTCAGGGTCCTTCTGACCCC 117 1728 1517589 3322 3341 N/A N/A CCACCCCCTCCCCACCGCCG  95 1729 1517594 3778 3797 N/A N/A TTCAGAGCCAGGAAGCAGCA 100 1730 1517633 6246 6265 1148 1167 TGCAGGCTTCGGCGTTCAGT  67 1731 1517634 6316 6335 1218 1237 GCGGGGACAGGGTCTCCCGC 105 1732 1517664 4228 4247 N/A N/A ATCACAGCTGCCCCGTGTCT  99 1733 1517681 3605 3624  179  198 CTTCCTGCCTGTGATTGGCC  79 1734 1517686 6346 6365 1248 1267 ACTAGGGTCCACCCCAGGAG  60 1735 1517694 2854 2873  106  125 CTCATCCCCGTGCCCCCGAC  84 1736 1517695 3390 3409 N/A N/A TCCCCATCCCCAGGTCGGCC 100 1737 1517704 2925 2944 N/A N/A GAGTAGCTCTCCTGAGACTA  89 1738 1517735 3156 3175 N/A N/A GCCCCTGGCTCCCCAGTTAT  91 1739 1517741 2869 2888  121  140 CTAGAGGCCCCTGAGCTCAT  84 1740 1517781 3530 3549 N/A N/A CAGCCCGGCCCCAACCCGGC 108 1741 1517792 4197 4216 N/A N/A TCTGCCTGCAATGCATTAGA  94 1742 1517794 4772 4791  254  273 CTCCACCGCTTGCTCCACCT  75 1743 1517797 6266 6285 1168 1187 GTGGCGTGGGGTCGCATGGC  47 1744 1517800 4656 4675 N/A N/A CACAAATGCTTCTTTGGAGC  96 1745 1517806 6306 6325 1208 1227 GGTCTCCCGCTGCAGGCTGC  41 1746 1517809 3300 3319 N/A N/A TCCATCTCAGTCCCAGTCTC  99 1747 1517824 3371 3390 N/A N/A CTCCATAGAAAATTCCATCT  75 1748 1517830 3843 3862 N/A N/A AAACAACTTCTAACTCCTAT  94 1749 1517845 3224 3243 N/A N/A TTCCATTTATGAGCTAATTC  91 1750 1517855 3034 3053 N/A N/A CCACCCCACCTTCTAGCGGG  88 1751 1517864 3437 3456 N/A N/A GCCCCCAACCCATTCCCTAT  91 1752 1517868 3427 3446 N/A N/A CATTCCCTATTTAACTCCCT  98 1753 1517876 2952 2971 N/A N/A GCTCCTCCTCTCCCCAAGCC  65 1754 1517880 6336 6355 1238 1257 ACCCCAGGAGGACGGCTGGG  94   72 1517888 3469 3488 N/A N/A CAACAGCCTAATCCCAGCAC  84 1755 1517895 6179 6198 1081 1100 ACCTTCTCCACCAGCCCGGC  78 1756

TABLE-US-00029 TABLE 29 Reduction of APOE RNA by 5-10-5 MOE gapmers with mixed PO/PS internucleoside linkages at a concentration of 4000 nM in Hep3B cells plated at 20,000 cells per well SEQ ID SEQ ID SEQ ID SEQ ID No: 1 No: 1 No: 2 No: 2 APOE Compound Start Stop Start Stop (% SEQ ID Number Site Site Site Site Sequence (5′ to 3′) UTC) NO  942587 6255 6274 1157 1176 TCGCATGGCTGCAGGCTTCG  30 1061  942591 6305 6324 1207 1226 GTCTCCCGCTGCAGGCTGCG  48  990 1517143 6335 6354 1237 1256 CCCCAGGAGGACGGCTGGGG  87 1757 1517161 4196 4215 N/A N/A CTGCCTGCAATGCATTAGAA  81 1758 1517163 2867 2886  119  138 AGAGGCCCCTGAGCTCATCC  97 1759 1517177 6235 6254 1137 1156 GCGTTCAGTGATTGTCGCTG  63 1760 1517196 3553 3572 N/A N/A CCAGTGAGGACTCCTCCCAC  83 1761 1517214 4244 4263 N/A N/A GTGATGGAGAATAAAGATCA  81 1762 1517219 3257 3276 N/A N/A TTCTAAGCTCCAACCTCACA  87 1763 1517233 4186 4205 N/A N/A TGCATTAGAAACCTCTAACT  85 1764 1517239 2974 2993 N/A N/A CCCTGCTGCTTGCCTCACCC  81 1765 1517242 3052 3071 N/A N/A CCAGTCCAGCTGCTCTCCCC  85 1766 1517244 2950 2969 N/A N/A TCCTCCTCTCCCCAAGCCCG  99 1767 1517247 3529 3548 N/A N/A AGCCCGGCCCCAACCCGGCC 101 1768 1517251 3660 3679 N/A N/A CCGCCCCCATACCTGCCAGG  92 1769 1517258 3632 3651  206  225 CAGCAACGCAGCCCACAGAA  86 1770 1517262 3436 3455 N/A N/A CCCCCAACCCATTCCCTATT 124 1771 1517266 2849 2868  101  120 CCCCGTGCCCCCGACTGCGC  96 1772 1517305 3426 3445 N/A N/A ATTCCCTATTTAACTCCCTC  86 1773 1517310 4597 4616 N/A N/A TGGAAAGCATTATGTATTTA  85 1774 1517321 3669 3688 N/A N/A GAGCAAGCCCCGCCCCCATA  79 1775 1517324 3499 3518 N/A N/A TTAGCCTTCCAAGCCTTGTT  87 1776 1517335 4911 4930  393  412 AGCTGAGCAGCTCCTCCTGC  30† 1777 1517342 4175 4194 N/A N/A CCTCTAACTCCCAGCCAGGT 103 1778 1517352 4713 4732 N/A N/A AGGGTCCTTCTGACCCCGTC  90 1779 1517354 6325 6344 1227 1246 ACGGCTGGGGCGGGGACAGG 108 1780 1517357 3298 3317 N/A N/A CATCTCAGTCCCAGTCTCGC  82 1781 1517366 3468 3487 N/A N/A AACAGCCTAATCCCAGCACA  78 1782 1517373 3517 3536 N/A N/A ACCCGGCCTCACCCCAGGTT  97 1783 1517380 6345 6364 1247 1266 CTAGGGTCCACCCCAGGAGG  71 1784 1517395 4655 4674 N/A N/A ACAAATGCTTCTTTGGAGCC  93 1785 1517399 2924 2943 N/A N/A AGTAGCTCTCCTGAGACTAC 106 1786 1517402 3360 3379 N/A N/A ATTCCATCTTCCTCTCCCGG  74 1787 1517405 3480 3499 N/A N/A TGCATTATCTGCAACAGCCT  80 1788 1517418 3321 3340 N/A N/A CACCCCCTCCCCACCGCCGG 130 1789 1517422 2964 2983 N/A N/A TGCCTCACCCCCGCTCCTCC 110 1790 1517427 6363 6382 1265 1284 TGGTGAATCTTTATTAAACT  26 1193 1517442 5060 5079 N/A N/A AGAGGAAGCTAGAACCAGCA  81† 1791 1517445 6355 6374 1257 1276 CTTTATTAAACTAGGGTCCA  30 1792 1517446 6137 6156 1039 1058 ACCAGGGGCTCGAACCAGCT  76 1793 1517469 3008 3027 N/A N/A CGTCTCTGCTGCCCAGCCCT  95 1794 1517484 5034 5053 N/A N/A CAGGCCCCCCAAGACTTAGC 102† 1795 1517505 4785 4804  267  286 GCTCCGGCTCTGTCTCCACC  66 1796 1517516 6197 6216 1099 1118 GTGCCCACGGCAGCCTGCAC  78   67 1517526 4821 4840  303  322 GGCCGCTCTGCCACTCGGTC 102 1797 1517532 6265 6284 1167 1186 TGGCGTGGGGTCGCATGGCT  27 1798 1517562 3153 3172 N/A N/A CCTGGCTCCCCAGTTATGGA 107 1799 1517563 6315 6334 1217 1236 CGGGGACAGGGTCTCCCGCT  92 1800 1517571 3066 3085 N/A N/A CTATGGCTTACATCCCAGTC  77 1801 1517582 3285 3304 N/A N/A GTCTCGCATTCCTCATTCTC  80 1802 1517598 4542 4561 N/A N/A GCAGCGGCCTGAACATGGTT 107 1803 1517615 6157 6176 1059 1078 ACTGGCGCTGCATGTCTTCC  74 1804 1517630 3370 3389 N/A N/A TCCATAGAAAATTCCATCTT  77 1805 1517635 3402 3421 N/A N/A TCTTCTCTTATCTCCCCATC  86 1806 1517642 3777 3796 N/A N/A TCAGAGCCAGGAAGCAGCAC 111 1807 1517644 3223 3242 N/A N/A TCCATTTATGAGCTAATTCA  69 1808 1517655 5046 5065 N/A N/A CCAGCAGAGACCCAGGCCCC 87† 1809 1517662 3619 3638  193  212 CACAGAACCTTCATCTTCCT  74 1810 1517665 6275 6294 1177 1196 AGGCACGGGGTGGCGTGGGG  77 1811 1517666 2886 2905  138  157 CAGGGTCCCAGCTCTTTCTA  82 1812 1517669 6177 6196 1079 1098 CTTCTCCACCAGCCCGGCCC  92 1813 1517670 3209 3228 N/A N/A AATTCAGTCCTCATTTTAAA  89 1814 1517718 3268 3287 N/A N/A CTCCCTTCACATTCTAAGCT  93 1815 1517733 3196 3215 N/A N/A TTTTAAAGTTCTCCAATCGA  71 1816 1517734 3842 3861 N/A N/A AACAACTTCTAACTCCTATC  73 1817 1517757 3412 3431 N/A N/A TCCCTCCTGGTCTTCTCTTA  82 1818 1517774 4214 4233 N/A N/A GTGTCTGGTATTCACTATCT  96 1819 1517786 3604 3623  178  197 TTCCTGCCTGTGATTGGCCA  73 1820 1517787 4893 4912  375  394 GCACCTGCTCAGACAGTGTC  52†   37 1517813 6285 6304 1187 1206 CGGAGGCAGGAGGCACGGGG  95 1821 1517825 6217 6236 1119 1138 TGGGCACAGGGGCGGCGCTG  91 1822 1517827 4771 4790  253  272 TCCACCGCTTGCTCCACCTT  86 1823 1517848 6245 6264 1147 1166 GCAGGCTTCGGCGTTCAGTG  50 1824 1517871 6295 6314 1197 1216 GCAGGCTGCGCGGAGGCAGG  45 1825 1517873 3389 3408 N/A N/A CCCCATCCCCAGGTCGGCCT  95 1826 1517891 6366 6385 1268 1287 ACTTGGTGAATCTTTATTAA  32 1827 1517906 2992 3011 N/A N/A CCCTTCCCAGGTCCAGTCCC  96 1828 1517908 3458 3477 N/A N/A TCCCAGCACATTTACCAAGC  87 1829

TABLE-US-00030 TABLE 30 Reduction of APOE RNA by 5-10-5 MOE gapmers with mixed PO/PS internucleoside linkages at a concentration of 4000 nM in Hep3B cells plated at 20,000 cells per well SEQ ID SEQ ID SEQ ID SEQ ID No: 1 No: 1 No: 2 No: 2 APOE Compound Start Stop Start Stop (% SEQ ID Number Site Site Site Site Sequence (5′ to 3′) UTC) NO  708021 6254 6273 1156 1175 CGCATGGCTGCAGGCTTCGG  19   70  708027 6234 6253 1136 1155 CGTTCAGTGATTGTCGCTGG  58   69 1517151 3479 3498 N/A N/A GCATTATCTGCAACAGCCTA  90 1830 1517152 3388 3407 N/A N/A CCCATCCCCAGGTCGGCCTC 109 1831 1517165 3284 3303 N/A N/A TCTCGCATTCCTCATTCTCC  78 1832 1517174 2963 2982 N/A N/A GCCTCACCCCCGCTCCTCCT  90 1833 1517179 5058 5077 N/A N/A AGGAAGCTAGAACCAGCAGA  98† 1834 1517188 6344 6363 1246 1265 TAGGGTCCACCCCAGGAGGA  93 1835 1517195 4195 4214 N/A N/A TGCCTGCAATGCATTAGAAA  96 1836 1517209 6195 6214 1097 1116 GCCCACGGCAGCCTGCACCT 104 1837 1517211 4820 4839  302  321 GCCGCTCTGCCACTCGGTCT  93 1838 1517222 3064 3083 N/A N/A ATGGCTTACATCCCAGTCCA  93 1839 1517248 4767 4786  249  268 CCGCTTGCTCCACCTTGGCC  88 1840 1517264 3552 3571 N/A N/A CAGTGAGGACTCCTCCCACC 100 1841 1517278 2866 2885  118  137 GAGGCCCCTGAGCTCATCCC  93 1842 1517286 3359 3378 N/A N/A TTCCATCTTCCTCTCCCGGG  80 1843 1517295 6244 6263 1146 1165 CAGGCTTCGGCGTTCAGTGA  62 1844 1517297 2884 2903  136  155 GGGTCCCAGCTCTTTCTAGA 109 1845 1517298 4708 4727 N/A N/A CCTTCTGACCCCGTCCAGGC  92 1846 1517300 3399 3418 N/A N/A TCTCTTATCTCCCCATCCCC  85 1847 1517327 3496 3515 N/A N/A GCCTTCCAAGCCTTGTTGCA  89 1848 1517350 3841 3860 N/A N/A ACAACTTCTAACTCCTATCT  87 1849 1517353 3411 3430 N/A N/A CCCTCCTGGTCTTCTCTTAT  94 1850 1517361 6294 6313 1196 1215 CAGGCTGCGCGGAGGCAGGA  54 1851 1517362 4783 4802  265  284 TCCGGCTCTGTCTCCACCGC  81 1852 1517369 3320 3339 N/A N/A ACCCCCTCCCCACCGCCGGT  89 1853 1517385 4910 4929  392  411 GCTGAGCAGCTCCTCCTGCA  37† 1854 1517391 3207 3226 N/A N/A TTCAGTCCTCATTTTAAAGT  82 1855 1517393 6274 6293 1176 1195 GGCACGGGGTGGCGTGGGGT  73 1856 1517414 6175 6194 1077 1096 TCTCCACCAGCCCGGCCCAC 116 1857 1517423 3194 3213 N/A N/A TTAAAGTTCTCCAATCGACG  77 1858 1517427 6363 6382 1265 1284 TGGTGAATCTTTATTAAACT  24 1193 1517435 3267 3286 N/A N/A TCCCTTCACATTCTAAGCTC  99 1859 1517479 3425 3444 N/A N/A TTCCCTATTTAACTCCCTCC  86 1860 1517481 2949 2968 N/A N/A CCTCCTCTCCCCAAGCCCGA  87 1861 1517514 3770 3789 N/A N/A CAGGAAGCAGCACAGAAGCC  86 1862 1517521 2835 2854   87  106 CTGCGCTTCTCACCGGCTCC 109 1863 1517524 3668 3687 N/A N/A AGCAAGCCCCGCCCCCATAC  86 1864 1517525 3255 3274 N/A N/A CTAAGCTCCAACCTCACAGT 101 1865 1517533 4892 4911  374  393 CACCTGCTCAGACAGTGTCT  49† 1866 1517543 3631 3650  205  224 AGCAACGCAGCCCACAGAAC  79 1867 1517545 6324 6343 1226 1245 CGGCTGGGGCGGGGACAGGG  86 1868 1517573 4185 4204 N/A N/A GCATTAGAAACCTCTAACTC  93 1869 1517578 6365 6384 1267 1286 CTTGGTGAATCTTTATTAAA  28 1870 1517584 5028 5047 N/A N/A CCCCAAGACTTAGCGACAGG  85† 1871 1517588 3435 3454 N/A N/A CCCCAACCCATTCCCTATTT  88 1872 1517595 6135 6154 1037 1056 CAGGGGCTCGAACCAGCTCT  96 1873 1517609 3220 3239 N/A N/A ATTTATGAGCTAATTCAGTC 103 1874 1517613 3051 3070 N/A N/A CAGTCCAGCTGCTCTCCCCA  86 1875 1517625 6314 6333 1216 1235 GGGGACAGGGTCTCCCGCTG  79 1876 1517637 4595 4614 N/A N/A GAAAGCATTATGTATTTATA  88 1877 1517659 3006 3025 N/A N/A TCTCTGCTGCCCAGCCCTTC 100 1878 1517667 6304 6323 1206 1225 TCTCCCGCTGCAGGCTGCGC  52 1879 1517675 2991 3010 N/A N/A CCTTCCCAGGTCCAGTCCCC  92 1880 1517685 3659 3678 N/A N/A CGCCCCCATACCTGCCAGGA  99 1881 1517691 4173 4192 N/A N/A TCTAACTCCCAGCCAGGTGC  90 1882 1517696 6334 6353 1236 1255 CCCAGGAGGACGGCTGGGGC 105 1883 1517719 2973 2992 N/A N/A CCTGCTGCTTGCCTCACCCC  75 1884 1517722 6264 6283 1166 1185 GGCGTGGGGTCGCATGGCTG  41 1885 1517724 6354 6373 1256 1275 TTTATTAAACTAGGGTCCAC  56 1886 1517731 3574 3593 N/A N/A GGAGAAACTGTCAATCAACC  90 1887 1517737 6155 6174 1057 1076 TGGCGCTGCATGTCTTCCAC  68 1888 1517758 3457 3476 N/A N/A CCCAGCACATTTACCAAGCC  80 1889 1517759 3528 3547 N/A N/A GCCCGGCCCCAACCCGGCCT  96 1890 1517761 4541 4560 N/A N/A CAGCGGCCTGAACATGGTTC  92 1891 1517771 4653 4672 N/A N/A AAATGCTTCTTTGGAGCCAT  88 1892 1517779 2922 2941 N/A N/A TAGCTCTCCTGAGACTACCT  89 1893 1517782 6215 6234 1117 1136 GGCACAGGGGCGGCGCTGGT  93 1894 1517783 3369 3388 N/A N/A CCATAGAAAATTCCATCTTC  92 1895 1517798 3516 3535 N/A N/A CCCGGCCTCACCCCAGGTTA 118 1896 1517811 3297 3316 N/A N/A ATCTCAGTCCCAGTCTCGCA  82 1897 1517816 3150 3169 N/A N/A GGCTCCCCAGTTATGGAGAT  93 1898 1517820 4211 4230 N/A N/A TCTGGTATTCACTATCTGCC  79 1899 1517829 6284 6303 1186 1205 GGAGGCAGGAGGCACGGGGT  81 1900 1517859 5045 5064 N/A N/A CAGCAGAGACCCAGGCCCCC 100† 1901 1517872 3467 3486 N/A N/A ACAGCCTAATCCCAGCACAT  83 1902 1517879 3618 3637  192  211 ACAGAACCTTCATCTTCCTG  84 1903 1517881 4243 4262 N/A N/A TGATGGAGAATAAAGATCAC 100 1904

Example 4: Effect of 3-10-3 cEt Mixed Backbone Modified Oligonucleotides on Human APOE RNA In Vitro, Single Dose

[0710] Modified oligonucleotides complementary to human APOE nucleic acid were designed and tested for their single dose effects on APOE RNA in vitro. The modified oligonucleotides were tested in a series of experiments that had the same culture conditions.

[0711] The modified oligonucleotides in the tables below are 3-10-3 cEt gapmers with mixed PO/PS internucleoside linkages. The gapmers are 16 nucleosides in length, wherein the central gap segment consists often 2′-β-D-deoxynucleosides, and wherein the 5′ and 3′ wing segments each consist of three cEt modified nucleosides. The sugar motif for the gapmers is (from 5′ to 3′): kkkddddddddddkkk; wherein each ‘d’ represents a 2′-β-D-deoxyribosyl sugar moiety, and each ‘k’ represents a cEt sugar moiety. The internucleoside linkage motif for the gapmers is (from 5′ to 3′): soossssssssssos; wherein each ‘o’ represents a phosphodiester internucleoside linkage and each ‘s’ represents a phosphorothioate internucleoside linkage. Each cytosine residue is a 5-methyl cytosine.

[0712] “Start site” indicates the 5′-most nucleoside to which the modified oligonucleotide is complementary in the target nucleic acid sequence. “Stop site” indicates the 3′-most nucleoside to which the modified oligonucleotide is complementary in the target nucleic acid sequence. Each modified oligonucleotide listed in the tables below is 100% complementary to SEQ ID NO: 1 (described herein above), to SEQ ID NO: 2 (described herein above), or to both. ‘N/A’ indicates that the modified oligonucleotide is not 100% complementary to that particular target nucleic acid sequence.

