LAMP TESTING DEVICE AND METHOD USING ISOTHERMAL AMPLIFICATION OF RNA/DNA TO IDENTIFY PATHOGENS

Abstract

The present invention provides a LAMP assay device that promotes isothermal RNA/DNA amplification applied to pathogen identification, comprising: a LAMP assay chamber (1); an electronics cabinet (4), a power supply means (7); and a top lid (2) for closing the LAMP assay chamber (1), wherein internally the device comprises: a metal cylindrical thermoblock (8) comprising openings (80) for positioning microtubes (81); a control board with central processing (14); a power electronics board (13); at least one heating element (10) in contact with the thermoblock (8) and adapted to heat the thermoblock (8) by induction; a temperature sensor (9) adapted to measure the temperature of the thermoblock (8); a plurality of RGB LEDs (12) positioned below the thermoblock (8) and adapted to excite each microtube positioned in the thermoblock (8); and a camera (11) positioned below the thermoblock (8) and adapted to capture images of each of the microtubes (81) positioned in the thermoblock (8). In addition, the invention provides a method for pathogen identification from a LAMP assay device.

Claims

1. LAMP assay device that promotes isothermal RNA/DNA amplification applied to pathogen identification, characterized by comprising: a LAMP assay chamber (1); an electronics cabinet (4), a power supply means (7); and a top lid (2) for closing the LAMP assay chamber (1), wherein internally the device comprises: a metal cylindrical thermoblock (8) comprising openings (80) for positioning microtubes (81); a control board with central processing (14); a power electronic board (13); at least one heating element (10) in contact with the thermoblock (8) and adapted to heat the thermoblock (8) by induction; a temperature sensor (9) adapted to measure the temperature of the thermoblock (8); a plurality of RGB LEDs (12) positioned below the thermoblock (8) and adapted to excite each microtube positioned in the thermoblock (8); and a camera (11) positioned below the thermoblock (8) and adapted to capture images of each of the microtubes (81) positioned in the thermoblock (8).

2. LAMP assay device according to claim 1, characterized by the control board with central processing (14) comprising means for communicating with a mobile user device and adapted to control the temperature of the thermoblock (8) according to a schedule established by controlling the heating element (10) and in response to a signal from the temperature sensor (9).

3. LAMP assay device according to claim 1, characterized by comprising a visual operating warning element adapted to inform a user of the status of the device, wherein the visual element is an LED positioned externally to the device adapted to indicate via specific colors, the condition of the device.

4. LAMP assay device according to claim 1, characterized by comprising a lid closing sensor (3) in communication with the central processing control board (14), wherein the central processing control board (14) is adapted to allow operation of the device only when the top lid (2) is closed.

5. LAMP assay device according to claim 1, characterized by externally comprising a power source connected to a power entry point; a bottom cover (6); an electronics cabinet (4) in which the electronic control devices are positioned; and an on/off button (5).

6. LAMP assay device according to claim 1, characterized by the thermoblock (8) comprising a cylindrical anodized aluminum block in which each opening is adapted to fairly accommodate a 0.2 mL microtube.

7. LAMP assay device according to claim 1, characterized by the heating element (10) in contact with the thermoblock (8) and heating the support by induction.

8. LAMP assay device according to claim 1, characterized by the openings (80) for positioning microtubes (81) angled at an angle ranging from 38° to 52°.

9. LAMP assay device according to claim 1, characterized by the thermoblock (8) comprising a hole (82) in the lower inner portion of each opening (80) for positioning microtubes (81), wherein the hole (82) is adapted to allow excitation of light with four bands of fluorescence signal, in addition to making it possible to image each microtube uniquely by the camera (11).

10. LAMP assay device according to claim 1, characterized by the communication between the control board with central processing (14) and the user device is performed by wireless technology.

11. Method for identifying pathogens from a LAMP assay device as defined in claim 1, characterized by comprising the steps of: activate at least one heating element (10) to raise the temperature of the thermoblock (8) to a preset temperature for the defined diagnostic reaction; maintain the temperature of the thermoblock (8) at the preset temperature for a preset period of time for the defined diagnostic reaction, and turn off the heating element (10); turn on the plurality of RGB LEDs (12) for excitation of each microtube positioned in the thermoblock (8); capture the values with camera image (11) for each position of each microtube and for each of the excitation colors, and send this information to the user device; processing the image information captured by camera 11, which involves converting the image information from RGB to chrominance and checking in which region of the 2D plane each value is located; define a positive or negative diagnosis for each microtube from the information processing; and display the diagnostic result of each microtube through the user device.

12. Method, according to claim 11, characterized by comprising the step of performing a real-time reading using displaceable probes in constructing a fluorescence vs time curve.

13. Method, according to claim 11, characterized by comprising the steps of: storing the diagnostic result of each microtube in a local database; and sending the diagnostic result of each microtube to a cloud database.

14. Method according to claim 11, characterized by the step of capturing values with camera imaging (11) for each position of each microtube, and for each of the excitation colors, further comprising using the green, red and orange fluorophores.

15. Method, according to claim 11, characterized by comprising a step of activating a cooling device to cool the assay chamber (1) of the LAMP device.

16. A method of diagnosis on a biological sample, characterized by the fact that it comprises: (i) subject the sample to a loop-mediated isothermal amplification (LAMP) by using a primer set specific for the target nucleic acid, where the primer set comprises: (a) six primers, each, respectively, having a sequence at least 90% identical to SEQ ID NO: 61, SEQ ID NO: 62, SEQ ID NO: 63, SEQ ID NO: 64, SEQ ID NO: 65, and SEQ ID NO: 66; or (b) six primers, each, respectively, having a sequence at least 90% identical to SEQ ID NO: 67, SEQ ID NO: 68, SEQ ID NO: 69, SEQ ID NO: 70, SEQ ID NO: 71 and SEQ ID NO: 72, or (c) six primers, each, respectively, having a sequence at least 90% identical to SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, and SEQ ID NO: 6; or (d) six primers each, respectively, having a sequence at least 90% identical to SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11, and SEQ ID NO: 12; or (e) six primers, each, respectively, having a sequence at least 90% identical to SEQ ID NO: 13, SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 16, SEQ ID NO: 17, and SEQ ID NO: 18; or (f) six primers, each, respectively, having a sequence at least 90% identical to SEQ ID NO: 19, SEQ ID NO: 20, SEQ ID NO: 21, SEQ ID NO: 22, SEQ ID NO: 23, and SEQ ID NO: 24; or (g) six primers, each, respectively, having a sequence at least 90% identical to SEQ ID NO: 25, SEQ ID NO: 26, SEQ ID NO: 27, SEQ ID NO: 28, SEQ ID NO: 29, and SEQ ID NO: 30; or (h) six primers, each, respectively, having a sequence at least 90% identical to SEQ ID NO: 31, SEQ ID NO: 32, SEQ ID NO: 33, SEQ ID NO: 34, SEQ ID NO: 35, and SEQ ID NO: 36; or (i) six primers, each, respectively, having a sequence at least 90% identical to SEQ ID NO: 37, SEQ ID NO: 38, SEQ ID NO: 39, SEQ ID NO: 40, SEQ ID NO: 41, and SEQ ID NO: 42; or (j) six primers, each, respectively, having a sequence at least 90% identical to SEQ ID NO: 43, SEQ ID NO: 44, SEQ ID NO: 45, SEQ ID NO: 46, SEQ ID NO: 47, and SEQ ID NO: 48; or (k) six primers, each, respectively, having a sequence at least 90% identical to SEQ ID NO: 49, SEQ ID NO: 50, SEQ ID NO: 51, SEQ ID NO: 52, SEQ ID NO: 53, and SEQ ID NO: 54; or (l) six primers, each, respectively, having a sequence at least 90% identical to SEQ ID NO: 55, SEQ ID NO: 56, SEQ ID NO: 57, SEQ ID NO: 58, SEQ ID NO: 59 and SEQ ID NO: 60; or (m) a combination of (a) and (b); or (n) the combination of (c) and (d); or (o) the combination of (f) and (g); or (p) the combination of (h) and (i); or (q) the combination of (j) and (k); and (ii) detect the target nucleic acid amplification product in the biological sample.

