RNF167 AND CASTOR1 AS NOVEL MTOR TARGETS
20230357430 · 2023-11-09
Assignee
Inventors
Cpc classification
A01K67/0275
HUMAN NECESSITIES
G01N33/57484
PHYSICS
C12N2740/16043
CHEMISTRY; METALLURGY
A01K2217/15
HUMAN NECESSITIES
A61K45/06
HUMAN NECESSITIES
C12N15/1135
CHEMISTRY; METALLURGY
C12Y207/11001
CHEMISTRY; METALLURGY
G01N2800/52
PHYSICS
A01K2217/203
HUMAN NECESSITIES
A61K31/00
HUMAN NECESSITIES
G01N2440/36
PHYSICS
International classification
Abstract
The present subject matter relates to the use of one or more inhibitors to treat a disease, e.g., cancer, in a subject. It is based, at least in part, on the discovery that protein kinase B (AKT) and ring finger protein 167 (RNF167)-mediated CASTOR1 degradation activates the mammalian target of rapamycin complex 1 (mTORC1) independent of arginine and promotes cancer progression. Accordingly, the presently disclosed subject matter provides for compositions, methods, and kits for treating a subject using an RNF167 inhibitor, an inhibitor that reduces phosphorylation of CASTOR1 at S14, ubiquitination and/or degradation of CASTOR1, or a combination thereof.
Claims
1. A method for treating a disease in a subject, comprising administering a therapeutically effective amount of a ring finger protein 167 (RNF167) inhibitor to the subject.
2. The method of claim 1, wherein the disease is diabetes or ageing.
3. The method of claim 1, wherein the disease is a cancer.
4. The method of claim 3, wherein the cancer is a breast cancer.
5. The method of claim 1, wherein the RNF167 inhibitor is selected from the group consisting of a compound, a small molecule, a chemical, a polypeptide, a peptide, a protein, and a combination thereof.
6. The method of claim 1, further comprising administering a therapeutically effective amount of an anti-cancer agent to the subject.
7. The method of claim 1, further comprising administering a therapeutically effective amount of an agent selected from the group consisting of a protein kinase B (AKT) inhibitor, a Tuberous Sclerosis Complex 2 (TSC2) inhibitor, an mTORC1 inhibitor and a combination thereof.
8. A method for treating a disease in a subject, comprising administering a therapeutically effective amount of an inhibitor that reduces phosphorylation of CASTOR1 at S14 and/or reduces degradation of CASTOR1 and/or an agonist of CASTOR1.
9. The method of claim 8, wherein the disease is diabetes or ageing.
10. The method of claim 8, wherein the disease is a cancer.
11. The method of claim 10, wherein the cancer is a breast cancer.
12. The method of claim 8, wherein the inhibitor that reduces phosphorylation of CASTOR1 at S14 and/or reduces degradation of CASTOR1 and/or the agonist of CASTOR1 is selected from the group consisting of a compound, a small molecule, a chemical, a polypeptide, a peptide, a protein, and a combination thereof.
13. The method of claim 8, further comprising administering a therapeutically effective amount of an anti-cancer agent to the subject.
14. The method of claim 8, further comprising administering a therapeutically effective amount of an agent selected from the group consisting of a protein kinase B (AKT) inhibitor, a Tuberous Sclerosis Complex 2 (TSC2) inhibitor, an mTORC1 inhibitor and a combination thereof.
15. A pharmaceutical composition for treating a disease in a subject, comprising a therapeutically effective amount of a ring finger protein 167 (RNF167) inhibitor.
16. The pharmaceutical composition of claim 15, wherein the RNF167 inhibitor is selected from the group consisting of a compound, a small molecule, a chemical, a polypeptide, a peptide, a protein, and a combination thereof.
17. A pharmaceutical composition for treating a disease in a subject, comprising a therapeutically effective amount of an inhibitor that reduces phosphorylation of CASTOR1 at S14 and/or reduces degradation of CASTOR1 and/or an agonist of CASTOR1.
18. The pharmaceutical composition of claim 17, wherein the inhibitor that reduces phosphorylation of CASTOR1 at S14 and/or reduces degradation of CASTOR1 and/or the agonist of CASTOR1 is selected from the group consisting of a compound, a small molecule, a chemical, a polypeptide, a peptide, a protein, and a combination thereof.
Description
BRIEF DESCRIPTION OF THE DRAWINGS
[0019]
[0020]
[0021]
[0022]
[0023]
[0024]
[0025]
[0026]
[0027]
[0028]
[0029]
[0030]
[0031]
[0032]
[0033]
[0034]
[0035]
[0036]
[0037]
[0038]
[0039]
[0040]
[0041]
[0042]
[0043]
[0044]
[0045]
[0046]
[0047]
[0048]
[0049]
[0050]
[0051]
DETAILED DESCRIPTION
[0052] The detailed description of the disclosed subject matter is divided into the following subsections for clarity and not by way of limitation: [0053] I. Definitions; [0054] II. Inhibitors and Agonists; [0055] III. Methods of Use; [0056] IV. Pharmaceutical Compositions; and [0057] V. Kits.
I. Definitions
[0058] The terms used in this specification generally have their ordinary meanings in the art, within the context of the disclosed subject matter and in the specific context where each term is used. Certain terms are discussed below, or elsewhere in the specification, to provide additional guidance to the practitioner in describing the compositions and methods of the disclosed subject matter.
[0059] As used herein, the use of the word “a” or “an” when used in conjunction with the term “comprising” in the claims and/or the specification may mean “one,” but it is also consistent with the meaning of “one or more,” “at least one,” and “one or more than one.” Still further, the terms “having,” “including,” “containing” and “comprising” are interchangeable and one of skill in the art is cognizant that these terms are open-ended terms.
[0060] The term “about” or “approximately” means within an acceptable error range for the particular value as determined by one of ordinary skill in the art, which will depend in part on how the value is measured or determined, i.e., the limitations of the measurement system. For example, “about” can mean within 3 or more than 3 standard deviations, per the practice in the art. Alternatively, “about” can mean a range of up to 20%, preferably up to 10%, more preferably up to 5%, and more preferably still up to 1% of a given value. Alternatively, particularly with respect to biological systems or processes, the term can mean within an order of magnitude, preferably within 5-fold, and more preferably within 2-fold, of a value.
[0061] As used herein, the term “inhibitor” refers to a compound or molecule (e.g., small molecule, peptide, peptidomimetic, natural compound, siRNA, anti-sense nucleic acid, aptamer, or antibody) that interferes with (e.g., reduces, prevents, decreases, suppresses, eliminates or blocks) the signaling function of a protein or pathway. An inhibitor can be any compound or molecule that changes any activity of a protein (signaling molecule, any molecule involved with the named signaling molecule or a named associated molecule), such as RNF167, or interferes with the interaction of a protein, e.g., RNF167, with signaling partners. Inhibitors also include molecules that indirectly regulate the biological activity of a named protein, e.g., RNF167, by intercepting upstream signaling molecules.
[0062] The term “agent,” as used herein, means a substance that produces or is capable of producing an effect and would include, but is not limited to, chemicals, pharmaceuticals, biologics, small organic molecules, antibodies, nucleic acids, peptides and proteins.
[0063] The terms “inhibiting,” “eliminating,” “decreasing,” “reducing” or “preventing,” or any variation of these terms, referred to herein, includes any measurable decrease or complete inhibition to achieve a desired result.
[0064] An “effective amount” or “therapeutically effective amount” of an agent, e.g., an RNF167 inhibitor, refers to an amount effective, at dosages and for periods of time necessary, to achieve the desired therapeutic or prophylactic result, e.g., treating a cancer in a subject. A therapeutically effective amount can be administered in one or more administrations.
[0065] An “individual” or “subject” herein is a vertebrate, such as a human or non-human animal, for example, a mammal. Mammals include, but are not limited to, humans, primates, farm animals, sport animals, rodents and pets. Non-limiting examples of non-human animal subjects include rodents such as mice, rats, hamsters, and guinea pigs; rabbits; dogs; cats; sheep; pigs; goats; cattle; horses; and non-human primates such as apes and monkeys.
[0066] The term “in need thereof” would be a subject known or suspected of having or being at risk of developing a disease, e.g., cancer.
[0067] As used herein, “treatment” (and grammatical variations thereof such as “treat” or “treating”) refers to clinical intervention in an attempt to alter the natural course of the individual being treated and can be performed either for prophylaxis or during the course of clinical pathology. Desirable effects of treatment include, but are not limited to, prolonging survival, preventing recurrence of disease, alleviation of symptoms, diminishment of any direct or indirect pathological consequences of the disease, preventing metastasis, decreasing the rate of disease progression, amelioration or palliation of the disease state, and remission or improved prognosis. In certain embodiments, antibodies of the presently disclosed subject matter are used to delay development of a disease or to slow the progression of a disease, e.g., cancer/tumor.
[0068] An “anti-cancer/tumor effect” refers to one or more of a reduction in aggregate cancer cell mass, a reduction in cancer cell growth rate, a reduction in cancer progression, a reduction in cancer cell proliferation, a reduction in tumor mass, a reduction in tumor volume, a reduction in tumor cell proliferation, a reduction in tumor growth rate and/or a reduction in tumor metastasis. In certain embodiments, an anti-cancer effect can refer to a complete response, a partial response, a stable disease (without progression or relapse), a response with a later relapse, or progression-free survival in a patient diagnosed with cancer.