[0713] Cultured Hep3B cells were treated with modified oligonucleotide at a concentration of 4000 nM by electroporation at a density of 20,000 cells per well. After a treatment period of approximately 24 hours, total RNA was isolated from the cells and APOE RNA levels were measured by quantitative real-time RTPCR. APOE RNA levels were measured by human primer-probe set RTS3073 (described herein in Example 1). APOE RNA levels were normalized to total RNA content, as measured by RIBOGREEN®. Results are presented in the tables below as percent APOE RNA relative to untreated control cells (% UTC). Each table represents results from an individual assay plate. The values marked with an “†” indicate that the modified oligonucleotide is complementary to the amplicon region of the primer probe set. Additional assays may be used to measure the potency and efficacy of the modified oligonucleotides complementary to the amplicon region.

TABLE-US-00031 TABLE 31 Reduction of APOE RNA by 3-10-3 cEt gapmers with mixed PO/PS internucleoside linkages at a concentration of 4000 nM in Hep3B cells plated at 20,000 cells per well SEQ ID SEQ ID SEQ ID SEQ ID No: 1 No: 1 No: 2 No: 2 APOE Compound Start Stop Start Stop (% SEQ ID Number Site Site Site Site Sequence (5′ to 3′) UTC) NO 1335585 4190 4205 N/A N/A TGCATTAGAAACCTCT 76 1905 1335661 6353 6368 1255 1270 TAAACTAGGGTCCACC  13 1906 1516543 6329 6344 1231 1246 ACGGCTGGGGCGGGGA  70 1907 1516550 5064 5079 N/A N/A AGAGGAAGCTAGAACC  89† 1908 1516555 6265 6280 1167 1182 GTGGGGTCGCATGGCT  15 1909 1516556 6132 6147 1034 1049 TCGAACCAGCTCTTGA  72 1910 1516597 3340 3355 N/A N/A CAAATTCCATCCCCCC  60 1911 1516600 5910 5925  812  827 GCCCGCACGCGGCCCT  63 1912 1516604 2853 2868  105  120 CCCCGTGCCCCCGACT 106 1913 1516614 6313 6328 1215 1230 CAGGGTCTCCCGCTGC  37 1914 1516625 6249 6264 1151 1166 GCAGGCTTCGGCGTTC  33 1915 1516649 6289 6304 1191 1206 CGGAGGCAGGAGGCAC  74 1916 1516653 3656 3671 N/A N/A ATACCTGCCAGGAATG 104 1917 1516654 5036 5051 N/A N/A GGCCCCCCAAGACTTA 102† 1918 1516660 2939 2954 N/A N/A GCCCGACCCCGAGTAG 143 1919 1516663 2915 2930 N/A N/A AGACTACCTGGAGGCC  81 1920 1516672 6361 6376 1263 1278 ATCTTTATTAAACTAG  13 1921 1516678 5718 5733  620  635 TGGCCGAGCATGGCCT  98 1922 1516687 4616 4631 N/A N/A GTCGGTTTAATCACTT  71 1923 1516693 2874 2889  126  141 TCTAGAGGCCCCTGAG 104 1924 1516728 4706 4721 N/A N/A GACCCCGTCCAGGCAT  85 1925 1516731 3253 3268 N/A N/A TCCAACCTCACAGTTA  79 1926 1516735 5770 5785  672  687 ACGCAGCTTGCGCAGG  57 1927 1516740 6378 6393 1280 1295 TGCGTGAAACTTGGTG  24 1928 1516747 3505 3520 N/A N/A GGTTAGCCTTCCAAGC  71 1929 1516781 3431 3446 N/A N/A CATTCCCTATTTAACT  86 1930 1516800 5857 5872  759  774 GAGGCCGCGCTCGGCG  88 1931 1516806 4540 4555 N/A N/A GCCTGAACATGGTTCA  83 1932 1516808 6273 6288 1175 1190 GGGGTGGCGTGGGGTC  66 1933 1516818 3452 3467 N/A N/A TTTACCAAGCCGCCCC  95 1934 1516825 3833 3848 N/A N/A TCCTATCTCAAGGATG  97 1935 1516836 4231 4246 N/A N/A TCACAGCTGCCCCGTG  82 1936 1516838 5195 5210 N/A N/A ATATAAAAGAGCTAGG  87† 1937 1516862 6257 6272 1159 1174 GCATGGCTGCAGGCTT  10 1938 1516863 2931 2946 N/A N/A CCGAGTAGCTCTCCTG  90 1939 1516864 5785 5800  687  702 GCGGAGGAGCCGCTTA  86 1940 1516873 5957 5972  859  874 GGGCCCGCTCCTGTAG  89 1941 1516893 3573 3588 N/A N/A AACTGTCAATCAACCG  84 1942 1516899 3522 3537 N/A N/A AACCCGGCCTCACCCC  94 1943 1516902 3073 3088 N/A N/A CTGCTATGGCTTACAT  71 1944 1516903 3153 3168 N/A N/A GCTCCCCAGTTATGGA 106 1945 1516911 6345 6360 1247 1262 GGTCCACCCCAGGAGG  61 1946 1516912 3419 3434 N/A N/A AACTCCCTCCTGGTCT  81 1947 1516914 3311 3326 N/A N/A CGCCGGTTCCATCTCA  82 1948 1516923 2948 2963 N/A N/A TCTCCCCAAGCCCGAC 107 1949 1516932 6370 6385 1272 1287 ACTTGGTGAATCTTTA  23 1950 1516933 3791 3806 N/A N/A AAATCGCTGTTCAGAG  85 1951 1516943 6321 6336 1223 1238 GGCGGGGACAGGGTCT  42 1952 1516952 3463 3478 N/A N/A ATCCCAGCACATTTAC  57 1953 1516960 6281 6296 1183 1198 GGAGGCACGGGGTGGC  48 1954 1516973 6305 6320 1207 1222 CCCGCTGCAGGCTGCG  31 1955 1516975 3485 3500 N/A N/A TTGCATTATCTGCAAC  87 1956 1516976 4800 4815  282  297 GCGCAGCTCGGGCTCC 132 1957 1516979 4987 5002 N/A N/A AGGTATAGCCGCCCAC  87† 1958 1516988 3063 3078 N/A N/A TTACATCCCAGTCCAG  70 1959 1516990 4126 4141 N/A N/A GGAGATCGAAACGGGC  85 1960 1517001 5645 5660  547  562 GCCGGGCCTGCGCCGC  57 1961 1517009 5987 6002  889  904 TCCGCGCGCGCAGCCG  63 1962 1517015 3634 3649  208  223 GCAACGCAGCCCACAG  59 1963 1517017 5692 5707  594  609 GCGGTACTGCACCAGG  75 1964 1517020 4978 4993 N/A N/A CGCCCACCAGGAGGGT  87† 1965 1517029 6233 6248 1135 1150 AGTGATTGTCGCTGGG  22 1966 1517037 4856 4871  338  353 CAAAAGCGACCCAGTG  62† 1967 1517052 6110 6125 1012 1027 CCTGGAAGGCCTCGGC  70 1968 1517066 5012 5027 N/A N/A GGCAGAATGAAACCTG  92† 1969 1517068 3444 3459 N/A N/A GCCGCCCCCAACCCAT  89 1970 1517074 5832 5847  734  749 GCCCCGGCCTGGTACA 100 1971 1517075 5570 5585  472  487 CCAGTTCCGATTTGTA  58 1972 1517078 3226 3241 N/A N/A CCATTTATGAGCTAAT  70 1973 1517079 3184 3199 N/A N/A TCGACGGCTAGCTACC  71 1974 1517081 4864 4879  346  361 GGTAATCCCAAAAGCG  58† 1975 1517101 3532 3547 N/A N/A GCCCGGCCCCAACCCG  84 1976 1517104 3668 3683 N/A N/A AGCCCCGCCCCCATAC  94 1977 1517105 6337 6352 1239 1254 CCAGGAGGACGGCTGG  78 1978 1517110 3197 3212 N/A N/A TAAAGTTCTCCAATCG  70 1979 1517119 6241 6256 1143 1158 CGGCGTTCAGTGATTG  39 1980 1517123 6297 6312 1199 1214 AGGCTGCGCGGAGGCA  15 1981 1517130 6365 6380 1267 1282 GTGAATCTTTATTAAA  20 1982

TABLE-US-00032 TABLE 32 Reduction of APOE RNA by 3-10-3 cEt gapmers with mixed PO/PS internucleoside linkages at a concentration of 4000 nM in Hep3B cells plated at 20,000 cells per well SEQ ID SEQ ID SEQ ID SEQ ID No: 1 No: 1 No: 2 No: 2 APOE Compound Start Stop Start Stop (% SEQ ID Number Site Site Site Site Sequence (5′ to 3′) UTC) NO 1335562 3196 3211 N/A N/A AAAGTTCTCCAATCGA  65 1983 1335576 3428 3443 N/A N/A TCCCTATTTAACTCCC  96 1984 1335671 5011 5026 N/A N/A GCAGAATGAAACCTGG  80† 1985 1335675 4189 4204 N/A N/A GCATTAGAAACCTCTA  83 1986 1335681 3846 3861 N/A N/A AACAACTTCTAACTCC  69 1987 1516527 4225 4240 N/A N/A CTGCCCCGTGTCTGGT  88 1988 1516528 4977 4992 N/A N/A GCCCACCAGGAGGGTC  92† 1989 1516532 6288 6303 1190 1205 GGAGGCAGGAGGCACG  60 1990 1516539 6256 6271 1158 1173 CATGGCTGCAGGCTTC  14 1991 1516548 4855 4870  337  352 AAAAGCGACCCAGTGC  61† 1992 1516558 3310 3325 N/A N/A GCCGGTTCCATCTCAG  76 1993 1516573 4986 5001 N/A N/A GGTATAGCCGCCCACC  81† 1994 1516578 3462 3477 N/A N/A TCCCAGCACATTTACC  82 1995 1516589 6320 6335 1222 1237 GCGGGGACAGGGTCTC  28 1996 1516607 6240 6255 1142 1157 GGCGTTCAGTGATTGT  14 1997 1516609 3790 3805 N/A N/A AATCGCTGTTCAGAGC  74 1998 1516621 5747 5762  649  664 CGAGGCGCACCCGCAG  84 1999 1516624 5782 5797  684  699 GAGGAGCCGCTTACGC  72 2000 1516627 5943 5958  845  860 AGCGGCTGGCCGGCCA  80 2001 1516655 5061 5076 N/A N/A GGAAGCTAGAACCAGC  67† 2002 1516673 4310 4325 N/A N/A CGCGCCCAGCGGAAAA  94 2003 1516697 6344 6359 1246 1261 GTCCACCCCAGGAGGA  84 2004 1516700 3521 3536 N/A N/A ACCCGGCCTCACCCCA 107 2005 1516723 3037 3052 N/A N/A CACCCCACCTTCTAGC 101 2006 1516734 2930 2945 N/A N/A CGAGTAGCTCTCCTGA  82 2007 1516745 2914 2929 N/A N/A GACTACCTGGAGGCCA  76 2008 1516748 3443 3458 N/A N/A CCGCCCCCAACCCATT  96 2009 1516765 5559 5574  461  476 TTGTAGGCCTTCAACT  66 2010 1516772 6108 6123 1010 1025 TGGAAGGCCTCGGCCT  86 2011 1516778 6360 6375 1262 1277 TCTTTATTAAACTAGG   4 2012 1516779 5831 5846  733  748 CCCCGGCCTGGTACAC  84 2013 1516791 3451 3466 N/A N/A TTACCAAGCCGCCCCC  96 2014 1516796 6194 6209 1096 1111 CGGCAGCCTGCACCTT  66 2015 1516824 3655 3670 N/A N/A TACCTGCCAGGAATGT  79 2016 1516841 2849 2864  101  116 GTGCCCCCGACTGCGC  99 2017 1516847 3531 3546 N/A N/A CCCGGCCCCAACCCGG  96 2018 1516848 3183 3198 N/A N/A CGACGGCTAGCTACCG  65 2019 1516854 5841 5856  743  758 CCCTCGCGGGCCCCGG  84 2020 1516858 3664 3679 N/A N/A CCGCCCCCATACCTGC  95 2021 1516867 3152 3167 N/A N/A CTCCCCAGTTATGGAG  89 2022 1516876 3832 3847 N/A N/A CCTATCTCAAGGATGG  85 2023 1516881 6264 6279 1166 1181 TGGGGTCGCATGGCTG  21 2024 1516886 6296 6311 1198 1213 GGCTGCGCGGAGGCAG  18 2025 1516890 6312 6327 1214 1229 AGGGTCTCCCGCTGCA  13 2026 1516892 3072 3087 N/A N/A TGCTATGGCTTACATC  78 2027 1516896 3570 3585 N/A N/A TGTCAATCAACCGCCA  77 2028 1516915 3502 3517 N/A N/A TAGCCTTCCAAGCCTT  85 2029 1516917 3481 3496 N/A N/A ATTATCTGCAACAGCC  67 2030 1516922 4863 4878  345  360 GTAATCCCAAAAGCGA  40† 2031 1516925 5986 6001  888  903 CCGCGCGCGCAGCCGC  56 2032 1516929 3633 3648  207  222 CAACGCAGCCCACAGA  57 2033 1516930 5194 5209 N/A N/A TATAAAAGAGCTAGGG  74† 2034 1516934 6131 6146 1033 1048 CGAACCAGCTCTTGAG  53 2035 1516939 2938 2953 N/A N/A CCCGACCCCGAGTAGC  72 2036 1516947 5637 5652  539  554 TGCGCCGCCTGCAGCT  84 2037 1516962 5909 5924  811  826 CCCGCACGCGGCCCTG  68 2038 1516968 6248 6263 1150 1165 CAGGCTTCGGCGTTCA  41 2039 1516972 3319 3334 N/A N/A CTCCCCACCGCCGGTT  88 2040 1516992 6328 6343 1230 1245 CGGCTGGGGCGGGGAC  89 2041 1516994 5717 5732  619  634 GGCCGAGCATGGCCTG  98 2042 1517000 3393 3408 N/A N/A CCCCATCCCCAGGTCG  98 2043 1517010 4776 4791  258  273 CTCCACCGCTTGCTCC 145 2044 1517016 6336 6351 1238 1253 CAGGAGGACGGCTGGG  40 2045 1517024 6377 6392 1279 1294 GCGTGAAACTTGGTGA  21 2046 1517027 2947 2962 N/A N/A CTCCCCAAGCCCGACC 104 2047 1517040 6272 6287 1174 1189 GGGTGGCGTGGGGTCG  32 2048 1517050 6304 6319 1206 1221 CCGCTGCAGGCTGCGC  46 2049 1517059 3252 3267 N/A N/A CCAACCTCACAGTTAA  70 2050 1517063 6369 6384 1271 1286 CTTGGTGAATCTTTAT  24 2051 1517073 2873 2888  125  140 CTAGAGGCCCCTGAGC  82 2052 1517083 5035 5050 N/A N/A GCCCCCCAAGACTTAG 101† 2053 1517088 5691 5706  593  608 CGGTACTGCACCAGGC  74 2054 1517100 6280 6295 1182 1197 GAGGCACGGGGTGGCG  41 2055 1517116 4615 4630 N/A N/A TCGGTTTAATCACTTG  63 2056 1517126 4705 4720 N/A N/A ACCCCGTCCAGGCATC 106 2057 1517129 3222 3237 N/A N/A TTATGAGCTAATTCAG  63 2058 1517130 6365 6380 1267 1282 GTGAATCTTTATTAAA  17 1982 1517131 6352 6367 1254 1269 AAACTAGGGTCCACCC  18 2059

TABLE-US-00033 TABLE 33 Reduction of APOE RNA by 3-10-3 cEt gapmers with mixed PO/PS internucleoside linkages at a concentration of 4000 nM in Hep3B cells plated at 20,000 cells per well SEQ ID SEQ ID SEQ ID SEQ ID No: 1 No: 1 No: 2 No: 2 APOE Compound Start Stop Start Stop (% SEQ ID Number Site Site Site Site Sequence (5′ to 3′) UTC) NO 1335568 4214 4229 N/A N/A CTGGTATTCACTATCT  71 2060 1335581 4614 4629 N/A N/A CGGTTTAATCACTTGG  58 2061 1516525 5779 5794  681  696 GAGCCGCTTACGCAGC  90 2062 1516534 3530 3545 N/A N/A CCGGCCCCAACCCGGC  95 2063 1516536 4704 4719 N/A N/A CCCCGTCCAGGCATCT 105 2064 1516552 6351 6366 1253 1268 AACTAGGGTCCACCCC  37 2065 1516559 6255 6270 1157 1172 ATGGCTGCAGGCTTCG  23 2066 1516561 6319 6334 1221 1236 CGGGGACAGGGTCTCC  63 2067 1516576 3317 3332 N/A N/A CCCCACCGCCGGTTCC 103 2068 1516593 2937 2952 N/A N/A CCGACCCCGAGTAGCT 105 2069 1516594 3190 3205 N/A N/A CTCCAATCGACGGCTA  72 2070 1516602 5908 5923  810  825 CCGCACGCGGCCCTGT  81 2071 1516638 2867 2882  119  134 GCCCCTGAGCTCATCC  78 2072 1516641 3501 3516 N/A N/A AGCCTTCCAAGCCTTG  70 2073 1516658 6359 6374 1261 1276 CTTTATTAAACTAGGG   6 2074 1516668 6327 6342 1229 1244 GGCTGGGGCGGGGACA  77 2075 1516670 3842 3857 N/A N/A ACTTCTAACTCCTATC  74 2076 1516674 4985 5000 N/A N/A GTATAGCCGCCCACCA  88† 2077 1516675 6106 6121 1008 1023 GAAGGCCTCGGCCTGC  90 2078 1516677 5984 5999  886  901 GCGCGCGCAGCCGCTC  82 2079 1516684 3035 3050 N/A N/A CCCCACCTTCTAGCGG  84 2080 1516686 5009 5024 N/A N/A AGAATGAAACCTGGAC  90† 2081 1516703 4187 4202 N/A N/A ATTAGAAACCTCTAAC  81 2082 1516707 6343 6358 1245 1260 TCCACCCCAGGAGGAC  86 2083 1516708 4774 4789  256  271 CCACCGCTTGCTCCAC  89 2084 1516710 5165 5180 N/A N/A GAGCCAGGACGAGTGT  98† 2085 1516713 3142 3157 N/A N/A ATGGAGATCTGAGGAC  83 2086 1516718 4975 4990 N/A N/A CCACCAGGAGGGTCAA  82† 2087 1516726 6376 6391 1278 1293 CGTGAAACTTGGTGAA  33 2088 1516755 3427 3442 N/A N/A CCCTATTTAACTCCCT  82 2089 1516763 4854 4869  336  351 AAAGCGACCCAGTGCC  32† 2090 1516775 3831 3846 N/A N/A CTATCTCAAGGATGGG  77 2091 1516782 6303 6318 1205 1220 CGCTGCAGGCTGCGCG  81 2092 1516788 4862 4877  344  359 TAATCCCAAAAGCGAC  55† 2093 1516792 6279 6294 1181 1196 AGGCACGGGGTGGCGT  56 2094 1516794 6239 6254 1141 1156 GCGTTCAGTGATTGTC  19 2095 1516797 5829 5844  731  746 CCGGCCTGGTACACTG  95 2096 1516803 3251 3266 N/A N/A CAACCTCACAGTTAAG  80 2097 1516809 6247 6262 1149 1164 AGGCTTCGGCGTTCAG  38 2098 1516814 4309 4324 N/A N/A GCGCCCAGCGGAAAAG  97 2099 1516815 6287 6302 1189 1204 GAGGCAGGAGGCACGG  80 2100 1516837 3569 3584 N/A N/A GTCAATCAACCGCCAG  79 2101 1516850 3071 3086 N/A N/A GCTATGGCTTACATCC  87 2102 1516860 3680 3695 N/A N/A GGGAACCGAGCAAGCC  99 2103 1516865 5556 5571  458  473 TAGGCCTTCAACTCCT  88 2104 1516884 6172 6187 1074 1089 CAGCCCGGCCCACTGG  81 2105 1516900 3480 3495 N/A N/A TTATCTGCAACAGCCT  79 2106 1516907 5716 5731  618  633 GCCGAGCATGGCCTGC  86 2107 1516908 5840 5855  742  757 CCTCGCGGGCCCCGGC 100 2108 1516935 3182 3197 N/A N/A GACGGCTAGCTACCGT  88 2109 1516936 6311 6326 1213 1228 GGGTCTCCCGCTGCAG  26 2110 1516938 5688 5703  590  605 TACTGCACCAGGCGGC  66 2111 1516948 6271 6286 1173 1188 GGTGGCGTGGGGTCGC  34 2112 1516951 3645 3660  219  234 GAATGTGACCAGCAAC  54 2113 1516955 5746 5761  648  663 GAGGCGCACCCGCAGC  99 2114 1516961 5636 5651  538  553 GCGCCGCCTGCAGCTC  75 2115 1516963 3450 3465 N/A N/A TACCAAGCCGCCCCCA  90 2116 1516964 2913 2928 N/A N/A ACTACCTGGAGGCCAG  99 2117 1516974 6368 6383 1270 1285 TTGGTGAATCTTTATT  25 2118 1516977 5059 5074 N/A N/A AAGCTAGAACCAGCAG  81† 2119 1516978 5934 5949  836  851 CCGGCCAGGGAGCCCA  85 2120 1516981 3515 3530 N/A N/A CCTCACCCCAGGTTAG  83 2121 1516987 6130 6145 1032 1047 GAACCAGCTCTTGAGG  59 2122 1516991 3221 3236 N/A N/A TATGAGCTAATTCAGT  71 2123 1517005 3309 3324 N/A N/A CCGGTTCCATCTCAGT  82 2124 1517014 6295 6310 1197 1212 GCTGCGCGGAGGCAGG  76 2125 1517021 2848 2863  100  115 TGCCCCCGACTGCGCT  92 2126 1517031 6263 6278 1165 1180 GGGGTCGCATGGCTGC  59 2127 1517033 3458 3473 N/A N/A AGCACATTTACCAAGC  87 2128 1517036 2929 2944 N/A N/A GAGTAGCTCTCCTGAG  79 2129 1517038 6335 6350 1237 1252 AGGAGGACGGCTGGGG  87 2130 1517046 5034 5049 N/A N/A CCCCCCAAGACTTAGC  83† 2131 1517054 3663 3678 N/A N/A CGCCCCCATACCTGCC  85 2132 1517057 3442 3457 N/A N/A CGCCCCCAACCCATTC  86 2133 1517065 2946 2961 N/A N/A TCCCCAAGCCCGACCC  79 2134 1517069 3632 3647  206  221 AACGCAGCCCACAGAA  67 2135 1517109 3391 3406 N/A N/A CCATCCCCAGGTCGGC  97 2136 1517130 6365 6380 1267 1282 GTGAATCTTTATTAAA  29 1982