17. Method according to claim 16, characterized by step (i) the method is an RT-LAMP.

18. Method according to claim 16, characterized by step (i) the target nucleic acid is a nucleic acid of SARS-CoV2.

19. Method according to claim 18, characterized by the fact that, in step (i), the primer sets comprise: (a) six primers, each, respectively, having a sequence at least 90% identical to SEQ ID NO: 25, SEQ ID NO: 26, SEQ ID NO: 27, SEQ ID NO: 28, SEQ ID NO: 29, and SEQ ID NO: 30; or (b) six primers, each, respectively, having a sequence at least 90% identical to SEQ ID NO: 31, SEQ ID NO: 32, SEQ ID NO: 33, SEQ ID NO: 34, SEQ ID NO: 35, and SEQ ID NO: 36; or (c) six primers, each, respectively, having a sequence at least 90% identical to SEQ ID NO: 37, SEQ ID NO: 38, SEQ ID NO: 39, SEQ ID NO: 40, SEQ ID NO: 41, SEQ ID NO: 42; or (d) six primers, each, respectively, having a sequence at least 90% identical to SEQ ID NO: 43, SEQ ID NO: 44, SEQ ID NO: 45, SEQ ID NO: 46, SEQ ID NO: 47, and SEQ ID NO: 48; or (e) six primers, each, respectively, having a sequence at least 90% identical to SEQ ID NO: 49, SEQ ID NO: 50, SEQ ID NO: 51, SEQ ID NO: 52, SEQ ID NO: 53, and SEQ ID NO: 54; or (f) six primers, each, respectively, having a sequence at least 90% identical to SEQ ID NO: 55, SEQ ID NO: 56, SEQ ID NO: 57, SEQ ID NO: 58, SEQ ID NO: 59 and SEQ ID NO: 60; or (g) six primers, each, respectively, having a sequence at least 90% identical to SEQ ID NO: 61, SEQ ID NO: 62, SEQ ID NO: 63, SEQ ID NO: 64, SEQ ID NO: 65, and SEQ ID NO: 66; or (h) six primers, each, respectively, having a sequence at least 90% identical to SEQ ID NO: 67, SEQ ID NO: 68, SEQ ID NO: 69, SEQ ID NO: 70, SEQ ID NO: 71 and SEQ ID NO: 72; or (i) a combination of (a) and (b); or (j) the combination of (c) and (d).

20. Method according to claim 16, characterized by the LAMP reaction performed at a temperature in the range of about 60° C. to 70° C.

21. Method according to claim 16, characterized by the fact that the RT-LAMP reaction includes a pH-sensitive indicator dye.

22. Method according to claim 16, characterized by the fact that the pH sensitive indicator dye is a colored dye detectable in visible light.

23. Method according to claim 16, characterized by the detection performed using fluorescently displaced probes.

24. A diagnostic kit on a biological sample, characterized by the fact that it comprises the primer sets, comprising: (a) six primers, each, respectively, having a sequence at least 90% identical to SEQ ID NO: 61, SEQ ID NO: 62, SEQ ID NO: 63, SEQ ID NO: 64, SEQ ID NO: 65, and SEQ ID NO: 66; or (b) six primers, each, respectively, having a sequence at least 90% identical to SEQ ID NO: 67, SEQ ID NO: 68, SEQ ID NO: 69, SEQ ID NO: 70, SEQ ID NO: 71, and SEQ ID NO: 72; or (c) six primers, each, respectively, having a sequence at least 90% identical to SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, and SEQ ID NO: 6; or (d) six primers each, respectively, having a sequence at least 90% identical to SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11, and SEQ ID NO: 12; or (e) six primers, each, respectively, having a sequence at least 90% identical to SEQ ID NO: 13, SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 16, SEQ ID NO: 17, and SEQ ID NO: 18; or (f) six primers, each, respectively, having a sequence at least 90% identical to SEQ ID NO: 19, SEQ ID NO: 20, SEQ ID NO: 21, SEQ ID NO: 22, SEQ ID NO: 23, and SEQ ID NO: 24; or (g) six primers, each, respectively, having a sequence at least 90% identical to SEQ ID NO: 25, SEQ ID NO: 26, SEQ ID NO: 27, SEQ ID NO: 28, SEQ ID NO: 29, and SEQ ID NO: 30; or (h) six primers, each, respectively, having a sequence at least 90% identical to SEQ ID NO: 31, SEQ ID NO: 32, SEQ ID NO: 33, SEQ ID NO: 34, SEQ ID NO: 35, and SEQ ID NO: 36; or (i) six primers, each, respectively, having a sequence at least 90% identical to SEQ ID NO: 37, SEQ ID NO: 38, SEQ ID NO: 39, SEQ ID NO: 40, SEQ ID NO: 41, and SEQ ID NO: 42; or (j) six primers, each, respectively, having a sequence at least 90% identical to SEQ ID NO: 43, SEQ ID NO: 44, SEQ ID NO: 45, SEQ ID NO: 46, SEQ ID NO: 47, and SEQ ID NO: 48; or (k) six primers, each, respectively, having a sequence at least 90% identical to SEQ ID NO: 49, SEQ ID NO: 50, SEQ ID NO: 51, SEQ ID NO: 52, SEQ ID NO: 53, and SEQ ID NO: 54; or (l) six primers, each, respectively, having a sequence at least 90% identical to SEQ ID NO: 55, SEQ ID NO: 56, SEQ ID NO: 57, SEQ ID NO: 58, SEQ ID NO: 59 and SEQ ID NO: 60; or (m) a combination of (a) and (b); or (n) the combination of (c) and (d); or (p) the combination of (f) and (g); or (q) the combination of (h) and (i); or (r) the combination of (j) and (k).

25. Oligonucleotide, characterized by having a sequence as defined in SEQ ID NO: 1 to SEQ ID NO: 72, or a sequence having 90% identity therewith.

Description

BRIEF DESCRIPTION OF THE IMAGES

[0023] The detailed description presented below makes reference to the attached figures and their respective reference numbers.

[0024] FIG. 1 illustrates a perspective view of an optional setting of the LAMP assay device that promotes isothermal RNA/DNA amplification applied to pathogen identification of the present invention.

[0025] FIGS. 1a, 1b and 1c illustrate front, side and top views, respectively, of the LAMP assay device of FIG. 1.

