PROTEINS AND BIOLOGICAL MATERIALS RELATED TO RICE (Oryza sativa L.) YIELD, AND USE THEREOF IN RICE YIELD INCREASE

20230365985 · 2023-11-16

    Inventors

    Cpc classification

    International classification

    Abstract

    The invention discloses proteins and biological materials related to rice (Oryza sativa L.) yield, and use thereof in increasing rice yield. The protein related to rice yield disclosed by the invention is OsDREB1C having SEQ ID NO: 1 in the Sequence Listing as its sequence, and having SEQ ID NO: 2 in the Sequence Listing as its coding gene sequence. Experiments have demonstrated that OsDREB1C and the associated biological materials thereof of the invention can enhance the photosynthetic efficiency of a plant, promote nitrogen uptake and transport and increase the nitrogen content in the plant and in its grains, promote earlier heading, and improve yield. The OsDREB1C and the associated biological materials thereof of the invention are of great biological significance and industrial value, and find bright prospects for application.

    Claims

    1. A protein, or a material that regulates the activity or content of the protein for use in any of the following: D1) regulation of yield of a plant; D2) preparation of a product that regulates yield of a plant; D3) regulation of photosynthesis and yield of a plant; D4) preparation of a product that regulates photosynthesis, and yield of plant; D5) regulation of nitrogen uptake or transport in, photosynthesis and yield of a plant; D6) preparation of a product that regulates nitrogen uptake or transport in, photosynthesis and yield of a plant; D7) regulation of nitrogen content in, photosynthesis and yield of a plant; D8) preparation of a product that regulates nitrogen content in, photosynthesis and yield of a plant; D9) regulation of nitrogen uptake or transport in, photosynthesis, blooming stage, and yield of a plant; D10) preparation of a product that regulates nitrogen uptake or transport in, photosynthesis, blooming stage and yield of a plant; D11) regulation of nitrogen content in, photosynthesis, blooming stage and yield of a plant; D12) preparation of a product that regulates nitrogen content in, photosynthesis, blooming stage and yield of a plant; D13) breeding of a plant; the protein is A1), A2), A3) or A4), as follows: A1) a protein having an amino acid sequence of SEQ ID NO: 1; A2) a protein obtained by subjecting the amino acid sequence shown in SEQ ID NO: 1 in the Sequence Listing to substitution and/or deletion and/or addition of one or more amino acid residues and having the same function; A3) a protein derived from rice, maize, sorghum, soybean, Brassica napus L., Arabidopsis, millet, aegilopsm, Brachypodium distachyon, or wheat, and having 64% or more identity with SEQ ID NO: 1 and having the same function as the protein of A1); A4) a fusion protein obtained by linking a tag to the N-terminus or/and C-terminus of A1) or A2) or A3).

    2. The protein, or the material that regulates the activity or content of the protein according to claim 1, characterized in that, the plant is M1) or M2) or M3): M1) a monocotyledon, or dicotyledon plant; M2) a gramineous plant, a cruciferous plant, or a leguminous plant; M3) rice, wheat, maize, Arabidopsis, Brassica napus L., or soybean.

    3. The protein, or the material that regulates the activity or content of the protein according to claim 1, characterized in that, the photosynthesis is reflected in photosynthetic rate, net photosynthetic rate, heat dissipation NPQ, maximum carboxylation efficiency, and/or maximum electron transfer rate; the transport is reflected in a transport from roots to above-ground parts, or to grains; the nitrogen content is nitrogen content in a plant or in an organ; the blooming stage is reflected in heading stage; the yield is reflected in grain yield, above-ground yield, and/or harvest index.

    4. A biological material associated with the protein of claim 1 for use in any of the following: D1) regulation of yield of a plant; D2) preparation of a product that regulates yield of a plant; D3) regulation of photosynthesis, and yield of a plant; D4) preparation of a product that regulates photosynthesis, and yield of plant; D5) regulation of nitrogen uptake or transport in, photosynthesis and yield of a plant; D6) preparation of a product that regulates nitrogen uptake or transport in, photosynthesis and yield of a plant; D7) regulation of nitrogen content in, photosynthesis and yield of a plant; D8) preparation of a product that regulates nitrogen content in, photosynthesis and yield of a plant; D9) regulation of nitrogen uptake or transport in, photosynthesis, blooming stag and yield of a plant; D10) preparation of a product that regulates nitrogen uptake or transport in, photosynthesis, blooming stage and yield of a plant; D11) regulation of nitrogen content in, photosynthesis, blooming stage and yield of a plant; D12) preparation of a product that regulates nitrogen content in, photosynthesis, blooming stage and yield of a plant; D13) breeding of a plant; the biological material is any of B1) to B9), as follows: B1) a nucleic acid molecule encoding the protein of claim 1; B2) an expression cassette containing the nucleic acid molecule of B1); B3) a recombinant vector containing the nucleic acid molecule of B1), or a recombinant vector containing the expression cassette of B2); B4) a recombinant microorganism containing the nucleic acid molecule of B1), or a recombinant microorganism containing the expression cassette of B2), or a recombinant microorganism containing the recombinant vector of B3); B5) a transgenic plant cell line containing the nucleic acid molecule of B1), or a transgenic plant cell line containing the expression cassette of B2); B6) a transgenic plant tissue containing the nucleic acid molecule of B1), or a transgenic plant tissue containing the expression cassette of B2); B7) a transgenic plant organ containing the nucleic acid molecule of B1), or a transgenic plant organ containing the expression cassette of B2); B8) a nucleic acid molecule for reducing the expression of the protein of claim 1, or with coding gene of the protein of claim 1 knocked out; B9) an expression cassette, a recombinant vector, a recombinant microorganism, a transgenic plant cell line, a transgenic plant tissue, or a transgenic plant organ containing the nucleic acid molecule of B8).

    5. The biological material associated with the protein according to claim 4, characterized in that, the nucleic acid molecule of B1) is b11) or b12) or b13) or b14) or b15), as follows: b11) a cDNA or DNA molecule having a coding sequence of SEQ ID NO: 2 in the Sequence Listing; b12) a cDNA or DNA molecule shown in SEQ ID NO: 2 in the Sequence Listing; b13) a DNA molecule shown in SEQ ID NO: 3 at positions 3001-4131 in the Sequence Listing; b14) a cDNA or DNA molecule having 73% or more identity with the nucleotide sequence defined in b11) or b12) or b13), and encoding the protein, the protein is A1), A2), A3) or A4), as follows: A1) a protein having an amino acid sequence of SEQ ID NO: 1; A2) a protein obtained by subjecting the amino acid sequence shown in SEQ ID NO: 1 in the Sequence Listing to substitution and/or deletion and/or addition of one or more amino acid residues and having the same function; A3) a protein derived from rice, maize, sorghum, soybean, Brassica napus L., Arabidopsis, millet, aegilops, Brackypodium distachvon, or wheat, and having 64% or more identity with SEQ ID NO: 1 and having the same function as the protein of A1); A4) a fusion protein obtained by linking a tag to the N-terminus or/and C-terminus of A1) or A2) or A3); b15) a cDNA or DNA molecule hybridizing with the nucleotide sequence defined in b11) or b12) or b13) or b14) under stringent conditions, and encoding the protein-, the protein is A1), A2), A3) or A4), as follows: A1) a protein having an amino acid sequence of SEQ ID NO: 1; A2) a protein obtained by subjecting the amino acid sequence shown in SEQ ID NO: 1 in the Sequence Listing to substitution and/or deletion and/or addition of one or more amino acid residues and having the same function; A3) a protein derived from rice, maize, sorghum, soybean, Brassica napus L., Arabidopsis, millet, aegilops, Brachypodium distachvon, or wheat, and having 64% or more identity with SEQ ID NO: 1 and having the same function as the protein of A1); A4) a fusion protein obtained by linking a tag to the N-terminus or/and C-terminus of A1) or A2) or A3); the expression cassette of B2) is b21) or b22) or b23), as follows: b21) a DNA molecule shown in SEQ ID NO: 3 in the Sequence Listing; b22) a DNA molecule having 73% or more identity with, and the same function as the nucleotide sequence defined in b21); b23) a DNA molecule hybridizing, under stringent conditions, with and having the same function as the nucleotide sequence defined in b21) or b22).

    6. The biological material associated with the protein according to claim 4, characterized in that, the plant is M1) or M2) or M3): M1) a monocotyledon, or dicotyledon plant; M2) a gramineous plant, a cruciferous plant, or a leguminous plant; M3) a rice, a wheat, a maize, an Arabidopsis, a Brassica napus L., or a soybean.

    7. The biological material associated with the protein according to claim 4, characterized in that, the photosynthesis is reflected in photosynthetic rate, net photosynthetic rate, heat dissipation NPQ, maximum carboxylation efficiency, and/or maximum electron transfer rate; the transport is reflected in a transport from roots to above-ground parts, or to grains; the nitrogen content is nitrogen content in a plant or in an organ; the blooming stage is reflected in heading stage; the yield is reflected in grain yield, above-ground yield, and/or harvest index.

    8. The biological material associated with the protein according to claim 4, characterized in that, the plant is M1) or M2) or M3): M1) a monocotyledon, or dicotyledon plant; M2) a gramineous plant, a cruciferous plant, or a leguminous plant; M3) rice, wheat, maize, Arabidopsis, Brassica napus L., or soybean; the photosynthesis is reflected in photosynthetic rate, net photosynthetic rate, heat dissipation NPQ, maximum carboxylation efficiency, and/or maximum electron transfer rate; the transport is reflected in a transport from roots to above-ground parts, or to grains; the nitrogen content is nitrogen content in a plant or in an organ; the blooming stage is reflected in heading stage; the yield is reflected in grain yield, above-ground yield, and/or harvest index.

    9. Any of the methods as follows: X1) a method for breeding a plant with increased yield, comprising expressing the protein of claim 1 in a recipient plant, or increasing the content or activity of the protein of claim 1 in the recipient plant to obtain a target plant with increased yield; X2) a method for breeding a plant with decreased yield, comprising lowering the content or activity of OsDREB1C in a recipient plant, or inhibiting the expression of OsDREB1C coding gene in the recipient plant to obtain a target plant with decreased yield compared to the recipient plant; X3) a method for breeding a plant with enhanced photosynthesis and increased yield, comprising expressing the protein of claim 1 in a recipient plant, or increasing the content or activity of the protein of claim 1 in the recipient plant to obtain a target plant with enhanced photosynthesis and increased yield; X4) a method for breeding a plant with enhanced photosynthesis, enhanced nitrogen uptake or transport capability, and increased yield, comprising expressing the protein of claim 1 in a recipient plant, or increasing the content or activity of the protein of claim 1 in the recipient plant to obtain a target plant with enhanced photosynthesis, enhanced nitrogen uptake or transport capability, and increased yield; X5) a method for breeding a plant with enhanced photosynthesis, increased nitrogen content, and increased yield, comprising expressing the protein of claim 1 in a recipient plant, or increasing the content or activity of the protein of claim 1 in the recipient plant to obtain a target plant with enhanced photosynthesis, increased nitrogen content, and increased yield; X6) a method for breeding a plant with enhanced photosynthesis, enhanced nitrogen uptake or transport capability, earlier blooming stage, and increased yield, comprising expressing the protein of claim 1 in a recipient plant, or increasing the content or activity of the protein of claim 1 in the recipient plant to obtain a target plant with enhanced photosynthesis, enhanced nitrogen uptake or transport capability, earlier blooming stage, and increased yield; X7) a method for breeding a plant with enhanced photosynthesis, increased nitrogen content, earlier blooming stage, and increased yield, comprising expressing the protein of claim 1 in a recipient plant, or increasing the content or activity of the protein of claim 1 in the recipient plant to obtain a target plant with enhanced photosynthesis, increased nitrogen content, earlier blooming stage, and increased yield.