TABLE-US-00034 TABLE 34 Reduction of APOE RNA by 3-10-3 cEt gapmers with mixed PO/PS internucleoside linkages at a concentration of 4000 nM in Hep3B cells plated at 20,000 cells per well SEQ ID SEQ ID SEQ ID SEQ ID No: 1 No: 1 No: 2 No: 2 APOE Compound Start Stop Start Stop (% SEQ ID Number Site Site Site Site Sequence (5′ to 3′) UTC) NO 1516551 2847 2862   99  114 GCCCCCGACTGCGCTT  92 2137 1516560 2864 2879  116  131 CCTGAGCTCATCCCCG  99 2138 1516563 3640 3655  214  229 TGACCAGCAACGCAGC  50 2139 1516575 6318 6333 1220 1235 GGGGACAGGGTCTCCC  75 2140 1516579 3476 3491 N/A N/A CTGCAACAGCCTAATC  89 2141 1516581 5686 5701  588  603 CTGCACCAGGCGGCCG 126 2142 1516588 2944 2959 N/A N/A CCCAAGCCCGACCCCG  92 2143 1516595 5704 5719  606  621 CTGCACCTCGCCGCGG  94 2144 1516596 4185 4200 N/A N/A TAGAAACCTCTAACTC  88 2145 1516606 3189 3204 N/A N/A TCCAATCGACGGCTAG  77 2146 1516616 5778 5793  680  695 AGCCGCTTACGCAGCT  99 2147 1516618 4613 4628 N/A N/A GGTTTAATCACTTGGA  74 2148 1516623 4896 4911  378  393 CACCTGCTCAGACAGT  24† 2149 1516632 5057 5072 N/A N/A GCTAGAACCAGCAGAG  88† 2150 1516644 6171 6186 1073 1088 AGCCCGGCCCACTGGC  87 2151 1516645 3631 3646  205  220 ACGCAGCCCACAGAAC  74 2152 1516646 6238 6253 1140 1155 CGTTCAGTGATTGTCG  21 2153 1516656 6254 6269 1156 1171 TGGCTGCAGGCTTCGG  17 2154 1516662 4984 4999 N/A N/A TATAGCCGCCCACCAG  90† 2155 1516667 5008 5023 N/A N/A GAATGAAACCTGGACC 100† 2156 1516680 3294 3309 N/A N/A TCCCAGTCTCGCATTC  85 2157 1516681 6367 6382 1269 1284 TGGTGAATCTTTATTA  26 2158 1516682 5033 5048 N/A N/A CCCCCAAGACTTAGCG 100† 2159 1516688 6278 6293 1180 1195 GGCACGGGGTGGCGTG  38 2160 1516696 6105 6120 1007 1022 AAGGCCTCGGCCTGCA  84 2161 1516704 3457 3472 N/A N/A GCACATTTACCAAGCC  89 2162 1516706 3426 3441 N/A N/A CCTATTTAACTCCCTC  75 2163 1516709 4861 4876  343  358 AATCCCAAAAGCGACC  25† 2164 1516716 3437 3452 N/A N/A CCAACCCATTCCCTAT 112 2165 1516730 5824 5839  726  741 CTGGTACACTGCCAGG  89 2166 1516736 6294 6309 1196 1211 CTGCGCGGAGGCAGGA  64 2167 1516742 3498 3513 N/A N/A CTTCCAAGCCTTGTTG  94 2168 1516743 6375 6390 1277 1292 GTGAAACTTGGTGAAT  35 2169 1516744 4853 4868  335  350 AAGCGACCCAGTGCCA  33† 2170 1516746 6326 6341 1228 1243 GCTGGGGCGGGGACAG  84 2171 1516749 3567 3582 N/A N/A CAATCAACCGCCAGTG  98 2172 1516756 3529 3544 N/A N/A CGGCCCCAACCCGGCC  83 2173 1516761 3679 3694 N/A N/A GGAACCGAGCAAGCCC  86 2174 1516762 6334 6349 1236 1251 GGAGGACGGCTGGGGC  82 2175 1516774 6286 6301 1188 1203 AGGCAGGAGGCACGGG  29 2176 1516783 3809 3824 N/A N/A CGAGGCCCAGAGAGCG  79 2177 1516785 5547 5562  449  464 AACTCCTTCATGGTCT  51 2178 1516790 3316 3331 N/A N/A CCCACCGCCGGTTCCA  84 2179 1516805 5983 5998  885  900 CGCGCGCAGCCGCTCG  75 2180 1516807 6342 6357 1244 1259 CCACCCCAGGAGGACG  64 2181 1516812 3250 3265 N/A N/A AACCTCACAGTTAAGC  76 2182 1516822 3514 3529 N/A N/A CTCACCCCAGGTTAGC  85 2183 1516827 6129 6144 1031 1046 AACCAGCTCTTGAGGC  73 2184 1516869 2879 2894  131  146 CTCTTTCTAGAGGCCC  74 2185 1516888 3839 3854 N/A N/A TCTAACTCCTATCTCA  79 2186 1516913 5624 5639  526  541 GCTCCTTGGACAGCCG  87 2187 1516924 3662 3677 N/A N/A GCCCCCATACCTGCCA  93 2188 1516928 3449 3464 N/A N/A ACCAAGCCGCCCCCAA  91 2189 1516950 6270 6285 1172 1187 GTGGCGTGGGGTCGCA  29 2190 1516953 5933 5948  835  850 CGGCCAGGGAGCCCAC  75 2191 1516956 5745 5760  647  662 AGGCGCACCCGCAGCT  76 2192 1516957 2995 3010 N/A N/A CCTTCCCAGGTCCAGT  91 2193 1516958 3220 3235 N/A N/A ATGAGCTAATTCAGTC  61 2194 1516965 6302 6317 1204 1219 GCTGCAGGCTGCGCGG  43 2195 1516966 5839 5854  741  756 CTCGCGGGCCCCGGCC  70 2196 1516969 3069 3084 N/A N/A TATGGCTTACATCCCA  80 2197 1516984 3181 3196 N/A N/A ACGGCTAGCTACCGTG  91 2198 1516996 3137 3152 N/A N/A GATCTGAGGACACTGG  86 2199 1517006 6350 6365 1252 1267 ACTAGGGTCCACCCCA  49 2200 1517019 4213 4228 N/A N/A TGGTATTCACTATCTG  69 2201 1517025 3389 3404 N/A N/A ATCCCCAGGTCGGCCT  86 2202 1517042 4741 4756 N/A N/A TGTGGAACAAGTTCAA  87 2203 1517056 5907 5922  809  824 CGCACGCGGCCCTGTT  64 2204 1517061 4305 4320 N/A N/A CCAGCGGAAAAGCATG 101 2205 1517062 6246 6261 1148 1163 GGCTTCGGCGTTCAGT  34 2206 1517077 2923 2938 N/A N/A CTCTCCTGAGACTACC  84 2207 1517082 6358 6373 1260 1275 TTTATTAAACTAGGGT  10 2208 1517085 6262 6277 1164 1179 GGGTCGCATGGCTGCA  18 2209 1517099 2936 2951 N/A N/A CGACCCCGAGTAGCTC  79 2210 1517107 6310 6325 1212 1227 GGTCTCCCGCTGCAGG  31 2211 1517124 5102 5117 N/A N/A GAATTCCAGAGAGCTA  90† 2212 1517130 6365 6380 1267 1282 GTGAATCTTTATTAAA  32 1982 1517135 4700 4715 N/A N/A GTCCAGGCATCTAGTA  75 2213

TABLE-US-00035 TABLE 35 Reduction of APOE RNA by 3-10-3 cEt gapmers with mixed PO/PS internucleoside linkages at a concentration of 4000 nM in Hep3B cells plated at 20,000 cells per well SEQ SEQ SEQ SEQ ID No: ID No: ID No: ID No: 1 1 2 2 APOE Compound Start Stop Start Stop Sequence (% SEQ Number Site Site Site Site (5′ to 3′) UTC) ID NO 1335571 3068 3083 N/A N/A ATGGCTTACATCCCAG  99 2214 1335663 4184 4199 N/A N/A AGAAACCTCTAACTCC  50 2215 1335673 3678 3693 N/A N/A GAACCGAGCAAGCCCC  86 2216 1335678 3425 3440 N/A N/A CTATTTAACTCCCTCC  82 2217 1335679 3105 3120 N/A N/A CTCGATAAATGATAGT  75 2218 1516529 4696 4711 N/A N/A AGGCATCTAGTACCTA  78 2219 1516537 4860 4875  342  357 ATCCCAAAAGCGACCC  15† 2220 1516538 5545 5560  447  462 CTCCTTCATGGTCTCG  47 2221 1516545 5837 5852  739  754 CGCGGGCCCCGGCCTG  75 2222 1516553 6357 6372 1259 1274 TTATTAAACTAGGGTC  16 2223 1516567 6055 6070  957  972 GCGCACCTCCGCCACC  66 2224 1516568 6116 6131 1018 1033 GGCGGGCCTGGAAGGC  74 2225 1516570 6253 6268 1155 1170 GGCTGCAGGCTTCGGC  18 2226 1516571 5006 5021 N/A N/A ATGAAACCTGGACCTG  88† 2227 1516591 3639 3654  213  228 GACCAGCAACGCAGCC  67 2228 1516598 3626 3641  200  215 GCCCACAGAACCTTCA  68 2229 1516603 6277 6292 1179 1194 GCACGGGGTGGCGTGG  39 2230 1516611 3513 3528 N/A N/A TCACCCCAGGTTAGCC 111 2231 1516613 6366 6381 1268 1283 GGTGAATCTTTATTAA   6 2232 1516615 3456 3471 N/A N/A CACATTTACCAAGCCG  65 2233 1516629 2921 2936 N/A N/A CTCCTGAGACTACCTG  77 2234 1516630 5623 5638  525  540 CTCCTTGGACAGCCGT  44 2235 1516633 4211 4226 N/A N/A GTATTCACTATCTGCC  85 2236 1516657 5777 5792  679  694 GCCGCTTACGCAGCTT  91 2237 1516661 3475 3490 N/A N/A TGCAACAGCCTAATCC  80 2238 1516666 4869 4884  351  366 GCGCAGGTAATCCCAA  29† 2239 1516692 4852 4867  334  349 AGCGACCCAGTGCCAG  30† 2240 1516750 6237 6252 1139 1154 GTTCAGTGATTGTCGC  20 2241 1516757 3180 3195 N/A N/A CGGCTAGCTACCGTGT  70 2242 1516769 2878 2893  130  145 TCTTTCTAGAGGCCCC  85 2243 1516770 5925 5940  827  842 GAGCCCACAGTGGCGG  96 2244 1516777 3838 3853 N/A N/A CTAACTCCTATCTCAA  65 2245 1516780 5055 5070 N/A N/A TAGAACCAGCAGAGAC  95† 2246 1516784 6309 6324 1211 1226 GTCTCCCGCTGCAGGC  31 2247 1516793 3377 3392 N/A N/A GCCTCCATAGAAAATT 109 2248 1516799 4983 4998 N/A N/A ATAGCCGCCCACCAGG  82† 2249 1516802 6349 6364 1251 1266 CTAGGGTCCACCCCAG  60 2250 1516810 3315 3330 N/A N/A CCACCGCCGGTTCCAT  96 2251 1516811 6170 6185 1072 1087 GCCCGGCCCACTGGCG  44 2252 1516819 6317 6332 1219 1234 GGGACAGGGTCTCCCG  72 2253 1516828 6269 6284 1171 1186 TGGCGTGGGGTCGCAT  28 2254 1516834 6374 6389 1276 1291 TGAAACTTGGTGAATC  22 2255 1516842 5032 5047 N/A N/A CCCCAAGACTTAGCGA  91† 2256 1516844 6341 6356 1243 1258 CACCCCAGGAGGACGG  70 2257 1516845 3248 3263 N/A N/A CCTCACAGTTAAGCGC  69 2258 1516866 6261 6276 1163 1178 GGTCGCATGGCTGCAG  11 2259 1516875 2845 2860   97  112 CCCCGACTGCGCTTCT  87 2260 1516882 3188 3203 N/A N/A CCAATCGACGGCTAGC  96 2261 1516885 2935 2950 N/A N/A GACCCCGAGTAGCTCT  79 2262 1516904 3436 3451 N/A N/A CAACCCATTCCCTATT  72 2263 1516906 5097 5112 N/A N/A CCAGAGAGCTAAAGCC  77† 2264 1516940 6285 6300 1187 1202 GGCAGGAGGCACGGGG  46 2265 1516946 3263 3278 N/A N/A CATTCTAAGCTCCAAC  74 2266 1516949 6333 6348 1235 1250 GAGGACGGCTGGGGCG  50 2267 1516954 3526 3541 N/A N/A CCCCAACCCGGCCTCA  84 2268 1516959 3795 3810 N/A N/A CGTCAAATCGCTGTTC  71 2269 1516982 5823 5838  725  740 TGGTACACTGCCAGGC  46 2270 1516983 5906 5921  808  823 GCACGCGGCCCTGTTC  56 2271 1516985 6245 6260 1147 1162 GCTTCGGCGTTCAGTG  32 2272 1516993 5743 5758  645  660 GCGCACCCGCAGCTCC  90 2273 1517002 4548 4563 N/A N/A GTGCAGCGGCCTGAAC  93 2274 1517022 4304 4319 N/A N/A CAGCGGAAAAGCATGT  97 2275 1517034 6325 6340 1227 1242 CTGGGGCGGGGACAGG  93 2276 1517043 4739 4754 N/A N/A TGGAACAAGTTCAAGG 103 2277 1517044 3566 3581 N/A N/A AATCAACCGCCAGTGA  80 2278 1517047 5697 5712  599  614 TCGCCGCGGTACTGCA  94 2279 1517053 2994 3009 N/A N/A CTTCCCAGGTCCAGTC  70 2280 1517060 6293 6308 1195 1210 TGCGCGGAGGCAGGAG  38 2281 1517084 2859 2874  111  126 GCTCATCCCCGTGCCC  65 2282 1517094 3448 3463 N/A N/A CCAAGCCGCCCCCAAC  77 2283 1517095 6301 6316 1203 1218 CTGCAGGCTGCGCGGA  63 2284 1517106 3660 3675 N/A N/A CCCCATACCTGCCAGG  93 2285 1517112 2943 2958 N/A N/A CCAAGCCCGACCCCGA  88 2286 1517118 3497 3512 N/A N/A TTCCAAGCCTTGTTGC  80 2287 1517130 6365 6380 1267 1282 GTGAATCTTTATTAAA  19 1982 1517134 3218 3233 N/A N/A GAGCTAATTCAGTCCT  68 2288 1517137 5685 5700  587  602 TGCACCAGGCGGCCGC  96 2289 1517138 5982 5997  884  899 GCGCGCAGCCGCTCGC  84 2290

TABLE-US-00036 TABLE 36 Reduction of APOE RNA by 3-10-3 cEt gapmers with mixed PO/PS internucleoside linkages at a concentration of 4000 nM in Hep3B cells plated at 20,000 cells per well SEQ SEQ SEQ SEQ ID No: ID No: ID No: ID No: 1 1 2 2 APOE Compound Start Stop Start Stop Sequence (% SEQ Number Site Site Site Site (5′ to 3′) UTC) ID NO 1335572 3474 3489 N/A N/A GCAACAGCCTAATCCC  65 2291 1335676 3455 3470 N/A N/A ACATTTACCAAGCCGC  74 2292 1516531 2942 2957 N/A N/A CAAGCCCGACCCCGAG  93 2293 1516535 3447 3462 N/A N/A CAAGCCGCCCCCAACC  79 2294 1516540 6340 6355 1242 1257 ACCCCAGGAGGACGGC  65 2295 1516541 5522 5537 N/A N/A GCGCCCTGCGGCCGAG 102† 2296 1516542 3837 3852 N/A N/A TAACTCCTATCTCAAG 129 2297 1516547 5662 5677  564  579 CTCCATGTCCGCGCCC  46 2298 1516564 3565 3580 N/A N/A ATCAACCGCCAGTGAG  89 2299 1516569 4694 4709 N/A N/A GCATCTAGTACCTAGG  72 2300 1516574 4738 4753 N/A N/A GGAACAAGTTCAAGGT  94 2301 1516587 5835 5850  737  752 CGGGCCCCGGCCTGGT  91 2302 1516592 3578 3593 N/A N/A GGAGAAACTGTCAATC 101 2303 1516620 6356 6371 1258 1273 TATTAAACTAGGGTCC  28 2304 1516642 5742 5757  644  659 CGCACCCGCAGCTCCT  62 2305 1516659 3659 3674 N/A N/A CCCATACCTGCCAGGA  95 2306 1516671 5914 5929  816  831 GGCGGCCCGCACGCGG 105 2307 1516679 3314 3329 N/A N/A CACCGCCGGTTCCATC  83 2308 1516690 2877 2892  129  144 CTTTCTAGAGGCCCCT  87 2309 1516691 3217 3232 N/A N/A AGCTAATTCAGTCCTC  73 2310 1516694 3677 3692 N/A N/A AACCGAGCAAGCCCCG 100 2311 1516695 6114 6129 1016 1031 CGGGCCTGGAAGGCCT  94 2312 1516712 6292 6307 1194 1209 GCGCGGAGGCAGGAGG  74 2313 1516715 6236 6251 1138 1153 TTCAGTGATTGTCGCT  28 2314 1516717 3512 3527 N/A N/A CACCCCAGGTTAGCCT  93 2315 1516721 5980 5995  882  897 GCGCAGCCGCTCGCCC  76 2316 1516732 4982 4997 N/A N/A TAGCCGCCCACCAGGA  86† 2317 1516737 6252 6267 1154 1169 GCTGCAGGCTTCGGCG  66 2318 1516741 3376 3391 N/A N/A CCTCCATAGAAAATTC  90 2319 1516753 5094 5109 N/A N/A GAGAGCTAAAGCCAGG  81† 2320 1516758 6373 6388 1275 1290 GAAACTTGGTGAATCT  20 2321 1516760 5005 5020 N/A N/A TGAAACCTGGACCTGG  79† 2322 1516768 5776 5791  678  693 CCGCTTACGCAGCTTG  64 2323 1516771 6260 6275 1162 1177 GTCGCATGGCTGCAGG  20 2324 1516787 3496 3511 N/A N/A TCCAAGCCTTGTTGCA  80 2325 1516789 4194 4209 N/A N/A GCAATGCATTAGAAAC  75 2326 1516817 3525 3540 N/A N/A CCCAACCCGGCCTCAC 126 2327 1516823 5905 5920  807  822 CACGCGGCCCTGTTCC  77 2328 1516829 2992 3007 N/A N/A TCCCAGGTCCAGTCCC 104 2329 1516830 6015 6030  917  932 TCGCGGGTCCGGCTGC  79 2330 1516832 6284 6299 1186 1201 GCAGGAGGCACGGGGT  29 2331 1516840 2919 2934 N/A N/A CCTGAGACTACCTGGA  77 2332 1516843 3067 3082 N/A N/A TGGCTTACATCCCAGT  83 2333 1516846 4545 4560 N/A N/A CAGCGGCCTGAACATG  92 2334 1516851 6332 6347 1234 1249 AGGACGGCTGGGGCGG  39 2335 1516857 2856 2871  108  123 CATCCCCGTGCCCCCG  84 2336 1516861 2844 2859   96  111 CCCGACTGCGCTTCTC  91 2337 1516871 4859 4874  341  356 TCCCAAAAGCGACCCA  14† 2338 1516880 5695 5710  597  612 GCCGCGGTACTGCACC  60 2339 1516887 6316 6331 1218 1233 GGACAGGGTCTCCCGC  43 2340 1516909 5031 5046 N/A N/A CCCAAGACTTAGCGAC  80† 2341 1516916 3422 3437 N/A N/A TTTAACTCCCTCCTGG  66 2342 1516921 6364 6379 1266 1281 TGAATCTTTATTAAAC  38 2343 1516931 6308 6323 1210 1225 TCTCCCGCTGCAGGCT  17 2344 1516937 4868 4883  350  365 CGCAGGTAATCCCAAA   9† 2345 1516942 3104 3119 N/A N/A TCGATAAATGATAGTG  80 2346 1516970 3637 3652  211  226 CCAGCAACGCAGCCCA  58 2347 1516986 6300 6315 1202 1217 TGCAGGCTGCGCGGAG  31 2348 1517018 3794 3809 N/A N/A GTCAAATCGCTGTTCA  78 2349 1517030 5799 5814  701  716 AGGTCATCGGCATCGC  47 2350 1517049 6244 6259 1146 1161 CTTCGGCGTTCAGTGA  43 2351 1517058 6324 6339 1226 1241 TGGGGCGGGGACAGGG  48 2352 1517064 5053 5068 N/A N/A GAACCAGCAGAGACCC  48† 2353 1517072 3187 3202 N/A N/A CAATCGACGGCTAGCT  76 2354 1517080 4302 4317 N/A N/A GCGGAAAAGCATGTAT  82 2355 1517098 3236 3251 N/A N/A GCGCCGTGTTCCATTT  90 2356 1517102 3179 3194 N/A N/A GGCTAGCTACCGTGTC  86 2357 1517108 6268 6283 1170 1185 GGCGTGGGGTCGCATG  32 2358 1517113 5619 5634  521  536 TTGGACAGCCGTGCCC  80 2359 1517117 3262 3277 N/A N/A ATTCTAAGCTCCAACC  71 2360 1517120 6348 6363 1250 1265 TAGGGTCCACCCCAGG  35 2361 1517121 6276 6291 1178 1193 CACGGGGTGGCGTGGG  47 2362 1517122 2934 2949 N/A N/A ACCCCGAGTAGCTCTC  65 2363 1517128 4177 4192 N/A N/A TCTAACTCCCAGCCAG 109 2364 1517130 6365 6380 1267 1282 GTGAATCTTTATTAAA  20 1982 1517132 6169 6184 1071 1086 CCCGGCCCACTGGCGC  98 2365 1517136 4851 4866  333  348 GCGACCCAGTGCCAGT  27† 2366 1517140 3435 3450 N/A N/A AACCCATTCCCTATTT 108 2367