[0026] FIG. 2 illustrates an exploded view of the LAMP assay device setting that promotes isothermal RNA/DNA amplification applied to pathogen identification from FIG. 1.

[0027] FIG. 3 illustrates an isolated top view of the thermoblock of FIG. 2

[0028] FIG. 3a illustrates a view of the thermoblock from FIG. 3 with microtubes inserted into the openings for positioning microtubes.

[0029] FIG. 3b illustrates a sectional view of the thermoblock from FIG. 3a.

[0030] FIG. 3c illustrates a sectional view of the thermoblock of FIG. 3a with a focus on an opening for positioning microtubes.

[0031] FIG. 4 illustrates an optional setting of the hardware architecture of the LAMP assay device of the present invention.

[0032] FIG. 5 illustrates the reaction disclosure using specific pH difference color change displaceable probe, according to an experiment performed using the LAMP assay device of the present invention for detection of SARS-CoV-2.

[0033] FIG. 6 illustrates the strategy for the design of primers F3/B3; FIP/BIP; LF/LB using the N gene of SARS-CoV-2, according to experiments performed.

[0034] FIG. 7 illustrates a comparison between samples that were positive for SARS-CoV-2.

DETAILED DESCRIPTION OF THE INVENTION

[0035] Preliminarily, it is emphasized that the following description will start from a preferred embodiment of the invention. As it will be evident to anyone skilled in the subject, however, the invention is not limited to this specific embodiment.

[0036] Particularly, the use of the device of the present invention for the rapid molecular detection of SARS-CoV-2 RNA will be described in more detail. However, obviously, the invention provides a LAMP assay device that promotes isothermal RNA/DNA amplification applied to the identification of different pathogens, for example, Dengue, Zika, and Chikungunya, among others. It should be noted that in the following paragraphs, for textual simplification purposes, the invention will be referred to simply as the LAMP device, which will certainly not cause confusion to an attentive reader.

[0037] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as understood by any person skilled in the art to which the invention pertains. The terminology used in describing the invention is intended to describe particular realizations only, and is not intended to limit the scope of the teachings. Unless otherwise indicated, all figures expressing quantities, percentages and proportions, and other numerical values used in the descriptive report and in claims, are to be understood as being modified in all cases by the term “about”. Thus, unless otherwise stated, the numerical parameters shown in the descriptive report and in the claims are approximations that may vary, depending on the properties to be obtained.

[0038] FIG. 1 illustrates a perspective view of an optional configuration of the LAMP assay device that promotes isothermal RNA/DNA amplification applied to pathogen identification of the present invention. FIGS. 1a, 1b and 1c illustrate front, side and top views, respectively, of the LAMP assay device of FIG. 1.

[0039] According to this configuration, the LAMP device externally comprises: a LAMP assay chamber 1; a power source 7 capable of being connected to a power entry point (optionally, a battery can be used); a top lid 2; a bottom lid 6; an electronics cabinet 4, where the electronic control devices are positioned; a sensor 3 for closing the top lid 2; and a button 5 for actuation.

[0040] With respect to the power source 7, the LAMP device of the present invention can be connected to an outlet or a mobile battery that provides the power required for its operation, so this feature does not represent a limitation to the scope of the invention.

[0041] It is emphasized that the position of the elements indicated in this figure is optional, so that other settings can be adopted, where the more general setting of the present invention will be defined by the main claim, as known to any person skilled in the art.

[0042] FIG. 2 illustrates an exploded view of the LAMP assay device setting that promotes isothermal RNA/DNA amplification applied to pathogen identification from FIG. 1. Internally the LAMP device comprises: a metal cylindrical microtube thermoblock 8 comprising openings 80 for positioning microtubes 81; a control board with central processing 14; a power electronics board 13; a heating element 10 connected to the thermoblock 8 and adapted to heat the thermoblock 8 by induction; a temperature sensor 9 adapted to measure the temperature of the thermoblock 8; RGB LEDs positioned at the bottom of a darkroom, next to the camera 11 and adapted to excite each microtube positioned in the thermoblock 8; and a camera 11 positioned below the thermoblock (8) and adapted to capture images of each of the microtubes positioned in the thermoblock 8.

[0043] In the setting illustrated in the figures of this report, the thermoblock 8 comprises a cylindrical anodized aluminum block with ten openings adapted to fairly accommodate ten 81 microtubes of 0.2 mL each. The cylindrical shape of the thermoblock 8, as well as the tight fit (no gaps) between each microtube and the thermoblock 8, ensure concurrent and uniform heating and homogeneous temperature control inside each of the microtubes 81 positioned in the openings.

[0044] Heating takes place as follows, the heater element 10 is in contact with thermoblock 8 and heats thermoblock 8 by induction. Since the thermoblock 8 is metallic (preferably made of anodized aluminum) it is heated quickly and substantially uniformly. Thus, the microtubes are also heated quickly and evenly, as they are tightly fitted to each of the openings 80. Thus, the invention ensures rapid and uniform heating of each of the samples inside the microtubes.

[0045] The number of heating elements 10 adopted for the thermoblock 8 may vary in different embodiments of the invention, in particular in dependence on the number of openings 80 for microtubes 81 available in the thermoblock 8. In optional settings of the invention, in which a plurality of openings 80 for microtubes 81 is adopted, more than one heating element 10 may be adopted, distributed in different ways with the aim of providing the fastest and most uniform heating possible of the thermoblock 8, and consequently of the microtubes 81 placed therein.

[0046] Thus, in summary, the invention provides for the adoption of at least one heating element 10, and more than one can be adopted (even as many as deemed necessary) according to specific applications, without departing from the scope of protection of the invention.

[0047] It should be noted that the resistors of the heating element 10 are controlled electronically by the control board with central processing 14. Thus, once the final temperature to be used in the experiment is programmed, the control board with central processing 14 will control the heating of the support until the temperature sensor 9 identifies that the desired temperature has been reached. From that point on, the control board with central processing 14 will control the heating element 10 to maintain the desired temperature throughout the experiment.

[0048] FIG. 3 illustrates an isolated top view of the thermoblock 8 from FIG. 2, FIG. 3a illustrates a view of the thermoblock 8 from FIG. 3 with microtubes inserted into the openings 80 for positioning the microtubes, FIG. 3b illustrates a sectional view of the thermoblock 8 from FIG. 3a, and FIG. 3c illustrates a sectional view of the thermoblock from FIG. 3a with a focus on an opening 80 for positioning microtubes.

[0049] The invention further provides that the LAMP reaction promoted using the described LAMP device is combined with a detection method. An example is the detection via alteration of color due to the difference in pH of the positive samples, which become acid—by the liberation of protones during the DNA amplification process—and in the presence of phenol red, turn yellow, different from the negative, non-amplified samples, which present a pinkish shade. In particular examples, the colored dye comprises cresol red, phenol red, m-cresol purple, bromocresol purple, neutral red, naphtholphtalein, thymol blue. In some examples, the pH sensitive indicator dye is a colored dye detectable in visible light. In other examples, the pH-sensitive indicator dye is a fluorescent indicator dye, including but not limited to 2′,7-bis-(2-carboxyethyl)-5 (6) carboxyfluoresceinna, 5 (6)-carboxy-21,71-dichlorofluorescein, 5(6) carboxyfluorescein, 3,6-diacetoxyphthalonitrile, 6,8-dihydroxy-1,3-pyrenedisulfonic acid, or 5-(e-6)-carboxyl seminaftorhodafluor.