    10. The method according to claim 9, characterized in that, the method of X1) - X7) is realized by introducing the coding gene of the protein of into the recipient plant and expressing the coding gene; the protein is A1), A2), A3) or A4), as follows: A1) a protein having an amino acid sequence of SEQ ID NO: 1; A2) a protein obtained by subjecting the amino acid sequence shown in SEQ ID NO: 1 in the Sequence Listing to substitution and/or deletion and/or addition of one or more amino acid residues and having the same function; A3) a protein derived from rice, maize, sorghum, soybean, Brassica napus L., Arabidopsis, millet, aegilops, Brachypodium distachyon, or wheat, and having 64% or more identity with SEQ ID NO: 1 and having the same function as the protein of A1); A4) a fusion protein obtained by linking a tag to the N-terminus or/and C-terminus of A1) or A2) or A3).

    11. The method according to claim 10, characterized in that, the coding gene is the nucleic acid molecule encoding the protein; the protein is A1), A2), A3) or A4), as follows: A1) a protein having an amino acid sequence of SEQ ID NO: 1; A2) a protein obtained by subjecting the amino acid sequence shown in SEQ ID NO: 1 in the Sequence Listing to substitution and/or deletion and/or addition of one or more amino acid residues and having the same function; A3) a protein derived from rice, maize, sorghum, sovbean, Brassica napus L., Arabidopsis, millet, aegilops, Brachypodium distachyon, or wheat, and having 64% or more identity with SEQ ID NO: 1 and having the same function as the protein of A1); A4) a fusion protein obtained by linking a tag to the N-terminus or/and C-terminus of A1) or A2) or A3).

    12. The method according to claim 9, characterized in that, the plant is M1) or M2) or M3): M1) a monocotyledon, or dicotyledon plant; M2) a gramineous plant, a cruciferous plant, or a leguminous plant; M3) rice, wheat, maize, Arabidopsis, Brassica napus L., or soybean.

    13. The method according to claim 9, characterized in that, the photosynthesis is reflected in photosynthetic rate, net photosynthetic rate, heat dissipation NPQ, maximum carboxylation efficiency, and/or maximum electron transfer rate; the transport is reflected in a transport from roots to above-ground parts, or to grains; the nitrogen content is nitrogen content in a plant or in an organ; the blooming stage is reflected in heading stage; the yield is reflected in grain yield, above-ground yield, and/or harvest index.

    14. The method according to claim 9, characterized in that, the plant is M1) or M2) or M3): M1) a monocotyledon, or dicotyledon plant; M2) a gramineous plant, a cruciferous plant, or a leguminous plant; M3) rice, wheat, maize, Arabidopsis, Brassica napus L., or soybean; the photosynthesis is reflected in photosynthetic rate, net photosynthetic rate, heat dissipation NPQ, maximum carboxylation efficiency, and/or maximum electron transfer rate; the transport is reflected in a transport from roots to above-ground parts, or to grains; the nitrogen content is nitrogen content in a plant or in an organ; the blooming stage is reflected in heading stage; the yield is reflected in grain yield, above-ground yield, and/or harvest index.

    15. A product having any of the following functions D1) -D6), comprising the protein of claim 1: D1) regulation of yield of a plant; D2) regulation of photosynthesis and yield of a plant; D3) regulation of nitrogen uptake or transport in, photosynthesis and yield of a plant; D4) regulation of nitrogen content in, photosynthesis and yield of a plant; D5) regulation of nitrogen uptake or transport in, photosynthesis, blooming stage and yield of a plant; D6) regulation of nitrogen content in, photosynthesis, blooming stage and yield of a plant.

    16. The product according to claim 15, characterized in that, the plant is M1) or M2) or M3): M1) a monocotyledon, or dicotyledon plant; M2) a gramineous plant, a cruciferous plant, or a leguminous plant; M3) rice, wheat, maize, Arabidopsis, Brassica napus L., or soybean.

    17. The product according to claim 15, characterized in that, the photosynthesis is reflected in photosynthetic rate, net photosynthetic rate, heat dissipation NPQ, maximum carboxylation efficiency, and/or maximum electron transfer rate; the transport is reflected in a transport from roots to above-ground parts, or to grains; the nitrogen content is nitrogen content in a plant or in an organ; the blooming stage is reflected in heading stage; the yield is reflected in grain yield, above-ground yield, and/or harvest index.

    18. A method for detecting yield traits of rice, comprises: detecting haplotypes of rice to be tested, the haplotypes of the rice being Hap.1, Hap.2 and Hap.3, the Hap. 1 having nucleotides, in sequence, A, A, G, C, A, G, G, C, T, and G at physical positions 1433007, 1433155, 1433229, 1433365, 1433528, 1433919, 1434216, 1434258, 1434486, and 1434806 within the rice reference genome version number Os-Nipponbare-Reference-IRGSP-1.0 (IRGSP-1.0); the Hap. 2 having nucleotides, in sequence, A, G, G, C, T, G, G, C, T, and G at physical positions 1433007, 1433155, 1433229, 1433365, 1433528, 1433919, 1434216, 1434258, 1434486, and 1434806 within the rice reference genome version number Os-Nipponbare-Reference-IRGSP-1.0 (IRGSP-1.0); the Hap. 3 having nucleotides, in sequence, G, G, A, G, T, A, A, T, G, and T at physical positions 1433007, 1433155, 1433229, 1433365, 1433528, 1433919, 1434216, 1434258, 1434486, and 1434806 within the rice reference genome version number Os-Nipponbare-Reference-IRGSP-1.0 (IRGSP-1.0); the yield traits of the rice to be tested are identified according to the following steps: homozygous rice to be tested having Hap. 2 as haplotype has lower yield, homozygous rice to be tested having Hap. 3 as haplotype has higher yield, and homozygous rice to be tested having Hap. 1 as a haplotype is not different from both the homozygous rice to be tested having Hap. 2 as haplotype and the homozygous rice to be tested having Hap. 3 as haplotype in yield; or homozygous rice to be tested having Hap. 2 as haplotype has lower grain yield per plant than that of homozygous rice to be tested having Hap. 3 as haplotype, and homozygous rice to be tested having Hap. 1 as a haplotype is not different from the homozygous rice to be tested having Hap. 2 as haplotype and the homozygous rice to be tested having Hap. 3 as haplotype in the grain yield per plant.

    19. (canceled)

    20. A method for breeding rice, comprising: detecting nucleotides in rice genome DNA at physical positions 1433007, 1433155, 1433229, 1433365, 1433528, 1433919, 1434216, 1434258, 1434486, and 1434806 within the rice reference genome version number Os-Nipponbare-Reference-IRGSP-1.0 (IRGSP-1.0), and selecting the rice having nucleotides, in sequence, A, A, G, C, A, G, G, C, T, and G, or G, G, A, G, T, A, A, T, G, and T at positions 1433007, 1433155, 1433229, 1433365, 1433528, 1433919, 1434216, 1434258, 1434486, and 1434806 as parent plants for breeding.

    21. (canceled)

    22. (canceled)

    Description

    DESCRIPTION OF THE DRAWINGS

    [0130] FIG. 1 shows the results of sequence alignment.

    [0131] FIG. 2 shows the detection of the relative expression level of OsDREB1C gene in transgenic rice, and the sequence detection of a target region of a rice material with the gene knocked out. (A) The relative expression level of OsDREB1C gene; (B) sites for gene editing in rice with Osdreb1c gene knocked out.

    [0132] FIG. 3 shows the photosynthetic parameters for wild-type and transgenic rice plants. A -diurnal variation of photosynthesis; B - diurnal variation of NPQ; C - light response curves; D -CO.sub.2 response curves; E - maximum CO.sub.2 carboxylation efficiency; F - maximum electron transfer rate.

    [0133] FIG. 4 shows the detection of nitrogen uptake and utilization in wild-type and transgenic rice plants. A - .sup.15N content of above-ground parts; B - .sup.15N content in roots; C - .sup.15N uptake efficiency; D - .sup.15N transport efficiency from roots to above-ground parts; E - nitrogen contents in different tissues of rice; F - distribution ratio of nitrogen in different tissues of rice. Grains, straws and leaves are arranged from top to bottom in sequence within the column diagrams of E and F.

    [0134] FIG. 5 shows the detection of BAR gene in transgenic wheat (A), and the relative expression level of OsDREB1C gene in transgenic Arabidopsis thaliana (B).

    [0135] FIG. 6 shows the phenotypes of wild-type and transgenic wheat. (A) The phenotypes of wild-type (Fielder) and transgenic wheat. (B-D) Heading stage (B), photosynthetic rate (C), grain number (D), 1000-grain weight (E), and grain yield per plant (F) of wild-type and transgenic lines.

    [0136] FIG. 7 shows the phenotypic characteristics of wild-type and transgenic Arabidopsis thaliana. (A) The phenotypes of wild-type Col-0 and transgenic lines of Arabidopsis thaliana. (B-D) Bolting stage (B), number of rosette leaves (C), and above-ground fresh weight (D) of the wild-type and transgenic lines of Arabidopsis thaliana.

    [0137] *P < 0.05, **P < 0.01.

    [0138] FIG. 8 is sequence analysis for three haplotypes.

    [0139] FIG. 9 is analysis of yields of three haplotypes. The vertical coordinate represents grain yield per plant, with Hap1, Hap2 and Hap3 representing Hap.1, Hap.2 and Hap.3. Different letters indicate significant differences between haplotypes (P<0.05, Duncan multiple range test).

    BEST MODES OF CARRYING OUT THE EMBODIMENTS

    [0140] The invention is further described in detail below in combination with specific embodiments. The examples are provided only for the purpose of illustrating the invention, without limiting the scope of the invention. The examples provided below can be used as a guide for an ordinary skilled in the art for further improvement, and do not constitute a limitation to the invention in any way.

    [0141] The experimental methods in the following examples, unless otherwise specifically stated, are routine methods, which are carried out in accordance with the techniques or conditions described in the literatures in the art, or in accordance with the product’s instructions. The materials, reagents, instruments used in the following examples are all commercially available, unless otherwise specifically indicated. The quantitative assays in the following examples are all repeated in triplicate, the results of which are averaged. In the following examples, unless otherwise specifically specified, the first position of each nucleotide sequence in the Sequence Listing is the 5′-terminal nucleotide of the respective DNA/RNA, and the last position is the 3′-terminal nucleotide of the respective DNA/RNA.

    [0142] The biological material, pBWA(V)HS vector (Zhao et al., DEP1 is involved in regulating the carbon-nitrogen metabolic balance to affect grain yield and quality in rice (Oriza sativa L.), PLOS ONE, Mar. 11, 2019, https.//doi.org/10.1371/journal.pone.0213504) in the following examples is available to the general public from the applicant, the biological material is merely intended to be used for replicating the relevant experiments in the invention and by no means for other purposes.

    [0143] The biological material, psgR-Cas9-Os containing plasmid (Xuejiao Hu, Jia Yang, Can Cheng, Jihua Zhou, Fu’an Niu, Xinqi Wang, Meiliang Zhang, Liming Cao, Huangwei Chu. Targeted Editing of Rice SDl Gene Using CRISPR/Cas9 System. Chinese Journal of Rice Science, 2018, 32(3): 219-225; Mao Y, Zhang H, Xu N, Zhang B, Gou F, Zhu J K. Application of the CRISPR-Cas system for efficient genome engineering in plants. Mol Plant, 2013, 6(6): 2008-2011.) in the following examples is available to the general public from the applicant, the biological material is merely intended to be used for replicating the relevant experiments in the invention and by no means for other purposes.

    Example 1: OsDREBIC Can Function To Enhance Photosynthetic Efficiency, Facilitate Nitrogen Uptake, Promote Early Heading, and Increase Yield of Rice.

    [0144] This example provides a protein from rice Nipponbare, which can function to enhance the photosynthetic efficiency, facilitate nitrogen uptake, promote early heading, and increase yield of rice, referred to as OsDREB1C, sequence of which is shown as SEQ ID NO: 1 in the Sequence Listing. In Nipponbare, the coding gene sequence of OsDREB1C is SEQ ID NO: 2, and the genome sequence is at positions 3001-4131 of SEQ ID NO: 3. In SEQ ID NO: 3, positions 1-3000 are the promoter of OsDREB1C gene in the genomic DNA of Nipponbare.

    [0145] The sequence alignment between rice OsDREB1C and homologous proteins in other plants reveals that the rice OsDREBIC has 73.52%, 64.06%, 66.52%, 66.05%, 66.05% and 65.88% identity with that from millet (Setaria italic), maize (Zea mays), sorghum (Sorghum bicolor), Aegilops tauschii, wheat (Triticum aestivum) and Brachypodium distachyon, respectively (FIG. 1).