TABLE-US-00037 TABLE 37 Reduction of APOE RNA by 3-10-3 cEt gapmers with mixed PO/PS internucleoside linkages at a concentration of 4000 nM in Hep3B cells plated at 20,000 cells per well SEQ SEQ SEQ SEQ ID No: ID No: ID No: ID No: 1 1 2 2 APOE Compound Start Stop Start Stop Sequence (% SEQ Number Site Site Site Site (5′ to 3′) UTC) ID NO 1335667 3575 3590 N/A N/A GAAACTGTCAATCAAC 113 2368 1335670 3793 3808 N/A N/A TCAAATCGCTGTTCAG  91 2369 1335672 6355 6370 1257 1272 ATTAAACTAGGGTCCA  24 2370 1516524 4737 4752 N/A N/A GAACAAGTTCAAGGTG  77 2371 1516544 3313 3328 N/A N/A ACCGCCGGTTCCATCT  53 2372 1516562 5775 5790  677  692 CGCTTACGCAGCTTGC  93 2373 1516572 5834 5849  736  751 GGGCCCCGGCCTGGTA 107 2374 1516577 3216 3231 N/A N/A GCTAATTCAGTCCTCA  74 2375 1516583 5091 5106 N/A N/A AGCTAAAGCCAGGAGT  90† 2376 1516590 2933 2948 N/A N/A CCCCGAGTAGCTCTCC  94 2377 1516601 6275 6290 1177 1192 ACGGGGTGGCGTGGGG  79 2378 1516608 5798 5813  700  715 GGTCATCGGCATCGCG  50 2379 1516617 6363 6378 1265 1280 GAATCTTTATTAAACT  12 2380 1516619 2831 2846   83   98 CTCACCGGCTCCTGGG  86 2381 1516622 3564 3579 N/A N/A TCAACCGCCAGTGAGG  93 2382 1516631 3473 3488 N/A N/A CAACAGCCTAATCCCA  83 2383 1516634 5992 6007  894  909 CTCCATCCGCGCGCGC  94 2384 1516635 4866 4881  348  363 CAGGTAATCCCAAAAG  63† 2385 1516636 5977 5992  879  894 CAGCCGCTCGCCCCAG 102 2386 1516637 6134 6149 1036 1051 GCTCGAACCAGCTCTT  66 2387 1516639 5740 5755  642  657 CACCCGCAGCTCCTCG  89 2388 1516640 6331 6346 1233 1248 GGACGGCTGGGGCGGG  78 2389 1516643 5656 5671  558  573 GTCCGCGCCCAGCCGG  80 2390 1516650 3454 3469 N/A N/A CATTTACCAAGCCGCC  80 2391 1516651 3658 3673 N/A N/A CCATACCTGCCAGGAA  80 2392 1516652 6307 6322 1209 1224 CTCCCGCTGCAGGCTG  26 2393 1516664 3494 3509 N/A N/A CAAGCCTTGTTGCATT  79 2394 1516683 3177 3192 N/A N/A CTAGCTACCGTGTCGC  92 2395 1516685 6323 6338 1225 1240 GGGGCGGGGACAGGGT 114 2396 1516689 3360 3375 N/A N/A CATCTTCCTCTCCCGG  86 2397 1516698 2855 2870  107  122 ATCCCCGTGCCCCCGA 108 2398 1516711 2965 2980 N/A N/A CTCACCCCCGCTCCTC  89 2399 1516719 3421 3436 N/A N/A TTAACTCCCTCCTGGT 111 2400 1516720 3186 3201 N/A N/A AATCGACGGCTAGCTA  88 2401 1516722 3836 3851 N/A N/A AACTCCTATCTCAAGG  96 2402 1516724 6283 6298 1185 1200 CAGGAGGCACGGGGTG  65 2403 1516725 3228 3243 N/A N/A TTCCATTTATGAGCTA  70 2404 1516727 5913 5928  815  830 GCGGCCCGCACGCGGC 102 2405 1516733 5617 5632  519  534 GGACAGCCGTGCCCGC  80 2406 1516739 5694 5709  596  611 CCGCGGTACTGCACCA 105 2407 1516752 5904 5919  806  821 ACGCGGCCCTGTTCCA  93 2408 1516766 3524 3539 N/A N/A CCAACCCGGCCTCACC  92 2409 1516776 3676 3691 N/A N/A ACCGAGCAAGCCCCGC 132 2410 1516798 3434 3449 N/A N/A ACCCATTCCCTATTTA 117 2411 1516801 3103 3118 N/A N/A CGATAAATGATAGTGA  77 2412 1516816 4858 4873  340  355 CCCAAAAGCGACCCAG  14† 2413 1516820 4301 4316 N/A N/A CGGAAAAGCATGTATT  88 2414 1516821 5515 5530 N/A N/A GCGGCCGAGAGGGCGG 109† 2415 1516833 4193 4208 N/A N/A CAATGCATTAGAAACC  88 2416 1516839 6259 6274 1161 1176 TCGCATGGCTGCAGGC  10 2417 1516849 3446 3461 N/A N/A AAGCCGCCCCCAACCC  96 2418 1516852 3065 3080 N/A N/A GCTTACATCCCAGTCC 128 2419 1516853 6291 6306 1193 1208 CGCGGAGGCAGGAGGC  53 2420 1516855 4980 4995 N/A N/A GCCGCCCACCAGGAGG  98† 2421 1516856 4989 5004 N/A N/A GGAGGTATAGCCGCCC  97† 2422 1516859 2917 2932 N/A N/A TGAGACTACCTGGAGG  95 2423 1516872 5029 5044 N/A N/A CAAGACTTAGCGACAG  71† 2424 1516878 3636 3651  210  225 CAGCAACGCAGCCCAC  68 2425 1516894 6339 6354 1241 1256 CCCCAGGAGGACGGCT  92 2426 1516910 3508 3523 N/A N/A CCAGGTTAGCCTTCCA  92 2427 1516918 6235 6250 1137 1152 TCAGTGATTGTCGCTG  70 2428 1516919 6347 6362 1249 1264 AGGGTCCACCCCAGGA  82 2429 1516920 2941 2956 N/A N/A AAGCCCGACCCCGAGT 110 2430 1516927 6112 6127 1014 1029 GGCCTGGAAGGCCTCG  92 2431 1516944 6315 6330 1217 1232 GACAGGGTCTCCCGCT  28 2432 1516971 6251 6266 1153 1168 CTGCAGGCTTCGGCGT  78 2433 1516995 5038 5053 N/A N/A CAGGCCCCCCAAGACT 104† 2434 1516999 4543 4558 N/A N/A GCGGCCTGAACATGGT  94 2435 1517003 6372 6387 1274 1289 AAACTTGGTGAATCTT  26 2436 1517004 3261 3276 N/A N/A TTCTAAGCTCCAACCT  89 2437 1517011 6299 6314 1201 1216 GCAGGCTGCGCGGAGG  38 2438 1517013 4175 4190 N/A N/A TAACTCCCAGCCAGGT 121 2439 1517026 6267 6282 1169 1184 GCGTGGGGTCGCATGG  15 2440 1517041 4693 4708 N/A N/A CATCTAGTACCTAGGG  88 2441 1517097 6243 6258 1145 1160 TTCGGCGTTCAGTGAT  57 2442 1517115 4850 4865  332  347 CGACCCAGTGCCAGTT  98† 2443 1517125 2876 2891  128  143 TTTCTAGAGGCCCCTG  75 2444 1517130 6365 6380 1267 1282 GTGAATCTTTATTAAA  34 1982

TABLE-US-00038 TABLE 38 Reduction of APOE RNA by 3-10-3 cEt gapmers with mixed PO/PS internucleoside linkages at a concentration of 4000 nM in Hep3B cells plated at 20,000 cells per well SEQ SEQ SEQ SEQ ID No: ID No: ID No: ID No: 1 1 2 2 APOE Compound Start Stop Start Stop Sequence (% SEQ Number Site Site Site Site (5′ to 3′) UTC) ID NO 1335665 5028 5043 N/A N/A AAGACTTAGCGACAGG  89† 2445 1335683 4191 4206 N/A N/A ATGCATTAGAAACCTC  95 2446 1516526 6322 6337 1224 1239 GGGCGGGGACAGGGTC  61 2447 1516530 3492 3507 N/A N/A AGCCTTGTTGCATTAT  95 2448 1516533 6371 6386 1273 1288 AACTTGGTGAATCTTT  45 2449 1516546 4673 4688 N/A N/A ACAGAAGGTGCTCCAC 110 2450 1516549 6362 6377 1264 1279 AATCTTTATTAAACTA  43 2451 1516554 3258 3273 N/A N/A TAAGCTCCAACCTCAC  76 2452 1516557 5572 5587  474  489 CTCCAGTTCCGATTTG  70 2453 1516565 5976 5991  878  893 AGCCGCTCGCCCCAGG 118 2454 1516566 3792 3807 N/A N/A CAAATCGCTGTTCAGA 102 2455 1516580 5037 5052 N/A N/A AGGCCCCCCAAGACTT 111† 2456 1516584 3657 3672 N/A N/A CATACCTGCCAGGAAT 108 2457 1516585 5693 5708  595  610 CGCGGTACTGCACCAG  94 2458 1516586 4128 4143 N/A N/A TGGGAGATCGAAACGG  90 2459 1516605 3574 3589 N/A N/A AAACTGTCAATCAACC 113 2460 1516626 6234 6249 1136 1151 CAGTGATTGTCGCTGG  54 2461 1516628 6266 6281 1168 1183 CGTGGGGTCGCATGGC  18 2462 1516647 2916 2931 N/A N/A GAGACTACCTGGAGGC 108 2463 1516648 5833 5848  735  750 GGCCCCGGCCTGGTAC 116 2464 1516665 5990 6005  892  907 CCATCCGCGCGCGCAG  65 2465 1516669 3835 3850 N/A N/A ACTCCTATCTCAAGGA 104 2466 1516676 3176 3191 N/A N/A TAGCTACCGTGTCGCT  99 2467 1516699 6133 6148 1035 1050 CTCGAACCAGCTCTTG  92 2468 1516701 6250 6265 1152 1167 TGCAGGCTTCGGCGTT  51 2469 1516702 6242 6257 1144 1159 TCGGCGTTCAGTGATT  72 2470 1516705 3312 3327 N/A N/A CCGCCGGTTCCATCTC  87 2471 1516714 3635 3650  209  224 AGCAACGCAGCCCACA  71 2472 1516738 6314 6329 1216 1231 ACAGGGTCTCCCGCTG  70 2473 1516751 6330 6345 1232 1247 GACGGCTGGGGCGGGG 119 2474 1516754 2805 2820   57   72 CTTCACCTCCGCTGGG  94 2475 1516764 3472 3487 N/A N/A AACAGCCTAATCCCAG  40 2476 1516767 3432 3447 N/A N/A CCATTCCCTATTTAAC 117 2477 1516804 3445 3460 N/A N/A AGCCGCCCCCAACCCA 108 2478 1516813 5912 5927  814  829 CGGCCCGCACGCGGCC 111 2479 1516826 3341 3356 N/A N/A TCAAATTCCATCCCCC  85 2480 1516831 6306 6321 1208 1223 TCCCGCTGCAGGCTGC  56 2481 1516835 2854 2869  106  121 TCCCCGTGCCCCCGAC 111 2482 1516868 6338 6353 1240 1255 CCCAGGAGGACGGCTG  89 2483 1516870 3420 3435 N/A N/A TAACTCCCTCCTGGTC 101 2484 1516874 3507 3522 N/A N/A CAGGTTAGCCTTCCAA 106 2485 1516877 6258 6273 1160 1175 CGCATGGCTGCAGGCT  35 2486 1516879 5739 5754  641  656 ACCCGCAGCTCCTCGG 104 2487 1516883 4233 4248 N/A N/A GATCACAGCTGCCCCG 112 2488 1516889 4979 4994 N/A N/A CCGCCCACCAGGAGGG 104† 2489 1516891 6354 6369 1256 1271 TTAAACTAGGGTCCAC  48 2490 1516895 5090 5105 N/A N/A GCTAAAGCCAGGAGTC 107† 2491 1516898 3453 3468 N/A N/A ATTTACCAAGCCGCCC 115 2492 1516901 6298 6313 1200 1215 CAGGCTGCGCGGAGGC  46 2493 1516905 3097 3112 N/A N/A ATGATAGTGACAACTC  79 2494 1516926 2875 2890  127  142 TTCTAGAGGCCCCTGA 104 2495 1516941 4988 5003 N/A N/A GAGGTATAGCCGCCCA 119† 2496 1516945 6274 6289 1176 1191 CGGGGTGGCGTGGGGT 122 2497 1516967 3185 3200 N/A N/A ATCGACGGCTAGCTAC 108 2498 1516980 6282 6297 1184 1199 AGGAGGCACGGGGTGG  78 2499 1516997 5344 5359 N/A N/A GCAGAGACGAAGAAGG  89† 2500 1517007 2949 2964 N/A N/A CTCTCCCCAAGCCCGA  86 2501 1517008 3557 3572 N/A N/A CCAGTGAGGACTCCTC 123 2502 1517012 5787 5802  689  704 TCGCGGAGGAGCCGCT  99 2503 1517028 5773 5788  675  690 CTTACGCAGCTTGCGC  99 2504 1517032 6111 6126 1013 1028 GCCTGGAAGGCCTCGG 104 2505 1517035 2940 2955 N/A N/A AGCCCGACCCCGAGTA 104 2506 1517045 2932 2947 N/A N/A CCCGAGTAGCTCTCCT 108 2507 1517051 3674 3689 N/A N/A CGAGCAAGCCCCGCCC 131 2508 1517055 5648 5663  550  565 CCAGCCGGGCCTGCGC  90 2509 1517067 4857 4872  339  354 CCAAAAGCGACCCAGT  23† 2510 1517070 6290 6305 1192 1207 GCGGAGGCAGGAGGCA  81 2511 1517071 6346 6361 1248 1263 GGGTCCACCCCAGGAG 107 2512 1517087 5903 5918  805  820 CGCGGCCCTGTTCCAC  58 2513 1517089 3198 3213 N/A N/A TTAAAGTTCTCCAATC  92 2514 1517090 3064 3079 N/A N/A CTTACATCCCAGTCCA  97 2515 1517092 3523 3538 N/A N/A CAACCCGGCCTCACCC 129 2516 1517093 4842 4857  324  339 TGCCAGTTCCCAGCGC 177 2517 1517096 4865 4880  347  362 AGGTAATCCCAAAAGC  87† 2518 1517103 3227 3242 N/A N/A TCCATTTATGAGCTAA 112 2519 1517127 4542 4557 N/A N/A CGGCCTGAACATGGTT 114 2520 1517130 6365 6380 1267 1282 GTGAATCTTTATTAAA  34 1982 1517139 4707 4722 N/A N/A TGACCCCGTCCAGGCA 110 2521

Example 5: Dose-Dependent Inhibition of Human APOE in HepG2 Cells by Modified Oligonucleotides

[0714] Modified oligonucleotides selected from Examples 1-4 above were tested at various doses in HepG2 cells. Cultured HepG2 cells at a density of 10,000 cells per well were treated by Lipofectin with various concentrations of modified oligonucleotide as specified in the tables below. After a treatment period of approximately 24 hours, total RNA was isolated from the cells and APOE RNA levels were measured by quantitative real-time RTPCR. Human APOE primer-probe set RTS3073 (described herein in Example 1) was used to measure RNA levels as described above. APOE RNA levels were normalized to total RNA content, as measured by RIBOGREEN®. Results are presented in the tables below as percent APOE RNA, relative to untreated control cells (% UTC). Modified oligonucleotides marked with an “†” indicate that the modified oligonucleotide is complementary to the amplicon region of the primer probe set. Additional assays may be used to measure the potency and efficacy of the modified oligonucleotides complementary to the amplicon region.

[0715] The half maximal inhibitory concentration (IC.sub.50) of each modified oligonucleotide was calculated using a linear regression on a log/linear plot of the data in Excel and is also presented in the tables below.

TABLE-US-00039 TABLE 39 Dose-dependent reduction of human APOE RNA in HepG2 cells by modified oligonucleotides APOE RNA (% UTC) Compound 6.25 12.5 25 50 100 200 IC.sub.50 No. nM nM nM nM nM nM (μM) 426010† 130 117 108 81 48 38 0.14 426011† 124 113 96 71 29 24 0.08 426013† 84 76 52 24 7 5 0.03 426017† 100 98 66 38 14 12 0.04 426020 142 123 114 92 55 54 >0.2 426028 128 117 98 69 47 39 0.12 426047 124 121 120 108 60 53 >0.2 426048 107 104 70 57 50 32 0.09 426049 121 119 109 80 59 40 0.16 426055 120 112 105 86 83 60 >0.2

Example 6: Dose-Dependent Inhibition of Human APOE in Hep3B Cells by Modified Oligonucleotides

[0716] Modified oligonucleotides selected from Examples 1˜4 above were tested at various doses in Hep3B cells. Cultured Hep3B cells at a density of 20,000 cells per well were treated by electroporation with various concentrations of modified oligonucleotide as specified in the tables below. After a treatment period of approximately 24 hours, total RNA was isolated from the cells and APOE RNA levels were measured by quantitative real-time RTPCR. Human APOE primer-probe set RTS3073 (described herein in Example 1) was used to measure RNA levels as described above. APOE RNA levels were normalized to total RNA content, as measured by RIBOGREEN®. Reduction of APOE RNA is presented in the tables below as percent APOE RNA, relative to untreated control cells (% UTC). Modified oligonucleotides marked with an “f” indicate that the modified oligonucleotide is complementary to the amplicon region of the primer probe set. Additional assays may be used to measure the potency and efficacy of the modified oligonucleotides complementary to the amplicon region.