[0050] It is possible to use other agents that reveal characteristics intrinsic to the reaction, such as the reduction of available magnesium ions by precipitation with the pyrophosphate. Dyes such as hydroxynaphthol blue (HNB) are able to detect this difference in magnesium ions and turn from purple, or dark blue, to sky blue.

[0051] This same characteristic of magnesium pyrophosphate precipitation in isotopic amplification reactions results in turbidity of positive samples, which occurs due to an increasing amount of magnesium pyrophosphate precipitate in solution as a byproduct of amplification. Turbidity is measured by visual inspection upon completion of the reaction or in real time using a turbidimeter.

[0052] Another way of detection is by chromatography (or migration) on a 2% agarose gel treated with ethidium bromide or any fluorescent DNA intercalator such as SYBR green or GelRed.

[0053] The invention also provides for the use of fluorescent intercalating agents, such as SYBR Green, SYTO 9, SYTO 13, SYTO 16, SYTO 24, SYTO 60, SYTO 62, SYT 64, SYTO 82, SYBR Gold, YOPRO-1, TOTO-1, TOTO-3, BOBO3, POPO3 and TOPRO3 (Invitrogen), Eva Green (Biotium), Boxto (TATA Biocentre), Miami Green, Miami Yellow, Miami Orange (Kerafast), Pico 488 (Lumiprobe), malachite green, without necessarily using agarose gel band resolution

[0054] In a further embodiment, the invention comprises the use of displaceable fluorescent probes for detection, which bind with high specificity to their targets. Thus, the camera 11 positioned inferiorly to the thermoblock 8 is adapted to capture the fluorescence emitted by the probes present in the amplification reaction. Examples of fluorescent dyes that may be used in the invention include, for example, calcein, Mag-Fura-2, and Magnesium green (Life Technologies, Grand Island, N.Y.) and Fluo-2Mg, Fura-2Mg. Indo-1 Mg, and Asante Magnesium green (TEF Labs, Austin, Texas). Fluorescence is detectable using an instrument, such as a fluorimeter that may be associated with a real-time PCR thermal cycler, making up a single system.

[0055] To allow accurate reading of the reaction result, as illustrated in FIGS. 3, 3a, 3b, and 3c preferably, the openings 80 for positioning microtubes 81 are angled at an angle of approximately 45° (can vary substantially between 38° and 52°, as illustrated in FIG. 3c).

[0056] It should be noted that the dimensions illustrated in FIG. 3c represent only an optional setting of a realized prototype of the invention, whereby these specific dimensions may vary according to the embodiment performed. Thus, the invention is not limited to that specific embodiment illustrated in that figure.

[0057] The thermoblock 8 further comprises an opening 82 in the lower inner portion of each opening 80 for positioning microtubes 81. Thus, through opening 82, a light is allowed to be excited with four fluorescence signal bands (or light channels from RGB LEDs) available, and it is also possible for the camera 11 to capture the image of each microtube.

[0058] The reading of fluorescence in different bands enables the concurrent detection of different targets and the quantification of the charge present in the sample, by using different probes labeled in the same reaction.

[0059] Optionally, a control board with central processing in which the processor is a 64-bit QuadCore 1.4 GHz ARMV8 (code: BCM2837B0) was adopted due to the simplicity of programming for a prototype in which the invention was tested. However, any other control board with central processing can be adopted to perform the functions defined in this report.

[0060] It is important to point out that the control board with central processing (14) is responsible for managing the entire performance of the assays, namely: perform the processing of the images captured by camera 11; control the temperature inside the assay chamber 1 LAMP, perform the automatic detection of the assay through image processing, and perform the communication with a graphical interface software compatible with tablet, computer, smartphone, etc.

[0061] Preferably, the communication between the control board with central processing 14 and the user device is performed by wireless technology, preferably bluetooth. However, in alternative settings, communication can be accomplished in different ways including wireless ways, or with cables.

[0062] FIG. 4 illustrates an optional setting of the hardware architecture of the LAMP device of the present invention.

[0063] Thus, in a more broadly way, the LAMP assay device that promotes isothermal RNA/DNA amplification applied to pathogen identification of the present invention comprises: a LAMP assay chamber 1; an electronics cabinet, a power supply means 7; and a top lid 2 for closing the LAMP assay chamber 1, internally the device comprises: a cylindrical metal thermoblock 8 comprising openings 80 for positioning microtubes 81; a control board with central processing 14; a power electronics board 13; at least one heating element 10 in contact with the thermoblock 8 and adapted to heat the thermoblock 8 by induction; a temperature sensor 9 adapted to measure the temperature of the thermoblock 8; a plurality of RGB LEDs 12 positioned below the thermoblock 8; and a camera 11 positioned below the thermoblock (8) adapted to capture images of each of the microtubes positioned in the thermoblock 8. According to this more general setting, the control board with central processing (14) further comprises means for communicating with a mobile user device (such as a smartphone, a computer, a tablet, etc.) and is adapted to control the temperature of the thermoblock 8 according to a schedule established by controlling the heating element 10 and in response to the signal of the temperature sensor 9. It is also adapted to perform the processing of the images captured by camera 11.

[0064] Optionally, there is a visual operation warning element to inform a user about the status of the device. Preferably, this element is an LED positioned externally to the LAMP device to indicate the condition of the device.

[0065] The device can further adopt a lid-closing sensor 3 in communication with the central processing control board (14), where the central processing control board (14) is adapted to allow the device to operate only when the top lid 2 is closed. The lid-closing sensor can be any that is known from the state of the art, so this does not represent a limitation to the scope of the invention.

[0066] Thus, for the use of the described device, the top lid 2 is opened to allow microtubes 81 to be inserted into each opening 80 to position microtubes 81 from thermoblock 8. As described, the number of openings 80 for positioning microtubes 81 can vary in different settings of the invention. The specific model illustrated in this report adopts a total of ten openings. However, as already described, the number of openings can vary in different embodiments of the invention, without departing from the scope of protection of the claims.

[0067] After closing the top lid 2, the lid-closing sensor 3 unlocks the operation of the device that can proceed with the assay. If the lid is not properly closed, an error signal/alert can be sent for the user to correct the problem (close the lid properly). This signal can be a visual signal on the device itself, or a message (visual and/or audible and/or by vibration of the user device) can be sent to the user device informing the user of the identified problem.

[0068] From this point on, the user interaction with the LAMP device takes place via the user device that is in communication with the control board with central processing (14). Then the user selects the diagnostic reaction to be performed (Dengue, Zika, Chikungunya, Yellow Fever, Covid-19, etc) through an application on the user device, which will start a process that contains the following steps: [0069] activate at least one heating element 10 to raise the temperature of the thermoblock 8 to a preset temperature for the defined diagnostic reaction; [0070] maintain the temperature of the thermoblock 8 at the preset temperature for a preset period of time for the defined diagnostic reaction, and turn off the heating element 10; [0071] turn on the plurality of RGB LEDs 12 for the excitation of each microtube (sample) positioned in the thermoblock 8; [0072] capture the values with camera image 11 for each position of each microtube and for each of the excitation colors, and send this information to the user device; [0073] process the information received by the user device, which involves the conversion of image information from RGB to chrominance and check in which region of the 2D plane each value is located; [0074] define a positive or negative diagnosis for each microtube (sample) from the processing of the information; [0075] perform real-time readings using displaceable probes to construct a fluorescence vs time curve (optional); [0076] display the diagnostic result of each microtube through the user device; [0077] store the diagnostic result of each microtube in a local database (optional); and [0078] send the diagnostic result of each microtube to a database in the cloud (optional).