[0069] An “anti-cancer/tumor agent,” as used herein, can be any molecule, compound, chemical, or composition that has an anti-cancer effect. Anti-cancer agents include, but are not limited to, chemotherapeutic agents, radiotherapeutic agents, cytokines, anti-angiogenic agents, apoptosis-inducing agents, anti-cancer antibodies and/or agents which promote the activity of the immune system. In certain embodiments, an anti-cancer agent can be a radiotherapeutic agent. In certain embodiments, an anti-cancer agent can be a chemotherapeutic agent. Other non-limiting exemplary anti-cancer agents that can be used with the presently disclosed subject matter include tumor-antigen based vaccines and chimeric antigen receptor T-cells.
[0070] As used herein, the term “disease” refers to any condition or disorder that damages or interferes with the normal function of a cell, tissue, or organ.
[0071] The terms “detection” or “detecting” include any means of detecting, including direct and indirect detection.
[0072] “Antibody,” “fragment of an antibody,” or “antibody fragment” are used interchangeably to mean one or more fragments or portions of an antibody that retain the ability to specifically bind to a specific antigen (Holliger et al., Nat. Biotech. (2005) 23(9): 1126). The present antibodies may be antibodies and/or fragments thereof. Antibody fragments include Fab, F(ab′)2, scFv, disulfide linked Fv, Fc, or variants and/or mixtures. The antibodies may be chimeric, humanized, single chain, or bi-specific. All antibody isotypes are encompassed by the present disclosure, including, IgA, IgD, IgE, IgG, and IgM. Suitable IgG subtypes include IgG1, IgG2, IgG3 and IgG4. An antibody light or heavy chain variable region consists of a framework region interrupted by three hypervariable regions, referred to as complementarity determining regions (CDRs). The CDRs of the present antibodies or antigen-binding portions can be from a non-human or a human source. The framework of the present antibodies or antigen-binding portions can be human, humanized, non-human (e.g., a murine framework modified to decrease antigenicity in humans), or a synthetic framework (e.g., a consensus sequence).
[0073] As described herein, any concentration range, percentage range, ratio range or integer range is to be understood to include the value of any integer within the recited range and, when appropriate, fractions thereof (such as one-tenth and one-hundredth of an integer), unless otherwise indicated.
II. Inhibitors and Agonists
[0074] The present disclosure relates to the use of inhibitors and agonists, e.g., inhibitors and agonists of proteins that indirectly and/or directly regulate mTORC1 activity, for preventing and/or treating a disease. In certain embodiments, the disease is a cancer and/or tumor, in a subject.
[0075] RING Finger Protein 167 (RNF167)
[0076] The present disclosure relates to the use of an inhibitor of RNF167 to treat a disease, e.g., a cancer and/or tumor, in a subject.
[0077] RNF167 is a RING-type E3 ligase involved in regulating protein trafficking, localization, and degradation by directly ubiquitinating targeted substrates. RNF167 is encoded by the RNF167 gene. In certain embodiments, RNF167 is a human RNF167 protein. In certain embodiments, RNF167 is a mouse RNF167 protein or a rat RNF167 protein.
[0078] In certain embodiments, RNF167 can be a human RNF167 protein having an amino acid sequence as set forth in GenBank Accession No. NP_056343 or an amino acid sequence at least about 95 percent or at least about 98 percent homologous thereto.
[0079] In certain embodiments, RNF167 can be an RNF167 protein that is post-translationally modified. For example, but not by way of limitation, the RNF167 protein can be glycosylated, e.g., at the N-terminus.
[0080] In certain embodiments, a nucleic acid encoding a human RNF167 protein of the present invention can comprise a nucleic acid sequence as set forth in GenBank Accession No. NM_015528.3 or a nucleic acid sequence at least about 95 percent or at least about 98 percent homologous thereto.
[0081] Any suitable RNF167 inhibitors known in the art can be used with the presently disclosed subject matter. Non-limiting exemplary RNF16 inhibitors can include any compounds, molecules, chemicals, polypeptides, proteins, peptides, agonists, and combinations thereof that inhibit and/or reduce the expression, function and/or activity of RNF167. In certain embodiments, the inhibitor can partially and/or completely inhibit the RNF167 signaling pathway and/or activity of RNF167. For example, but not by way of limitation, “partially inhibit” can refer to a reduction of at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 97% or at least 99% in the activity, function and/or expression of RNF167, e.g., as compared to a reference. In certain embodiments, the reference is a sample not treated with the RNF167 inhibitor.
[0082] In certain embodiments, the RNF167 inhibitor for use with the presently disclosed subject matter can be a small molecule compound that inhibits and/or reduces the expression, function and/or activity of RNF167 or a pharmaceutically acceptable salt or solvate thereof.
[0083] In certain embodiments, the RNF167 inhibitor can be a ribozyme, an antisense oligonucleotide, a shRNA molecule, and/or an siRNA molecule that specifically inhibits and/or reduces the expression, function and/or activity of RNF167. Non-limiting examples of such inhibitors are provided in the Example.
[0084] In certain embodiments, the RNF167 inhibitor can be an antisense nucleic acid, a shRNA, or a siRNA that is homologous to at least a portion of a RNF167 nucleic acid sequence. The homology of the portion relative to the RNF167 nucleic acid sequence can be at least about 50, at least about 55, at least about 60, at least about 65, at least about 70, at least about 75, at least about 80, at least about 85, at least about 90, at least about 95, or at least about 98 percent. The percent homology can be determined by, for example, BLAST or FASTA software. In certain embodiments, the homologous portion constitutes at least 10 nucleotides, at least 15 nucleotides, at least 20 nucleotides, at least 25 nucleotides, at least 30 nucleotides. In certain embodiments, the antisense nucleic acid, shRNA, or siRNA molecules have up to 15, up to 20, up to 25, up to 30, up to 35, up to 40, up to 45, up to 50, up to 75, or up to 100 nucleotides in length. In certain embodiments, the antisense nucleic acid, shRNA, or siRNA molecules comprise DNA or atypical or non-naturally occurring residues, for example, but not limited to, phosphorothioate residues.
[0085] In certain embodiments, the antisense nucleic acid, shRNA, or siRNA molecules disclosed herein can be expressed from a vector or produced chemically or synthetically. Methods for selecting an appropriate dsRNA or dsRNA-encoding vector are well known in the art for genes whose sequence is known (e.g., see Tuschl, T. et al. (1999); Elbashir, S. M. et al. (2001); Hannon, G J. (2002); McManus, M T. et al. (2002); Brummelkamp, T R. et al. (2002); U.S. Pat. Nos. 6,573,099 and 6,506,559; and PCT Patent Application Nos. WO 2001/036646, WO 1999/032619 and WO 2001/068836, the contents of which are incorporated by reference herein in their entireties).
[0086] In certain embodiments, the RNF167 inhibitor for use with the presently disclosed subject matter can be a peptide and/or a small protein fragment. For example, but not by way of limitation, a peptide and/or a small protein fragment that inhibits and/or reduces the expression, function and/or activity of RNF167 and/or partially or completely blocks the RNF167 signaling pathway or activity can be used as the RNF167 inhibitor.
[0087] In certain embodiments, the RNF167 inhibitor can be an antibody or an antibody fragment that partially or completely blocks RNF167 signaling and/or activity. For example, but not by way of limitation, an antibody (or fragment thereof) for use in the present disclosure can physically bind to RNF167 and/or bind to a protein that regulates the expression, activity and/or function of RNF167.
[0088] In certain embodiments, an RNF167 inhibitor of the present disclosure can be conjugated to a modality that specifically targets cancer cells. For example, and not by way of limitation, a RNF167 inhibitor can be conjugated to an antibody or antibody fragment and/or peptide, e.g., that recognizes an epitope on the surface of a cancer cell. In certain embodiments, the modality can be a nanoparticle that specifically targets cancer cells, e.g., by the presence of a targeting moiety conjugated to the nanoparticle.
[0089] Cytosolic Arginine Sensor for mTORC1 Subunit 1 (CASTOR1)
[0090] The present disclosure further relates to the use of an inhibitor that inhibits and/or reduces the phosphorylation, ubiquitination and/or degradation of CASTOR1 to treat a disease. The present disclosure further provides agonists of CASTOR1 that increase and/or enhance the activity, function and/or expression of CASTOR1. In certain embodiments, the disease is a cancer and/or tumor in a subject.
[0091] CASTOR1 functions as an arginine sensor for the mTORC1 pathway and contains a consensus AKT1 phosphorylation motif (e.g., R—V—R—V-L-S14 (SEQ ID NO: 26)). CASTOR1 is encoded by the CASTOR1 gene. In certain embodiments, CASTOR1 is a human CASTOR1 protein. In certain embodiments, CASTOR1 is a mouse CASTOR1 protein or a rat CASTOR1 protein.
[0092] In certain embodiments, CASTOR1 can be a human CASTOR1 protein having an amino acid sequence as set forth in GenBank Accession No. NP_001032755 or an amino acid sequence at least about 95 percent or at least about 98 percent homologous thereto.
[0093] In certain embodiments, a nucleic acid encoding a human CASTOR1 protein of the present invention can comprise a nucleic acid sequence as set forth in GenBank Accession No. NM_001037666.3 or a nucleic acid sequence at least about 95 percent or at least about 98 percent homologous thereto.