    1. Construction of a Recombinant Vector

    [0146] Construction of an overexpression vector: PCR products containing full-length CDS of OsDREB1C gene were obtained by amplifying from cDNA of rice Nipponbare by PCR. The resulting PCR products were cleaved with BsaI (Eco31I) alone, and the resulting enzymatically cleaved products were linked to the vector backbone of the PBWA(V)HS vector obtained by being cleaved with BsaI (Eco31I) alone, to give a recombinant vector with correct sequence, designated as PBWA(V)HS-OsDREBIC. pBWA(V)HS-OsDREBIC is a recombinant vector obtained by inserting the OsDREB1C coding gene shown in SEQ ID NO: 2 in the Sequence Listing at the BsaI (Eco31I) enzyme cleavage of the PBWA(V)HS vector. pBWA(V)HS-OsDREB1C can be driven under CaMV 35S promoter to express the protein encoded by OsDREB1C gene (i.e. the protein OsDREB1C shown in SEQ ID NO: 1).

    [0147] The primer sequences used are as follows: [0148] OsDREB1C-F: 5′-CAGTGGTCTCACAACATGGAGTACTACGAGCAGGAGGAGT-3′ (SEQ ID NO: 4 in the Sequence Listing); [0149] OsDREBIC-R: 5′-CAGTGGTCTCATACATCAGTAGCTCCAGAGTGTGACGTCG-3′ (SEQ ID NO: 5 in the Sequence Listing).

    [0150] Construction of a gene knockout vector: sgRNA and primers were designed on an online design website (http://skl.scau.edu.cn/) to have a target sequence determined as 5′-AGTCATGCCCGCACGACGC-3′ (positions 356-374 in SEQ ID NO: 2). OsDREBIC-sgRNA-F and OsDREBIC-sgRNA-R were annealed, the resulting products were cleaved by BsaI, and the resulting enzymatically cleaved products were linked to the vector backbone of the psgR-Cas9-Os containing plasmid obtained by being cleaved with BsaI, to give a recombinant vector with correct sequence, an OsDREB1C gene knockout vector, designated as OsU3-sgRNA-OsUBI-Cas9-OsDREBIC. In this recombinant vector, OsU3 promoter drove sgRNA, and OsUBI promoter drove Cas9.

    [0151] In the above, the primer sequences used are as follows: [0152] OsDREBIC-sgRNA-F: 5′-TGTGTGGCGTCGTGCGGGCATGACT-3′ (SEQ ID NO: 6 in the Sequence Listing); [0153] OsDREBIC-sgRNA-R: 5′-AAACAGTCATGCCCGCACGACGCCA-3′ (SEQ ID NO: 7 in the Sequence Listing).

    2. Construction of a Transgenic Plant

    [0154] After disinfecting the mature seeds of Nipponbare, a cultivar of Oryza sativa subsp. Keng of rice, they were induced to provide embryogenic callus. PBWA(V)HS-OsDREBIC and OsU3-sgRNA-OsUBI-Cas9-OsDREBIC obtained in step 1 were introduced into Agrobacterium EHA105, respectively. The callus was transfected and co-cultured with Agrobacterium using a genetic transformation method for rice, mediated by Agrobacterium, to provide a transgenic plant upon resistance screening. The screened transgenic rice derived from PBWA(V)HS-OsDREBIC is an OsDREB1C transgenic rice, and the transgenic rice derived from OsU3-sgRNA-OsUBI-Cas9-OsDREBIC is an OsDREB1C gene knockout rice material.

    [0155] The relative expression levels of OsDREB1C gene at RNA level in the OsDREB1C transgenic rice and the OsDREB1C gene knockout rice were detected by qRT-PCR assay using Nipponbare (WT), a cultivar of Oryza sativa subsp. japonica (Geng) of rice as a control. The primers used were: 5′-CATGATGATGCAGTACCAGGA-3′ (SEQ ID NO: 8 in the Sequence Listing), 5′-GATCATCAGTAGCTCCAGAGTG-3′ (SEQ ID NO: 9 in the Sequence Listing); the internal reference gene is rice Ubiquitin, and the primers for the internal reference gene are: 5′-AAGAAGCTGAAGCATCCAGC-3′ (SEQ ID NO: 10 in the Sequence Listing), 5′-CCAGGACAAGATGATCTGCC-3′ (SEQ ID NO: 11 in the Sequence Listing).

    [0156] The results showed that the relative expression level of OsDREB1C gene in each of three lines (OE1, OE2 and OE5) of the OsDREB1C transgenic rice was significantly higher than that of the wild type (WT), and the three lines were rice materials that overexpress OsDREB1C (A of FIG. 2). The presence of base deletion or insertion in the sequence of OsDREB1C gene in three lines (KO1, KO2 and KO3) of the OsDREB1C gene knockout rice material caused frame shift mutation, thereby resulting in loss of normal function of the OsDREB1C protein (B of FIG. 2).

    [0157] PCR amplification and sequencing were carried out on the three lines (KO1, KO2 and KO3) of the OsDREB1C gene knockout rice material using primers that can amplify the target sequence, as well as the upstream and downstream sequences thereof. The results showed the changes of the target sequence in the three lines, as shown in B of FIG. 2: deletion of one nucleotide occurred in both KO1 and KO2, insertion of one nucleotide occurred in KO3, and frame shift mutations occurred in each of the target genes of the three lines.

    3. Enhancement of Photosynthetic Efficiency in OsDREB1C Transgenic Rice

    [0158] The photosynthesis indexes of field-grown rice were measured. The rice to be tested: wild-type rice Nipponbare (WT), OsDREB1C overexpressing rice (OE1/OE2/OE5), and OsDREB1C gene knockout rice (KO1/ KO2/ KO3).

    [0159] The flag leaves of the rice to be tested at heading stage were measured using LICOR-6400XT Portable Photosynthesis System (LI-COR, USA) for diurnal variation of photosynthesis, light response curves, and CO.sub.2 response curves, respectively, which reflected the photosynthetic capacity of a plant. The diurnal variation of photosynthesis was measured once every 2-4 hours from 8:00 to 16:00 in sunny and cloudless weather. The photosynthetic rate was measured using LICOR-6400XT Portable Photosynthesis System, and NPQ (non-photochemical quenching) was measured using FluorPen FP100 (PSI, Czech), where the leaves needed to be in dark adaptation for 15-20 minutes prior to NPQ measurement. In the measurement of light response curves, the CO.sub.2 was set at a concentration of 400 .Math.mol mol.sup.-1, and the light intensity (PPFD) at 0 to 2000 .Math.mol m.sup.-2s.sup.-1. In the measurement of CO.sub.2 response curves, PPFD was set at 1200 .Math.mol m.sup.-2 s.sup.-1, and CO.sub.2 concentration decreased from 400 to 50 .Math.mol mol.sup.-1, then increased from 400 .Math.mol mol.sup.-1 to 1200 .Math.mol mol.sup.-1 again. Both light response curves and CO.sub.2 response curves were fitted by Farquhar-von Caemmerer-Berry (FvCB) model, and maximum carboxylation efficiency (V.sub.max) and maximum electron transfer rate (J.sub.max) were calculated from the CO.sub.2 response curves.

    [0160] The results showed that the photosynthetic efficiency (i.e. photosynthesis efficiency) of OsDREB1C overexpressing rice was each significantly higher than that of the wild type in the daytime, with a peak in the difference at noon when the light intensity was highest, from which a significant level was observed — an increase by 29.5-43.3% compared with the wild type. At the same time, NPQ which involves consumption of heat dissipation of excess absorbed energy was significantly lower than that in the wild type (A, B in FIG. 3, and Tables 1 and 2), and the differences each reached a significant level, suggesting that more light energy was involved in photosynthesis. Further, the measurements of light response curves and CO.sub.2 response curves showed that when the light intensity was less than 200 .Math.mol m.sup.-2 s.sup.-1, there is no significant difference in net photosynthetic rate between the OsDREB1C overexpressing rice and the wild-type rice, while a gradually growing difference was observed under high light intensity - an increase in the photosynthetic rate, under the light intensity of 2000 .Math.mol m.sup.-2 s.sup.-1, of the OsDREB1C overexpressing rice by 18.4-27.6% compared with the wild type (C in FIG. 3, and Table 3) - the difference has reached a significant level. The measurement of CO.sub.2 response curves was similar to that of light response curves, the photosynthetic rate of OsDREB1C overexpressing rice was significantly higher than that of the wild type when CO.sub.2 concentration was greater than 400 .Math.mol mol.sup.-1 (D in FIG. 3, and Table 4). Further calculation showed that both the maximum carboxylation efficiency (V.sub.cmax) and maximum electron transfer rate (J.sub.max) were significantly higher than that of the wild type (E, F in FIG. 3, and Table 5). Still, photosynthesis associated parameters for the OsDREB1C gene knockout rice were lower than, or close to those of the wild type. The above results indicate that, overexpression of OsDREB1C gene in rice can significantly enhance both light use efficiency and CO.sub.2 assimilation capability.

    TABLE-US-00002 Measurements of Photosynthetic Efficiency (.Math.mol CO.sub.2 m.sup.-2s.sup.-1) Time WT OE1 OE2 OE5 KO1 KO2 KO3 8:00 21.59±1.42 22.78±1.08 25.51±1.76.sup.∗∗ 25.53±0.80.sup.∗∗ 18.44±0.80 19.35±1.49.sup.∗ 20.41±0.70 10:00 20.78±2.53 23.94±1.41 .sup.∗ 26.26±0.49.sup.∗∗ 27.18:1:1.69.sup.∗∗ 21.88±1.42 20.49±2.43 19.74±1.83 13:00 14.07±0.95 20.16±0.80.sup.∗∗ 20.12±0.76.sup.∗∗ 18.22±0.63.sup.∗∗ 13.77±1.19 12.81±1.31 13.41:1:2.29 16:00 13.44±1.59 18.08±1.79.sup.∗∗ 19.03±2.09.sup.∗∗ 16.78:1:1.57.sup.∗∗ 14.00+2.61 .sup.∗ 11.44±0.79 .sup.∗ 11.55±0.91 .sup.∗ In Table 1, compared with WT at the same place in the same year, .sup.∗indicates that the difference has reached a significant level (p < 0.05); .sup.∗∗indicates that the difference has reached an extremely significant level (p < 0.01).

    TABLE-US-00003 Measurements of NPQ Time WT OE1 OE2 OE5 KO1 KO2 KO3 8:00 3.12±0.76 0.25±0.13.sup.∗∗ 1.03±0.74.sup.∗∗ 0.89±0.58.sup.∗∗ 1.60±0.25.sup.∗ 2.96±0.32 2.50±0.57 10:00 3.97±0.28 1.36±0.64.sup.∗∗ 2.05±0.43.sup.∗∗ 1.21±0.74.sup.∗∗ 2.85±0.21.sup.∗∗ 3.78±0.53 3.75±0.54 12:00 3.45±0.07 1.83±0.23.sup.∗∗ 2.26±0.33.sup.∗∗ 1.72±0.25.sup.∗∗ 4.23±0.47.sup.∗ 3.67±0.44 3.66±0.80 14:00 3.62±0.20 1.58±0.80.sup.∗ 1.65:1:1.13.sup.∗ 1.98:1:1.05.sup.∗ 3.32±0.45 4.23±0.72 3.95±1.19 16:00 2.70±0.24 0.23±0.12.sup.∗∗ 0.95±0.73* 0.76±0.65.sup.∗∗ 2.65±0.66 2.82±0.67 2.82±0.31 18:00 0.28±0.33 0.06±0.07 0.01±0.02 0.45±0.51 1.63±0.24.sup.∗∗ 1.62±0.49 1.28±0.43.sup.∗ In Table 2, compared with WT at the same place in the same year, .sup.∗indicates that the difference has reached a significant level (p < 0.05); .sup.∗∗indicates that the difference has reached an extremely significant level (p < 0.01).