[0079] More specifically, the step of capturing values with camera image 11 for each microtube, and for each of the excitation colors, can further include using the green, red, and orange fluorophores, for example.

[0080] At the end of the process, it is also possible that a cooling device (optionally a fan) is activated to cool down assay chamber 1 of the LAMP device.

[0081] From what has been described so far, and in view of the recent developments related to the COVID-19 pandemic the world faces, experiments were conducted in which the LAMP device of the invention was tested to verify its applicability in performing assays for the identification of those contaminated by COVID-19.

[0082] In this sense, the use of the Loop Mediated Isothermal Amplification (LAMP) technique for rapid molecular detection of nucleic acids in biological samples has been proposed.

[0083] The LAMP technique is characterized by its high specificity and sensitivity that generates amplified nucleic acids in a short interval of time by using a DNA polymerase with chain shift activity (Notomi et al., Nucl. Acids. Res. 28:E63, 2000). LAMP can also be used to amplify a target RNA molecules by adding reverse transcriptase (RT) in a single-step reaction by using constant temperature, and is called RT-LAMP. This methodology is used to diagnose pathogens from biological samples. For example, these pathogens can be Zika, Dengue, Chikungunya, Yellow Fever, and SARS.CoV-2, among others.

[0084] In one embodiment, this technique can be used for molecular detection of SARS-CoV-2 RNA in biological samples, preferably from oropharyngeal and nasopharyngeal swabs and saliva, sputum, bronchoalveolar lavage, etc.

[0085] In this regard, the biological samples to which the present invention refers to are the oropharyngeal and nasopharyngeal swabs, saliva, bronchoalveolar lavage, among others containing nucleic acids, which can be isolated from the group comprising, but not limited to: cells, tissues, blood, serum, plasma, saliva, urine, cerebrospinal fluid, nasopharyngeal aspirates, middle ear fluids, bronchoalveolar lavage, tracheal aspirates, sputum, vomit, buccal swab, vaginal swab, rectal swab, and feces. The samples can be used directly in the amplification reaction. In another embodiment, the samples are first treated with lysis buffer or heat treated, prior to their addition to the reaction means. The methodologies for isolating/extracting nucleic acids from samples are widely known to any person skilled in the art.

[0086] The LAMP-Loop mediated isothermal amplification technique employs a set of at least 4 four primers (2 pairs, an inner pair and an outer pair) that bind to six distinct regions within the target molecule. Forward inner primers (FIP) and Backward Inner Primer (BIP) have two distinct annealing regions: the F2 region, in the case of FIP, and B2 region, in the case of BIP, are located in the 3′ portion of the primers and pair directly with the target molecule; the F1c and B1c regions are sequences complementary and inverted to an internal region of the target molecule strand that will be polymerized by the F2 and B2 regions, respectively. The external primers, F3 and B3, are externally paired to the internal primers, so that their function is to serve as an anchor point for the DNA polymerase to invade the strand formed in the polymerization initiated by the F2/B2 region. In some embodiments, two more primers (2 pairs) that bind to the loop can be used (LoopF or LF—Forward loop primer, and LoopB or LB—Backward loop primer), making a total of 6 primers and 8 binding regions.

[0087] For purposes of this invention, “primer” refers to an enzymatically extendable oligonucleotide comprising a defined sequence that is designed to hybridize in an antiparallel way with a complementary portion of a target nucleic acid sequence. Therefore, the primer is usually provided in molar excess relative to its target nucleic acid sequence. A primer does not need to be 100% complementary to its target for the elongation to occur; primers with less than 100% complementarity may be sufficient for hybridization and enzyme for the elongation to occur. A primer is preferably, but not necessarily, synthetic, and is usually about 10 to about 100 nucleotides in length. In addition, for purposes of this invention, sequences with at least about 85%, more preferably at least about 90%, 95%, 96%, 97%, 98% or 99% of identity with the primers described herein are included, as measured by well-known sequence identity assessment algorithms such as FASTA, BLAST or Gap.

[0088] Unlike the PCR technique, in the LAMP technique the use of a thermocycler is not necessary and the reaction preferably takes place at a constant temperature, most preferably the temperature is between 60¬70° C., and even more preferably 60-65° C. The reaction time can vary between 10 and 120 minutes, more preferably between 15 and 90 minutes, even more preferably between 20 and 60 minutes.

[0089] The DNA polymerase used is selected from the group consisting of DNA polymerase Bst, DNA polymerase Bsm, DNA polymerase Gsl and DNA polymerase SD and combinations thereof. In particular, the DNA polymerase enzyme is DNA polymerase Bst.

[0090] The reverse transcriptase (RT) used in the RT-LAMP reaction can be any RT enzyme appropriate for the assay, which can be selected by the person skilled in the art. In some embodiments, the RT enzyme is from avian myeloblastosis virus (AMV) or Moloney murine leukemia virus (MMLV).

[0091] It is worth noting that the LAMP device of the invention meets point-of-care (POC) criteria and may be useful for the decentralization and democratization of molecular diagnosis of COVID-19.

[0092] Furthermore, the use of inputs for molecular diagnosis of COVID-19, unlike those used for the RT-PCR technique, takes the focus off an international dispute and favors diversification in the search for alternative solutions, giving a chance for the test to reach those who need it most, the patient or health professional suspected of contamination.

[0093] For detection purposes, probes and primers can include a detectable label, such as a radiolabel, fluorescent dye, biotin, enzyme, or chemiluminescent compound, where the label can be provided before, during, or after hybridization of the probe or primer to the target sequence or its complement.

[0094] For purposes of this invention, the term “probe” is a nucleic acid molecule that has, attached to it, a detectable label or reporter molecule. The probe size is, for example, at least 10 nucleotides or more in length, such as 10-60, 15-50, 20-40, 20-50, 25-50, 30-60 nucleotides. The detectable labels or reporter molecule may comprise fluorescent and fluorogenic labels (e.g., fluorophores), chromogenic portions, haptenes (such as biotin, digoxigenin, and fluorescein), affinity labels, and radioactive isotopes (such as 32P, 33P, 35S, and 125I). The label may be directly detectable (e.g. optically detectable) or indirectly detectable (e.g. through interaction with one or more additional molecules that are, in turn, detectable). For this application, the technique of displaceable probes, in which the LF primer is functionalized with fluorescent (fluorophore) labels, whose output is specific to the selected target with higher sensitivity than RT-PCR, may be used. The result of this test can also be verified by the migration of the reaction product, illustrated in FIG. 5 which shows the image of six reaction microtubes using a specific displaceable probe of pH difference color change where the two tubes on the right of the image have different colors and that such differences can be detected by the device's image processing.

[0095] In a preferred embodiment of the present invention, the labels include a fluorescent and a quencher portion.