[0094] In certain embodiments, an inhibitor for use in the present disclosure can reduce or inhibit phosphorylation and/or ubiquitination of CASTOR1. In certain embodiments, an inhibitor for use in the present disclosure can reduce or inhibit phosphorylation of CASTOR1 at S14. In certain embodiments, an inhibitor for use in the present disclosure can reduce or inhibit the ubiquitination of CASTOR1. In certain embodiments, an inhibitor for use in the present disclosure can reduce or inhibit degradation of CASTOR1. In certain embodiments, an inhibitor for use in the present disclosure can reduce and/or inhibit the binding of an E3 ligase, e.g., RNF167, to CASTOR1.
[0095] In certain embodiments, an agonist of CASTOR1 can be an inhibitor as disclosed herein, e.g., an inhibitor that inhibits and/or reduces the phosphorylation, ubiquitination and/or degradation of CASTOR1 and/or an inhibitor that inhibits and/or reduces the expression, function and/or activity of RNF167 and/or the RNF167 signaling pathway.
[0096] In certain embodiments, the inhibitor can partially and/or completely inhibit the phosphorylation, degradation and/or ubiquitination of CASTOR1. For example, but not by way of limitation, “partially inhibit” can refer to a reduction of at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 97% or at least 99% in the phosphorylation, degradation and/or ubiquitination of CASTOR1, e.g., as compared to a reference. In certain embodiments, the reference is a sample not treated with the inhibitor.
[0097] In certain embodiments, an inhibitor that reduces or inhibits phosphorylation and/or ubiquitination of CASTOR1 and/or reduces and/or inhibits the binding of an E3 ligase to CASTOR1 results in an increase in the expression, activity and/or function of CASTOR1. For example, but not by way of limitation, an inhibitor can result in greater than a 1.5-fold increase, greater than about a 2-fold increase, greater than about a 2.5-fold increase, greater than about 3-fold increase or greater than about a 3.5-fold increase in CASTOR1 expression, activity and/or function, e.g., relative to the reference control level. In certain embodiments, the reference control level is the level of expression, activity and/or function of CASTOR1 in a sample not treated with the inhibitor.
[0098] Any suitable inhibitors for reducing and/or phosphorylation, ubiquitination and/or degradation of CASTOR1 known in the art can be used with the presently disclosed subject matter. Non-limiting exemplary inhibitors, which reduce and/or inhibit phosphorylation of CASTOR1, can include any compounds, molecules, chemicals, polypeptides, peptides, proteins, agonists, and combinations thereof.
[0099] In certain embodiments, the inhibitors for use with the presently disclosed subject matter are small molecule compounds that reduce or inhibit the phosphorylation, ubiquitination and/or degradation of CASTOR1 or a pharmaceutically acceptable salt or solvate thereof.
[0100] In certain non-limiting embodiments, a peptide and/or a small protein fragment that reduces and/or inhibits, e.g., partially or completely blocks, phosphorylation, ubiquitination and/or degradation of CASTOR1 can be used as an inhibitor. For example, but not by way of limitation, peptides and or protein fragments that can regulate the activity of CASTOR1 by modifying ubiquitination level and/or the binding of an E3 ligase (e.g., RNF167) can be used as an inhibitor.
[0101] In certain embodiments, the inhibitors, which reduce or inhibit phosphorylation, ubiquitination and/or degradation of CASTOR1, can be selected from the group consisting of ribozymes, antisense oligonucleotides, shRNA molecules, and siRNA molecules. In non-limiting embodiments, the inhibitor can be an antisense nucleic acid, shRNA, or siRNA that is homologous to at least a portion of a CASTOR1 nucleic acid sequence. The homology of the portion relative to the CASTOR1 sequence can be at least about 50, at least about 55, at least about 60, at least about 65, at least about 70, at least about 75, at least about 80, at least about 85, at least about 90, at least about 95, or at least about 98 percent. The percent homology can be determined by, for example, BLAST or FASTA software. In certain embodiments, the homologous portion constitutes at least 10 nucleotides, at least 15 nucleotides, at least 20 nucleotides, at least nucleotides, at least 30 nucleotides. In certain embodiments, the antisense nucleic acid, shRNA, or siRNA molecules have up to 15, up to 20, up to 25, up to 30, up to 35, up to 40, up to 45, up to 50, up to 75, or up to 100 nucleotides in length. In certain embodiments, the antisense nucleic acid, shRNA, or siRNA molecules comprise DNA or atypical or non-naturally occurring residues, for example, but not limited to, phosphorothioate residues.
[0102] In certain embodiments, the antisense nucleic acid, shRNA, or siRNA molecules disclosed herein can be expressed from a vector or produced chemically or synthetically. Methods for selecting an appropriate dsRNA or dsRNA-encoding vector are well known in the art for genes whose sequence is known.
[0103] In certain embodiments, the inhibitors, which reduce or inhibit phosphorylation of CASTOR1, e.g., at S14, ubiquitination and/or degradation of CASTOR1 can be an antibody or an antibody fragment. For example, but not by way of limitation, an antibody (or an antibody fragment) that reduces and/inhibits the phosphorylation of CASTOR1 can partially and/or completely block the interaction between CASTOR1 and a protein that induces the phosphorylation of CASTOR1, e.g., by binding CASTOR1 and/or binding the protein that induces the phosphorylation, ubiquitination and/or degradation of CASTOR1. In certain embodiments, an antibody (or an antibody fragment) that reduces and/inhibits CASTOR1 activity can partially and/or completely block the interaction between phosphorylated CASTOR1 and RNF167. For example, but not by way of limitation, the inhibitor can be an antibody or fragment thereof that selectively binds to a phosphorylation and/or ubiquitination site. For example, but not by way of limitation, the inhibitor can be an antibody or fragment thereof that specifically binds to the S14 phosphorylation site of CASTOR1. In certain embodiments, the inhibitor can be an antibody or fragment thereof that specifically binds to one or more CASTOR1 ubiquitination sites, e.g., K61, K96 and/or K213.
[0104] In certain embodiments, the inhibitors, which reduce and/or inhibit phosphorylation, ubiquitination and/or degradation of CASTOR1, of the present disclosure can be conjugated to a modality that specifically targets cancer cells. For example, and not by way of limitation, the inhibitor can be conjugated to an antibody or antibody fragment and/or peptide, e.g., that recognizes an epitope on the surface of a cancer cell. In certain embodiments, the modality can be a nanoparticle that specifically targets cancer cells, e.g., by the presence of a targeting moiety conjugated to the nanoparticle.
II. Methods of Use
[0105] Prognostic Methods
[0106] The present disclosure provides methods for determining the prognosis of a patient that has cancer and/or a tumor. As described in detail in the Example section below, the studies presented in the instant application indicate that high RNF167 expression and/or low CASTOR1 expression are associated with a poor prognosis.
[0107] In certain embodiments, the expression level of RNF167 can be used as a marker for determining the prognosis of a subject. In certain embodiments, the expression level of CASTOR1 can be used as a marker for determining the prognosis of a subject. In certain non-limiting embodiments, phosphorylation and/or ubiquitination of CASTOR1 can be used as a marker for determining the prognosis of a subject.
[0108] In certain embodiments, a prognostic method of the present disclosure includes determining the expression level of RNF167 in a cancer, e.g., in a sample of a cancer, of a subject. In certain embodiments, the method can further include comparing the expression level of RNF167 in the cancer to a reference control level of RNF167, where increased expression of RNF167 in the cancer compared to the RNF167 reference control level indicates that the subject has a poor prognosis. A “reference control level” or “reference control expression level” of RNF167, as used interchangeably herein, can, for example, be established using a reference control sample. Non-limiting examples of reference control samples include normal and/or healthy cells, e.g., from a sample of normal or benign tissue, that have wild-type RNF167 activity. In certain embodiments, a reference control level of RNF167 can, for example, be established using normal cells, e.g., benign cells, located adjacent to the tumor in a patient. In certain embodiments, the expression level of RNF167 can be the nucleic acid expression level of RNF167. Alternatively and/or additionally, the expression level of RNF167 can be the protein expression level of RNF167.
[0109] In certain embodiments, a prognostic method of the present disclosure includes determining the expression level of CASTOR1 in a cancer, e.g., a sample of a cancer, of a subject. In certain embodiments, the method can further include comparing the expression level of CASTOR1 in the cancer to a reference control level of CASTOR1, where reduced expression of CASTOR1 in the cancer compared to the CASTOR1 reference control level indicates that the subject has a poor prognosis. A “reference control level” or “reference control expression level” of CASTOR1, as used interchangeably herein, can, for example, be established using a reference control sample. Non-limiting examples of reference control samples include normal and/or healthy cells, e.g., from a sample of normal or benign tissue, that have wild-type CASTOR1 activity. In certain embodiments, a reference control level of CASTOR1 can, for example, be established using normal cells, e.g., benign cells, located adjacent to the tumor in a patient. In certain embodiments, the expression level of CASTOR1 can be the protein expression level of CASTOR1. Alternatively and/or additionally, the expression level of CASTOR1 can be the nucleic acid expression level of CASTOR1.
[0110] In certain embodiments, a prognostic method of the present disclosure includes determining the phosphorylation level and/or ubiquitination level of CASTOR1 in a cancer, e.g., a sample of a cancer, of a subject. In certain embodiments, the method can further include comparing the phosphorylation level and/or ubiquitination level of CASTOR1 in the cancer to a reference control level of CASTOR1, where increased phosphorylation level and/or ubiquitination level of CASTOR1 in the cancer compared to the CASTOR1 reference control level indicates that the subject has a poor prognosis. A “reference control level” or “reference control expression level” of CASTOR1, as used interchangeably herein, can, for example, be established using a reference control sample. Non-limiting examples of reference control samples include normal and/or healthy cells that have wild-type CASTOR1 activity. In certain embodiments, a reference control level of CASTOR1 phosphorylation and/or ubiquitination can, for example, be established using normal cells, e.g., benign cells, located adjacent to the tumor in a patient.