    TABLE-US-00004 Measurements of Light Response Curves Light Intensity (umol m.sup.-25.sup.-1) WT OE1 OE2 OE5 KO1 KO2 KO3 0 -1.994±0.20 -2.20±4.47 -1.41±0.026.sup.∗ -1.70±0.26 -2.22±0.40 -1.91±0.14 -1.48±0.33 40 0.69±0.12 0.12±0.63 1.32±0.33 0.85±0.38 0.26±0.79 0.84±0.31 0.88±0.46 60 1.76±0.24 1.20±0.55 2.22±0.52 2.26±0.16.sup.∗ 1.43±0.91 2.10±0.20 2.03±0.27 100 3.80±0.39 3.09±0.59 4.59±0.42 4.17±0.35 3.44±0.98 3.95±0.49 3.73±0.47 200 7.98±0.34 7.95±0.75 9.13±0.51.sup.∗ 9.07±0.68 7.68±1.17 8.22±0.45 8.13±0.59 400 13.79±0.12 14.40±0.91 15.48±0.33.sup.∗∗ 15.94+0.15.sup.∗∗ 13.68±1.45 13.41±0.23 13.03±0.94 600 17.28±0.23 18.70±0.48.sup.∗ 19.25±0.70.sup.∗ 20.28±0.89.sup.∗ 17.38±1.04 16.21±0.24.sup.∗∗ 15.86±0.75 900 19.98±0.56 22.68±0.23.sup.∗∗ 22.47±0.85.sup.∗ 23.79±1.42.sup.∗ 20.35±1.34 18.47±0.38.sup.∗ 18.42±0.62.sup.∗ 1200 21.57±0.57 25.30±0.44.sup.∗∗ 24.76±1.04.sup.∗ 25.50±1.69.sup.∗ 22.16±1.39 19.81±0.42.sup.∗ 19.74±0.66.sup.∗ 1500 22.44±0.53 27.18±0.45.sup.∗∗ 26.13±1.44.sup.∗ 27.17±1.53.sup.∗ 23.35±1.19 20.85±0.29.sup.∗ 20.49±0.67.sup.∗ 2000 23.40±0.60 29.88±0.78.sup.∗∗ 27.72±1.96 28.20±1.46.sup.∗ 24.76±0.85 22.23±0.27 21.39±0.91.sup.∗ In Table 3. compared with WT at the the same year, .sup.∗indicates that the difference has reached a significant level (p < 0.05); .sup.∗∗indicates that the difference has reached an extremely significant level (p <0.01)

    TABLE-US-00005 Measurements of CO.sub.2 Response Curves CO.sub.2 Concentration (.Math.mol m.sup.-2 5.sup.-1) WT OE1 OE2 OE5 KO1 KO2 KO3 50 -1.26±0.25 -1.45±0.63 -0.41±0.13.sup.∗ -1.36±0.22 -1.02±1.09 -1.57±0.55 -0.50±0.40 100 3.06±0.46 3.46±0.58 4.84±0.37.sup.∗∗ 3.74±0.47 2.83±0.33 2.46±1.00 3.95±0.16 200 10.72±0.64 11.86±0.95 15.45±1.22.sup.∗∗ 13.94±0.63.sup.∗∗ 9.56±1.15 10.12±1.51 11.51±0.28 300 17.57±0.64 19.60±0.92.sup.∗ 22.11±2.07 21.52±0.83.sup.∗∗ 15.61±1.46 16.83±1.91 18.11±0.51 400 24.36±0.86 27.03±0.59.sup.∗ 31.28±2.08.sup.∗ 29.76±0.73.sup.∗∗ 21.60±1.85 23.32±1.85 24.21±0.87 600 34.59±1.29 38.73±1.42.sup.∗ 41.39±2.27.sup.∗ 40.57±0.79.sup.∗∗ 33.24±2.83 31.97±1.99 35.02±0.52 800 39.48±0.80 45.07±1.75.sup.∗ 46.65±1.89.sup.∗ 46.29±1.63.sup.∗∗ 37.27±3.56 36.13±1.50 40.44±1.17 1000 42.47±2.04 48.59±1.60.sup.∗ 49.20±1.47.sup.∗ 48.55±2.88.sup.∗ 39.05±3.50 37.60±3.08 42.86±2.08 1200 43.72±2.29 50.73±1.06.sup.∗ 50.24±1.28.sup.∗ 49.99±2.90 39.36±3.09 39.60±2.99 43.57±3.05 In Table 4, compared with WT at the same place in the same year, .sup.∗indicates that the difference has reached a significant level (p < 0.05); .sup.∗∗indicates that the diffiffence has reached an extremely significant level (p < 0.01).

    TABLE-US-00006 Results of Maximum Carboxylation Efficiency (V.sub.cmax) and Maximum Electron Transfer Rate (J.sub.max) Rice Maximum Carboxylation Efficiency (V.sub.cmax) Maximum Electron Transfer Rate (J.sub.max) (.Math.mol m.sup.-2 s.sup.-1) (.Math.mol m.sup.-2 s.sup.-1) WT 64.53±0.13 147.28±9.19 OE1 80.43±6.02.sup.∗ 188.51±11.70.sup.∗∗ OE2 71.73±0.55.sup.∗∗ 168.36±12.19 OE5 78.29±1.01.sup.∗∗ 176.31±10.78.sup.∗ KO1 55.84±5.16 122.29±13.20 KO2 63.90±1.66 142.99±5.71 KO3 63.95±6.51 142.65±11.51

    4. Increase in Nitrogen Use Efficiency in OsDREB1C Transgenic Rice

    [0161] Rice was measured for nitrogen use efficiency. The rice to be tested: wild-type rice Nipponbare (WT), OsDREB1C overexpressing rice (OE1/OE2/OE5), and OsDREB1C gene knockout rice (KO1/ KO2/ KO3).

    [0162] Rice seedlings to be tested, which were hydroponically cultured in a greenhouse for 3 weeks, were placed in Kimura B solution without nitrogen (free of (NH.sub.4).sub.2SO.sub.4 and KNO.sub.3) in advance for nitrogen starvation treatment for 3 days. After the nitrogen starvation treatment, the roots of the seedlings were completely immersed in 0.1 mM CaSO.sub.4 solution (deionized water as the solvent) for 1 minute before the residual water was sucked up, and then they were cultured by placing the roots in a nutrient solution containing 0.5 mM K.sup.15NO.sub.3. 3 hours later, the roots of the seedlings were again immersed in 0.1 mM CaSO.sub.4 solution for 1 minute, after which the residual water was sucked up, followed by collecting the respective above-ground parts and roots for dryness at 70° C. for 3 days to constant weights, and the dry weights of the samples were recorded. After the samples were ground and crushed, .sup.15N contents in the respective above-ground parts and roots were measured using IsoPrime 100 stable isotope ratio mass spectrometer (Elementar, Germany), and nitrogen uptake efficiency and nitrogen transport efficiency were calculated. Nitrogen uptake efficiency = (.sup.15N contents in above-ground parts + .sup.15N contents in roots) / dry weights of roots / 3; Nitrogen transport efficiency = .sup.15N contents in above-ground parts / .sup.15N contents in roots.

    [0163] In addition, mature rice plants to be tested grown in Beijing field were harvested, and leaves, straws and grains of a single plant were taken for kill-green at 105° C. for 30 minutes and dried at 70° C. for 3 days. After the samples were ground and crushed, nitrogen contents were separately measured using IsoPrime 100 stable isotope ratio mass spectrometer (Elementar, Germany), and distribution ratios of nitrogen in different parts were calculated.

    [0164] The nutrient solutions used were as follows:

    [0165] Nutrient solution: Kimura B nutrient solution (0.5 mM (NH.sub.4).sub.2SO.sub.4, 1 mM KNO.sub.3, 0.54 mM MgSO.sub.4.Math.7H.sub.2O, 0.3 mM CaCl.sub.2, 0.18 mM KH.sub.2PO.sub.4, 0.09 mM K.sub.2SO.sub.4, 16 .Math.M Na.sub.2SiO.sub.3.Math.9H.sub.2O, 9.14 .Math.M MnCl.sub.2.Math.4H.sub.2O, 46.2 .Math.M Na.sub.2MoO.sub.4.Math.2H.sub.2O, 0.76 .Math.M ZnSO.sub.4.Math.7H.sub.2O, 0.32 .Math.M CuSO.sub.4.Math.5H.sub.2O, 40 .Math.M Fe(II)-EDTA, pH= 5.8).

    [0166] Nutrient solution containing 0.5 mM K.sup.15NO.sub.3: Kimura nutrient solution without nitrogen which has been incorporated a dilution of 0.5 M K.sup.15NO.sub.3 stock solution by 1000-fold (0.54 mM MgSO.sub.4.Math.7H.sub.2O, 0.3 mM CaCl.sub.2, 0.18 mM KH.sub.2PO.sub.4, 0.09 mM K.sub.2SO.sub.4, 16 .Math.M Na.sub.2SiO.sub.3.Math.9H.sub.2O, 9.14 .Math.M MnCl.sub.2.Math.4H.sub.2O, 46.2 .Math.M Na.sub.2MoO.sub.4.Math.2H.sub.2O, 0.76 .Math.M ZnSO.sub.4.Math.7H.sub.2O, 0.32 .Math.M CuSO.sub.4.Math.5H.sub.2O, 40 .Math.M Fe(II)-EDTA, pH= 5.8).

    [0167] The results showed that after 3 hours of .sup.15N treatment, .sup.15N contents in above-ground parts and roots of the OsDREB1C overexpressing rice were significantly higher than that of the wild type (A, B of FIG. 4, and Table 6), which was primarily attributed to the significant rise over the wild type in nitrogen uptake efficiency in roots (C of FIG. 4, Table 6), and in transport efficiency of nitrogen from roots to above-ground parts (D of FIG. 4, Table 6); while the difference between the OsDREB1C gene knockout rice and the wild type was not obvious: its indexes were approximate to that of the wild type, except for a lower .sup.15N uptake efficiency than that of the wild type. Further, analysis of nitrogen distribution in different tissues of a field-grown rice plant suggested a general increase in nitrogen content in a whole plant of OsDREB1C overexpressing rice than in the wild type (E of FIG. 4, Table 7), with 50.3-66.4% of the nitrogen distributed to grains, much higher than 41.1% for the wild type, and 26-38.6% for the OsDREB1C knockout rice (F of FIG. 4, table 7). At the same time, the nitrogen allocated to leaves and straws decreased correspondingly, at 21.1-29.7% and 12.5-19.9%, respectively; while the ratios in the wild type were 42.66% and 16.28%, respectively, with 43.2-49.3% and 18.2-24.7% for the OsDREB1C knockout rice (F of FIG. 4). From the above results, overexpression of OsDREB1C gene in rice can significantly increase the efficiency of nitrogen uptake and transport in a plant, and allocate more nitrogen to grains.

    TABLE-US-00007 Measurements of Indexes of Rice Cultivated in Greenhouse Rice Greenhouse .sup.15N Contents in Above-Ground Parts (.Math.mol .sup.15N/hour/g DW) .sup.15N Contents in Roots (.Math.mol .sup.15N/hour/g DW) .sup.15N Uptake Efficiency Efficiency of .sup.15N Transport from Roots toAbove-Ground Parts WT 1.45±0.18 7.30±2.30 5.00±0.83 0.55±0.06 OE1 2.17±0.10.sup.∗∗ 11.50±0.69.sup.∗ 6.46±0.94.sup.∗ 0.74±0.20 OE2 2.20±0.30.sup.∗∗ 10.95±1.05.sup.∗ 6.33±0.74.sup.∗ 0.73±0.14.sup.∗ OE5 2.43±0.15.sup.∗∗ 13.81±0.34.sup.∗∗ 7.75±0.61.sup.∗∗ 0.68±0.09.sup.∗ KO1 1.45±0.38 7.96±0.58 4.24±0.62 0.59±0.15 KO2 1.66±0.17 7.67±0.50 4.27±0.53 0.67±0.12 KO3 1.53±0.22 9.39±0.90 5.10±0.55 0.63±0.04 In Table 6, compared with WT at the same place in the same year, .sup.∗indicates that the difference has reached a significant level (p < 0.05); .sup.∗∗indicates that the difference has reached an extremely significant level (p < 0.01).