[0096] The fluorescent fraction emits light energy at a specific emission wavelength when excited by light energy at an appropriate excitation wavelength. When the fluorescent portion and the quencher portion are held in close proximity, the light energy emitted by the fluorescent portion is absorbed by the quencher portion. But when a probe hybridizes with the nucleic acid present in the sample, the fluorescent and quencher portions are separated from each other by the action of DNA polymerase Bst and the light energy emitted by the fluorescent portion can be detected. Fluorescent portions that are excited and emit at different, distinguishable wavelengths can be combined with different probes. Different probes can be added to a sample, and the presence and amount of target nucleic acids associated with each probe can be determined by alternately exposing the sample to light energy at different excitation wavelengths and measuring the light emission from the sample at the different wavelengths corresponding to the different fluorescent portions.

[0097] The fluorophores that can be used in the probes and primers disclosed herein can be selected from the group comprising: acridine and acridine isothiocyanate, 4-amino-N [3-vinyl-sulfonyl) phenyl] naphthalimide-3,5 disulfonate (Lucifer Yellow VS); Brilliant Yellow; coumarin and derivatives such as 7-amino-4-methylcoumarin (AMC, Coumarin 120), 7-amino-4-trifluoromethylcouluarin (Coumaran 151); cyanine; 4′,6-diaminidino-2-phenylindole (DAPI); etidium; -fluorescein and derivatives such as 5-carboxyfluorescein (FAM), 2′7′-dimethoxy-4′51-dichloro-6-carboxyfluorescein (JOE), fluorescein, 6-carboxy-fluorescein (HEX) and TET (tetramethyl fluorescein); Phenol red; rhodamine and derivatives such as 6-carboxy-X-rodamine (ROX), rhodamine (Rhod), rhodamine B, rhodamine 123, rhodamine X isothiocyanate, N,N,N′N′-tetramethyl-6-carboxyrodamine (TAMRA); sulforodamine B; sulforodamine 101 and sulforodamine 101 sulfonyl chloride derivative (Texas Red); LightCycler Red 640; Cy5.5; and Cy56-carboxyfluorescein; other fluorophores include Cy3; CyS, VIC (from Applied Biosystems); LC Red 640; LC Red 705; and Quasar® 570, Quasar® 670, CalRed 590, CalRed 610, CalRed 615, CalRed 635, CalGreen 520, CalGold 540 and CalOrange 560 (Biosearch Technologies, Novato, California).

[0098] The present invention also includes diagnostic kits. As described herein, the diagnostic kit of the invention is based on loop-mediated isothermal amplification assay (LAMP) to amplify a target region within a target pathogen, comprising, but not limited to Zika, Dengue, Chikungunya, Yellow Fever and SARS-CoV, in a sample, wherein the kit comprises: [0099] (1) a mixture of primers designed to amplify a pathogen sequence by loop-mediated isothermal amplification assay, thereby producing at least one reaction product.

[0100] In an exemplary way, primers are those described in SEQ ID NOS: 1-6, or sequences with at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% of identity to them.

[0101] In another exemplary way, the primers are those described in SEQ ID NOS: 7-12, or sequences with at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% of identity to them.

[0102] In another exemplary way, the primers are those described in SEQ ID NOS: 13-18, or sequences with at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% of identity to them.

[0103] In another exemplary way, the primers are those described in SEQ ID NOS: 19-24, or sequences with at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% of identity to them.

[0104] In another exemplary way, the primers are those described in SEQ ID NOS: 25-30, or sequences with at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% of identity to them.

[0105] In another exemplary way, the primers are those described in SEQ ID NOS: 31-36, or sequences with at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% of identity to them.

[0106] In another exemplary way, the primers are those described in SEQ ID NOS: 37-42, or sequences with at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% of identity to them.

[0107] In another exemplary way, the primers are those described in SEQ ID NOS: 43-48, or sequences with at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% of identity to them.

[0108] In another exemplary way, the primers are those described in SEQ ID NOS: 49-54, or sequences with at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% of identity to them.

[0109] In another exemplary way, the primers are those described in SEQ ID NOS: 55-60, or sequences with at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% of identity to them.

[0110] In another exemplary way, the primers are those described in SEQ ID NOS: 61-66, or sequences with at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% of identity to them.

[0111] In another exemplary way, the primers are those described in SEQ ID NOS: 67-72, or sequences with at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% of identity to them.

[0112] The primer sets are supplied in one or more containers, microtubes, multiwell plates, or cards. The primers can be provided suspended in an aqueous solution or as a lyophilized powder, for example.

[0113] In another form of embodiment, the kit may further comprise, in addition to (1) above: [0114] (2) a nucleic acid probe comprising a polynucleotide of at least 10 nucleotides in length that is sufficiently complementary to the amplified region, in such way that the nucleic acid probe and the amplification product are hybridisable, where the probe is conjugated with a detectable label or reporter molecule.

[0115] Preferably, the probe comprises the primer LF (or LB), or a sequence with at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% with such, functionalized with a detectable label or reporter molecule.

[0116] In another form of embodiment, the kit may further comprise, in addition to (1) above: [0117] (2′) includes a pH sensitive indicator dye.

[0118] In some embodiments, the kit still includes one or more components for performing the LAMP or RT-LAMP reaction, for example, buffer, DNA polymerase, reverse transcriptase, dNTPs, or any combination thereof.

[0119] One or more primers or nucleic acids used as a positive and/or negative control can be part of the kit. Examples of negative controls include any nucleic acids from pathogens other than those that are detected by the kit (e.g., non-SARS-Cov-2 nucleic acid for a kit for detection of SARS-Cov-2, a non-zika nucleic acid for a kit for detection of zika virus, and so on).

[0120] The following examples are provided to illustrate particular embodiments. These examples should not be understood as limiting to the invention.

EXAMPLES

Example 1: Exemplary Primers of the Invention

[0121] As a target for nucleic acid detection in biological samples, the present invention illustratively discloses the primers from tables 1 to 10.

TABLE-US-00001 TABLE 1 Zika Primers Iniciador Sequências Set1_F3 GCAGAGCAATGGATGGGATA (SEQ ID NO: 1) Set1_B3 CCCATCCTTGAGGTACAGCT (SEQ ID NO: 2) Set1_FIP AACCTGAGGGCATGTGCAAACC GCGGTCAGTGGAGATGACT (SEQ ID NO: 3) Set1_BIP CACAGGAGTGGAAACCCTCGAC TGAAGTGGTGGGAGCAGAA (SEQ ID NO: 4) Set1_LF TCGATTGGCTTCACAACGC (SEQ ID NO: 5) Set1_LB GGAGCAATIGGGAAGAAGTCC (SEQ ID NO: 6)

TABLE-US-00002 TABLE 2 Dengue Primers Iniciador Sequências Set1_F3 GCTGTACQCACGGTGTAG (SEQ ID NO: 7) Set1_B3 CCTGGAATGATGCTGAGGAG (SEQ ID NO: 8) Set1_FIP GGTACAGCTTCCCTCAGTGC TCGTGGTTAGAGGAGACCCC T (SEQ ID NO: 9) Set1_BIP AGAGGTTAGAGGAGACCCCC CAGCAGGATCTCTGGTCTCT C (SEQ ID NO: 10) Set1_LP CTGCTGCGTTGTGTCAT (SEQ ID NO: 11) Set1_LB CAGCATATTGACGCTGG (SEQ ID NO: 12)