[0717] The half maximal inhibitory concentration (IC.sub.50) of each modified oligonucleotide was calculated using a linear regression on a log/linear plot of the data in Excel and is also presented in the tables below.

TABLE-US-00040 TABLE 40 Dose-dependent reduction of human APOE RNA in Hep3B cells by modified oligonucleotides Compound APOE RNA (% UTC) IC.sub.50 No. 62 nM 185 nM 556 nM 1667 nM 5000 nM (μM) 426048 116 85 57 38 24 1.10 688999 137 131 151 100 79 >5 689003 115 109 92 69 48 5.68 689009 117 136 126 78 72 >5 689013 112 63 54 64 18 1.13 689014 97 122 67 44 19 1.40 689015 99 50 32 30 12 0.41 689016 131 75 54 58 38 1.72 689017 145 98 82 71 26 2.29 689023 132 172 116 84 53 >5 689027 115 99 100 65 66 >5 689028 123 96 102 68 29 3.11 689029 136 114 99 75 56 >5 689040 135 121 93 103 74 >5 689042 124 133 110 93 66 >5

TABLE-US-00041 TABLE 41 Dose-dependent reduction of human APOE RNA in Hep3B cells by modified oligonucleotides Compound APOE RNA (% UTC) IC.sub.50 No. 185 nM 556 nM 1667 nM 5000 nM (μM) 426048 71 72 41 15 0.94 688711 184 226 167 132 >5 688848 77 94 97 73 >5 688886 82 103 108 66 >5 689015 55 31 15 9 0.19 689016 71 62 50 22 1.06 689029 73 71 64 39 3.22 689043 65 57 38 12 0.63 689044 135 101 53 31 2.42 689046 58 32 26 15 0.24 689047 92 91 72 50 >5 689048 53 31 25 13 0.17 689049 99 76 35 32 1.55 689050 75 69 18 15 0.73 689051 61 39 29 14 0.34 689090† 92 116 110 92 >5 689102† 100 138 98 85 >5 689110 95 96 78 83 >5 689118 67 49 29 8 0.50

TABLE-US-00042 TABLE 42 Dose-dependent reduction of human APOE RNA in Hep3B cells by modified oligonucleotides Compound APOE RNA (% UTC) IC.sub.50 No. 78.125 nM 312.5 nM 1250 nM 5000 nM (μM) 1516537† 46 31 19 11 <0.08 1516553 63 46 17 19 0.19 1516570 71 56 33 23 0.43 1516613 35 21 8 3 <0.08 1516617 84 54 30 16 0.49 1516620 76 59 33 15 0.46 1516715 74 58 29 11 0.41 1516750 72 62 33 11 0.44 1516758 44 26 25 26 <0.08 1516771 82 46 32 17 0.43 1516828 64 43 20 15 0.19 1516834 51 32 26 30 <0.08 1516839 56 41 17 14 0.12 1516866 59 42 18 10 0.15 1516871† 29 16 10 7 <0.08 1516931 101 58 29 21 0.71 1516937† 40 18 6 5 <0.08 1517136† 69 51 34 24 0.37 1517427 95 50 25 27 0.60

TABLE-US-00043 TABLE 43 Dose-dependent reduction of human APOE RNA in Hep3B cells by modified oligonucleotides Compound APOE RNA (% UTC) IC.sub.50 No. 78.125 nM 312.5 nM 1250 nM 5000 nM (μM)  689043 76 55 35 18 0.47  708021 84 50 28 14 0.45 1335661 78 65 34 14 0.55 1335672 82 56 25 12 0.44 1516555 73 40 33 15 0.29 1516628 71 46 29 11 0.29 1516652 70 57 41 17 0.47 1516672 72 53 35 25 0.45 1516816† 24 13 11 5 <0.08 1516862 62 43 19 11 0.17 1516944 70 51 36 13 0.36 1517003 44 38 25 25 <0.08 1517026 33 19 10 5 <0.08 1517067† 54 35 21 10 0.10 1517123 96 73 44 26 1.10 1517427 75 60 32 10 0.44 1517437† 28 13 4 4 <0.08 1517532 66 37 25 11 0.19 1517578 79 62 52 15 0.72

TABLE-US-00044 TABLE 44 Dose-dependent reduction of human APOE RNA in Hep3B cells by modified oligonucleotides Compound APOE RNA (% UTC) IC.sub.50 No. 78.125 nM 312.5 nM 1250 nM 5000 nM (μM) 1516539 86 65 36 19 0.68 1516559 81 55 31 21 0.51 1516607 96 67 38 22 0.87 1516658 50 31 14 11 <0.08 1516740 31 20 17 27 <0.08 1516778 51 26 18 5 <0.08 1516794 91 62 33 22 0.70 1516881 82 38 45 24 0.50 1516886 99 78 45 28 1.28 1516890 56 58 26 11 0.23 1516932 45 30 23 23 <0.08 1516936 75 57 32 16 0.44 1516974 66 46 23 30 0.25 1517024 27 25 23 23 <0.08 1517029 72 57 30 23 0.43 1517063 72 39 28 27 0.28 1517130 94 76 46 34 1.43 1517131 88 60 36 23 0.70 1517427 89 66 36 29 0.87

TABLE-US-00045 TABLE 45 Dose-dependent reduction of human APOE RNA in Hep3B cells by modified oligonucleotides Compound APOE RNA (% UTC) IC.sub.50 No. 78.125 nM 312.5 nM 1250 nM 5000 nM (μM)  942586 78 52 25 12 0.38 1516589 80 79 51 33 1.53 1516824 89 94 92 93 >5 1516892 87 95 87 88 >5 1517016 96 89 71 51 >5 1517130 89 73 46 23 1.00 1517180 91 75 53 31 1.47 1517383 71 45 21 9 0.26 1517427 85 57 29 15 0.52 1517529† 33 17 13 9 <0.08 1517535 80 53 29 21 0.46 1517574 93 73 48 30 1.29 1517746† 84 57 32 18 0.54 1517770 56 26 18 5 0.08 1517807† 63 30 20 14 0.12 1517837 52 32 29 25 <0.08 1517849 66 49 32 27 0.33 1517853 73 56 28 16 0.39 1517885 79 58 33 18 0.52

TABLE-US-00046 TABLE 46 Dose-dependent reduction of human APOE RNA in Hep3B cells by modified oligonucleotides Compound APOE RNA (% UTC) IC.sub.50 No. 78.125 nM 312.5 nM 1250 nM 5000 nM (μM)  708024 46 25 26 20 <0.08  942588 82 57 31 25 0.57 1516623† 74 44 20 9 0.27 1516646 87 65 37 23 0.76 1516656 73 46 16 11 0.27 1516681 77 42 27 24 0.35 1516709† 68 50 28 9 0.29 1517082 66 32 16 9 0.15 1517085 77 46 17 9 0.30 1517130 88 66 45 22 0.87 1517208 100 79 75 45 4.89 1517220 80 47 30 17 0.41 1517269† 48 32 20 12 <0.08 1517427 81 52 27 13 0.42 1517508 67 50 25 15 0.28 1517736† 77 73 53 25 1.07 1517841 86 72 64 34 2.02 1517863† 39 24 20 14 <0.08 1517874 81 51 29 29 0.52

Example 7: Dose-Dependent Inhibition of Human APOE in Hep3B Cells by Modified Oligonucleotides

[0718] Modified oligonucleotides selected from Examples 1˜4 above were tested at various doses in Hep3B cells. Cultured Hep3B cells at a density of 20,000 cells per well were treated by electroporation with various concentrations of modified oligonucleotide as specified in the tables below. After a treatment period of approximately 24 hours, total RNA was isolated from the cells and APOE RNA levels were measured by quantitative real-time RTPCR. Human APOE primer-probe set RTS4652 (forward sequence CGCCTGGACGAGGTGAAG, designated herein as SEQ ID NO: 13; reverse sequence CCACTGGCGCTGCATGT, designated herein as SEQ ID NO: 14; probe sequence TTCCAGGCCCGCCTCAAGAGC, designated herein as SEQ ID NO: 15) was used to measure RNA levels as described above. APOE RNA levels were normalized to total RNA content, as measured by RIBOGREEN®. Reduction of APOE RNA is presented in the tables below as percent APOE RNA, relative to untreated control cells (% UTC). Modified oligonucleotides marked with an “†” indicate that the modified oligonucleotide is complementary to the amplicon region of the primer probe set. Additional assays may be used to measure the potency and efficacy of the modified oligonucleotides complementary to the amplicon region.

[0719] The half maximal inhibitory concentration (IC.sub.50) of each modified oligonucleotide was calculated using a linear regression on a log/linear plot of the data in Excel and is also presented in the tables below.

TABLE-US-00047 TABLE 47 Dose-dependent reduction of human APOE RNA in Hep3B cells by modified oligonucleotides Compound APOE RNA (% UTC) IC.sub.50 No. 185 nM 556 nM 1667 nM 5000 nM (μM) 426048 95 67 37 16 1.13 688739† 100 108 112 67 >5 688740† 94 76 86 55 >5 688742† 65 112 70 77 >5 688746† 114 109 76 71 >5 688750† 104 80 122 108 >5 688753† 94 81 83 62 >5 688758† 70 76 72 56 >5 688759† 85 125 70 74 >5 688761† 91 95 88 93 >5 688763† 101 90 109 101 >5 688769† 80 97 87 71 >5 688770† 69 73 81 53 >5 688776 117 89 87 85 >5 688783 72 62 53 35 1.62 688787 107 119 73 57 >5 688802 74 30 46 20 0.55 689014 102 85 54 43 2.86 689016 84 50 70 26 1.68

TABLE-US-00048 TABLE 48 Dose-dependent reduction of human APOE RNA in Hep3B cells by modified oligonucleotides Compound APOE RNA (% UTC) IC.sub.50 No. 185 nM 556 nM 1667 nM 5000 nM (μM) 426048 65 74 47 56 >5 688738† 81 76 85 87 >5 688748† 94 139 123 114 >5 688749† 109 88 100 58 >5 688752† 108 131 147 95 >5 688756† 70 73 88 55 >5 688762† 100 71 71 51 >5 688771† 97 95 101 89 >5 688774† 135 106 112 97 >5 688775† 137 112 201 104 >5 688777 112 99 113 97 >5 688778 116 75 78 58 >5 688780 99 76 94 66 >5 688800 125 108 92 92 >5 688801 128 92 94 95 >5 688806 76 152 116 75 >5 688811 88 164 62 140 >5 689014 83 81 98 56 >5 689016 95 84 102 49 >5

Example 8: Dose-Dependent Inhibition of Human APOE in Transgenic Primary Mouse Hepatocytes by Modified Oligonucleotides

[0720] Modified oligonucleotides selected from Examples 1-4 above were tested at various doses in transgenic primary mouse hepatocytes. An ApoE4 transgenic mouse model (model #1549) was obtained from Taconic Biosciences. Cultured transgenic primary mouse hepatocytes at a density of 15,000 cells per well were treated by free uptake with various concentrations of modified oligonucleotide as specified in the tables below. After a treatment period of approximately 24 hours, total RNA was isolated from the cells and APOE RNA levels were measured by quantitative real-time RTPCR. Human APOE primer-probe set RTS3073 (described herein in Example 1) was used to measure RNA levels as described above. APOE RNA levels were normalized to total RNA content, as measured by RIBOGREEN®. Reduction of APOE RNA is presented in the tables below as percent APOE RNA, relative to untreated control cells (% UTC). Modified oligonucleotides marked with an “†” indicate that the modified oligonucleotide is complementary to the amplicon region of the primer probe set. Additional assays may be used to measure the potency and efficacy of the modified oligonucleotides complementary to the amplicon region.

[0721] The half maximal inhibitory concentration (IC.sub.50) of each modified oligonucleotide was calculated using a linear regression on a log/linear plot of the data in Excel and is also presented in the tables below.

TABLE-US-00049 TABLE 49 Dose-dependent reduction of human APOE RNA in transgenic primary mouse hepatocytes by modified oligonucleotides APOE RNA (% UTC) Compound 222 667 2000 6000 IC.sub.50 No. nM nM nM nM (μM) 689046 6 7 4 5 <0.2 942358 45 53 57 58 0.54 942363 77 87 81 118 >6 942472 59 79 92 104 >6 942490 78 73 86 107 >6 942496 63 81 81 94 >6 942497 85 73 67 81 >6 942514 76 75 71 61 >6 942585 24 24 22 36 <0.2 942591 23 25 24 18 <0.2 942594 45 46 53 50 2.28 942595 43 45 36 38 <0.2 942597 56 52 42 49 1.01 942618 99 83 76 111 >6 942619 97 92 75 63 >6 942627 144 107 86 63 >6 942649 76 73 64 68 >6 942765† 131 86 79 95 >6 942774† 75 75 80 92 >6

TABLE-US-00050 TABLE 50 Dose-dependent reduction of human APOE RNA in transgenic primary mouse hepatocytes by modified oligonucleotides APOE RNA (% UTC) Compound 222 667 2000 6000 IC.sub.50 No. nM nM nM nM (μM) 689046 9 6 5 5 <0.2 942354 57 58 72 103 0.23 942423 76 68 68 62 >6 942499 90 94 92 106 >6 942512 78 93 75 90 >6 942542 135 113 102 142 >6 942552 94 85 79 110 >6 942564 67 89 83 109 >6 942587 5 6 5 6 <0.2 942588 4 5 4 4 <0.2 942593 60 33 35 35 0.28 942598 15 13 14 17 <0.2 942604 83 85 100 127 >6 942617 82 87 72 69 >6 942629 101 98 106 103 >6 942665 120 120 87 110 >6 942670 101 136 141 183 >6 942724 96 74 86 80 >6 942778† 108 107 99 102 >6

Example 9: Design of RNAi Compounds with Antisense RNAi Oligonucleotides Complementary to a Human APOE Nucleic Acid

[0722] RNAi compounds comprising antisense RNAi oligonucleotides complementary to a human APOE nucleic acid and sense RNAi oligonucleotides complementary to the antisense RNAi oligonucleotides were designed as follows.

[0723] The RNAi compounds in the tables below consist of an antisense RNAi oligonucleotide and a sense RNAi oligonucleotide. The antisense RNAi oligonucleotide in each case is 23 nucleosides in length; has a sugar motif (from 5′ to 3′) of: yfyfyfyfyfyfyfyfyfyfyyy; wherein “y” represents a 2′40-methylribosyl sugar, and the “f” represents a 2′-fluororibosyl sugar; and a linkage motif (from 5′ to 3′) of: ssooooooooooooooooooss; wherein ‘o’ represents a phosphodiester internucleoside linkage and ‘s’ represents a phosphorothioate internucleoside linkage. The sense RNAi oligonucleotide in each case is 21 nucleosides in length; has a sugar motif (from 5′ to 3′) of: fyfyfyfyfyfyfyfyfyfyf; wherein “y” represents a 2′-O-methylribosyl sugar, and the “f” represents a 2′-fluororibosyl sugar; and a linkage motif (from 5′ to 3′) of: ssooooooooooooooooss; wherein ‘o’ represents a phosphodiester internucleoside linkage and ‘s’ represents a phosphorothioate internucleoside linkage. Each antisense RNAi oligonucleotides is complementary to the target nucleic acid (APOE), and each sense RNAi oligonucleotides is complementary to the first of the 21 nucleosides of the antisense RNAi oligonucleotide (from 5′ to 3′) wherein the last two 3′-nucleosides of the antisense RNAi oligonucleotides are not paired with the sense RNAi oligonucleotide (are overhanging nucleosides).

[0724] “Start site” indicates the 5′-most nucleoside to which the antisense RNAi oligonucleotides is complementary in the human gene sequence. “Stop site” indicates the 3′-most nucleoside to which the antisense RNAi oligonucleotide is complementary in the human gene sequence. Each modified antisense RNAi oligonucleoside listed in the tables below is 100% complementary to SEQ ID NO: 2 (described herein above). In cases where the antisense RNAi oligonucleotide is not 100% complementary to SEQ ID NO: 2, the antisense RNAi oligonucleotide is mapped to SEQ ID NO: 3 as shown in Table 52 below. Any mismatches of the antisense RNAi oligonucleotide to SEQ ID NO:3 are indicated as below.