[0111] In certain embodiments, the phosphorylation level is the level of phosphorylation at a particular site. For example, but not by way of limitation, a prognostic method of the presently disclosed subject can include analyzing the level of CASTOR1 phosphorylation at a particular site, e.g., at a particular amino acid, e.g., serine 14 (S14). As described in the Example section, CASTOR1 phosphorylated at S14 is an indicator of mTORC1 activity, where increased S14 phosphorylation of CASTOR1 in the cancer compared to the CASTOR1 reference control level indicates that the subject has a poor prognosis.
[0112] In certain embodiments, the ubiquitination level is the ubiquitination level at a particular site. In certain embodiments, a prognostic method of the presently disclosed subject can include analyzing the level of CASTOR1 ubiquitination at one or more particular sites, e.g., at one or more amino acids, e.g., at one or more lysines (K), e.g., K61, K96 and/or K213.
[0113] Where comparisons to reference control expression levels are referred to herein, the expression level of a nucleic acid and/or protein of interest is assessed relative to the reference control expression level within the same species. For example, a human RNF167 expression level and/or presence are compared with a human RNF167 reference control level.
[0114] In certain embodiments, the absence and/or a reduced expression of CASTOR1 means the detection of less than about 90%, less than about 80%, less than about 70%, less than about 60%, less than about 50/%, less than about 40% or less than about 30% expression relative to the CASTOR1 reference control level. In certain embodiments, the increased expression of RNF167 means the detection of greater than about a 1.5-fold increase, greater than about a 2-fold increase, greater than about a 2.5-fold increase, greater than about 3-fold increase or greater than about a 3.5-fold increase in expression relative to the reference control level. In certain embodiments, the increased phosphorylation, e.g., at S14, and/or ubiquitination, e.g., at K61, K96 and/or K213, of CASTOR1 means the detection of greater than about a 1.5-fold increase, greater than about a 2-fold increase, greater than about a 2.5-fold increase, greater than about 3-fold increase or greater than about a 3.5-fold increase in phosphorylation and/or ubiquitination relative to the reference control level.
[0115] Methods for qualitatively and quantitatively detecting and/or determining the expression level of a nucleic acid, e.g., a RNF167 nucleic acid and/or a CASTOR1 nucleic acid, include, but are not limited to polymerase chain reaction (PCR), including conventional, qPCR and digital PCR, in situ hybridization (for example, but not limited to Fluorescent In situ Hybridization (“FISH”)), gel electrophoresis, sequencing and sequence analysis, microarray analysis and other techniques known in the art.
[0116] In certain embodiments, the method of detection can be real-time PCR (RT-PCR), quantitative PCR, fluorescent PCR, RT-MSP (RT methylation specific polymerase chain reaction), PicoGreen™ (Molecular Probes, Eugene, Oreg.) detection of DNA, radioimmunoassay or direct radio-labeling of DNA. For example, but not by way of limitation, a nucleic acid can be reversed transcribed into cDNA followed by polymerase chain reaction (RT-PCR); or, a single enzyme can be used for both steps as described in U.S. Pat. No. 5,322,770, or the nucleic acid can be reversed transcribed into cDNA followed by symmetric gap ligase chain reaction (RT-AGLCR) as described by R. L. Marshall, et al., PCR Methods and Applications 4: 80-84 (1994).
[0117] In certain embodiments, quantitative real-time polymerase chain reaction (qRT-PCR) is used to evaluate mRNA levels. The levels of a mRNA of interest and a control mRNA can be quantitated in cancer tissue or cells and adjacent benign tissues.
[0118] In certain embodiments, the method of detection of the present disclosure can be carried out without relying on amplification, e.g., without generating any copy or duplication of a target sequence, without involvement of any polymerase, or without the need for any thermal cycling. In certain embodiments, detection can be performed using the principles set forth in the QuantiGene™ method described in U.S. application Ser. No. 11/471,025, filed Jun. 19, 2006, and is incorporated herein by reference.
[0119] In certain embodiments, in situ hybridization visualization can be employed, where a radioactively labeled antisense RNA probe is hybridized with a thin section of a biological sample, e.g., a biopsy sample, washed, cleaved with RNase and exposed to a sensitive emulsion for autoradiography. The samples can be stained with haematoxylin to demonstrate the histological composition of the sample, and dark field imaging with a suitable light filter shows the developed emulsion. Non-radioactive labels such as digoxigenin can also be used.
[0120] In certain non-limiting embodiments, evaluation of nucleic acid expression can be performed by fluorescent in situ hybridization (FISH). FISH is a technique that can directly identify a specific region of DNA or RNA in a cell and therefore enables visual determination of the biomarker expression in tissue samples. The FISH method has the advantages of a more objective scoring system and the presence of a built-in internal control consisting of the biomarker gene signals present in all non-neoplastic cells in the same sample. FISH is a direct in situ technique that can be relatively rapid and sensitive, and can also be automated. Immunohistochemistry can be combined with a FISH method when the expression level of the biomarker is difficult to determine by FISH alone.
[0121] In certain embodiments, the expression of a nucleic acid can be detected on a DNA array, chip or a microarray. Oligonucleotides corresponding to the nucleic acids of interest, e.g., a RNF167 nucleic acid and/or a CASTOR1 nucleic acid, are immobilized on a chip which is then hybridized with labeled nucleic acids of a biological sample, e.g., tumor sample, obtained from a subject. Positive hybridization signal is obtained with the sample containing the nucleic acids of interest. Methods of preparing DNA arrays and their use are well known in the art. (See, for example, U.S. Pat. Nos. 6,618,679; 6,379,897; 6,664,377; 6,451,536; 6,548,257; U.S. Patent Application Nos. 20030157485 and Schena et al. 1995 Science 20:467-470; Gerhold et al. 1999 Trends in Biochem. Sci. 24, 168-173; and Lennon et al. 2000 Drug discovery Today 5: 59-65, which are herein incorporated by reference in their entirety). Serial Analysis of Gene Expression (SAGE) can also be performed (See, for example, U.S. Patent Application No. 20030215858).
[0122] In certain embodiments, to monitor a nucleic acid, e.g., RNF167 nucleic acid, expression levels, nucleic acid, e.g., mRNA, can be extracted from the biological sample to be tested, reverse transcribed and fluorescent-labeled cDNA probes can be generated. The labeled cDNA probes can then be applied to microarrays capable of hybridizing to a biomarker, allowing hybridization of the probe to microarray and scanning the slides to measure fluorescence intensity. This intensity correlates with the hybridization intensity and expression levels of the biomarker.
[0123] Types of probes for detection of nucleic acids include cDNA, riboprobes, synthetic oligonucleotides and genomic probes. The type of probe used will generally be dictated by the particular situation, such as riboprobes for in situ hybridization, and cDNA for Northern blotting, for example. In certain non-limiting embodiments, the probe is directed to nucleotide regions unique to the particular RNA. The probes can be as short as is required to differentially recognize the particular biomarker mRNA transcripts, and can be as short as, for example, 15 bases. Probes of at least 17 bases, 18 bases and 20 bases can also be used. In certain embodiments, the primers and probes hybridize specifically under stringent conditions to a nucleic acid fragment having the nucleotide sequence corresponding to the target gene. As herein used, the term “stringent conditions” means hybridization will occur only if there is at least 95% or at least 97% identity between the sequences.
[0124] The form of labeling of the probes can be any that is appropriate, such as the use of radioisotopes, for example, .sup.32P and .sup.35S, or fluorophores. Labeling with radioisotopes can be achieved, whether the probe is synthesized chemically or biologically, by the use of suitably labeled bases.
[0125] Methods for detecting and/or determining the expression level of a protein, e.g., a RNF167 protein and/or a CASTOR1 protein and/or the phosphorylation and/or ubiquitination level of a CASTOR1 protein are well known to those skilled in the art, and include, but are not limited to, mass spectrometry techniques, I-D or 2-D gel-based analysis systems, chromatography, enzyme linked immunosorbent assays (ELISAs), radioimmunoassays (RIA), enzyme immunoassays (EIA), Western Blotting, immunoprecipitation and immunohistochemistry. These methods use antibodies, or antibody equivalents, to detect protein, or use biophysical techniques. Antibody arrays or protein chips can also be employed, see, for example, U.S. Patent Application Nos. 2003/0013208; 2002/0155493, 2003/0017515 and U.S. Pat. Nos. 6,329,209 and 6,365,418, herein incorporated by reference in their entireties.
[0126] In certain non-limiting embodiments, a detection method for measuring protein expression and/or phosphorylation and/or ubiquitination includes the steps of contacting a biological sample, e.g., a tissue sample, with an antibody or variant (e.g., fragment) thereof, which selectively binds the biomarker, and detecting whether the antibody or variant thereof is bound to the sample. The method can further include contacting the sample with a second antibody, e.g., a labeled antibody. The method can further include one or more washing steps, e.g., to remove one or more reagents. In certain embodiments, the detection method can include contacting the sample with an antibody or variant (e.g., fragment) thereof that selectively binds to a phosphorylation and/or ubiquitination site. For example, but not by way of limitation, an antibody or variant (e.g., fragment) thereof for use in the methods disclosed herein can specifically bind to the S14 phosphorylation site of CASTOR1. In certain embodiments, an antibody or variant (e.g., fragment) thereof for use in the methods disclosed herein can specifically bind to one or more CASTOR1 ubiquitination sites, e.g., K61, K96 and/or K213.