    TABLE-US-00008 Measurements of Indexes of Field-Cultivated Rice Rice Nitrogen Contents (g/plant) Nitrogen Distribution Ratio (%) Grains Straws Leaves Grains Straws Leaves WT 0.30±0.05 0.12±0.01 0.3±0.03 41.06±6.42 16.28±1.61 42.66±5.51 OE1 0.47±0.03.sup.∗ 0.19±0.03 0.28±0.04 50.39±3.12 19.92±2.86 29.69±3.93 OE2 0.52±0.07.sup.∗ 0.09±0.01 0.16±0.01.sup.∗ 66.40±3.19.sup.∗ 12.51±1.60 21.09±1.63.sup.∗ OE5 0.51±0.06.sup.∗ 0.13±0.01 0.18±0.01.sup.∗ 61.92±2.61.sup.∗ 16.15±1.53 21.94±2.01.sup.∗ KO1 0.35±0.05 0.16±0.01.sup.∗∗ 0.38±0.02.sup.∗ 38.59±3.88 18.19±1.04 43.23±2.88 KO2 0.27±0.03 0.15±0.02 0.37±0.04 33.85±2.77 19.25±1.41 46.89±1.48 KO3 0.17±0.03 0.16±0.01.sup.∗∗ 0.31±0.02 26.01±2.61 24.69±0.87.sup.∗∗ 49.30±2.20 In Table 7, compared with WT at the same place in the same year, .sup.∗indicates that the difference has reached a significant level (p < 0.05); .sup.∗∗indicates that the difference has reached an extremely significant level (p < 0.01).

    5. Early Heading Stage of OsDREB1C Transgenic Rice

    [0168] Rice was examined for their heading stages. The rice to be tested: wild-type rice Nipponbare (WT), OsDREB1C overexpressing rice (OE1/OE2/OE5), and OsDREB1C gene knockout rice (KO1/ KO2/ KO3).

    [0169] The heading stage of each rice to be tested was counted under field growing conditions in Beijing. The statistical method was as follows: each type of the rice to be tested was grown in triplicate plots in a random arrangement; the moment when the spikes of 50% of the plants in the plot were unsheathed by ½ of the flag leaf sheaths was recorded as heading; and the heading stage was the days from sowing to heading.

    [0170] The results showed (Table 8) that the heading stage of the OsDREB1C overexpressing rice was substantially advanced than that of the wild type, 13-17 days earlier in 2018 and 17-19 days earlier in 2019, while the heading stage of the OsDREB1C gene knockout rice was 6-8 days and 3-5 days later than that of the wild type, respectively; grain filling and maturity stage of rice was advanced or postponed, correspondingly. This indicated that OsDREB1C and coding gene thereof can regulate the heading stage of rice.

    TABLE-US-00009 Heading Stages of Wild-Type and Transgenic Rice under Field Conditions in Beijing (Days) Rice Year of 2018 Year of 2019 WT 117±1 120.6±0.5 OE1 99.3±0.5 .sup.∗∗ 103±1 .sup.∗∗ OE2 103.3±0.5 .sup.∗∗ 101.3±0.5 .sup.∗∗ OE5 101.6±0.5 .sup.∗∗ 103±1 .sup.∗∗ KO1 123.7±0.58 .sup.∗∗ 124.7±0.58 .sup.∗∗ KO2 123.3±0.58 .sup.∗∗ 124±0 .sup.∗∗ KO3 124.7±0.58 .sup.∗∗ 123.7±0.58 .sup.∗∗ In Table 8, compared with WT at the same place in the same year, .sup.∗∗indicates that the difference has reached an extremely significant level (p < 0.01).

    6. A Substantial Rise in Yield, Quality, and Harvest Index of Field-Grown Transgenic Rice

    [0171] The above-ground dry weight and grain yield of rice were measured. The rice to be tested: wild-type rice Nipponbare (WT), OsDREB1C overexpressing rice (OE1/OE2/OE5), and OsDREB1C gene knockout rice (KO1/ KO2/ KO3).

    [0172] In the field experiments carried out in Beijing and Hainan, separately, each type of the rice to be tested was grown in triplicate plots in a random arrangement. After rice grains were mature, grain yield per plant, grain yield per plot, and dry weight of above-ground straw were measured and a harvest index was calculated. The harvest index was a ratio of the grain yield per plant to the above-ground biomass (the sum of the dry weight of above-ground straw and the grain yield per plant).

    [0173] Measurements of the dry weight of above-ground straw were as follows: after the rice was mature, a single straw with its grains removed was put into a nylon mesh bag and dried to a constant weight at 80° C., and the sample was weighed. 20-30 individual plants were taken from each rice material for repeated tests for statistical analysis.

    [0174] Measurements of the grain yield were as follows: the grain weight obtained by weighing grains from a single rice plant after ear being threshed and shriveled particles being removed is grain yield per plant. 20-30 individual plants were taken from each rice material for repeated tests for statistical analysis. When the plot yield is calculated, edge row was excluded, and grain weight measured from 30 rice plants of middle rows was taken and calculated as yield of one plot, triplicate plots were used for statistical analysis.

    [0175] Determination of rice quality was as follows: rice quality was determined after a natural storage for 3 months of the grains of the rice harvested from Beijing field experiment in 2019. The determination was carried out with reference to the industry standard “NY/T 83-2017 Determination of rice quality” under Ministry of Agriculture of the PRC. The results showed a substantial rise in grain yield of the OsDREB1C overexpressing rice than that of the wild type, with the difference reaching a significant level. At the same time, its above-ground straw weight was markedly lower than that of the wild type, which enables a significantly increased harvest index compared with the wild type.

    [0176] According to result of the yield (Table 9), the yield per plant for the transgenic rice was increased by 45.1-67.6% and 7.8-16%, respectively, compared with that for the wild type, in Beijing and Hainan; the yield in the transgenic rice’s plots was increased by 41.3-68.3% and 11.9-27.4% than that in the wild type’s. At the same time, a decrease of 12.1-24.7% and 17.5-25.8% in the above-ground straw for the transgenic rice compared with the wild type resulted in a significant increase in the harvest index (HI) of the transgenic rice compared with the wild type, with an increase of HI of 10.3-55.7% in Beijing. Meanwhile, the rice quality of the transgenic rice was also elevated, to varying extents, from the wild type (Table 10): the brown rice rate, the milled rice rate and the whole milled rice rate each were significantly higher than that of the wild type, the chalkiness and the chalky grain rate reduced, the appearance quality improved, and the contents of amylose and proteins not significantly affected. Both the yield per plant and the yield per plot for the OsDREB1C knockout rice were significantly lower than that of the wild type, while the above-ground biomass was increased, giving direct rise to a substantial decline of 22.4-37.7% in the harvest index compared with the wild type. It showed that introduction of OsDREB1C gene into rice can substantially increase the yield, rice quality and harvest index of the transgenic rice. OsDREB1C and the coding gene thereof can regulate the grain yield, rice quality and harvest index of rice.

    [0177] The results for each index are shown in Table 9 and Table 10.

    TABLE-US-00010 Yields from Field Experiments in Beijing and Hainan in 2018-2019 Indexes Places WT OE1 OE2 OE5 KO1 KO2 KO3 Dry weight of above-ground straw (g) Beijing 43.14±1.92 38.83±2.21 32.02±1.32 .sup.∗∗ 30.68±1.20 .sup.∗∗ 47.13±2.77 49.26±2.87 54.61±3.65 .sup.∗∗ Hainan 20.53±0.49 23.64±0.73 .sup.∗∗ 16.94±0.48 .sup.∗∗ 15.21±0.61.sup.∗∗ 25.24±0.88 .sup.∗∗ 30.37±0.97 .sup.∗∗ 32.95±1.27 Grain yield per plant (g) Benijing 23.17±1.72 42.87±2.82 .sup.∗∗ 39.30±1.79 .sup.∗∗ 38.70±1.97.sup.∗∗ 19.65±1.92 19.94±1.21 12.40±1.15 .sup.∗∗ 24.73±0.60 28.68±1.17 .sup.∗∗ 27.41±0.78 .sup.∗∗ 26.67±1.32 12.28±0.48 .sup.∗∗ 13.97±1.10 .sup.∗∗ 6.28±0.45 .sup.∗∗ Grain yield per plot (g) Beijing 810.59±27.52 1283.06±111.73 .sup.∗ 1437.65±186.35 .sup.∗ 1404.94±30.07 .sup.∗∗ 713.11±27.67 .sup.∗ 662.47±25.55 .sup.∗∗ 475.54±27.41 .sup.∗∗ Hainan 802.19±35.77 1022.34±39.91 .sup.∗ 940.09±40.94 897.80±85.35 418.69±6.36 .sup.∗∗ 468.84±44.35 .sup.∗∗ 236.92±12.93 .sup.∗∗ Harvest index (HI) Beijing 0.345±0.014 0.521±0.019 .sup.∗∗ 0.549±0.015 .sup.∗∗ 0.554±0.018 .sup.∗∗ 0.285±0.013 .sup.∗∗ 0.289±0.010 .sup.∗∗ 0.187±0.011 .sup.∗∗ Hainan 0.546±0.008 0.544±0.007 0.618±0.006.sup.∗∗ 0.629±0.009 .sup.∗∗ 0.328±0.007 .sup.∗∗ 0.307±0.019 .sup.∗∗ 0.158±0.009 .sup.∗∗ In Table 9, dry weight of above-ground straw is of a single plant but without grains; compared with WT at the same place in the same year, .sup.∗∗indicates that the difference has reached a significant level (p < 0.01). and .sup.∗ indicates that the difference has reached a significant level (p < 0.05).

    TABLE-US-00011 Rice Quality of Wild Type and Transgenic Rice WT OE1 OE2 OE5 KO1 KO2 KO3 Brown rice rate (%) 77.67±0.52 81.83±0.91.sup.∗∗ 81.90±0.35.sup.∗∗ 82.83±0.15.sup.∗∗ 76.87±0.68 74.00±0.87.sup.∗∗ 76.97±0.50 Milled rice rate (%) 66.40±0.89 73.90±1.56.sup.∗∗ 74.20±0.78.sup.∗∗ 74.43±0.57.sup.∗∗ 63.83±1.96 58.17±0.81.sup.∗∗ 63.70±0.85.sup.∗ Whole milled rice rate (%) 57.63±1.00 69.73±1.80.sup.∗∗ 69.13±1.10.sup.∗∗ 67.13±0.55.sup.∗∗ 47.53±2.69* 45.73±0.61.sup.∗∗ 51.33±1.44.sup.∗∗ Chalkiness 5.17±0.35 4.63±0.05 4.87±0.90 1.07±0.15.sup.∗∗ 6.77±0.23.sup.∗∗ 4.70±0.40 9.63±0.47.sup.∗∗ Chalky grain rate (%) 57.33±1.53 48.00±5.20 60.33±6.11 14.00±3.46.sup.∗∗ 57.33±1.53 42.00±1.73.sup.∗∗ 67.67±4.62* Adhesive strength (mm) 72.67±2.31 78.00±5.29 78.00±2.00* 78.00±4.00 66.00±3.61 59.00±1.73.sup.∗∗ 58.00±0.00.sup.∗∗ Amylose content (%) 19.10±0.10 17.87±0.31.sup.∗ 18.13±0.06.sup.∗∗ 19.17±0.15 19.13±0.06 19.07±0.06 18.50±0.10.sup.∗∗ Protein content (%) 6.65±0.17 5.92±0.14.sup.∗∗ 6.69±0.35 7.18±0.20* 7.22±0.16.sup.∗ 7.16+0.17.sup.∗ 7.91+0.16.sup.∗∗ In Table 10, compared with WT at the same place in the same year, .sup.∗∗ indicates that the difference has reached a significant level (p < 0.01); .sup.∗ indicates that the difference has reached a significant level (p < 0.05).