TABLE-US-00051 TABLE 51 RNAi compounds targeting human APOE SEQ ID NO: 2 SEQ ID SEQ ID Anti- NO: 2 NO: 2 sense Anti- Anti- Sense RNAi Antisense SEQ sense sense RNAi Sense SEQ Compoud Oligo Sequence ID Start Stop oligo Sequence ID Number ID (5′ to 3′) NO Site Site ID (5′ to 3′) NO 1518137 1518154 UCACCUCCGCUG 2552   48   70 1518148 ACUCAGCCCCA 2743 GGGCUGAGUAG GCGGAGGUGA 1518139 1518153 AUGUGACCAGCA 2553  210  232 1518145 GGGCUGCGUUG 2744 ACGCAGCCCAC CUGGUCACAU 1518140 1518152 CACAGAACCUUC 2554  190  212 1518147 CAGGAAGAUGA 2745 AUCUUCCUGCC AGGUUCUGUG 1518141 1518150 CUCCUGGGGAAG 2555   68   90 1518146 AAGGACGUCCU 2746 GACGUCCUUCA UCCCCAGGAG 1518142 1518151 GGCCUGGCAUCC 2556  230  252 1518144 UUCCUGGCAGG 2747 UGCCAGGAAUG AUGCCAGGCC 1518155 1518171 UCCACCGCUUGC 2557  250  272 1518164 CAAGGUGGAGC 2748 UCCACCUUGGC AAGCGGUGGA 1518156 1518169 CACCCAGCGCAG 2558  350  372 1518161 UGGGAUUACCU 2749 GUAAUCCCAAA GCGCUGGGUG 1518157 1518168 AAAAGCGACCCA 2559  330  352 1518162 AACUGGCACUG 2750 GUGCCAGUUCC GGUCGCUUUU 1518158 1518172 UCCCAGCGCUGG 2560  310  332 1518165 GCAGAGCGGCC 2751 CCGCUCUGCCA AGCGCUGGGA 1518159 1518167 CCACUCGGUCUG 2561  290  312 1518163 CUGCGCCAGCA 2752 CUGGCGCAGCU GACCGAGUGG 1518160 1518170 GCUCGGGCUCCG 2562  270  292 1518166 AGACAGAGCCG 2753 GCUCUGUCUCC GAGCCCGAGC 1518173 1518183 ACCUGCUCAGAC 2563  370  392 1518181 GCAGACACUGU 2754 AGUGUCUGCAC CUGAGCAGGU 1518174 1518185 AGGCCUUCAACU 2564  450  472 1518180 CCAUGAAGGAG 2755 CCUUCAUGGUC UUGAAGGCCU 1518175 1518187 GUCUCGUCCAUC 2565  430  452 1518178 GAGGGCGCUGA 2756 AGCGCCCUCAG UGGACGAGAC 1518176 1518190 AGCUGAGCAGCU 2566  390  412 1518186 UGCAGGAGGAG 2757 CCUCCUGCACC CUGCUCAGCU 1518177 1518188 CAGUUCCUGGGU 2567  410  432 1518182 UCCCAGGUCAC 2758 GACCUGGGAGC CCAGGAACUG 1518179 1518189 UUCCUCCAGUUC 2568  470  492 1518184 UACAAAUCGGA 2759 CGAUUUGUAGG ACUGGAGGAA 1518191 1518204 UCCGCCACCGGG 2569  490  512 1518200 ACAACUGACCC 2760 GUCAGUUGUUC CGGUGGCGGA 1518192 1518208 GCCGCGGUACUG 2570  590  612 1518198 CGCCUGGUGCA 2761 CACCAGGCGGC GUACCGCGGC 1518193 1518207 GGCCGCACACGU 2571  570  592 1518199 ACAUGGAGGAC 2762 CCUCCAUGUCC GUGUGCGGCC 1518194 1518203 UCCGCGCCCAGC 2572  550  572 1518197 GCAGGCCCGGC 2763 CGGGCCUGCGC UGGGCGCGGA 1518195 1518205 CGCCGCCUGCAG 2573  530  552 1518202 UCCAAGGAGCU 2764 CUCCUUGGACA GCAGGCGGCG 1518196 1518206 ACAGCCGUGCCC 2574  510  532 1518201 AGGAGACGCGG 2765 GCGUCUCCUCC GCACGGCUGU 1518209 1518221 CCGAGCAUGGCC 2575  610  632 1518218 CGAGGUGCAGG 2766 UGCACCUCGCC CCAUGCUCGG 1518210 1518222 UGCCAGGCGCUU 2576  710  732 1518217 GACCUGCAGAA 2767 CUGCAGGUCAU GCGCCUGGCA 1518211 1518226 CAUCGGCAUCGC 2577  690  712 1518216 GGCUCCUCCGC 2768 GGAGGAGCCGC GAUGCCGAUG 1518212 1518223 CGCUUACGCAGC 2578  670  692 1518215 CCUGCGCAAGC 2769 UUGCGCAGGUG UGCGUAAGCG 1518213 1518224 GUGGGAGGCGAG 2579  650  672 1518220 CGGGUGCGCCU 2770 GCGCACCCGCA CGCCUCCCAC 1518214 1518225 GCAGCUCCUCGG 2580  630  652 1518219 GCCAGAGCACC 2771 UGCUCUGGCCG GAGGAGCUGC 1518227 1518240 CGGGCCCCGGCC 2581  730  752 1518234 AGUGUACCAGG 2772 UGGUACACUGC CCGGGGCCCG 1518228 1518241 UGGCGGCCCGCA 2582  810  832 1518233 AGGGCCGCGUG 2773 CGCGGCCCUGU CGGGCCGCCA 1518229 1518239 UGUUCCACCAGG 2583  790  812 1518235 CCUGGGGCCCC 2774 GGCCCCAGGCG UGGUGGAACA 1518230 1518242 GCGCUCGCGGAU 2584  770  792 1518237 CUCAGCGCCAU 2775 GGCGCUGAGGC CCGCGAGCGC 1518231 1518243 GGCCGCGCUCGG 2585  750  772 1518236 GCGAGGGCGCC 2776 CGCCCUCGCGG GAGCGCGGCC 1518232 1518244 GCCGGCCAGGGA 2586  830  852 1518238 ACUGUGGGCUC 2777 GCCCACAGUGG CCUGGCCGGC 1518245 1518257 GCCCGCUCCUGU 2587  850  872 1518253 CCAGCCGCUAC 2778 AGCGGCUGGCC AGGAGCGGGC 1518246 1518261 GCGCACCUCCGC 2588  950  972 1518254 GAGCAGGUGGC 2779 CACCUGCUCCU GGAGGUGCGC 1518247 1518259 CCUUCACCUCGU 2589  930  952 1518252 ACCGCCUGGAC 2780 CCAGGCGGUCG GAGGUGAAGG 1518248 1518258 CUCCUCCAUCCG 2590  890  912 1518251 CUGCGCGCGCG 2781 CGCGCGCAGCC GAUGGAGGAG 1518249 1518260 GCCGCUCGCCCC 2591  870  892 1518255 CCCAGGCCUGG 2782 AGGCCUGGGCC GGCGAGCGGC 1518250 1518262 UCGCGGGUCCGG 2592  910  932 1518256 GAUGGGCAGCC 2783 CUGCCCAUCUC GGACCCGCGA 1518263 1518279 GCCUGCUCCUCC 2593  970  992 1518271 CGCCAAGCUGG 2784 AGCUUGGCGCG AGGAGCAGGC 1518264 1518276 GCUGCAUGUCUU 2594 1050 1072 1518270 CCCUGGUGGAA 2785 CCACCAGGGGC GACAUGCAGC 1518265 1518278 CACCAGCCCGGC 2595 1070 1092 1518273 CGCCAGUGGGC 2786 CCACUGGCGCU CGGGCUGGUG 1518266 1518275 GGCUCGAACCAG 2596 1030 1052 1518269 CCUCAAGAGCU 2787 CUCUUGAGGCG GGUUCGAGCC 1518267 1518280 CCUGCAGGCGUA 2597  990 1012 1518272 CCCAGCAGAUA 2788 UCUGCUGGGCC CGCCUGCAGG 1518268 1518277 GCGGGCCUGGAA 2598 1010 1032 1518274 GCCGAGGCCUU 2789 GGCCUCGGCCU CCAGGCCCGC 1518281 1518293 ACGGCAGCCUGC 2599 1090 1112 1518288 GGAGAAGGUGC 2790 ACCUUCUCCAC AGGCUGCCGU 1518282 1518295 CGGCGUUCAGUG 2600 1136 1158 1518289 AGCGACAAUCA 2791 AUUGUCGCUGG CUGAACGCCG 1518283 1518294 GGCGUUCAGUGA 2601 1135 1157 1518287 CAGCGACAAUC 2792 UUGUCGCUGGG ACUGAACGCC 1518284 1518297 UCAGUGAUUGUC 2602 1130 1152 1518291 GUGCCCAGCGA 2793 GCUGGGCACAG CAAUCACUGA 1518285 1518296 CAGGGGCGGCGC 2603 1110 1132 1518290 UGGGCACCAGC 2794 UGGUGCCCACG GCCGCCCCUG 1518286 1518298 UCGGCGUUCAGU 2604 1137 1159 1518292 GCGACAAUCAC 2795 GAUUGUCGCUG UGAACGCCGA 1518299 1518312 UUCGGCGUUCAG 2605 1138 1160 1518305 CGACAAUCACU 2796 UGAUUGUCGCU GAACGCCGAA 1518300 1518311 AGGCUUCGGCGU 2606 1142 1164 1518306 AAUCACUGAAC 2797 UCAGUGAUUGU GCCGAAGCCU 1518301 1518313 GGCUUCGGCGUU 2607 1141 1163 1518307 CAAUCACUGAA 2798 CAGUGAUUGUC CGCCGAAGCC 1518302 1518314 GCUUCGGCGUUC 2608 1140 1162 1518308 ACAAUCACUGA 2799 AGUGAUUGUCG ACGCCGAAGC 1518303 1518316 CUUCGGCGUUCA 2609 1139 1161 1518309 GACAAUCACUG 2800 GUGAUUGUCGC AACGCCGAAG 1518304 1518315 CAGGCUUCGGCG 2610 1143 1165 1518310 AUCACUGAACG 2801 UUCAGUGAUUG CCGAAGCCUG 1518317 1518329 UGCAGGCUUCGG 2611 1145 1167 1518323 CACUGAACGCC 2802 CGUUCAGUGAU GAAGCCUGCA 1518318 1518331 UGGCUGCAGGCU 2612 1149 1171 1518326 GAACGCCGAAG 2803 UCGGCGUUCAG CCUGCAGCCA 1518319 1518334 GCAGGCUUCGGC 2613 1144 1166 1518324 UCACUGAACGC 2804 GUUCAGUGAUU CGAAGCCUGC 1518320 1518332 GGCUGCAGGCUU 2614 1148 1170 1518325 UGAACGCCGAA 2805 CGGCGUUCAGU GCCUGCAGCC 1518321 1518333 GCUGCAGGCUUC 2615 1147 1169 1518328 CUGAACGCCGA 2806 GGCGUUCAGUG AGCCUGCAGC 1518322 1518330 CUGCAGGCUUCG 2616 1146 1168 1518327 ACUGAACGCCG 2807 GCGUUCAGUGA AAGCCUGCAG 1518335 1518347 AUGGCUGCAGGC 2617 1150 1172 1518342 AACGCCGAAGC 2808 UUCGGCGUUCA CUGCAGCCAU 1518336 1518348 UCGCAUGGCUGC 2618 1154 1176 1518341 CCGAAGCCUGC 2809 AGGCUUCGGCG AGCCAUGCGA 1518337 1518351 CGCAUGGCUGCA 2619 1153 1175 1518346 GCCGAAGCCUG 2810 GGCUUCGGCGU CAGCCAUGCG 1518338 1518350 GCAUGGCUGCAG 2620 1152 1174 1518344 CGCCGAAGCCU 2811 GCUUCGGCGUU GCAGCCAUGC 1518339 1518352 CAUGGCUGCAGG 2621 1151 1173 1518343 ACGCCGAAGCC 2812 CUUCGGCGUUC UGCAGCCAUG 1518340 1518349 GUCGCAUGGCUG 2622 1155 1177 1518345 CGAAGCCUGCA 2813 CAGGCUUCGGC GCCAUGCGAC 1518353 1518355 GGUCGCAUGGCU 2623 1156 1178 1518354 GAAGCCUGCAG 2814 GCAGGCUUCGG CCAUGCGACC 1518356 1518369 GGGUCGCAUGGC 2624 1157 1179 1518364 AAGCCUGCAGC 2815 UGCAGGCUUCG CAUGCGACCC 1518357 1518367 GGGGUCGCAUGG 2625 1158 1180 1518362 AGCCUGCAGCC 2816 CUGCAGGCUUC AUGCGACCCC 1518358 1518366 CGUGGGGUCGCA 2626 1161 1183 1518361 CUGCAGCCAUG 2817 UGGCUGCAGGC CGACCCCACG 1518359 1518370 GUGGGGUCGCAU 2627 1160 1182 1518363 CCUGCAGCCAU 2818 GGCUGCAGGCU GCGACCCCAC 1518360 1518368 UGGGGUCGCAUG 2628 1159 1181 1518365 GCCUGCAGCCA 2819 GCUGCAGGCUU UGCGACCCCA 1518371 1518385 UGGCGUGGGGUC 2629 1164 1186 1518380 CAGCCAUGCGA 2820 GCAUGGCUGCA CCCCACGCCA 1518372 1518388 GGGUGGCGUGGG 2630 1167 1189 1518379 CCAUGCGACCCC 2821 GUCGCAUGGCU ACGCCACCC 1518373 1518386 GGUGGCGUGGGG 2631 1166 1188 1518381 GCCAUGCGACC 2822 UCGCAUGGCUG CCACGCCACC 1518374 1518387 GGCGUGGGGUCG 2632 1163 1185 1518377 GCAGCCAUGCG 2823 CAUGGCUGCAG ACCCCACGCC 1518375 1518384 GUGGCGUGGGGU 2633 1165 1187 1518382 AGCCAUGCGAC 2824 CGCAUGGCUGC CCCACGCCAC 1518376 1518383 GCGUGGGGUCGC 2634 1162 1184 1518378 UGCAGCCAUGC 2825 AUGGCUGCAGG GACCCCACGC 1518389 1518406 CGGGGUGGCGUG 2635 1169 1191 1518400 AUGCGACCCCA 2826 GGGUCGCAUGG CGCCACCCCG 1518390 1518404 GGCACGGGGUGG 2636 1173 1195 1518397 GACCCCACGCCA 2827 CGUGGGGUCGC CCCCGUGCC 1518391 1518402 GCACGGGGUGGC 2637 1172 1194 1518399 CGACCCCACGCC 2828 GUGGGGUCGCA ACCCCGUGC 1518392 1518403 CACGGGGUGGCG 2638 1171 1193 1518398 GCGACCCCACGC 2829 UGGGGUCGCAU CACCCCGUG 1518393 1518405 GGGGUGGCGUGG 2639 1168 1190 1518396 CAUGCGACCCC 2830 GGUCGCAUGGC ACGCCACCCC 1518394 1518401 ACGGGGUGGCGU 2640 1170 1192 1518395 UGCGACCCCAC 2831 GGGGUCGCAUG GCCACCCCGU 1518407 1518419 GAGGCACGGGGU 2641 1175 1197 1518416 CCCCACGCCACC 2832 GGCGUGGGGUC CCGUGCCUC 1518408 1518423 GCAGGAGGCACG 2642 1179 1201 1518415 ACGCCACCCCGU 2833 GGGUGGCGUGG GCCUCCUGC 1518409 1518424 CAGGAGGCACGG 2643 1178 1200 1518413 CACGCCACCCCG 2834 GGUGGCGUGGG UGCCUCCUG 1518410 1518421 GGAGGCACGGGG 2644 1176 1198 1518414 CCCACGCCACCC 2835 UGGCGUGGGGU CGUGCCUCC 1518411 1518422 AGGAGGCACGGG 2645 1177 1199 1518418 CCACGCCACCCC 2836 GUGGCGUGGGG GUGCCUCCU 1518412 1518420 AGGCACGGGGUG 2646 1174 1196 1518417 ACCCCACGCCAC 2837 GCGUGGGGUCG CCCGUGCCU 1518425 1518440 GGCAGGAGGCAC 2647 1180 1202 1518432 CGCCACCCCGUG 2838 GGGGUGGCGUG CCUCCUGCC 1518426 1518441 GCGGAGGCAGGA 2648 1185 1207 1518433 CCCCGUGCCUCC 2839 GGCACGGGGUG UGCCUCCGC 1518427 1518442 GGAGGCAGGAGG 2649 1183 1205 1518436 CACCCCGUGCCU 2840 CACGGGGUGGC CCUGCCUCC 1518428 1518438 CGGAGGCAGGAG 2650 1184 1206 1518435 ACCCCGUGCCUC 2841 GCACGGGGUGG CUGCCUCCG 1518429 1518437 GAGGCAGGAGGC 2651 1182 1204 1518434 CCACCCCGUGCC 2842 ACGGGGUGGCG UCCUGCCUC 1518430 1518439 AGGCAGGAGGCA 2652 1181 1203 1518431 GCCACCCCGUGC 2843 CGGGGUGGCGU CUCCUGCCU 1518443 1518456 CGCGGAGGCAGG 2653 1186 1208 1518450 CCCGUGCCUCCU 2844 AGGCACGGGGU GCCUCCGCG 1518444 1518460 GGCUGCGCGGAG 2654 1191 1213 1518451 GCCUCCUGCCUC 2845 GCAGGAGGCAC CGCGCAGCC 1518445 1518455 GCUGCGCGGAGG 2655 1190 1212 1518453 UGCCUCCUGCC 2846 CAGGAGGCACG UCCGCGCAGC 1518446 1518458 UGCGCGGAGGCA 2656 1188 1210 1518454 CGUGCCUCCUG 2847 GGAGGCACGGG CCUCCGCGCA 1518447 1518459 GCGCGGAGGCAG 2657 1187 1209 1518449 CCGUGCCUCCU 2848 GAGGCACGGGG GCCUCCGCGC 1518448 1518457 CUGCGCGGAGGC 2658 1189 1211 1518452 GUGCCUCCUGC 2849 AGGAGGCACGG CUCCGCGCAG 1518461 1518477 CAGGCUGCGCGG 2659 1193 1215 1518467 CUCCUGCCUCCG 2850 AGGCAGGAGGC CGCAGCCUG 1518462 1518476 CGCUGCAGGCUG 2660 1198 1220 1518469 GCCUCCGCGCA 2851 CGCGGAGGCAG GCCUGCAGCG 1518463 1518474 CUGCAGGCUGCG 2661 1196 1218 1518472 CUGCCUCCGCGC 2852 CGGAGGCAGGA AGCCUGCAG 1518464 1518473 UGCAGGCUGCGC 2662 1195 1217 1518471 CCUGCCUCCGCG 2853 GGAGGCAGGAG CAGCCUGCA 1518465 1518478 AGGCUGCGCGGA 2663 1192 1214 1518470 CCUCCUGCCUCC 2854 GGCAGGAGGCA GCGCAGCCU 1518466 1518475 GCAGGCUGCGCG 2664 1194 1216 1518468 UCCUGCCUCCGC 2855 GAGGCAGGAGG GCAGCCUGC 1518479 1518492 CCGCUGCAGGCU 2665 1199 1221 1518489 CCUCCGCGCAGC 2856 GCGCGGAGGCA CUGCAGCGG 1518480 1518493 UCUCCCGCUGCA 2666 1203 1225 1518486 CGCGCAGCCUG 2857 GGCUGCGCGGA CAGCGGGAGA 1518481 1518491 CUCCCGCUGCAG 2667 1202 1224 1518485 CCGCGCAGCCU 2858 GCUGCGCGGAG GCAGCGGGAG 1518482 1518495 CCCGCUGCAGGC 2668 1200 1222 1518488 CUCCGCGCAGCC 2859 UGCGCGGAGGC UGCAGCGGG 1518483 1518496 UCCCGCUGCAGG 2669 1201 1223 1518487 UCCGCGCAGCC 2860 CUGCGCGGAGG UGCAGCGGGA 1518484 1518494 GCUGCAGGCUGC 2670 1197 1219 1518490 UGCCUCCGCGC 2861 GCGGAGGCAGG AGCCUGCAGC 1518497 1518509 GUCUCCCGCUGC 2671 1204 1226 1518501 GCGCAGCCUGC 2862 AGGCUGCGCGG AGCGGGAGAC 1518498 1518514 GGUCUCCCGCUG 2672 1205 1227 1518506 CGCAGCCUGCA 2863 CAGGCUGCGCG GCGGGAGACC 1518499 1518511 ACAGGGUCUCCC 2673 1209 1231 1518504 GCCUGCAGCGG 2864 GCUGCAGGCUG GAGACCCUGU 1518500 1518512 AGGGUCUCCCGC 2674 1207 1229 1518508 CAGCCUGCAGC 2865 UGCAGGCUGCG GGGAGACCCU 1518502 1518513 GGGUCUCCCGCU 2675 1206 1228 1518505 GCAGCCUGCAG 2866 GCAGGCUGCGC CGGGAGACCC 1518503 1518510 CAGGGUCUCCCG 2676 1208 1230 1518507 AGCCUGCAGCG 2867 CUGCAGGCUGC GGAGACCCUG 1518515 1518530 GACAGGGUCUCC 2677 1210 1232 1518525 CCUGCAGCGGG 2868 CGCUGCAGGCU AGACCCUGUC 1518516 1518531 GCGGGGACAGGG 2678 1215 1237 1518521 AGCGGGAGACC 2869 UCUCCCGCUGC CUGUCCCCGC 1518517 1518529 CGGGGACAGGGU 2679 1214 1236 1518522 CAGCGGGAGAC 2870 CUCCCGCUGCA CCUGUCCCCG 1518518 1518528 GGGGACAGGGUC 2680 1213 1235 1518524 GCAGCGGGAGA 2871 UCCCGCUGCAG CCCUGUCCCC 1518519 1518532 GGACAGGGUCUC 2681 1211 1233 1518526 CUGCAGCGGGA 2872 CCGCUGCAGGC GACCCUGUCC 1518520 1518527 GGGACAGGGUCU 2682 1212 1234 1518523 UGCAGCGGGAG 2873 CCCGCUGCAGG ACCCUGUCCC 1518533 1518550 GGCGGGGACAGG 2683 1216 1238 1518540 GCGGGAGACCC 2874 GUCUCCCGCUG UGUCCCCGCC 1518534 1518545 GCUGGGGCGGGG 2684 1221 1243 1518539 AGACCCUGUCC 2875 ACAGGGUCUCC CCGCCCCAGC 1518535 1518549 CUGGGGCGGGGA 2685 1220 1242 1518541 GAGACCCUGUC 2876 CAGGGUCUCCC CCCGCCCCAG 1518536 1518546 UGGGGCGGGGAC 2686 1219 1241 1518542 GGAGACCCUGU 2877 AGGGUCUCCCG CCCCGCCCCA 1518537 1518548 GGGCGGGGACAG 2687 1217 1239 1518544 CGGGAGACCCU 2878 GGUCUCCCGCU GUCCCCGCCC 1518538 1518547 GGGGCGGGGACA 2688 1218 1240 1518543 GGGAGACCCUG 2879 GGGUCUCCCGC UCCCCGCCCC 1518551 1518563 GGACGGCUGGGG 2689 1226 1248 1518558 CUGUCCCCGCCC 2880 CGGGGACAGGG CAGCCGUCC 1518552 1518564 GGCUGGGGCGGG 2690 1222 1244 1518557 GACCCUGUCCCC 2881 GACAGGGUCUC GCCCCAGCC 1518553 1518565 GACGGCUGGGGC 2691 1225 1247 1518559 CCUGUCCCCGCC 2882 GGGGACAGGGU CCAGCCGUC 1518554 1518567 ACGGCUGGGGCG 2692 1224 1246 1518561 CCCUGUCCCCGC 2883 GGGACAGGGUC CCCAGCCGU 1518555 1518566 CGGCUGGGGCGG 2693 1223 1245 1518560 ACCCUGUCCCCG 2884 GGACAGGGUCU CCCCAGCCG 1518556 1518568 AGGACGGCUGGG 2694 1227 1249 1518562 UGUCCCCGCCCC 2885 GCGGGGACAGG AGCCGUCCU 1518569 1518582 GAGGACGGCUGG 2695 1228 1250 1518579 GUCCCCGCCCCA 2886 GGCGGGGACAG GCCGUCCUC 1518570 1518586 CCAGGAGGACGG 2696 1232 1254 1518578 CCGCCCCAGCCG 2887 CUGGGGCGGGG UCCUCCUGG 1518571 1518585 CCCAGGAGGACG 2697 1233 1255 1518576 CGCCCCAGCCGU 2888 GCUGGGGCGGG CCUCCUGGG 1518572 1518581 CAGGAGGACGGC 2698 1231 1253 1518575 CCCGCCCCAGCC 2889 UGGGGCGGGGA GUCCUCCUG 1518573 1518583 AGGAGGACGGCU 2699 1230 1252 1518577 CCCCGCCCCAGC 2890 GGGGCGGGGAC CGUCCUCCU 1518574 1518584 GGAGGACGGCUG 2700 1229 1251 1518580 UCCCCGCCCCAG 2891 GGGCGGGGACA CCGUCCUCC 1518587 1518600 CCCCAGGAGGAC 2701 1234 1256 1518596 GCCCCAGCCGUC 2892 GGCUGGGGCGG CUCCUGGGG 1518588 1518599 GUCCACCCCAGG 2702 1239 1261 1518597 AGCCGUCCUCC 2893 AGGACGGCUGG UGGGGUGGAC 1518589 1518602 UCCACCCCAGGA 2703 1238 1260 1518593 CAGCCGUCCUCC 2894 GGACGGCUGGG UGGGGUGGA 1518590 1518603 CCACCCCAGGAG 2704 1237 1259 1518595 CCAGCCGUCCUC 2895 GACGGCUGGGG CUGGGGUGG 1518591 1518604 CACCCCAGGAGG 2705 1236 1258 1518598 CCCAGCCGUCCU 2896 ACGGCUGGGGC CCUGGGGUG 1518592 1518601 ACCCCAGGAGGA 2706 1235 1257 1518594 CCCCAGCCGUCC 2897 CGGCUGGGGCG UCCUGGGGU 1518605 1518617 GGUCCACCCCAG 2707 1240 1262 1518612 GCCGUCCUCCU 2898 GAGGACGGCUG GGGGUGGACC 1518606 1518618 UAGGGUCCACCC 2708 1243 1265 1518611 GUCCUCCUGGG 2899 CAGGAGGACGG GUGGACCCUA 1518607 1518620 GGGUCCACCCCA 2709 1241 1263 1518615 CCGUCCUCCUG 2900 GGAGGACGGCU GGGUGGACCC 1518608 1518621 AGGGUCCACCCC 2710 1242 1264 1518614 CGUCCUCCUGG 2901 AGGAGGACGGC GGUGGACCCU 1518609 1518619 CUAGGGUCCACC 2711 1244 1266 1518613 UCCUCCUGGGG 2902 CCAGGAGGACG UGGACCCUAG 1518610 1518622 ACUAGGGUCCAC 2712 1245 1267 1518616 CCUCCUGGGGU 2903 CCCAGGAGGAC GGACCCUAGU 1518623 1518637 AACUAGGGUCCA 2713 1246 1268 1518629 CUCCUGGGGUG 2904 CCCCAGGAGGA GACCCUAGUU 1518624 1518640 AUUAAACUAGGG 2714 1250 1272 1518632 UGGGGUGGACC 2905 UCCACCCCAGG CUAGUUUAAU 1518625 1518639 UUAAACUAGGGU 2715 1249 1271 1518634 CUGGGGUGGAC 2906 CCACCCCAGGA CCUAGUUUAA 1518626 1518635 UAUUAAACUAGG 2716 1251 1273 1518633 GGGGUGGACCC 2907 GUCCACCCCAG UAGUUUAAUA 1518627 1518636 AAACUAGGGUCC 2717 1247 1269 1518630 UCCUGGGGUGG 2908 ACCCCAGGAGG ACCCUAGUUU 1518628 1518638 UAAACUAGGGUC 2718 1248 1270 1518631 CCUGGGGUGGA 2909 CACCCCAGGAG CCCUAGUUUA 1518641 1518656 CUUUAUUAAACU 2719 1254 1276 1518651 GUGGACCCUAG 2910 AGGGUCCACCC UUUAAUAAAG 1518642 1518654 AAUCUUUAUUAA 2720 1257 1279 1518649 GACCCUAGUUU 2911 ACUAGGGUCCA AAUAAAGAUU 1518643 1518655 AUCUUUAUUAAA 2721 1256 1278 1518647 GGACCCUAGUU 2912 CUAGGGUCCAC UAAUAAAGAU 1518644 1518653 UCUUUAUUAAAC 2722 1255 1277 1518648 UGGACCCUAGU 2913 UAGGGUCCACC UUAAUAAAGA 1518645 1518658 UUUAUUAAACUA 2723 1253 1275 1518650 GGUGGACCCUA 2914 GGGUCCACCCC GUUUAAUAAA 1518646 1518657 UUAUUAAACUAG 2724 1252 1274 1518652 GGGUGGACCCU 2915 GGUCCACCCCA AGUUUAAUAA 1518659 1518671 GAAUCUUUAUUA 2725 1258 1280 1518665 ACCCUAGUUUA 2916 AACUAGGGUCC AUAAAGAUUC 1518660 1518672 UGGUGAAUCUUU 2726 1262 1284 1518666 UAGUUUAAUAA 2917 AUUAAACUAGG AGAUUCACCA 1518661 1518673 GGUGAAUCUUUA 2727 1261 1283 1518667 CUAGUUUAAUA 2918 UUAAACUAGGG AAGAUUCACC 1518662 1518674 GUGAAUCUUUAU 2728 1260 1282 1518668 CCUAGUUUAAU 2919 UAAACUAGGGU AAAGAUUCAC 1518663 1518676 UGAAUCUUUAUU 2729 1259 1281 1518669 CCCUAGUUUAA 2920 AAACUAGGGUC UAAAGAUUCA 1518664 1518675 UUGGUGAAUCUU 2730 1263 1285 1518670 AGUUUAAUAAA 2921 UAUUAAACUAG GAUUCACCAA 1518677 1518692 CUUGGUGAAUCU 2731 1264 1286 1518686 GUUUAAUAAAG 2922 UUAUUAAACUA AUUCACCAAG 1518678 1518689 UGAAACUUGGUG 2732 1269 1291 1518684 AUAAAGAUUCA 2923 AAUCUUUAUUA CCAAGUUUCA 1518679 1518690 GAAACUUGGUGA 2733 1268 1290 1518688 AAUAAAGAUUC 2924 AUCUUUAUUAA ACCAAGUUUC 1518680 1518693 AAACUUGGUGAA 2734 1267 1289 1518683 UAAUAAAGAUU 2925 UCUUUAUUAAA CACCAAGUUU 1518681 1518691 AACUUGGUGAAU 2735 1266 1288 1518685 UUAAUAAAGAU 2926 CUUUAUUAAAC UCACCAAGUU 1518682 1518694 ACUUGGUGAAUC 2736 1265 1287 1518687 UUUAAUAAAGA 2927 UUUAUUAAACU UUCACCAAGU 1518695 1518705 CGUGAAACUUGG 2737 1271 1293 1518700 AAAGAUUCACC 2928 UGAAUCUUUAU AAGUUUCACG 1518697 1518706 GCGUGAAACUUG 2738 1272 1294 1518701 AAGAUUCACCA 2929 GUGAAUCUUUA AGUUUCACGC 1518698 1518707 UGCGUGAAACUU 2739 1273 1295 1518702 AGAUUCACCAA 2930 GGUGAAUCUUU GUUUCACGCA 1518699 1518709 GUGAAACUUGGU 2740 1270 1292 1518703 UAAAGAUUCAC 2931 GAAUCUUUAUU CAAGUUUCAC