[0127] In certain non-limiting embodiments, Western blotting can be used for detecting and quantitating protein expression levels. Cells can be homogenized in lysis buffer to form a lysate and then subjected to SDS-PAGE and blotting to a membrane, such as a nitrocellulose filter. Antibodies (unlabeled) can then brought into contact with the membrane and assayed by a secondary immunological reagent, such as labeled protein A or anti-immunoglobulin (suitable labels including .sup.125I, horseradish peroxidase and alkaline phosphatase). Chromatographic detection can also be used. In certain embodiments, immunodetection can be performed with antibody to a biomarker using the enhanced chemiluminescence system (e.g., from PerkinElmer Life Sciences, Boston, Mass.).
[0128] Immunohistochemistry can be used to detect the expression and/or presence of a biomarker, e.g., in a biopsy sample. A suitable antibody can be brought into contact with, for example, a thin layer of cells, followed by washing to remove unbound antibody, and then contacted with a second, labeled, antibody. Labeling can be by fluorescent markers, enzymes, such as peroxidase, avidin or radiolabeling. The assay can be scored visually, using microscopy, and the results can be quantitated. Machine-based or autoimaging systems can also be used to measure immunostaining results for the biomarker.
[0129] Various automated sample processing, scanning and analysis systems suitable for use with immunohistochemistry are available in the art. Such systems can include automated staining (see, e.g., the Benchmark system, Ventana Medical Systems, Inc.) and microscopic scanning, computerized image analysis, serial section comparison (to control for variation in the orientation and size of a sample), digital report generation, and archiving and tracking of samples (such as slides on which tissue sections are placed). Cellular imaging systems are commercially available that combine conventional light microscopes with digital image processing systems to perform quantitative analysis on cells and tissues, including immunostained samples. See, e.g., the CAS-200 system (Becton, Dickinson & Co.).
[0130] Labeled antibodies against proteins, e.g., an RNF167 protein and/or a CASTOR1 protein (or a phosphorylated CASTOR1 protein), can also be used for imaging purposes, for example, to detect the presence of the protein in cells of a subject. Suitable labels include radioisotopes, iodine (.sup.125I, .sup.121I), carbon (.sup.14C), sulphur (.sup.35S), tritium (H), indium (.sup.112In), and technetium (99mTc), fluorescent labels, such as fluorescein and rhodamine, and biotin. Immunoenzymatic interactions can be visualized using different enzymes such as peroxidase, alkaline phosphatase, or different chromogens such as DAB, AEC or Fast Red. The labeled antibody or antibody fragment will preferentially accumulate at the location of cells which contain a biomarker. The labeled antibody or variant thereof, e.g., antibody fragment, can then be detected using known techniques.
[0131] In certain non-limiting embodiments, agents that specifically bind to a protein other than antibodies are used, such as peptides. Peptides that specifically bind can be identified by any means known in the art, e.g., peptide phage display libraries. Generally, an agent that is capable of detecting a protein, such that the presence of the protein is detected and/or quantitated, can be used.
[0132] In addition, a protein can be detected using Mass Spectrometry such as MALDI/TOF (time-of-flight), SELDI/TOF, liquid chromatography-mass spectrometry (LC-MS), gas chromatography-mass spectrometry (GC-MS), high performance liquid chromatography-mass spectrometry (HPLC-MS), capillary electrophoresis-mass spectrometry, nuclear magnetic resonance spectrometry, or tandem mass spectrometry (e.g., MS/MS, MS/MS/MS, ESI-MS/MS, etc.). See, for example, U.S. Patent Application Nos. 2003/0199001, 2003/0134304, 2003/0077616, which are herein incorporated by reference in their entireties.
[0133] Mass spectrometry methods are well known in the art and have been used to quantify and/or identify biomolecules, such as proteins (see, e.g., Li et al. (2000) Tibtech 1:151-160; Rowley et al. (2000) Methods 20: 383-397; and Kuster and Mann (1998) Curr. Opin. Structural Biol. 8: 393-400). Further, mass spectrometric techniques have been developed that permit at least partial de novo sequencing of isolated proteins. Chait at al., Science 262:89-92 (1993); Keough at al., Proc. Natl. Acad. Sci. USA. 96:7131-6 (1999); reviewed in Bergman, EXS 88:133-44 (2000).
[0134] Detection of the presence of a nucleic acid and/or protein will typically involve detection of signal intensity. This, in turn, can reflect the quantity and character of a polypeptide bound to the substrate. For example, in certain embodiments, the signal strength of peak values from spectra of a first sample and a second sample can be compared (e.g., visually or by computer analysis), to determine the relative amounts of a particular biomarker. Software programs such as the Biomarker Wizard program (Ciphergen Biosystems, Inc., Fremont, Calif) can be used to aid in analyzing mass spectra.
[0135] Additional methods for determining nucleic acid and/or protein expression in samples are described, for example, in U.S. Pat. Nos. 6,271,002; 6,218,122; 6,218,114; and 6,004,755; and in Wang et al, J. Clin. Oncol., 22(9): 1564-1671 (2004); and Schena et al., Science, 270:467-470 (1995); all of which are incorporated herein by reference in their entireties.
[0136] Methods of Treatment
[0137] The present disclosure relates to methods for preventing and/or treating a disease and/or disorder of a subject. In certain embodiments, the disease can be a cancer and/or tumor in the subject. In certain embodiments, the disease can be diabetes. In certain embodiments, the disease can be ageing. In certain embodiments, the disease can be a disease related to metabolism.
[0138] The present disclosure provides methods for preventing and/or treating a disease, e.g., a cancer or tumor, in a subject by reducing the expression, activity and/or function of RNF167 and/or decreasing the degradation and/or phosphorylation and/or ubiquitination of CASTOR1 to increase the expression, activity and/or function of CASTOR1. In certain embodiments, methods for preventing and/or treating a disease, e.g., a cancer, a tumor, diabetes and/or ageing, in a subject include reducing the expression, activity and/or function of RNF167. In certain embodiments, methods for preventing and/or treating a disease, e.g., a cancer, a tumor, diabetes and/or ageing, in a subject include decreasing the degradation and/or phosphorylation and/or ubiquitination of CASTOR1 to increase the expression, activity and/or function of CASTOR1.
[0139] In certain non-limiting embodiments, the present disclosure provides for preventing and/or treating a subject that has a disease, e.g., a cancer or tumor. For example, but not by way of limitation, the method can include administering a therapeutically effective amount of an RNF167 inhibitor to the subject. In certain embodiments, administration of the RNF167 inhibitor inhibits the proliferation and/or survival of cancer cells in the subject.
[0140] Alternatively or additionally, a method of the present disclosure can include administering a therapeutically effective amount of an inhibitor to the subject that inhibits and/or reduces phosphorylation of CASTOR1, e.g., phosphorylation of CASTOR1 at amino acid S14, and/or inhibits or reduces the degradation of CASTOR1 and/or inhibits or reduces the ubiquitination of CASTOR1. In certain embodiments, a method of the present disclosure can include administering a therapeutically effective amount of a CASTOR1 agonist to the subject that increases and/or enhances the activity, function and/or expression of CASTOR1. In certain embodiments, administration of such an inhibitor and/or agonist inhibits the proliferation and/or survival of cancer cells in the subject.
[0141] In certain embodiments, the present disclosure provides a method for lengthening the period of survival of a subject having a disease, e.g., a cancer or tumor. For example, but not by way of limitation, one or more of the disclosed inhibitors and/or agonists, e.g., an RNF167 inhibitor, can be administered to a subject and prolong the survival of the subject relative to a control subject or control subject population not receiving the disclosed treatment. In certain embodiments, the period of survival is extended at least about 10 percent, at least about 25 percent, at least about 30 percent, at least about 50 percent, at least about 60 percent or at least about 70 percent. In certain embodiments, the period of survival is extended by about 1 month, about 2 months, about 4 months, about 6 months, about 8 months, about 10 months, about 12 months, about 14 months, about 18 months, about 20 months, about 2 years, about 3 years, about 5 years or more. In certain embodiments, the disclosed inhibitors can prolong the remission of a cancer in the subject relative to a control subject or control subject population not receiving the disclosed treatment.
[0142] In certain embodiments, the present disclosure provides methods for producing an anti-cancer effect in a subject. For example, but not by way of limitation, the method for producing an anti-cancer effect includes administering to a subject having a cancer and/or tumor a therapeutically effective amount of one or more of the disclosed inhibitors and/or agonists, e.g., an RNF167 inhibitor, to produce an anti-cancer effect in the subject. In certain embodiments, the anti-cancer effect is selected from the group consisting of a reduction in aggregate cancer cell mass, a reduction in cancer cell growth rate, a reduction in cancer cell proliferation, a reduction in tumor mass, a reduction in tumor volume, a reduction in cancer cell proliferation, a reduction in cancer growth rate, a reduction in cancer metastasis, and combinations thereof. In certain embodiments, the anti-cancer effect is a reduction in the number of cancer cells. In certain embodiments, the anti-cancer effect is a reduction in tumor size and/or a reduction in the rate of tumor growth. In certain embodiments, the anti-cancer effect is a reduction in the aggregate cancer cell burden. In certain embodiments, the anti-cancer effect is a reduction in the rate of cell proliferation and/or an increase in the rate of cell death. In certain embodiments, the anti-cancer effect is a prolongation of survival of the subject. In certain embodiments, the anti-cancer effect is a prolongation in the interval until relapse relative to a control subject or control subject population not receiving the disclosed treatment.