TABLE-US-00003 TABLE 3 Chikinuninva Primers Iniciador Sequências Set1_F3 CGTCAACGTACTCCTAAC (SEQ ID NO: 13) Set1_B3 ACGTTGGCTTTRTTTTGG (SEQ ID NO: 14) Set1_FIP GAAGTTTCCTTTCGGTGG GTTTTTGGAAGACACTYT CYGG (SEQ ID NO: 15) Set1_BIP AAGGAGTGGGAGGTGGATT TTTTCAYTTGGTGACTGCA G (SEQ ID NO: 16) Set1_LF AGCGTCTTTATCCACGGG (SEQ ID NO: 17) Set1_LB AYGCATCRATAATGGCGG G (SEQ ID NO: 18)

TABLE-US-00004 TABLE 4 Yellow Fever Primers Iniciador Sequências Set1_F3 TCCACACCTTGGAGGCATTA (SEQ ID NO: 19) Set1_B3 GTCCATCACAGTTGCCATCA (SEQ ID NO: 20) Set1_FIP GGCCTCCGATTGATCTCGGC LEtt GTGTGAGTGGCCACTGAC (SEQ ID NO: 21) Set1_BIP GGTTCAGACGAACGGACCTT GGCCCTGGGCAAGCTTCTCT (SEQ ID NO: 22) Set1_LF CTTCAACTGATGTTCCAATC GTATG (SEQ ID NO: 23) Set1_LB ATGCAGGTACCACTAGAAGT GA (SEQ) ID NO: 24)

TABLE-US-00005 TABLE 5 N gene SARS-COV2 Primers Iniciador Sequências SARSCov2_ TGGCTACTACCGAAGAGCT gNSet1_F3 (SEQ ID NO: 25) SARSCov2_ TGCAGCATTGTTAGCAGGAT gNSet1_B3 (SEQ ID NO: 26) SARSCov2_ TCTGGCCCAGTTCCTAGGTAGT gNSet1_FIP GACGAATTCGTGGTGGTGA (SEQ ID NO: 27) SARSCov2_ AGACGGCATCATATGGGTTGCA gNSet1_BIP CGGGTGCCAATGTGATCT (SEQ ID NO: 28) SARSCov2_ TGGACTGAGATGTTTCATTTTACCG gNSet1_LF (SEQ ID NO: 29) SARSCov2_ ACTGAGGGAGCCTTGAATACA gNSet1_LB (SEQ ID NO: 30) SARSCov2_ TGGACCCCAAAATCAGCG gNSet2_F3 (SEQ ID NO: 31) SARSCov2_ GCCTTGTCCTCGAGGGAAT gNSet2_B3 (SBQ ID NO: 32) SARSCov2_ CCACTGCGTTCTCCATTCTGGTAAA gNSet2_FIP TGCACCCCGCATTACG (SEQ ID NO: 33) SARSCov2_ CGCGATCAAAACAACGTCGGCCCTT gNSet2_BIP GCCATGTTGAGTGAGA (SEQ ID NO: 34) SARSCov2_ TGAATCTGAGGGTCCACCAAA gNSet2_LF (SEQ ID NO: 35) SARSCov2_ GGTTTACCCAATAATACTGCGTCTT gNSet2_LB (SEQ ID NO: 36)

TABLE-US-00006 TABLE 6 E gene SARS-COV2 Primers Iniciador Sequências SARSCov2_ TGATGAGCCTGAAGAACATG gE_Set1_F3 (SEQ ID NO: 37) SARSCov2_ CGCTATTAACTATTAACGTACCT gE_Seti_B3 (SEQ ID NO: 38) SARSCov2_ TCGGTTCATCATAAATTGGT gE_Set1_FIP TCCATCAAATTCACACAA TCGACGG (SEQ ID NO: 39) SARSCov2_ ACGACTACTAGCGTGCCTTTG gE_Set1_BIP TCTCTTCCGAAACGAA TG (SEQ ID NO: 40) SARSCov2_ ACTGGATTAACAACTCCGGATGA gE_Sett_LF (SEQ ID NO: 41) SARSCov2_ GTAAGCACAAGCTGATGAGTACGAA gE_Set1_LB (SEQ ID NO: 42) SARSCov2_ TTGTAAGCACAAGCTGATG gE_Set2_F3 (SEQ ID NO: 43) SARSCov2_ AGAGTAAACGTAAAAAGAAGGTT gE_Set2_B3  (SEQ ID NO: 44) SARSCov2_ CGAAAGCAAGAAAAAGAAGT gE_Set2_FIP ACGCTAGTACGAACTT ATGTACTCATTCG (SEQ ID NO: 45) SARSCov2_ TGGTATTCTTGCTAGTTACACT gE_Set2_BIP AGCAAGACTCACGTTAACAATA TTGC (SEQ ID NO: 46) SARSCov2_ ACGTACCTGTCTCTTCCGAAA gE_Set2_LF (SEQ ID NO: 47) SARSCov2_ CATCGTTACTGCGCTTCGATT gE_Set2_LB (SEQ ID NO: 48)

TABLE-US-00007 TABLE 7 RdRn gene SARS-COV2 Primers Iniciador Sequências SARSCov2_RdRp_ CTGTCAAATTACAGAATAAT Set1_F3 GAGC (SEQ ID NO: 49) SARSCov2_RdRp_ TCCATCACTCTTAGGGAATC Set1_B3 (SEQ ID NO: 50) SARSCov2_RdRp_ TGTCATCAGTGCAAGCAGTT Set1_ FIP TGGTGTTGCACTACGACAGA (SEQ ID NO: 51) SARSCov2_RdRp_ ATGCGTTAGCTTACTACAAC Set1_BIP ACACCCATTTCAAATCCTGT AAATCG (SEQ ID NO: 52) SARSCov2_RdRp_ ACCGGCAGCACAAGACA Set1_LF (SEQ ID NO: 53) SARSCov2_RdRp_ ACAAAGGGAGGTAGGTTTG Set1_LB TACT (SEQ ID NO: 54)

TABLE-US-00008 TABLE 8 N2 gene SARS-COV2 Primers Iniciador Sequências N2_F3 ACCAGGAACTAATCAGACAAG (SEQ ID NO: 55) N2_B3 GACTTGATCTTTGAAATTTGGATCT (SEQ ID NO: 56) N2_FIP TTCCGAAGAACGCTGAAGCGGAAC TGATTACAAACATTGGCC (SEQ ID NO: 57) N2_BIP CGCATGCATGGAAGTCACAATTTG ATGGCACCTGTGTA (SEQ ID NO: 58) N2_LF GGGGGCAAATTGTGCAATTTG (SEQ ID NO: 59) N2_LB CTTCGGGAACGTGGTTGACC (SEQ ID NO: 60)