TABLE-US-00052 TABLE 52 RNAi compounds targeting human APOE SEQ ID NO: 3 SEQ ID SEQ ID Sense Antisense Antisense SEQ NO: 3 NO: 3 RNAi Sense SEQ Compound RNAi Sequence ID Antisense Antisense Oligo Sequence ID Number Oligo ID (5′ to 3′) NO Start Site Stop Site ID (5′ to 3′) NO 1518138 1518149 GCCUGUGAUUG 2741  40  62 1518143 GCCGACUGGCC 2932 GCCAGUCGGCU AAUCACAGGC C 1518696 1518708* GGCGGCCGCGC 2742 438 460 1518704 UGGAGGACGU 2933 ACGUCCUCCAU GCGCGGCCGCC G *Compound No. 1518708 has a single mismatch to SEQ ID NO: 3 located at position 10 (from 5′ to 3′) of the antisense strand.

Example 10: Effect of RNAi Compounds on Human APOE RNA In Vitro, Single Dose

[0725] Double-stranded RNAi compounds described above were tested in a series of experiments under the same culture conditions. The results for each experiment are presented in separate tables below.

[0726] Cultured Hep3B cells at a density of 20,000 cells per well were transfected using RNAiMAX with 20 nM of double stranded RNAi. After a treatment period of approximately 24 hours, RNA was isolated from the cells and APOE RNA levels were measured by quantitative real-time RTPCR. Human primer probe set RTS3073 (described herein in Example 1 above) was used to measure RNA levels. APOE RNA levels were normalized to total RNA content, as measured by RIBOGREEN®. Results are presented as percent APOE RNA relative to the amount in untreated control cells (% UTC). The values marked with an “†” indicate that the modified oligonucleotide is complementary to the amplicon region of the primer probe set. Additional assays may be used to measure the potency and efficacy of the modified oligonucleotides complementary to the amplicon region. N.D. in the tables below refers to instances where the value was Not Defined.

TABLE-US-00053 TABLE 53 Reduction of APOE RNA by RNAi Compound Number APOE (% UTC) 1518137 107  1518138 87 1518139  7 1518140  7 1518141 81 1518142 132  1518155 43 1518156  76† 1518157  52† 1518158 104  1518159 25 1518160 89 1518173  59† 1518174 12 1518175  42† 1518176  88† 1518177  81† 1518179 97 1518191 90 1518192 81 1518193 111  1518194 103  1518195 35 1518196 84 1518209 76 1518210 23 1518211 96 1518212 43 1518213 83 1518214 91 1518227 88 1518228 77 1518229 89 1518230 71 1518231 104  1518232 75 1518245 74 1518246 66 1518247 88 1518248 84 1518249 84 1518250 86 1518263 75 1518264 62 1518265 92 1518266  7 1518267 80 1518268 74 1518281 57 1518282  5 1518283 21 1518284 57 1518285 72 1518286 23 1518299 23 1518300 55 1518301 38 1518302 41 1518303 39 1518304 10 1518317 43 1518318 72 1518319 14 1518320 71 1518321 41 1518322 60 1518335  5 1518336 38 1518337 17 1518338 42 1518339  9 1518340 16 1518353 76 1518356 61 1518357 11 1518358 64 1518359 53 1518360 40 1518372 68 1518376 68

TABLE-US-00054 TABLE 54 Reduction of APOE RNA by RNAi Compound Number APOE (% UTC) 1518425 106 1518426 111 1518427 107 1518428 118 1518429 109 1518430 110 1518443 107 1518444 112 1518445 103 1518446 100 1518447 113 1518448 87 1518461 88 1518462 91 1518463 97 1518464 101 1518465 83 1518466 101 1518479 87 1518480 N.D. 1518481 N.D. 1518482 68 1518483 44 1518484 82 1518497 67 1518498 N.D. 1518499 61 1518500 79 1518502 82 1518503 15 1518515 55 1518516 53 1518517 N.D. 1518518 67 1518519 11 1518520 68 1518533 86 1518534 69 1518535 79 1518536 89 1518537 72 1518538 94 1518551 84 1518552 N.D. 1518553 N.D. 1518554 76 1518555 74 1518556 61 1518569 60 1518570 65 1518571 67 1518572 82 1518573 N.D. 1518574 73 1518587 66 1518588 N.D. 1518589 82 1518590 66 1518591 74 1518592 71 1518605 60 1518606 N.D. 1518607 70 1518608 67 1518609 57 1518610 71 1518623 65 1518624 50 1518625 67 1518626 6 1518627 21 1518628 17 1518641 61 1518642 2 1518643 2 1518644 2 1518645 46 1518646 24 1518659 2 1518663 2

TABLE-US-00055 TABLE 55 Reduction of APOE RNA by RNAi Compound Number APOE (% UTC) 1518371 85 1518373 69 1518374 91 1518375 96 1518389 102 1518390 93 1518391 100 1518392 104 1518393 98 1518394 96 1518407 89 1518408 96 1518409 92 1518410 100 1518411 94 1518412 82 1518660 6 1518661 6 1518662 N.D. 1518664 8 1518677 6 1518678 5 1518679 6 1518680 7 1518681 3 1518682 4 1518695 12 1518696 98 1518697 7 1518698 61 1518699 7

Example 11: Design of Modified Oligonucleotides Complementary to Human APOE Nucleic Acid

[0727] Modified oligonucleotides complementary to a human APOE nucleic acid were designed, as described in the tables below. “Start site” indicates the 5′-most nucleoside to which the modified oligonucleotide is complementary in the target nucleic acid sequence. “Stop site” indicates the 3′-most nucleoside to which the modified oligonucleotide is complementary in the target nucleic acid sequence. Each modified oligonucleotide listed in the tables below is 100% complementary to SEQ ID NO: 1 (described herein above), to SEQ ID NO: 2 (described herein above), or to both. ‘N/A’ indicates that the modified oligonucleotide is not 100% complementary to that particular target nucleic acid sequence.

[0728] The modified oligonucleotides in Table 56 are 5-10-5 MOE gapmers. The gapmers are 20 nucleosides in length, wherein the central gap segment consists of ten 2′-β-D-deoxynucleosides, and the 5′ and 3′ wing segments each consists of five 2′-MOE modified nucleosides. The sugar motif for the gapmers is (from 5′ to 3′): eeeeeddddddddddeeeee; wherein each ‘d’ represents a 2′-β-D-deoxyribosyl sugar moiety, and each ‘e’ represents a 2′-MOE modified sugar moiety. The gapmers have an internucleoside linkage motif of (from 5′ to 3′): sooosssssssssssooss; wherein each “s” represents a phosphorothioate internucleoside linkage, and each “o” represents a phosphodiester internucleoside linkage. Each cytosine residue is a 5-methyl cytosine.

TABLE-US-00056 TABLE 56 5-10-5 MOE gapmers with mixed PO/PS internucleoside linkages complementary to human APOE SEQ SEQ SEQ SEQ ID No: ID No: ID No: ID No: Compound 1 Start 1 Stop 2 Start 2 Stop SEQ Number Sequence (5′ to 3′) Site Site Site Site ID NO 1401842 CCTCATTTTAAAGTTCTCCA 3201 3220 N/A N/A 2522 1401843 CCTCATTCTCCCTTCACATT 3275 3294 N/A N/A 2523 1401845 GGGACACCCAGTAGGTGCTC 3118 3137 N/A N/A 2524 1401846 TTCCTCATTCTCCCTTCACA 3277 3296 N/A N/A 2525 1401848 GAGCTAATTCAGTCCTCATT 3214 3233 N/A N/A 2526 1401852 TCCTCATTCTCCCTTCACAT 3276 3295 N/A N/A 2527 1401853 CTCCAATCGACGGCTAGCTA 3186 3205 N/A N/A 2528 1401857 TGAGCTAATTCAGTCCTCAT 3215 3234 N/A N/A 2529 1401861 CATTCCTCATTCTCCCTTCA 3279 3298 N/A N/A 2530 1401862 GCATTCCTCATTCTCCCTTC 3280 3299 N/A N/A 2531

[0729] The modified oligonucleotides in Table 57 are 5-10-5 MOE gapmers. The gapmers are 20 nucleosides in length, wherein the central gap segment consists of ten 2′-β-D-deoxynucleosides, and the 5′ and 3′ wing segments each consists of five 2′-MOE modified nucleosides. The sugar motif for the gapmers is (from 5′ to 3′): eeeeeddddddddddeeeee; wherein each ‘d’ represents a 2′-β-D-deoxyribosyl sugar moiety, and each ‘e’ represents a 2′-MOE modified sugar moiety. The gapmers have an internucleoside linkage motif of (from 5′ to 3′): soooossssssssssooss; wherein each “s” represents a phosphorothioate internucleoside linkage, and each “o” represents a phosphodiester internucleoside linkage. Each cytosine residue is a 5-methyl cytosine.

TABLE-US-00057 TABLE 57 5-10-5 MOE gapmers with mixed PO/PS internucleoside linkages complementary to human APOE SEQ SEQ SEQ SEQ ID No: ID No: ID No: ID No: Compound 1 Start 1 Stop 2 Start 2 Stop SEQ Number Sequence (5′ to 3′) Site Site Site Site ID NO 1419518 ATGCATTAGAAACCTCTAAC 4187 4206 N/A N/A 1697 1419519 GTTGCATTATCTGCAACAGC 3482 3501 N/A N/A 1632 1419520 CCTGCTATGGCTTACATCCC 3070 3089 N/A N/A 1669 1419521 CTATGGCTTACATCCCAGTC 3066 3085 N/A N/A 1801 1419522 TCTGGTATTCACTATCTGCC 4211 4230 N/A N/A 1899 1419523 CCCTTCACATTCTAAGCTCC 3266 3285 N/A N/A 1188 1419524 CTCATTTTAAAGTTCTCCAA 3200 3219 N/A N/A 1539 1419525 CTCGATAAATGATAGTGACA 3101 3120 N/A N/A 1419 1419526 GCATTATCTGCAACAGCCTA 3479 3498 N/A N/A 1830 1419527 TCATTTTAAAGTTCTCCAAT 3199 3218 N/A N/A 1638 1419528 TATGAGCTAATTCAGTCCTC 3217 3236 N/A N/A 1350 1419529 CACATTCTAAGCTCCAACCT 3261 3280 N/A N/A 1521 1419530 CCTCCATAGAAAATTCCATC 3372 3391 N/A N/A 1662 1419531 TGCTCCACAAATGCTTCTTT 4661 4680 N/A N/A 1656 1419532 CCTCATTTTAAAGTTCTCCA 3201 3220 N/A N/A 2522 1419533 CAGCACATTTACCAAGCCGC 3455 3474 N/A N/A  855 1419534 TCCTCATTTTAAAGTTCTCC 3202 3221 N/A N/A 1457 1419535 TTCCATTTATGAGCTAATTC 3224 3243 N/A N/A 1750

[0730] The modified oligonucleotides in Table 58 are 5-10-5 MOE gapmers. The gapmers are 20 nucleosides in length, wherein the central gap segment consists of ten 2′-β-D-deoxynucleosides, and the 5′ and 3′ wing segments each consists of five 2′-MOE modified nucleosides. The sugar motif for the gapmers is (from 5′ to 3′): eeeeeddddddddddeeeee; wherein each represents a 2′-β-D-deoxyribosyl sugar moiety, and each ‘e’ represents a 2′-MOE modified sugar moiety. The gapmers have an internucleoside linkage motif of (from 5′ to 3′): sossssssssssssssoss; wherein each “s” represents a phosphorothioate internucleoside linkage, and each “o” represents a phosphodiester internucleoside linkage. Each cytosine residue is a 5-methyl cytosine.

TABLE-US-00058 TABLE 58 5-10-5 MOE gapmers with mixed PO/PS internucleoside linkages complementary to human APOE SEQ SEQ SEQ SEQ ID No: ID No: ID No: ID No: Compound 1 Start 1 Stop 2 Start 2 Stop SEQ Number Sequence (5′ to 3′) Site Site Site Site ID NO 1449189 CAGCACATTTACCAAGCCGC 3455 3474 N/A N/A  855 1449190 CCTCATTTTAAAGTTCTCCA 3201 3220 N/A N/A 2522 1449191 TATGAGCTAATTCAGTCCTC 3217 3236 N/A N/A 1350 1449192 TTCCATTTATGAGCTAATTC 3224 3243 N/A N/A 1750 1449193 TGGTGAATCTTTATTAAACT 6363 6382 1265 1284 1193

[0731] The modified oligonucleotides in Table 59 are 3-10-3 cEt gapmers. The gapmers are 16 nucleosides in length, wherein the central gap segment consists of ten 2′-β-D-deoxynucleosides, and wherein the 5′ and 3′ wing segments each consist of three cEt modified nucleosides. The sugar motif for the gapmers is (from 5′ to 3′): kkkddddddddddkkk; wherein each represents a 2′-β-D-deoxyribosyl sugar moiety, and each 1′ represents a cEt sugar moiety. The gapmers have an internucleoside linkage motif of (from 5′ to 3′): soossssssssssos; wherein each “s” represents a phosphorothioate internucleoside linkage and each “o” represents a phosphodiester internucleoside linkage. Each cytosine residue is a 5-methyl cytosine.