[0143] In certain embodiments, the present disclosure provides methods for reducing tumor growth in a subject. For example, but not by way of limitation, the method for reducing tumor growth includes administering to a subject a therapeutically effective amount of one or more of the disclosed inhibitors and/or agonists. In certain embodiments, tumor growth can be inhibited or reduced by decreasing expression, activity or function of RNF167. In certain embodiments, tumor growth can be inhibited or reduced by decreasing the phosphorylation and/or ubiquitination of CASTOR1 in the tumor cells. As shown in the Examples described herein, CASTOR1 can be a tumor suppressor in various cancers and tumors.
[0144] Methods disclosed herein can be used for treating any suitable cancers. Non-limiting examples of cancers that can be treated accordingly the presently disclosed methods include carcinomas, e.g., adenocarcinoma, lymphoma, blastoma, melanoma, sarcoma, and leukemia, melanoma, lung cancer, head and neck cancer, renal cell cancer, colon cancer, colorectal cancer, squamous cell cancer, small-cell lung cancer, non-small cell lung cancer, gastrointestinal cancer, Hodgkin's and non-Hodgkin's lymphoma, pancreatic cancer, glioblastoma, glioma, cervical cancer, ovarian cancer, liver cancer, bladder cancer, breast cancer, endometrial carcinoma, myeloma, salivary gland carcinoma, kidney cancer such as renal cell carcinoma and Wilms' tumors, basal cell carcinoma, prostate cancer, vulval cancer, thyroid cancer, testicular cancer, fallopian tube adenocarcinoma, and esophageal cancer. In certain embodiments, the cancer is breast cancer. In certain embodiments, the cancer can be a cancer and/or tumor in which mTORC1 is dysregulated. In certain embodiments, the cancer can be breast invasive carcinoma, brain lower grade glioma, skin cutaneous melanoma, head and neck squamous cell carcinoma, cervical squamous cell carcinoma and endocervical adenocarcinoma, lung adenocarcinoma, liver hepatocellular carcinoma, pancreatic adenocarcinoma, glioblastoma multiforme or acute myeloid leukemia. In certain embodiments, the cancer is lung cancer, a bladder carcinoma, a fibroadenoma, a breast cancer, a fallopian tube adenocarcinoma, a gall bladder adenocarcinoma, a kidney tumor, a pancreas adenocarcinoma, a skin malignant melanoma, a testis seminoma, a thyroid adenoma, and combinations thereof.
[0145] In certain embodiments, a method of the present disclosure can further include assessing the expression level of mTORC1 (or a subunit thereof, e.g., mTOR) in a cancer and/or tumor or a sample thereof. In certain embodiments, the sample can be obtained from the cancer and/or tumor of the subject. In certain embodiments, a method for treating a subject having a cancer can include determining the expression level of mTORC1 (or a subunit thereof) in a sample of the cancer, where if the expression level of mTORC1 (or a subunit thereof) is increased compared to an mTORC1 control level, then administering to the subject a therapeutically effective amount of an inhibitor disclosed herein, e.g., an RNF167 inhibitor. Any suitable detecting methods known in the art and disclosed herein can be used with the presently disclosed subject matter to detect the expression level of mTORC1 (or a subunit thereof) (e.g., at the nucleic acid or protein level) in a cancer and/or tissue.
[0146] In certain embodiments, a method of the present disclosure can further include assessing the expression level of RNF167 in a cancer and/or tumor or a sample thereof. In certain embodiments, the sample can be obtained from the cancer and/or tumor of the subject. In certain embodiments, a method for treating a subject having a cancer can include determining the expression level of RNF167 in a sample of the cancer, where if the expression level of RNF167 is increased compared to an RNF167 control level, then administering to the subject a therapeutically effective amount of an inhibitor disclosed herein, e.g., an RNF167 inhibitor and/or an inhibitor that inhibits and/or reduces phosphorylation of CASTOR1, e.g., phosphorylation of CASTOR1 at amino acid S14, and/or inhibits or reduces the degradation of CASTOR1. Any suitable detecting methods known in the art and disclosed herein can be used with the presently disclosed subject matter to detect the expression level of RNF167 (e.g., at the nucleic acid or protein level) in a cancer and/or tissue.
[0147] In certain embodiments, a method of the present disclosure can further include assessing the expression level of CASTOR1 in a cancer and/or tumor or a sample thereof. In certain embodiments, a method of the present disclosure can further include assessing the level of phosphorylated CASTOR1 (e.g., CASTOR1 phosphorylated at S14) in a cancer and/or tumor or a sample thereof. In certain embodiments, the sample can be obtained from the cancer and/or tumor of the subject. In certain embodiments, a method for treating a subject having a cancer can include determining the expression level of CASTOR1 in a sample of the cancer, where if the expression level of CASTOR1 is reduced and/or decreased compared to an CASTOR1 control level, then administering to the subject a therapeutically effective amount of an inhibitor disclosed herein, e.g., an RNF167 inhibitor and/or an inhibitor that inhibits and/or reduces phosphorylation of CASTOR1, e.g., phosphorylation of CASTOR1 at amino acid S14, and/or inhibits or reduces the degradation of CASTOR1. Any suitable detecting methods known in the art and disclosed herein can be used with the presently disclosed subject matter to detect the expression level of CASTOR1 (e.g., at the nucleic acid or protein level) or level of phosphorylated CASTOR1 in a cancer and/or tissue.
[0148] In certain embodiments, an inhibitor of the present disclosure can be administered to a subject at a dose of about 0.05 mg/kg to about 100 mg/kg. In certain embodiments, a subject can be administered up to about 2,000 mg of an inhibitor of the present disclosure in a single dose or as a total daily dose.
[0149] In certain embodiments, the dosage administered varies depending upon known factors, such as the pharmacodynamic characteristics of the particular agent, and its mode and route of administration; age, health, and weight of the recipient; nature and extent of symptoms, kind of concurrent treatment, frequency of treatment, and the effect desired. In addition, it is to be understood that, for any particular subject, specific dosage regimes should be adjusted over time according to the individual need and the professional judgment of the person administering or supervising the administration of the inhibitor. For example, the dosage of the inhibitor can be increased if the lower dose does not provide sufficient activity in the treatment of a disease or condition described herein (e.g., cancer). Alternatively, the dosage of the inhibitor can be decreased if the disease (e.g., cancer) is reduced, no longer detectable or eliminated.
[0150] In certain embodiments, the disclosed inhibitors can be administered to the subject in a single dose or divided doses. In certain embodiments, the disclosed inhibitors can be administered to the subject once a day, twice a day, once a week, twice a week, three times a week, four times a week, five times a week, six times a week, once every two weeks, once a month, twice a month, once every other month or once every third month.
[0151] In certain embodiments, the duration of the disclosed treatment can be between about one week to about two years. In certain embodiments, the duration of the disclosed treatment is at least about 1 week, at least about 2 weeks, at least about 3 weeks, at least about 1 month, at least about 2 months, at least about 3 months, at least about 4 months, at least about 5 months, at least about 6 months, at least about 7 months, at least about 8 months, at least about 9 months, at least about 10 months, at least about 11 months, at least about 12 months, at least about 13 months, at least about 14 months, at least about 15 months, at least about 16 months, at least about 17 months, at least about 18 months, at least about 19 months, at least about 20 months, at least about 21 months, at least about 22 months, at least about 23 months, or at least about 24 months. In certain embodiments, the duration of the disclosed treatment is at most about 1 week, at most about 2 weeks, at most about 3 weeks, at most about 1 month, at most about 2 months, at most about 3 months, at most about 4 months, at most about 5 months, at most about 6 months, at most about 7 months, at most about 8 months, at most about 9 months, at most about 10 months, at most about 11 months, at most about 12 months, at most about 13 months, at most about 14 months, at most about 15 months, at most about 16 months, at most about 17 months, at most about 18 months, at most about 19 months, at most about 20 months, at most about 21 months, at most about 22 months, at most about 23 months, or at most about 24 months. In certain embodiments, the duration of the disclosed inhibitor treatment is at most 24 months or 2 years. In certain embodiments, the inhibitor can be administered until the cancer, cancer cells and/or tumor is no longer detectable.
[0152] In certain embodiments, the disclosed inhibitors can be cyclically administered to a subject. Cycling therapy involves the administration of the inhibitors for a period of time, followed by a rest for a period of time, and repeating this sequential administration. Cycling therapy can reduce the development of resistance to one or more of the therapies, avoid or reduce the side effects of one of the therapies, and/or improves the efficacy of the treatment. In certain embodiments, the treatment stops after one cycle because the subject is intolerable to the adverse effects and toxicities associated with the disclosed inhibitors.
[0153] In certain embodiments, the number of cycles is from about one to about twenty-four cycles. In certain embodiments, the number of cycles is more than twenty-four cycles. In certain embodiments, the number of cycles is about 1, about 2, about 3, about 4, about 5, about 6, about 7, about 8, about 9, about 10, about 11, about 12, about 13, about 14, about 15, about 16, about 17, about 18, about 19, about 20, about 21, about 22, about 23, or about 24. In certain embodiments, the duration of a cycle is from about 21 to about 30 days. In certain embodiments, the duration of a cycle is about 21, about 22, about 23, about 24, about 25, about 26, about 27, about 28, about 29, or about 30 days. In certain embodiments, the duration of a cycle is about 27 days, about 28 days, about 29, or about 30 days. In certain embodiments, the number of cycles is about twenty-four cycles.