TABLE-US-00009 TABLE 9 E1 gene SARS-COV2 Primers Iniciador Sequências E1_F3 TGAGTACGAACTTATGTACTCAT (SEQ ID NO: 61) E1_B3 TTCAGATTTTTAACACGAGAGT (SEQ ID NO: 62) E1_FIP ACCACGAAAGCAAGAAAAAGAAG TTCGTTTCGGAAGAGACAG (SEQ ID NO: 63) E1_BIP TTGCTAGTTACACTAGCCATCGT TAGGTTTTACAAGACTCACGT (SEQ ID NO: 64) E1_LF CGCTATTAACTATTAACG (SEQ ID NO: 65) E1_LB GCGGTTCGATTGTGTGCGT (SEQ ID NO: 66)

TABLE-US-00010 TABLE 8 As le gene SARS-COV2 Primers Iniciador Sequências Asle_F3 CGGTGGACAAATTGTCAC (SEQ ID NO: 67) Asle_B3 CTTCTCTGGATTTAACACACTT (SEQ ID NO: 68) Asle_FIP TCAGCACACAAAGCCAAAAA TTTATTTTTCTGTGCAAAGG AAATTAAGGAG (SEQ ID NO: 69) Asle_BIP TATTGGTGGAGCTAAACTTAA AGCCTTTTCTGTACAATCC CTTTGAGTG (SEQ ID NO: 70) Asle_LF TTACAAGGTTAAAGAATGTCT GAACACT (SEQ ID NO: 71) Asle_LB TTGAATTTAGGTGAAACATTTG TCACG (SEQ ID NO: 72)

Example 2: COVID-19 Diagnosis

[0122] In one example embodiment, the methodology disclosed by the present invention uses as targets for detection of SARS.CoV-2 RNA two regions of the N gene that encodes for the nucleoprotein, as illustrated in FIG. 6. This target has proven to be specific and does not react with the RNA from other viruses as it was clear from the tests performed (FIG. 7).

[0123] However, it is also anticipated the utilization of other targets for detection of SARS-Cov-2 RNA, such as the gene encoding for the E and N2 proteins, and part of the lab ORF (NSP3, RdRp, As le).

[0124] The LAMP methodology with viral RNA is performed by means of amplification reactions by using the enzyme Bst 3.0 DNA Polymerase (New England Biolabs) or with a mixture containing Bst 2.0 DNA Polymerase WarmStart and RTx (New England Biolabs; in a reaction of 25 IttL of the final volume, containing the primers FIP, BIP, F3, B3 and the loops (LF/LB); dNTPs (1.4 mM of each); Tris-HCl buffer (20 mM); KCl (50 mM); (NH4)SO4 (10 mM); MgSO4 (8 mM); Tween 20 (0.1%); DTT (1 mM); with viral RNA. The reactions are optimized with a maximum of 0.1 ng of viral RNA per reaction. The mixture is incubated at 65° C./30-50 min.

[0125] It is important to emphasize that the LAMP amplification reaction takes place at the same time as reverse transcription (RT-LAMP one step) using Bst 3.0 DNA polymerase which also has the RNA as a template or in the presence of RTx and Bst 2.0 WarmSmart (New England Biolabs).

[0126] As indicated earlier in this report, a responsive WEB application with access on any user device with any available screen size, such as computer, tablet and smartphone, was developed for remote monitoring of the LAMP device of the invention. In this specific test, the application uses the JavaScript programming language, with ReactJS for the frontend and NodeJS for the backend. It has a Postgresql relational database to hold all the information, as well as a non-relational database such as MongoDB or Redis for quick consultations and management report processing.

[0127] The informations are transmitted encrypted to the server in AWS with a docker container system on Linux, allowing you to distribute the load of multiple accesses. In addition, all services provided through Telemedicine have the appropriate technological infrastructure, pertinent and obeying the security rules concerning storage, handling, data transmission, confidentiality, privacy, and guarantee of professional secrecy, according to the Brazilian legislation, CFM Resolution No. 1.643/2002.

[0128] The LAMP device of the present invention is a dedicated microprocessor-based computing device. The system is compatible with 10 microtubes 81 of 0.2 mL. The heating required for isothermal amplification (about 65° C.) is achieved and stabilized by activating ceramic resistor wires. The lid will be independently heated up to about 75° C., controlled by a PID (Proportional-Integrative-Derivative) algorithm. The working temperature range of the block will be 25° C. to 70° C. The temperature control will be ensured by the use of thermistors and PID algorithm. The power supply is bivolt 100/240 V; frequency: 50-60 Hz; consumption: 70 W. The system is operated via microcontroller by Arduino UNO R3 (ATmega328) that communicates with the smartphone by a low-power HM11 Bluetooth module. One of the Arduino's digital outputs supplies 5 V input using MOSFETs. A temperature sensor monitors the heating and sends a signal to the control board with central processing. The analog reading is converted into a temperature that will be continuously monitored to operate the heating in an isothermal manner using pulse width modulation.

[0129] Samples collected by nasal and throat swabs from patients with suspected COVID-19 are collected and diluted in 2 mL of DMEM culture means and 3 IttL used to perform the isothermal amplification reaction on the device.

[0130] For the RT-LAMP reaction in 96-well plates, 12.5 zuL of the “WarmSmart Colorimetric Lamp 2X Master mix” reagent (New England Biolabs, M1800) are used in the presence of DEPC-treated ultrapure water and the SARS-CoV-2-specific primers. 3 zuL of sample containing RNA are used. Controls are used in the absence of RNA (negative) and internal reaction controls. The plate is incubated at 65° C. for 30 min. Alternatively, the same process is repeated in the presence of a DNA intercalator, SYTO-9, to evaluate the quantitative profile using real-time PCR thermal cycler. The sensitivity and specificity of LAMP reactions are compared with RT-PCR.

[0131] The World Health Organization—WHO has recommended a large-scale testing for every suspected case of COVID-19 and immediate isolation for cases where testing is positive. Such actions are the main weapons in the fight against spreading the virus, since it makes possible to break the chain of transmission. Therefore, the improvement, expansion, and diagnostic speed in COVID are of strategic importance.

[0132] Regarding hospital care, the more tests are performed in hospitalized suspect patients, the more agile will become the provision of services, with reduction in the occupancy rate and greater availability of beds, medications, and respirators for the population, with direct impact on cost reduction and an economic and social efficiency. Patients with negative tests will not need to stay in isolation and will have another conduction of therapy, with no risk of exposure to the truly infected.

[0133] The diagnostic clarification also allows a better dimensioning of the pandemic, since currently the tests are being made available only for severe cases, generating an under dimensioning of the data of total cases of infection, and on the other hand an over dimensioning of the lethality rate, with a consequent undesirable bias in the epidemiological profile. The calculation of epidemiological data allows a better knowledge of the behavior of the virus in the local reality, subsidizing policies in Public Health.

[0134] In addition, the expansion in diagnostic capacity enables the optimization of health-related work processes for professionals all over the country. Doctors and nurses, directly involved in the care of suspected patients, can have more confidence in the management of cases through diagnostic clarification. The prospect of testing the health professionals themselves points to a significant reduction in absenteeism, and can minimize staff shortages in hospitals, with a consequent increase in the workload of those who work on the front line in cases that are negative for the virus.

[0135] The present invention presents great positive impact in fighting/controlling the global coronavirus pandemic faced by mankind nowadays.

[0136] It should be noted that numerous variations affecting the scope of protection of the present application are permissible. Thus, it is reinforced that the present invention is not limited to the particular configurations/embodiments described above.