    Example 2. Detection of Function of OsDREB1C in Wheat (Triticum Aestivum) and Arabidopsis Thaliana

    1. Construction of Recombinant Vector

    [0178] Construction of an overexpression vector for wheat: A full-length of CDS of OsDREB1C gene was amplified from cDNA of rice Nipponbare by PCR. The resulting recovered PCR products were linked to the vector backbone of pWMB110 vector (Huiyun Liu, Ke Wang, Zimiao Jia, Qiang Gong, Zhishan Lin, Lipu Du, Xinwu Pei, Xingguo Ye, Efficient induction of haploid plants in wheat by editing of TaMTL using an optimized Agrobacterium-mediated CRISPR system, Journal of Experimental Botany, Volume 71, Issue 4, 7 Feb. 2020, Pages 1337-1349, https://doi.org/10.1093/jxb/erz529) obtained by double cleaving with BamHI and SacI via In-Fusion Reaction System to give a recombinant vector with correct sequence, designated as pWMB110-OsDREB1C. pWMB110-OsDREB1C is a recombinant vector obtained by substituting the DNA fragment between BamHI and SacI recognition sites on the pWMB110 vector for the OsDREB1C coding gene shown in SEQ ID NO: 2 in the Sequence Listing. pWMB110-OsDREB1C can be driven under UBI promoter to express the protein encoded by OsDREB1C gene (i.e. the OsDREB1C protein shown in SEQ ID NO: 1).

    [0179] The primer sequences used are as follows: [0180] Fielder-OsDREB1C-OE-F: 5′-CAGGTCGACTCTAGAGGATCCATGGAGTACTACGAGCAGGAG-3′ (SEQ ID NO: 12 in the Sequence Listing); [0181] Fielder-OsDREB1C-OE-R: 5′-CGATCGGGGAAATTCGAGCTCTCAGTAGCTCCAGAGTGTGAC-3′ (SEQ ID NO: 13 in the Sequence Listing).

    [0182] Construction of an overexpression vector for Arabidopsis thaliana: CDS of OsDREB1C gene (excluding termination codon) was obtained by amplifying from cDNA of rice Nipponbare by PCR. The resulting recovered PCR products were linked to Gateway System Entry Vectors pENTR (ThermoFisher, K240020SP) to give a recombinant vector with correct sequence, designated as pENTR-OsDREB1C, which was then in LR reaction with the pGWB5 vector (Nakagawa T, Kurose T, Hino T, Tanaka K, Kawamukai M, Niwa Y, Toyooka K, Matsuoka K, Jinbo T, Kimura T. Development of series of gateway binary vectors, pGWBs, for realizing efficient construction of fusion genes for plant transformation. J Biosci Bioeng. 2007 Jul;104(1):34-41. doi: 10.1263/jbb.104.34.) to transfer the CDS sequence of OsDREB1C to the final vector pGWB5, to give a recombinant vector with correct sequence, designated as pGWB5-OsDREB1C. pGWB5-OsDREB1C can be driven under CaMV 35S promoter to express the protein encoded by OsDREB1C gene (i.e. the OsDREB1C protein shown in SEQ ID NO: 1).

    [0183] The primer sequences used are as follows: [0184] OsDREB1C-CDS-F: 5′-CACCATGGAGTACTACGAGCAGGAG-3′ (SEQ ID NO: 14 in the Sequence Listing); [0185] OsDREB1C-CDS-R: 5′-GTAGCTCCAGAGTGTGACGTC-3′ (SEQ ID NO: 15 in the Sequence Listing).

    2. Construction of a Transgenic Plant

    [0186] After disinfecting the immature embryo of Fielder, a cultivar of wheat, it was induced to provide embryogenic callus. pWMB110-OsDREB1C obtained in step 1 was introduced into Agrobacterium C58C1. The callus was transfected and co-cultured with Agrobacterium using a genetic transformation method for wheat, mediated by Agrobacterium, to provide a transgenic plant upon resistance screening. The screened transgenic plant was an OsDREB1C transgenic wheat material. Due to the extremely high similarity between OsDREB1C and homologous genes of wheat’s own, it failed to detect the expression level of OsDREB1C gene in wheat by qRT-PCR assay. Therefore, the presence or absence of Bar gene of the vector in the cDNA of the transgenic wheat was examined by PCR assay using wild-type Fielder as a control. The primers used were as follows: 5′-CAGGAACCGCAGGAGTGGA-3′ (SEQ ID NO: 16 in the Sequence Listing), 5′-CCAGAAACCCACGTCATGCC-3′ (SEQ ID NO: 17 in the Sequence Listing). Electrophoresis detection showed that Bar gene was present in all three lines (TaOE-5, TaOE-8 and TaOE-9) of the OsDREB1C transgenic wheat, but not in the wild type, indicating that the three lines were all a transgenic material introduced with the pWMB110-OsDREB1C vector (A of FIG. 5).

    [0187] The pWMB110-OsDREB1C obtained in step 1 was introduced into Agrobacterium GV3101, followed by transferring to Col-0, a wild-type Arabidopsis thaliana, using an Agrobacterium-mediated floral dip method. After being harvested the seeds, they were seeded into resistant media for screening to provide a transgenic plant, that is, an OsDREB1C transgenic Arabidopsis thaliana material. The relative expression level of OsDREB1C gene at RNA level in the OsDREB1C transgenic Arabidopsis thaliana was detected by qRT-PCR assay, using Col-0, a wild-type Arabidopsis thaliana, as a control. The primers used were as follows: 5′-CATGATGATGCAGTACCAGGA-3′ (SEQ ID NO: 18 in the Sequence Listing), 5′-GATCATCAGTAGCTCCAGAGTG-3′ (SEQ ID NO: 19 in the Sequence Listing); the internal reference gene is Arabidopsis thaliana Actin, and the primers for the internal reference gene are: 5′- GCACCACCTGAAAGGAAGTACA -3′ (SEQ ID NO: 20 in the Sequence Listing), 5′- CGATTCCTGGACCTGCCTCATC -3′ (SEQ ID NO: 21 in the Sequence Listing). The results showed that the relative expression levels of OsDREB1C gene in the three lines of OsDREB1C transgenic Arabidopsis thaliana (AtOE-10, AtOE-11 and AtOE-12) were significantly higher than that in the wild type (Col-0), and the three lines were all an OsDREBloverexpressing Arabidopsis thaliana material (B of FIG. 5).

    3. Phenotypic Identification of the OsDREB1C Transgenic Wheat

    [0188] Pot grown wheat in a greenhouse was identified for its phenotype. The materials to be tested: wild-type wheat (Fielder) and OsDREB1C overexpressing wheat (TaOE-5, TaOE-8 and TaOE-9). The greenhouse temperature was controlled at 22-24° C., and the length of day was 12 hours of light /12 hours of darkness.

    [0189] The heading stages of wild-type and transgenic wheat were counted, and the photosynthetic rates of the flag leaves of the wheat to be tested at the heading stages were measured using LICOR-6400XT Portable Photosynthesis System (LI-COR, USA), with light intensity set at 1000 .Math.mol m.sup.-2 s.sup.-1. The grain number, 1000-grain weight, and grain yield per plant were measured after wheat grains went mature.

    [0190] The results showed (Table 11 and FIG. 6) that the transgenic wheat (TaOE-5, TaOE-8 and TaOE-9) spiked earlier than the wild-type Fielder while having a higher photosynthetic rate than the wild type. The grain number per ear among the yield traits was also higher than that of the wild type, and the 1000-grain weight was significantly larger than that of the wild type, resulting in an increase in yield per plant ultimately, indicating that OsDREB1C likewise functions in promoting heading date, improving photosynthetic capacity and increasing yield in wheat. The heading stage was the days from sowing to heading.

    TABLE-US-00012 Heading Stage, Photosynthetic Rate and Yield Traits of Wild-Type and Transgenic Wheat Wheat Heading Stage (Days) Photosynthetic Rate (.Math.mol CO.sub.2 m.sup.-1 s.sup.-1) Grain Number 1000-Grain Weight (g) Yield per Plant (g) Fielder 85.17±1.47 15.27±1.23 48.5±9.72 32.53±9.49 3.48±0.88 TaOE-5 80±2.96 18.11±1.87 55.1±18.62 41.89±9.75 4.32±1.50 TaOE-8 78.43±5.03 17.68±0.89 50.27±10.15 38.39±9.47 4.24±1.18 TaOE-9 77.5±3.50 17.96±1.81 55.2±17.31 46.89±7.61 4.15±1.33

    4. Phenotypic Identification of the OsDREB1C Transgenic Arabidopsis Thaliana

    [0191] Arabidopsis thaliana grown in a greenhouse was identified for its phenotype. The materials to be tested: wild-type Arabidopsis thaliana (Col-0) and OsDREB1C overexpressing Arabidopsis thaliana (AtOE-10, AtOE-11 and AtOE-12). They were grown in short day (8 hours of light /16 hours of darkness) for 2 weeks, and then transferred to long day condition (16 hours of light /8 hours of darkness).

    [0192] The bolting stage, number of rosette leaves, and above-ground biomass (comprising fresh weight and dry weight) were counted for wild-type and transgenic Arabidopsis thaliana. Bolting stage is the number of days from sowing to stem elongation and flowering.

    [0193] The results showed (Table 12 and FIG. 7) that the transgenic Arabidopsis thaliana (AtOE-10, AtOE-11 and AtOE-12) bolted earlier (1-3.9 days) than wild-type Col-0, with 5-7 more rosette leaves than the wild type when bolting, and their above-ground fresh weight and dry weight were both higher than the wild type, indicating that overexpression of OsDREB1C can likewise increase the biomass of a dicotyledon plant, Arabidopsis thaliana, and enable Arabidopsis thaliana bolt earlier.

    TABLE-US-00013 Phenotypic Indexes of Wild-Type and Transgenic Arabidopsis thaliana Arabidopsis Thaliana Bolting Stage (days) Number of Rosette Leaves Fresh Weight (g) Col-0 38±0.94 17.6±0.97 0.81±0.08 AtOE-10 35.1±0.99 23.1±1.91 0.93±0.12 AtOE-11 34.1±0.74 24.6+1.26 1.01±0.14 AtOE-12 37±0.82 22.6±1.35 1.10±0.20

    Example 3: Haplotypes Hap.1, Hap.2 and Hap.3 of Rice Are Correlated With Yield of Rice

    [0194] 709 rice core germplasm materials, including 299 indica, 355 temperate japonica, 14 tropical japonica, and 41 intermediate were for testing.

    [0195] Each of the materials for testing was planted, followed by counting and recording grain yield per plant after they were mature.

    [0196] A literature (Li et al., Analysis of genetic architecture and favorable allele usage of agronomic traits in a large collection of Chinese rice accessions, SCIENCE CHINA Life Sciences, November 2020, Vol. 63 No. 11: 1688 - 1702, https://doi.org/10.1007/s11427-019-1682-6) had disclosed the sequences of 709 rice core germplasm materials (the sequence of each rice material disclosed in this literature was in NCBI, BioProject PRJCA000322 and GSA accession CRA000167, website: https://bigd.big.ac.cn/), based on which alignment was performed for SNP genotypes among populations, and the SNP of the first 2kbs in the promoter region of the gene LOC_Os06g03670 was taken in the vcf file. According to the results of GWAS, missense mutation(s) in the gene region and site(s) with -Log10 (P-value) values greater than 10 in the promoter region served as SNPs for distinguishing haplotypes. General Linear Model in the software TASSEL 5.0 (http://www.maizegenetics.net/tassel) as developed by the Buckler Laboratory of Cornell University (Zhang Z, Ersoz E, Lai CQ, Todhunter RJ, Tiwari HK, Gore MA, Bradbury PJ, Yu J, Arnett DK, Ordovas JM, Buckler ES. Mixed linear model approach adapted for genome-wide association studies. Nature Genetics. 2010 Apr;42(4):355-60. https://doi.org/10.1038/ng.546) was employed for the analysis of correlation of SNPs with grain yield per plant.

    [0197] The results showed that three haplotypes, Hap.1, Hap.2 and Hap.3, respectively, of this DNA fragment in rice genome were found to be related to grain yield per plant. The three haplotypes involved 10 SNP sites, whose physical positions in the reference genome (version number: Os-Nipponbare-Reference-IRGSP-1.0 (IRGSP-1.0), updated on Feb. 6, 2013, website: https://rapdb.dna.affrc.go.jp/) were, in sequence, 1433007, 1433155, 1433229, 1433365, 1433528, 1433919, 1434216, 1434258, 1434486, and 1434806, as shown in FIG. 8 for their positions on the first 2kbs in the promoter of the gene LOC_Os06g03670. The nucleotides of these 10 sites for Hap. 1 were, in sequence, A, A, G, C, A, G, G, C, T, and G; the nucleotides of these 10 sites of Hap.2 were, in sequence, A, G, G, C, T, G, G, C, T, and G; and the nucleotides of these 10 sites of Hap. 3 were, in sequence, G, G, A, G, T, A, A, T, G, and T. Haplotypes of each rice material were shown in Tables 13 and 14.