[0154] In certain embodiments, each cycle is followed by a rest period, where the disclosed inhibitors are not administered to the subject. In certain embodiments, the rest period is from about two weeks to about six weeks, from three weeks to about five weeks, from about four weeks to about six weeks. In certain embodiments, the rest period is about three weeks, about four weeks, about five weeks, or about six weeks. The present disclosure further allows the frequency, number, and length of dosing cycles and rest periods to be adjusted.
[0155] In certain embodiments, the inhibitors and agonists disclosed herein can be used alone or in combination with one or more agents, e.g., anti-cancer agents. For example, but not by way of limitation, methods of the present disclosure can include administering one or more inhibitors and one or more agents, e.g., anti-cancer agents. “In combination with,” as used herein, means that the inhibitor or agonist, e.g., RNF167 inhibitor, and the one or more agents, e.g., anti-cancer agents, are administered to a subject as part of a treatment regimen or plan. In certain embodiments, being used in combination does not require that the inhibitor or agonist and one or more agents, e.g., anti-cancer agents, are physically combined prior to administration, administered by the same route or that they be administered over the same time frame. In certain embodiments, the agent, e.g., anti-cancer agent, is administered before an inhibitor or agonist. In certain embodiments, the agent, e.g., anti-cancer agent, is administered after an inhibitor or agonist. In certain embodiments, the agent, e.g., anti-cancer agent, is administered simultaneously with an inhibitor or agonist. In certain embodiments, a CASTOR1 inhibitor or agonist disclosed herein can be administered in combination with one or more agents, e.g., anti-cancer agents.
[0156] In certain embodiments, the one or more agents can be an anti-cancer agent. Non-limiting exemplary anti-cancer agents include, but are not limited to, chemotherapeutic agents, radiotherapeutic agents, cytokines, anti-angiogenic agents, apoptosis-inducing agents, anti-cancer antibodies, a targeted drug, and/or agents which promote the activity of the immune system, including but not limited to cytokines such as but not limited to interleukin 2, interferon, an anti-CTLA4 antibody, an anti-PD-1 antibody and/or an anti-PD-L1 antibody, and checkpoint inhibitors. In certain embodiments, the anti-cancer agent can be a taxane, a platinum-based agent, an anthracycline, an anthraquinone, an alkylating agent, a HER2 targeting therapy, vinorelbine, a nucleoside analog, ixabepilone, eribulin, cytarabine, a hormonal therapy, methotrexate, capecitabine, lapatinib, 5-FU, vincristine, etoposide or any combination thereof. In certain embodiments, the anti-cancer agent can be radiation therapy. Other non-limiting exemplary anti-cancer agents that can be used with the presently disclosed subject matter include tumor-antigen based vaccines and chimeric antigen receptor T-cells.
[0157] In certain embodiments, the one or more agents can be an agent that is the standard of care for a disease. For example, but not by way of limitation, the one or more agents can be the standard of care for treating diabetes, e.g., insulin, an insulin analog, metformin or similar diabetes agents, sulfonylureas, meglitinides, thiazolidinediones, DPP-4 inhibitors, GLP-1 receptor agonists and SGLT2 inhibitors.
[0158] In certain embodiments, the method can further include administering to the subject a therapeutically effective amount of an additional inhibitor selected from the group consisting of an AKT inhibitor, a TSC2 inhibitor, an mTORC1 inhibitor, e.g., an mTOR inhibitor, and combinations thereof. Non-limiting examples of such inhibitors can include a compound, a small molecule, a chemical, a polypeptide, a peptide, a protein, and combinations thereof that reduces the expression, function and/or activity of AKT, TSC2, and/or mTORC1. In certain embodiments, the additional inhibitor can be a ribozyme, an antisense oligonucleotide, a shRNA molecule and/or an siRNA molecule that reduces the expression, function and/or activity of AKT, TSC2, and/or mTORC1 (or a subunit thereof). Any suitable methods known in the art can be used for administering to the subject the disclosed inhibitors disclosed herein. In certain embodiments, the disclosed inhibitors can be administered to the subject orally or parenterally. For example, and not by way of limitation, the route of administration can be intravenous, intraarterial, intrathecal, intraperitoneal, intramuscular, subcutaneous, topical, intradermal, intranasal, vaginal, rectal, route, locally to the cancer, or combinations thereof.
IV. Pharmaceutical Compositions
[0159] The present disclosure further provides pharmaceutical compositions comprising one or more inhibitors and/or agonist disclosed herein for use in treating a disease in a subject. In certain embodiments, the disease cancer and/or a tumor, diabetes and/or ageing. For example, but not by way of limitation, the inhibitor can be selected from the group consisting of a RNF167 inhibitor, an inhibitor that inhibits and/or reduces phosphorylation of CASTOR1, e.g., at S14, or inhibits and/or reduces degradation of CASTOR1, and a combination thereof. In certain embodiments, the present disclosure provides a pharmaceutical composition that includes an RNF167 inhibitor. In certain embodiments, the present disclosure provides a pharmaceutical composition that includes a CASTOR1 agonist.
[0160] In certain embodiments, a pharmaceutical composition of the present disclosure includes an inhibitor or agonist, e.g., an RNF167 inhibitor or a CASTOR1 agonist, and a pharmaceutically acceptable carrier. Suitable pharmaceutically acceptable carriers that can be used with the presently disclosed subject matter have the characteristics of not interfering with the effectiveness of the biological activity of the active ingredients, e.g., disclosed inhibitors/anti-cancer agents, and that is not toxic to the patient to whom it is administered. Non-limiting examples of suitable pharmaceutical carriers include phosphate-buffered saline solutions, water, emulsions, such as oil/water emulsions, various types of wetting agents, and sterile solutions. Additional non-limiting examples of pharmaceutically acceptable carriers include gels, bioabsorbable matrix materials, implantation elements containing the inhibitor and/or any other suitable vehicle, delivery or dispensing means or material. Such pharmaceutically acceptable carriers can be formulated by conventional methods and can be administered to the subject. In certain embodiments, the pharmaceutical acceptable carriers can include buffers such as phosphate, citrate, and other organic acids; antioxidants including ascorbic acid and methionine; preservatives (such as, but not limited to, octadecyldimethylbenzyl ammonium chloride, hexamethonium chloride, benzalkonium chloride, benzethonium chloride, phenol, butyl or benzyl alcohol, alkyl parabens such as methyl or propyl paraben, catechol, resorcinol, cyclohexanol, 3-pentanol and m-cresol); low molecular weight (less than about 10 residues) polypeptides; proteins, such as serum albumin, gelatin or immunoglobulins; hydrophilic polymers such as polyvinylpyrrolidone; amino acids such as glycine, glutamine, asparagine, histidine, arginine or lysine; monosaccharides, disaccharides, and other carbohydrates including glucose, mannose or dextrins; chelating agents such as EDTA; sugars such as sucrose, mannitol, trehalose or sorbitol; salt-forming counter-ions such as sodium; metal complexes (e.g., Zn-protein complexes); and/or non-ionic surfactants such as polyethylene glycol (PEG). In certain embodiments, the suitable pharmaceutically acceptable carriers can include one or more of water, saline, phosphate buffered saline, dextrose, glycerol, ethanol or combinations thereof.
[0161] In certain non-limiting embodiments, the pharmaceutical compositions of the present disclosure can be formulated using pharmaceutically acceptable carriers well known in the art that are suitable for oral administration. Such carriers enable the pharmaceutical compositions to be formulated as tablets, pills, capsules, liquids, gels, syrups, slurries, suspensions and the like, for oral or nasal ingestion by a patient to be treated. In certain embodiments, the pharmaceutical composition is formulated as a capsule. In certain embodiments, the pharmaceutical composition can be a solid dosage form. In certain embodiments, the tablet can be an immediate release tablet. Alternatively or additionally, the tablet can be an extended or controlled release tablet. In certain embodiments, the solid dosage can include both an immediate release portion and an extended or controlled release portion.
[0162] In certain embodiments, the pharmaceutical compositions of the present disclosure can be formulated using pharmaceutically acceptable carriers well known in the art that are suitable for parenteral administration. The terms “parenteral administration” and “administered parenterally,” as used herein, refers to modes of administration other than enteral and topical administration, usually by injection, and includes, without limitation, intravenous, intramuscular, intraarterial, intrathecal, intracapsular, intraorbital, intracardiac, intradermal, intraperitoneal, transtracheal, subcutaneous, subcuticular, intraarticular, subcapsular, subarachnoid, intraspinal, epidural and intrasternal injection and infusion. For example, and not by way of limitation, pharmaceutical compositions of the present disclosure can be administered to the patient intravenously in a pharmaceutically acceptable carrier such as physiological saline. In certain embodiments, the present disclosure provides a parenteral pharmaceutical composition comprising inhibitors disclosed herein.
[0163] In certain embodiments, the pharmaceutical compositions suitable for use in the presently disclosed subject matter can include compositions where the active ingredients, e.g., an RNF167 inhibitor, are contained in a therapeutically effective amount. The therapeutically effective amount of an active ingredient can vary depending on the active ingredient, compositions used, the cancer and its severity, and the age, weight, etc., of the subject to be treated. In certain embodiments, a subject can receive a therapeutically effective amount of the disclosed inhibitors in single or multiple administrations of one or more composition, which can depend on the dosage and frequency as required and tolerated by the patient.