TABLE-US-00059 TABLE 59 3-10-3 cEt gapmers with mixed PO/PS internucleoside linkages complementary to human APOE SEQ SEQ SEQ SEQ ID ID ID ID No: 1 No: 1 No: 2 No: 2 SEQ Compound Sequence Start Stop Start Stop ID Number (5′ to 3′) Site Site Site Site NO 1335664 GAAGCTAGAA 5060 5075 N/A N/A 2532 CCAGCA 1335669 GTTTAATCAC 4612 4627 N/A N/A 2533 TTGGAA 1335682 CCAATTATAG 2758 2773 101 25 2534 GGCTCC

[0732] The modified oligonucleotides in Table 60 are 17 nucleosides in length. The sugar motif for each of the gapmers is (from 5′ to 3′): eeeeddddddddkkeee; wherein each ‘e’ represents a 2′-MOE modified sugar moiety, each represents a 2′-β-D-deoxyribosyl sugar moiety, and each 1′ represents a cEt sugar moiety. The gapmers each have an internucleoside linkage motif of (from 5′ to 3′): soosssssssssooss; wherein each “s” represents a phosphorothioate internucleoside linkage and each “o” represents a phosphodiester internucleoside linkage. Each cytosine residue is a 5-methyl cytosine.

TABLE-US-00060 TABLE 60 Modified oligonucleotides with mixed PO/PS internucleoside linkages complementary to human APOE SEQ ID SEQ ID SEQ ID SEQ ID No: 1 No: 1 No: 2 No: 2 Compound Sequence Start Stop Start Stop SEQ Number (5′ to 3′) Site Site Site Site ID NO 1449171 GTGAATCTTTATTAAAC 6364 6380 1266 1282 2535 1449172 CCTCATTTTAAAGTTCT 3204 3220 N/A N/A 2536 1449173 CACATTTACCAAGCCGC 3455 3471 N/A N/A 2537 1449174 GCACATTTACCAAGCCG 3456 3472 N/A N/A 2538 1449176 CAGCACATTTACCAAGC 3458 3474 N/A N/A 2539 1449177 CATTTATGAGCTAATTC 3224 3240 N/A N/A 2540 1449178 CCATTTATGAGCTAATT 3225 3241 N/A N/A 2541 1449179 TCCATTTATGAGCTAAT 3226 3242 N/A N/A 2542 1449180 TTCCATTTATGAGCTAA 3227 3243 N/A N/A 2543 1449181 GGTGAATCTTTATTAAA 6365 6381 1267 1283 2544 1449182 GAGCTAATTCAGTCCTC 3217 3233 N/A N/A 2545 1449183 TGAGCTAATTCAGTCCT 3218 3234 N/A N/A 2546 1449184 ATGAGCTAATTCAGTCC 3219 3235 N/A N/A 2547 1449185 TATGAGCTAATTCAGTC 3220 3236 N/A N/A 2548 1449186 CATTTTAAAGTTCTCCA 3201 3217 N/A N/A 2549 1449187 TCATTTTAAAGTTCTCC 3202 3218 N/A N/A 2550 1449188 CTCATTTTAAAGTTCTC 3203 3219 N/A N/A 2551

Example 12: Activity of Modified Oligonucleotides Complementary to Human APOE in Transgenic Mice

[0733] ApoE4 transgenic mice (model #1549) were obtained from Taconic Biosciences. APOE transgenic mice were divided into groups of 4 mice each. Each mouse received a single intracerebroventricular (ICV) bolus of 100 μg, or 300 μg of modified oligonucleotide, as indicated in the tables below. A group of 4 mice received a single ICV bolus with PBS as a negative control, and the PCR values were normalized to this group.

[0734] Two weeks post treatment, mice were sacrificed and RNA was extracted from cortical brain tissue, and/or spinal cord for quantitative real-time RTPCR analysis of RNA expression of APOE using primer probe set RTS3073 (described herein above). Results are presented as percent change of RNA, relative to PBS control, normalized to mouse cyclophilin A (% control). Mouse cyclophilin A was amplified using primer probe set m_cyclo24 (forward sequence TCGCCGCTTGCTGCA, designated herein as SEQ ID NO: 16; reverse sequence ATCGGCCGTGATGTCGA, designated herein as SEQ ID NO: 17; probe sequence CCATGGTCAACCCCACCGTGTTC, designated herein as SEQ ID NO: 18). Data indicated as “n.d.” (no data) means that no data is available for that tissue for that compound.

[0735] As shown in the table below, treatment with modified oligonucleotides resulted in reduction of APOE RNA in comparison to the PBS control.

TABLE-US-00061 TABLE 61 Reduction of human APOE RNA in transgenic mice, 100 μg dose APOE RNA Compound No. (% control) - CORTEX PBS 100 1335661 82 1335663 97 1335664 88 1335669 79 1335672 73 1335675 75 1335678 90 1335679 83 1335681 81 1335682 86 1335683 79

TABLE-US-00062 TABLE 62 Reduction of human APOE RNA in transgenic mice, 300 μg dose APOE RNA Compound No. (% control) - CORTEX PBS 100 942665 92 942683 74 1335661 82 1335663 65 1335664 77 1335675 71 1335683 86 1401842 89 1401843 90 1401845 91 1401846 96 1401848 80 1401852 82 1401853 80 1401857 91 1401861 88 1401862 71

TABLE-US-00063 TABLE 63 Reduction of human APOE RNA in transgenic mice, 300 μg dose APOE RNA Compound No. (% control) - CORTEX PBS 100 1419518 83 1419519 121 1419520 78 1419521 88 1419522 96 1419523 75 1419524 90 1419525 86 1419526 89 1419527 96 1419528 56 1419529 104 1419530 87 1419531 92 1419532 62 1419533 63 1419534 80 1419535 58

TABLE-US-00064 TABLE 64 Reduction of human APOE RNA in transgenic mice, 300 μg dose Compound APOE RNA (% control) No. CORTEX SPINAL CORD PBS 100 100 1449171 56 44 1449172 114 89 1449173 69 70 1449174 57 71 1449176 78 80 1449177 69 87 1449178 46 70 1449179 59 70 1449180 56 77 1449181 36 48 1449182 55 64 1449183 49 72 1449184 54 66 1449185 62 82 1449186 62 68 1449187 41 60 1449188 49 58 1449189 62 71 1449190 42 52 1449191 70 64 1449192 67 80 1449193 44 55

Example 13: Activity of Modified Oligonucleotides Complementary to Human APOE in Knock-In Mice

[0736] APOE knock-in mice used in this study express the full-length human APOE gene knocked into the mouse locus. Humanization of APOE gene was done via CRISPR/Cas-9-mediated gene editing, allowing for generation of a model with constitutive expression of human APOE gene. Targeting strategy was based on NCBI transcripts NM_009696.4 (mouse) and NM_000041.4 (human). Mouse genomic sequence from exon 1 to exon 4 (including the 5′ and 3′ UTRs) was replaced with the human counterpart from 141 bp upstream of exon 1 to 28 bp downstream of exon 4. A plasmid allowing expression of Cas9 mRNA, specific gRNA, and the puromycin resistance cassette, and a plasmid containing the homology regions of the mouse APOE gene, and the replaced human region were co-transfected into the Taconic Biosciences C57BL/6N Tac ES cell line. Homologous recombination clones were isolated using positive puromycin selection, and humanized allele was obtained after Cas9-mediated gene editing. C57BL/6NTac-Apoeem7250_A-C03(APOE) Tac mice were used in these experiments, and are herein called APOE knock-in mice.

[0737] APOE knock-in mice were divided into groups of 2 mice each. Each mouse received a single ICV bolus of 300 μg of modified oligonucleotide. A group of 4 mice received a single ICV bolus with PBS as a negative control.

[0738] Two weeks post treatment, mice were sacrificed and RNA was extracted from cortical brain tissue, and spinal cord for quantitative real-time RTPCR analysis of RNA expression of APOE using primer probe set RTS3073 (described herein above). Results are presented as percent change of RNA, relative to PBS control, normalized to mouse cyclophilin A (% control). Mouse cyclophilin A was amplified using primer probe set m_cyclo24 (designated herein above). The values marked with a “t” indicate that the modified oligonucleotide is complementary to the amplicon region of the primer-probe set. In such cases, human primer-probe set RTS36365 (forward sequence CAGCGGAGGTGAAGGAC, designated herein as SEQ ID NO: 7; reverse sequence CAACGCAGCCCACAGAA, designated herein as SEQ ID NO: 8; probe sequence TCATCTTCCTGCCTGTGATTGGCC, designated herein as SEQ ID NO: 9) was used to confirm RNA expression of APOE.

[0739] As shown in the table below, treatment with modified oligonucleotides resulted in reduction of APOE RNA in comparison to the PBS control.

TABLE-US-00065 TABLE 65 Reduction of human APOE RNA in knock-in mice APOE RNA (% control) APOE RNA (% control) RTS3073 RTS36365 Compound SPINAL SPINAL No. CORD CORTEX CORD CORTEX PBS 100  100  100  100  688711 64 78 64 78 688730 96 102  109  111  688775 103†  92† 111  98 688817 69 80 83 98 689046 45 52 48 55 729709 101  82 111  87 942364 80 92 90 99 942391  98†  94† 115  99 942393  99†  96† 114  110  942593 96 81 97 100  942728 78 78 89 91 1419528 83 82  90†  93† 1419533 79 89  81†  97† 1419535 77 91  81†  93† 1449190 67 73  70†  81† 1449193 61 59 72 71 1517154 80 72  77†  82† 1517173 89 90 89 95 1517222 90 87  89†  85† 1517226 80 70  84†  69† 1517228 94 86 95 90 1517234 106  87 101  93 1517246 78 78  75†  79† 1517248 89 93 87 91 1517254 52 57 53 56 1517281 71 81 77 84 1517311  76† 100† 72 104  1517316 90 98 94 107  1517356 94 91  95†  96† 1517372 115  96 116† 101† 1517383 81 69 73 72 1517394 129  103  117† 111† 1517508 77 71 63 73 1517529 226†  97† 175  108  1517561 85 96  87† 102† 1517564 108  95 108 103  1517641 107  99 101 102  1517651 100  99  96† 105† 1517652 90 79 78 87 1517663 103  105   96† 141† 1517732 87 89 102† 100† 1517770 33 35 40 39 1517853 65 53 70 65 1517891 65 49 77 66

TABLE-US-00066 TABLE 66 Reduction of human APOE RNA in knock-in mice Compound APOE RNA (% control) No. SPINAL CORD CORTEX PBS 100 100  689046 43.7‡  57‡ 942594 83 107  942596 100 101  942684 85 85 1401848 79 87 1517718 91 85 1517841 78 73 1517885 63 58 ‡Fewer than 2 samples available

TABLE-US-00067 TABLE 67 Reduction of human APOE RNA in knock-in mice Compound APOE RNA (% control) No. SPINAL CORD CORTEX PBS 100 100 1449193 65 71 1517770 28 35

Example 14: Design of Modified Oligonucleotides Complementary to Human APOE Nucleic Acid

[0740] Modified oligonucleotides complementary to a human APOE nucleic acid were designed, as described in the tables below. “Start site” indicates the 5′-most nucleoside to which the modified oligonucleotide is complementary in the target nucleic acid sequence. “Stop site” indicates the 3′-most nucleoside to which the modified oligonucleotide is complementary in the target nucleic acid sequence. Each modified oligonucleotide listed in the tables below is 100% complementary to SEQ ID NO: 1 (described herein above), to SEQ ID NO: 2 (described herein above), or to both. ‘N/A’ indicates that the modified oligonucleotide is not 100% complementary to that particular target nucleic acid sequence.

[0741] The modified oligonucleotides in Table 56 are 6-10-4 MOE gapmers. The gapmers are 20 nucleosides in length. The sugar motif for the gapmers is (from 5′ to 3′): eeeeeeddddddddddeeee; wherein each ‘d’ represents a 2′-β-D-deoxyribosyl sugar moiety, and each ‘e’ represents a 2′-MOE modified sugar moiety. The gapmers have an internucleoside linkage motif of (from 5′ to 3′): sooooossssssssssoss; wherein each “s” represents a phosphorothioate internucleoside linkage, and each “o” represents a phosphodiester internucleoside linkage. Each cytosine residue is a 5-methyl cytosine.

TABLE-US-00068 TABLE 68 6-10-4 MOE gapmers with mixed PO/PS internucleoside linkages complementary to human APOE SEQ SEQ SEQ SEQ ID No: ID No: ID No: ID No: Compound 1 Start 1 Stop 2 Start 2 Stop SEQ Number Site Site Site Site Sequence (5′ to 3′) ID NO 1601915 4761 4780 243 262 GCTCCACCTTGGCCTGGCAT 2934 1601916 3430 3449 N/A N/A ACCCATTCCCTATTTAACTC 1462 1601918 3070 3089 N/A N/A CCTGCTATGGCTTACATCCC 1669 1601924 3266 3285 N/A N/A CCCTTCACATTCTAAGCTCC 1188 1601926 3179 3198 N/A N/A CGACGGCTAGCTACCGTGTC  934 1601928 3284 3303 N/A N/A TCTCGCATTCCTCATTCTCC 1832 1601929 2970 2989 N/A N/A GCTGCTTGCCTCACCCCCGC 1376 1601931 4779 4798 261 280 GCTCTGTCTCCACCGCTTGC 1341 1601932 3405 3424 N/A N/A TGGTCTTCTCTTATCTCCCC 1586 1601934 3269 3288 N/A N/A TCTCCCTTCACATTCTAAGC 1705 1601937 3061 3080 N/A N/A GCTTACATCCCAGTCCAGCT 1254 1601938 2973 2992 N/A N/A CCTGCTGCTTGCCTCACCCC 1884 1601940 3297 3316 N/A N/A ATCTCAGTCCCAGTCTCGCA 1897 1601914 4613 4632 N/A N/A AGTCGGTTTAATCACTTGGA 1179 1601919 3424 3443 N/A N/A TCCCTATTTAACTCCCTCCT 1197 1601935 3283 3302 N/A N/A CTCGCATTCCTCATTCTCCC 1219 1601936 3408 3427 N/A N/A TCCTGGTCTTCTCTTATCTC 1322 1601939 3217 3236 N/A N/A TATGAGCTAATTCAGTCCTC 1350 1601945 3220 3239 N/A N/A ATTTATGAGCTAATTCAGTC 1874 1601951 4212 4231 N/A N/A GTCTGGTATTCACTATCTGC  942 1601952 3414 3433 N/A N/A ACTCCCTCCTGGTCTTCTCT 1718 1601954 3403 3422 N/A N/A GTCTTCTCTTATCTCCCCAT 1687 1601960 4206 4225 N/A N/A TATTCACTATCTGCCTGCAA 1385

Example 15: Design of RNAi Compounds with Antisense RNAi Oligonucleotides Complementary to a Human APOE Nucleic Acid

[0742] RNAi compounds comprising antisense RNAi oligonucleotides complementary to a human APOE nucleic acid and sense RNAi oligonucleotides complementary to the antisense RNAi oligonucleotides were designed as follows.

[0743] The RNAi compounds in the tables below consist of an antisense RNAi oligonucleotide and a sense RNAi oligonucleotide. The antisense RNAi oligonucleotide in each case is 23 nucleosides in length; has a sugar motif (from 5′ to 3′) of: efyyyfyyyyyyyfyfyyyyyyy; wherein ‘e’ represents a 2′-MOE modified sugar moiety, each “y” represents a 2′-O-methylribosyl sugar, and each “f” represents a 2′-fluororibosyl sugar; and an internucleoside linkage motif (from 5′ to 3′) of: ssooooooooooooooooooss; wherein ‘o’ represents a phosphodiester internucleoside linkage and ‘s’ represents a phosphorothioate internucleoside linkage. Each antisense RNAi oligonucleotide described in the table below has a 5′-(E)-Vinylphosphonate on the 5′ end of the compound.

[0744] The sense RNAi oligonucleotide in each case is 21 nucleosides in length; has a sugar motif (from 5′ to 3′) of: yyyyyyfyfffyyyyyyyyyy; wherein each “y” represents a 2′-O-methylribosyl sugar, and each “f” represents a 2′-fluororibosyl sugar; and an internucleoside linkage motif (from 5′ to 3′) of: ssooooooooooooooooss; wherein ‘o’ represents a phosphodiester internucleoside linkage and ‘s’ represents a phosphorothioate internucleoside linkage. Each antisense RNAi oligonucleotides is complementary to the target nucleic acid (APOE), and each sense RNAi oligonucleotides is complementary to the first of the 21 nucleosides of the antisense RNAi oligonucleotide (from 5′ to 3′) wherein the last two 3′-nucleosides of the antisense RNAi oligonucleotides are not paired with the sense RNAi oligonucleotide (are overhanging nucleosides). Further, the RNAi sense oligonucleotides are conjugated to a [3nC7-C16] moiety at the 3′ end. “[3nC7-C16]” represents a palmitate moiety linked to a 3′-C7 amino modifier, as shown below, which is attached to the 3′-nucleoside via a phosphodiester linkage.

##STR00012##

[0745] “Start site” indicates the 5′-most nucleoside to which the modified oligonucleotide is complementary in the target nucleic acid sequence. “Stop site” indicates the 3′-most nucleoside to which the modified oligonucleotide is complementary in the target nucleic acid sequence. Each modified antisense RNAi oligonucleoside listed in the tables below is complementary to SEQ ID NO: 2 (described herein above), with a single mismatch to SEQ ID NO: 2 (described herein above) located at position 1 on 5′ end of the antisense strand. The non-complementary nucleobase is marked in the Antisense Sequence column in

TABLE-US-00069 TABLE 69A RNAi compounds targeting human APOE SEQ ID SEQ ID Anti- NO: 2 NO: 2 sense Anti- Anti- RNAi SEQ sense sense Compound Oligo Antisense ID Start Stop Number ID Sequence (5′ to 3′) NO Site Site 1642901 1628239 AUCUUUAUUAAACUAGGGUCCA 2935 1257 1278 1644690 1628956 AACUUGGUGAAUCUUUAUUAAA 2936 1267 1288 1644691 1628970 GACAGGGUCUCCCGCUGCAGGC 2937 1211 1232 1644692 1628972 AGGGUCUCCCGCUGCAGGCUGC 2938 1208 1229 1644693 1628974 GCUCGAACCAGCUCUUGAGGCG 2939 1030 1051

TABLE-US-00070 TABLE 69B RNAi compounds targeting human APOE Sense SEQ Compound RNAi Sense ID Number oligo ID Sequence (5′ to 3′) NO 1642901 1628318 GACCCUAGUUUAAUAAAGAUA 2940 1644690 1640442 UAAUAAAGAUUCACCAAGUUA 2941 1644691 1640443 CUGCAGCGGGAGACCCUGUCA 2942 1644692 1640444 AGCCUGCAGCGGGAGACCCUA 2943 1644693 1640445 CCUCAAGAGCUGGUUCGAGCA 2944

Example 16: Activity of Modified Oligonucleotides and RNAi Compounds that Target Human APOE in Knock-In Mice

[0746] ApoE4 knock-in mice (C57BL/6NTac-Apoeem7250_A-C03(APOE)Tac) were obtained from Taconic Biosciences. APOE knock-in mice were divided into groups of 2 mice each. Each mouse received a single ICV bolus of 300 μg of modified oligonucleotide or a single ICV bolus of 300 μg of RNAi compound. A group of 4 mice received a single ICV bolus with PBS as a negative control.

[0747] Two weeks post treatment, mice were sacrificed and RNA was extracted from cortical brain tissue, and spinal cord for quantitative real-time RTPCR analysis of RNA expression of APOE using primer probe set RTS3073 (described herein above). Results are presented as percent change of RNA, relative to PBS control, normalized to mouse cyclophilin A (% control). Mouse cyclophilin A was amplified using primer probe set m_cyclo24 (designated herein above).

[0748] As shown in the table below, treatment with modified oligonucleotides resulted in reduction of APOE RNA in comparison to the PBS control.

TABLE-US-00071 TABLE 70 Reduction of human APOE RNA in knock-in mice Compound APOE RNA (% control) No. SPINAL CORD CORTEX 1601915 75 93 1601916 110 95 1601918 90 92 1601924 114 100 1601926 117 91 1601928 103 96 1601929 118 100 1601931 78 80 1601932 82 89 1601934 118 98 1601937 87 79 1601938 201 166 1601940 95 70

TABLE-US-00072 TABLE 71 Reduction of human APOE RNA in knock-in mice Compound APOE RNA (% control) No. SPINAL CORD CORTEX PBS 100  100  1601914 74 79 1601919 87 89 1601935 53 69 1601936 88 92 1601939 85 91 1601945 104  102  1601951 58 82 1601952 100  98 1601954 81 78 1601960 82 67 1642901  4 13 1644690  3‡  5‡ 1644691 15 62 1644692 17 47 ‡Fewer than 2 samples available

TABLE-US-00073 TABLE 72 Reduction of human APOE RNA in knock-in mice Compound APOE RNA (% control) No. SPINAL CORD CORTEX 1644693 12 76 1644690 5 28