    [0198] Grain yield per plant was counted for the three haplotypes, and results for some of the rice materials were shown in Tables 13 and 14.

    TABLE-US-00014 Results for Grain Yield per Plant Haplotype s Name of Materials Grain Yield per Plant (g) Haplotypes Name of Materials Grain Yield per Plant (g) Hap.1 HongNuo 15.30 Hap.3 YanGeng2Hao 34.40 CeHengGuangKeNuo NA SiDao8Hao 34.00 IRAT12 NA SuXieGeng 56.40 Cica9 NA YangGeng201 29.70 Cr5272 NA ZhenDao1Hao 46.10 JiangHui151 NA NanGeng36 48.70 YiHui1577B NA WuYuGeng3Hao 39.00 LeHui188 NA YanGeng4Hao 43.00 Gang46B NA WuGeng4Hao 35.30 DShanB NA SiDao10Hao 47.80 D62B NA ZhenDao4Hao 40.30 ChuanXiang29B NA YanGeng5Hao 39.60 D297B NA TongGeng109 16.80 K17B NA XiangGeng111 44.50 Fu74B NA ZhenXiangGeng5Hao 46.60 II-32B NA WuYunGeng8Hao 51.20 803B NA HuaiDao5Hao 36.60 YiXiangB NA YangGeng9538 31.40 Rong18B NA NanGeng39 47.60 FeiB 10.90 WuYunGeng11Hao 37.70 WuJin5B 15.10 ZhenDao8Hao 54.40 R907 27.50 NanGeng40 35.00 R95-2(WangXuDong) 35.20 HuaGeng1Hao 50.50 R122(SiChuan) 38.70 GuangLingXiangGeng 35.20 YunHui290 24.00 TongYuGeng1Hao 22.80 YunHui72 26.60 NanGeng41 25.00 YouIb 11.40 HuaiDao7Hao 16.40 YuanHui2Hao 37.30 HuaGeng3Hao 34.40 Zhong9B 10.30 YangFuGeng7Hao 35.50 CiXuan4Hao 33.90 YanGeng9Hao 40.70 Zhong8B 13.50 HuaGeng4Hao 22.00 TeQing 15.50 HuaiGeng9Hao 30.40 YangDao1Hao929-2 32.20 YangFuGeng8Hao 42.30 YangDao2Hao 25.60 YanGeng9Hao 37.80 YangDao3Hao 32.60 HuaiDao10Hao 33.80 YangDao4Hao 43.20 YangNongGeng1Hao 39.50 YangFuXian2Hao 24.40 HuaiDao 13Hao 30.20 NanJing11Hao 34.80 YanGeng10Hao 16.10 GuMei4Hao 17.10 NanGeng45 18.20 Cbb23 33.80 WuYunGeng24Hao 29.10 K89-B5 29.10 HuaGeng7Hao 25.40 GuiChao2Hao 36.20 NingGeng5Hao 28.30 K17B 11.00 ZhenDao14Hao 29.70 QiMiaoXiang 40.70 YangYuGen2Hao 28.00 ShengTai1Hao 51.00 Balilla 19.00 HuaRun2Hao 46.90 NanGeng11 18.80 WuShanSiMiao 52.40 NanGeng33 7.80 WuShanSiMiaoXuan 76.60 XiuShui04 24.20 LuXiang618B 16.50 ZhenDao6Hao 34.50 HuaGengXian74 21.10 HuaiDao6Hao 17.20 GuangLuAi4Hao 34.20 WuYuGeng5Hao 13.20 JiaFuZhan 46.60 Pi5 16.40 HuangHuaZhan 42.00 XiFeng 43.20 SanHuangZhan2Hao 39.60 ZhongDan1Hao 29.30 GuangChao123 35.90 Nipponbare 14.10 YueJingSiMiao2Hao 30.30 HuangJinQing 8.10 YueKang1121 42.30 YangGeng186 3.70 Xin1122 71.30 WuFuGeng 5.40 LuZhouZaoB 21.60 WuYuGeng2Hao 15.10 GuangHui128 56.30 XiuShui37 13.80 YueR9113 11.40 ZhenDao7Hao 14.00 XieB 14.60 YueGuang 13.20 ChuanGuB 16.70 WuXiangDao1Hao 18.70 HuHan15 14.60 ZhenDao88Hao 12.80 HanDao10Hao 37.20 ZhenDao99Hao 21.50 ZhongHan221 50.10 Nongken 58 39.30 ZhongHan215 13.80 NongHu6Hao 53.00 ZhongHan211 24.40 FuNong709 38.20 ZhongHan209 32.20 XiuShui04 51.90 Digu 17.30 HuangKeZao20Ri 50.80 MiYang46 51.40 FuYu 33.30 Jaya 54.40 ZiJinNuo 28.50 Bg90-2 56.10 YanGeng187 34.00 Bg304 40.60 YangGeng687 41.10 BALA 28.00 HuaGeng2Hao 27.50 K18B 7.90 XiuShui11 47.20 IR841 54.00 JiaHu6Hao 32.20 IRBB71033-121-15 39.50 Jia33 33.90 N11 NA 9522 29.50 K22B 23.70 ChunJiang03 41.80 Q15B 7.20 WuGeng15 40.80 YiXiang1B 21.70 02428 50.80 D62B 28.40 YanGeng8Hao 13.10 D702B 17.40 Dan8 9.20 Gang16B 20.10 ZaoDan8 21.70 Gang46B.sup.∗ 25.60 TaiHuGeng1Hao 28.20 ZhenShan97B 11.10 XiuShui122 27.00 TianFengB 17.20 SuFengGeng1Hao 38.30 YueFengB 23.50 TaiZhongYu39 25.10 903B 20.40 TaiHuNuo 14.30 FengYuanB 15.30 TaiHuGeng2Hao 28.60 LongS 3.20 ChangNongGeng1Hao 22.70 YueTaiB 20.00 ChangNongGeng3Hao 24.50 97S-4Pigm 14.90 XiuShui63 33.10 12Msj66 7.50 ChangNongGeng4Hao 24.90 R507 35.70 XiangGeng 52.20 Ii-32B 19.20 TaiHuGeng 12.50 R711 27.40 WuXiangGeng9Hao 12.80 R609 28.20 EZhong5Hao 28.40 R1307 19.80 Tos2300 (Tox7-3-4-10-131) NA R1310 18.30 Wab56-50 NA NanNong3005 23.70 TGR78 NA 98J65 32.70 Irat104 NA GuangKang13B 15.10 IRAT109 NA Gui630.sup.∗ 22.90 IRAT110 NA MingHui69 24.10 IRAT112 NA Xiangai B 16.20 B2997C-7B-4-2-1 NA HuaZhan 17.50 B6136-3-Tb-0-1-5 NA YaHuaHui1431 21.80 Gui630 NA Zhong413 19.00 HuHui602 NA V20B 8.80 ShuHui881 NA MianHui501 29.60 ShuHui498 NA ShuHui166 36.60 ChengHui177 NA ShuHui118 39.70 ChengHui3203 NA B222(IR102560B) NA Minghui 63 NA B226(IR93558B) NA Cdr22 NA B227(IR58025B) NA MianHui725 NA B228(IR68897B) NA ShuHui527 NA B229(IR79125B) NA ShuHui162 NA B230(IR79156B) NA FuHui838 NA B231(IR80559B) NA HuHui17 NA WuShanSiMiao-Xuan5 NA DuoXi1Hao NA WuShanSiMiao-Xuan8 NA WuYuGeng30Hao 9.80 WuShanSiMiao-Xuan11 NA SuiGeng3Hao 9.40 WuShanSiMiao-Xuan16 NA KenGeng5Hao 13.20 WuShanSiMiao-Xuan31 NA Tk65 10.50 CENTAURO/CT17238//FL053 72.sup.∗ NA BeiDao3Hao 5.70 IRBL9-W[US]JPP156.sup.∗ NA AoYu324 12.40 F321(APL).sup.∗ NA PuTe6Hao 5.40 R5366(APL).sup.∗ NA HuaX0609 7.10 YY6ô[00001]UnknownSymbol(NB).sup.∗ NA LongJiao06-192 6.90 R779(APL).sup.∗ NA LongGengXiang1Hao 7.90 R776(APL).sup.∗ NA Pu2006Er892-48-1 NA Hap.2 AiJiNuoMi 15.80 HeHang99-1 11.10 LaoHuDao 45.20 ZhongRiQiHao 9.90 ZiJinGeng1Hao 17.00 BeiDao1Hao 17.80 LaoLaiQing 48.90 LongGeng32Hao 14.10 BaWuSan 30.90 LongGeng33Hao 12.60 B6144F-Mr-6 NA LongGeng38Hao 9.90 GuanDong58 8.20 SuiGeng10Hao 10.90 XiangZhenZhu 13.40 SuiGeng4Hao 10.80 DongNong8Hao 11.50 ZhongLongXiangGeng1H ao 12.90 LongGeng30Hao 12.80 SuiGeng8Hao 9.70 JiaHe1Hao 13.00 YouZhiMi(Japan) 22.50 LongGeng37Hao 14.60 YiJianZhongQing 21.90 LaoTouDao 15.20 KenDao10-2153 10.00 C9083 29.60 SongGeng15Hao 21.00 R041 21.60 JiYuGeng 10.20 SuXiangGeng1Hao 15.30 KenDao09-2883 11.30 R109 19.20 KenDao08-1716 10.90 11Cr240 30.40 LongGeng11Hao 16.80 WuRongHeXian 10.10 LongGeng21Hao 16.50 IR64R 31.70 LongGeng31Hao 16.70 DongXiang NA DongNong428 16.20 Shen08S 11.40 DongDao4 11.00 GuangXiang24S 11.80 KenDao12Hao 9.20 ZhongJiang6280 16.90 Ken98-196 10.70 EnHui58 26.50 Song98-131 10.80 Unknown NA WuYouDao1Hao 12.40 R2(IR86455-14-3-1-9-1 -1-1-1) NA Gyh-ZiYuan 10.60 R3(IR86522-25-6-1-1-2 -1-1-1) NA ZiYuan64 4.80 R4(IR86526-11-9-1-1-1-1) NA LongDao11Hao 7.60 R7(IR72998-93-3-3-2R) NA DaoHuaXiang2Hao 13.10 R10(IR73971-87-1-1-1-1) NA JiGeng88Hao 11.10 R11(STR3) NA SongGeng9Hao 14.30 R12(IR64R) NA SuiGeng9Hao 8.50 R13(IR69712-154-2-3-1-3R) NA SuiGeng11Hao 14.70 R14(IR75287-19-3-3-3) NA SiSuiGeng8 21.20 Hap.3 GuiHuaHuang 24.60 SuiGeng13Hao 8.10 NongKen57 35.50 LongGeng27Hao 9.40

    TABLE-US-00015 Results for Grain Yield per Plant Haplotypes Name of Materials Grain Yield per Plant (g) Haplotypes Name of Materials Grain Yield per Plant (g) Hap.3 LongGeng28Hao 9.90 Hap.3 WuXiangGeng14Hao 28.20 LianDaoYiHao 22.20 ZhongDao1Hao 22.00 LongDun01-200 12.80 WuGeng15 32.60 LongGeng39Hao.sup.∗ 3.70 WuYuGeng2Hao 21.50 HeJiang18Hao 8.80 WuYuGeng16Hao 18.40 LongHua01-501 21.00 WuYuGeng20Hao 21.40 KenNuo1Hao 15.30 RuanYu2Hao 41.00 MuDanJiang22Hao 18.40 XinRuanYu 37.40 LongGeng10Hao 20.70 YunCunRuanMi 28.80 QiuLing 13.90 YinYu2084 32.60 Ken94-1043 11.30 YinYu2239 28.70 XuDao3Hao 20.30 LianGeng4Hao 20.90 LianGeng7Hao 17.60 SiDao785 25.70 ShengDao16 14.60 SiDao11Hao 41.00 YangGuang200 10.00 SiDao12Hao 8.10 YangGuang600 16.10 HuaGeng2Hao 19.90 DaLiang203 25.30 HuaGeng3Hao 22.70 LinDao16Hao 8.60 HuaGeng5Hao 15.10 LinDao17Hao 17.10 HuaGeng6Hao 24.70 LinDao18Hao 11.10 HuaGeng7Hao 31.60 ZhengDao18Hao 9.10 DaHuaXiangNuo 23.30 XinDao20 8.40 LianGeng6Hao 13.70 XinDao29 12.90 SuXiangGeng2Hao 11.20 LianGeng8Hao 10.30 R130 21.40 JinDao1007 14.00 9363 23.50 JinDao263 9.60 ChangNongGeng4Hao 19.60 SuXiu10Hao 14.20 ChangNongGeng5Hao 11.90 LianJiaGeng1Hao 21.00 ChangGeng09-5 23.70 XiuShui05 25.50 TongGeng981 14.50 XiuShui134 35.20 NanTongZiNuo 18.60 XiuShui08 30.60 ShengDao15 11.30 XiuShui09 32.70 NeiHui99-14 25.80 XiuShui114 31.10 DuoXi1Hao 21.00 XiuShui123 31.80 NeiDuoHui1Hao 31.50 LianGeng9Hao 11.40 DuoHui57 30.90 XiuShui137 39.80 NeiHui92-4 28.70 XiuShui128 35.70 LuHui602 23.60 Jia33 24.90 LuHui926 26.00 Bing8979 27.30 LuHui615 20.50 Bing03123 36.70 LuHui17 43.00 Bing03123 32.10 ChuanR527 23.00 Bing03123 22.30 ChuanR838 32.40 Jia02147(JiaXing) 38.00 ShuHui498 31.00 JiaHua1Hao 38.20 ChengHui727 25.90 ChunJiang1Hao 26.80 R702 20.20 LianGeng10Hao 19.10 WanHui88 25.90 You1 20.50 ShuHui881 25.00 YongGeng05-8 31.50 EFengB 7.70 YongZhi19 43.20 R363 25.40 HuGeng312 30.00 R130 26.80 QingJiao301 22.60 ZhenHui832 29.40 QingJiao307 18.30 YangDao6Hao(awnless) 26.70 BaoNong34 17.80 YangDao6Hao(awn) 34.10 JinNongFeng 22.70 9311 M 28.70 JinFeng 24.30 YangDao8Hao 43.30 ShenShi3Hao 33.30 R167 43.00 LianGeng11Hao 14.60 Ry1Hao 51.00 C418 44.40 XiangZaJiaoDao-Male Parent 42.50 LunHui422 50.70 Nuo608 28.90 R162 21.50 R1128 15.30 XiangQing 18.70 R2012 21.40 Zhongchao123 35.60 R9368 31.40 HanGengWang 28.20 R900 23.90 ZhengGene2Hao 21.30 YangHui916 39.30 ZheneHan8Hao 29.70 YangHui 120 36.40 HanDao8Hao 40.80 R938 22.70 LuoDao998 21.60 YanLiangYou88-Male Parent 35.60 XuHan29 30.40 ZhongJiangD208 29.10 HanDao44 27.70 GuangLiangYou66-Male Parent 33.00 HanDao108 16.20 R476 31.90 HanDao277 37.10 R6326Wh26 21.50 Han287 2.80 WenHui689.sup.∗ 36.50 ZhongHan502 30.00 JiaoDianXian-Restorer.sup.∗ 21.30 Jin9540 29.70 R108 27.60 YanGeng2Hao 37.60 R108.sup.∗ 38.50 YanGeng5Hao 27.70 XiangHui4Hao 37.50 JiGeng83Hao 34.20 XiangHui1Hao 23.00 JiGeng88Hao 28.60 9311B 15.30 ChangBai16 22.30 YanXian3021 24.50 LongGeng05-191 5.60 LuoBiao 49.60 LongGeng25Hao 6.50 ZhongJian2Hao 39.20 LongGeng26Hao 7.90 NongXiang18 31.90 LiaoGeng21 33.10 JiangXiSiMiao 32.10 NingGeng28Hao 11.50 XiangWanXian10Hao 42.40 HuaiDao11Hao 21.10 LiuFengXiangZhan 40.20 NingGeng35Hao 9.40 R207 62.50 NingGeng38Hao 6.20 R6090 40.50 NingGeng43Hao 13.90 TaiXiangGeng 48.50 DanGeng06-8 10.20 N333-Restorer 29.90 Jia09-90 27.50 02428 18.80 ChangShu-6-85 32.50 HanHui10Hao 24.90 R972 32.10 BaXiLuDao 28.30 NingGeng24Hao 18.70 HanYou3HaoXian 27.50 NingGeng36Hao 23.10 JiangXi1587 23.90 NingGeng37Hao 24.60 MiYang23 32.60 HuaiNuo12Hao 32.30 Cpslo17 36.00 NingGeng41Hao 20.70 Lagrue 34.90 LiaoYuan31-1 34.00 IR64 47.50 LiaoYuan31-2 27.80 IRBB61 18.70 JiGeng80Hao 30.70 WuFengB 16.70 JinDao253 18.70 SuiFengB 17.80 TianJin28-1 32.90 Shen95A 7.80 JinYuan45 33.40 239B 24.80 SongGeng9Hao 48.50 GuangZhan2S 18.10 SongGeng12Hao 18.10 GuangZhan4S 26.40 TieGeng7Hao 40.40 Y58S 6.30 HuaiDao13Hao 23.70 1892S 25.80 YuGeng6Hao 39.60 C134S 4.80 Tai0206 29.00 Pi64S 2.20 JiaHe218 41.10 Yang186S 9.70 Nipponbare 29.40 LongKe638S 5.90 DongHaiBuKangTiao 29.50 13Msj131 16.80 SuYuNuo 31.90 Zhen084 30.70 XiangHui628 33.10 R153 24.80 TaiWan30 23.70 R902 26.30 TaiWan50 22.70 R814 22.20 TaiWan65 33.70 T136 19.70 XuDao4Hao 25.00 R332 31.50 HuaiDao14Hao 24.50 R542 20.50 HuaiDao15Hao 31.20 R411 30.70 YanXuan2Hao 21.40 R6547 18.20 YanGeng6Hao 33.30 Kang559 21.10 YanGeng7Hao 5.30 ZhongJiangR728 28.80 YanGeng9Hao 35.00 Minghui 63 23.80 YanGeng10Hao 34.70 MingHui86 14.40 YanGeng11Hao 15.10 ShuangKangMingZhan 28.60 YanDao815 28.80 MingHui78 23.90 YanDao8Hao 15.70 R8006 23.80 XuDao5Hao 27.90 EnHui69 24.20 YanDao9Hao 34.00 JinHui21 27.30 YanDao60Hao 34.50 MianHui725 38.00 YangGeng805 33.70 MianHui3724 32.30 XiangGeng49 25.80 MianHui146 26.60 YangGeng9538 19.40 MianHui523 25.10 YangGeng4038 33.10 MianHui9939 35.90 YangGeng806 28.00 MianHui3728 16.60 YangGeng186 28.50 MianHui662 34.00 YangGeng687 20.20 ChuanHui687 30.20 XuDao6Hao 16.50 ZheHui0506 14.40 YangFuGeng7Hao 17.30 Unknown NA YangFuGeng8Hao 39.90 R1(IR86417-11-9-1-1-1-1-1) NA ZhenDao88Hao 12.80 R6(IR90926-25-5-1-1-1) NA ZhenDao99Hao 18.50 FL06733/CT17238//FL04577.sup.∗ NA Zhen9424 25.70 YY5 ô (NB).sup.∗ NA ZhenDao11 24.40 R1083(APL).sup.∗ NA ZhenDao14Hao 32.60 J176(APL).sup.∗ NA ZhenDao15Hao 34.60 R1998(APL).sup.∗ NA ZhenDao16Hao 25.20 Chun59 NA NingGeng1Hao 38.60 Chun84 NA XuDao7Hao 27.80 YY10ô(NB).sup.∗ NA NingGeng3Hao 30.30 R1813(APL).sup.∗ NA NingGeng4Hao 16.40 R700(APL).sup.∗ NA NingGeng5Hao 42.00 R1999(APL).sup.∗ NA Ning9108 14.40 R1968(APL).sup.∗ NA Ning5055 20.20 R973(APL).sup.∗ NA NanGeng44 25.40 R5867(APL).sup.∗ NA NanGeng46 17.30 R121(APL).sup.∗ NA NanGeng49 40.10 R199(APL).sup.∗ NA NanGeng41 20.60 R421(APL).sup.∗ NA 07Gy31 17.80 R572(APL).sup.∗ NA XuGeng8Hao 8.10 R651(APL).sup.∗ NA WuYunGeng7Hao 23.00 R9918(APL).sup.∗ NA WuYunGeng8Hao 33.70 GuiR1117(APL).sup.∗ NA WuYunGeng21Hao 31.80 WR32(APL).sup.∗ NA WuYunGeng22Hao 22.10 H553(APL).sup.∗ NA WuYunGeng23Hao 28.00 H2019(APL).sup.∗ NA WuYunGeng24Hao 17.40 H5832(APL).sup.∗ NA WuYunGeng27Hao 34.60 YanDao12Hao 29.60 WuYunGeng29Hao 35.90 WuXiangGeng9Hao 33.00

    [0199] In Tables 13 and 14, NA represents the absence of data.

    [0200] Grain yield per plant was counted for each of the haplotypes. The grain yield per plant of the rice having Hap. 1 as haplotype was 27.98 ± 1.49 g, the grain yield per plant of the rice having Hap.2 as haplotype was 20.48 ± 2.30 g, and the grain yield per plant of the rice having Hap.3 as haplotype was 25.23 ± 0.53 g; the grain yield per plant of the rice having Hap.2 as haplotype was significantly lower than that having Hap.3 as haplotype, and there was no significant differences in grain yield per plant between the rice having Hap. 1 as haplotype, and both the rice having Hap.2 and Hap.3 as haplotypes (FIG. 9), indicating that the three haplotypes of rice were related to grain yield per plant of rice, and could be used in rice breeding.

    [0201] The invention has been described in detail above. For those skilled in the art, the invention can be carried out within a wider range at equivalent parameters, concentrations and conditions, without departing from the purpose and scope of the invention and without unnecessary experiments. Although the invention provides specific examples, it is to be appreciated that the invention can be further modified. In short, according to the principle of the invention, the application is intended to include any modifications, uses or improvements to the invention, including changes made with conventional techniques known in the art beyond the scope contained in the application. Some fundamental features can be applied, according to the scope of the following appended claims.

    INDUSTRIAL APPLICATION

    [0202] Experiments have demonstrated that OsDREB1C and the associated biological materials thereof of the invention can enhance the photosynthetic efficiency of a plant, promote nitrogen uptake and transport and increase the nitrogen content in the plant and its grains, promote earlier heading, and improve yield. Aiming at a synergetic enhancement in photosynthetic efficiency, nitrogen use efficiency and heading stage of crops, the invention has achieved a synergetic increase in nitrogen use efficiency while yielding a substantial amount of crops, and also provided a solution to the contradiction between high yield and prematurity of crops. Therefore, the invention further strengthens the potential in substantially yielding crops and increases nitrogen use efficiency, achieving “high yield and high efficiency”; on the other hand, the solution of the contradiction between high yield and prematurity has found potential applications to dealing with prematurity and high yield of direct seeded rice and, grains and cash crops, grains and vegetables, continuous cropping rice for grains and oil, double cropping rice, as well as “transgressive late maturing” of inter-subspecies hybrid rice, etc.

    [0203] In addition, the invention starts from the function of OsDREB1C gene in regulating yield of rice to analyze the haplotypes of its gene sequence, and discovers that haplotype 3 (Hap. 3) has excellent traits that increases yield of rice, and finds bright prospects in application to genetic breeding of rice and cultivar modification.