[0164] In certain non-limiting embodiments, pharmaceutical compositions of the present disclosure can include one or more additional inhibitors or be administered in combination with one or more additional inhibitors. For example, but not by way of limitation, the additional inhibitor can include a protein kinase B (AKT) inhibitor, a tuberous Sclerosis Complex 2 (TSC2) inhibitor, an mTORC1 (or a subunit of mTORC1) inhibitor, or a combination thereof. In certain non-limiting embodiments, an inhibitor that can regulate cell proliferation can be used in combination with the disclosed subject matter. For example, but not by way of limitation, any inhibitors that can target any kinases that mediate cell proliferation can be used in combination with the disclosed subject matter. Non-limiting examples of kinase inhibitors include afatinib, alectinib, axitinib, bevacizumab, bosutinib, cetuximab, crizotinib, canertinib, dasatinib, erlotinib, fostamatinib, gefitinib, GSK1838705A, ibrutinib, imatinib, lapatinib, lenvatinib, mubritinib, nilotinib, panitumumab, pazopanib, pegaptanib, ranibizumab, ruxolitinib, sorafenib, sunitinib, su6656, trastuzumab, tofacitinib, vandetanib and vemurafenib.
[0165] In certain embodiments, pharmaceutical compositions of the present disclosure can include or more anti-cancer agents or administered in combination with one or more additional anti-cancer agents. Non-limiting exemplary anti-cancer agents include, but are not limited to, chemotherapeutic agents, radiotherapeutic agents, cytokines, anti-angiogenic agents, apoptosis-inducing agents, anti-cancer antibodies, a targeted drug, agents which promote the activity of the immune system, and checkpoint inhibitors. Other non-limiting exemplary anti-cancer agents that can be used with the presently disclosed subject matter include tumor-antigen based vaccines and chimeric antigen receptor T-cells.
V. Kits
[0166] The present disclosure provides kits that can be used to practice the presently disclosed methods of treating a disease, e.g., a cancer and/or tumor, diabetes or ageing in a subject. In certain embodiments, the kits disclosed herein comprise a pharmaceutical composition disclosed herein.
[0167] In certain embodiments, the kits comprise a pharmaceutical composition comprising a therapeutically effective amount of an inhibitor or agonist disclosed herein, e.g., an RNF167 inhibitor; an inhibitor that reduces phosphorylation of CASTOR1, e.g., at S14, or inhibits and/or reduces degradation of CASTOR1; an agonist of CASTOR1 that increases and/or enhances the activity, function and/or expression of CASTOR1; or a combination thereof.
[0168] In certain embodiments, the kit can include one or more additional inhibitors within the same container (or pharmaceutical compositions thereof) or within a second container. For example, but not by way of limitation, the additional inhibitor can include a protein kinase B (AKT) inhibitor, a tuberous Sclerosis Complex 2 (TSC2) inhibitor, a mTORC1 inhibitor, or a combination thereof.
[0169] In certain embodiments, the kit can include one or more anti-cancer agents. Non-limiting exemplary anti-cancer agents include, but are not limited to, chemotherapeutic agents, radiotherapeutic agents, cytokines, anti-angiogenic agents, apoptosis-inducing agents, anti-cancer antibodies, a targeted drug, agents which promote the activity of the immune system, and checkpoint inhibitors. Other non-limiting exemplary anti-cancer agents that can be used with the presently disclosed subject matter include tumor-antigen based vaccines and chimeric antigen receptor T-cells.
[0170] In certain embodiments, the kits further comprise instructions for using the kits in treating a subject. In certain embodiments, the instructions indicate that the disclosed inhibitors can be administered in accordance with the methods disclosed herein. In certain embodiments, the instructions indicate the disclosed inhibitors can be administered for up to 2 years. For example, and not by way of limitation, the instructions can include a description of the disclosed inhibitors and/or agonists and/or a second anti-cancer agent, and, optionally, other components present in the kit. In certain embodiments, the instructions can describe methods for administration of the components of the kit, including methods for determining the proper state of the subject, the proper dosage amount and the proper administration method for administering one or more of the disclosed inhibitors and/or other anti-cancer agent. Instructions can also include guidance for monitoring the subject over the duration of the treatment time. In certain embodiments, the kit can further comprise one or more containers comprising additional inhibitors and/or other anti-cancer agents.
[0171] In certain non-limiting embodiments, the present disclosure provides for a kit of this disclosure further including one or more of the following: devices and additional reagents, and components, such as tubes, containers, cartridges, and syringes for performing the methods disclosed herein.
[0172] In certain embodiments, a kit of the present disclosure can include one or more agents for detecting the expression level of RNF167, CASTOR1 and/or mTORC1 (or a subunit thereof) in a sample from the subject. For example but not by way of limitation, a kit of the present disclosure can be used for determining the prognosis of a subject having cancer. In certain embodiments, a kit for determining the prognosis of a subject having cancer can include means for detecting ring finger protein 167 (RNF167) and/or CASTOR1 that include one or more comprises one or more primers, probes, arrays/microarray, antibodies and/or bead for detecting RNF167 and/or CASTOR1. In certain embodiments, the means for detecting CASTOR1 comprises an antibody that specifically binds to S14 of CASTOR1. In certain embodiments, a kit for determining the prognosis of a subject having cancer further includes (i) a therapeutically effective amount of a ring finger protein 167 (RNF167) inhibitor; (ii) a therapeutically effective amount of an inhibitor that reduces phosphorylation of CASTOR1 at S14 and/or reduces degradation and/or ubiquitination of CASTOR1; and/or (iii) a therapeutically effective amount of an agonist of CASTOR1 that increases and/or enhances the activity, function and/or expression of CASTOR1.
[0173] The following examples are merely illustrative of the presently disclosed subject matter and should not be considered as limiting in any way.
Example 1: RNF167 Activates mTORC1 and Promotes Tumorigenesis by Targeting CASTOR1 for Ubiquitination and Degradation
[0174] (CASTOR1) functions as an arginine sensor and regulates mTORC1 activity in response to arginine status. CASTOR1 is expected to contain a consensus AKT1 phosphorylation motif R—V—R—V-L-S14 (SEQ ID NO: 26). Proteomic analysis identified CASTOR1 phosphorylation at S14, suggesting that CASTOR1 is a potential AKT1 substrate. Examination with point mutation prediction algorithms revealed increased stability of CASTOR1 if S14 is mutated to a non-phosphorylatable mimic alanine (A), and a decreased stability if it is mutated to a constitutively phosphorylated mimic aspartic acid (D). These analyses suggest that AKT1 might phosphorylate CASTOR1 and regulate its stability.
[0175] The phosphorylation-dependent regulation of protein stability is closely associated with protein polyubiquitination, a mark for their degradation via 26S proteasome. The formation of polyubiquitin chain conjugated to a target protein occurs in a cascade of three steps: activation, conjugation, and ligation, exerted by E1 ubiquitin-activating enzyme, E2-conjugating enzyme, and E3 ubiquitin-ligase, respectively. The first linkage is initiated by the binding of the C-terminal glycine in ubiquitin to the lysine in the substrate, forming an isopeptide bond. Further polyubiquitin chain can be formed by linking the glycine residue of another ubiquitin molecule to the lysine of ubiquitin bound to a substrate. Seven lysine residues in ubiquitin are responsible for polyubiquitin formation, including K6, K11, K27, K29, K33, K48, and K63. Among them, K29-, K48- or K63-mediated polyubiquitination typically triggers proteasomal degradation. RING finger protein (RNF167) is a RING-type E3 ligase involved in regulating protein trafficking, localization, and degradation by directly ubiquitinating targeted substrates.
[0176] This Example shows that a low expression level of CASTOR1 is correlated with poor patient survival in numerous types of cancer including breast cancer, and that CASTOR1 is a substrate of RNF167. Furthermore, AKT-mediated phosphorylation of CASTOR1 facilitates its interaction with RNF167, leading to CASTOR1 ubiquitination and proteasome-dependent degradation. Additionally, CASTOR1 phosphorylation at S14 by AKT decreases its binding affinity to the GATOR2 complex. The phosphorylation and degradation of CASTOR1 collectively release the GATOR2 complex, activate mTORC1, and promote breast cancer progression. These findings reveal a novel mechanism by which cancer cells overcome the suppressive effect of CASTOR1 in the nutrient-deficient tumor microenvironment, and hence identify a potential novel therapeutic target for treating mTORC1-associated diseases including cancer.
[0177] Methods:
[0178] Cell culture and transfection: 293T cells obtained from ATCC (CRL-3216) were maintained in DMEM supplemented with 10% FBS. MCF7, T47D, HCC1569, and HCC202 cells were obtained from Dr. Xiaosong Wang at the University of Pittsburgh, and cultured in RPMI1640 with 10% FBS. MM cells were cultured in DMEM plus 10% FBS, while KMM cells were cultured in DMEM plus 10% FBS and 10 μg/ml hygromycin. HSAEC (FC-0016) and HLBEC (FC-0054) cells were purchased from Lifeline and cultured with the BronchiaLife™ Epithelial Airway Medium Complete Kit (Lifeline LL-0023). All cells were maintained at 37 C° in 5% CO.sub.2.
[0179] For amino acid deprivation and re-stimulation to assess mTORC1 activation, cells were incubated in EBSS medium (Thermo 24010043) for 50 min and then stimulated by adding arginine (Sigma A5131) at the indicated concentration. For ubiquitination assays, cells were deprived of FBS or arginine, or treated with 10 μM MK2206 (Selleckem S1078) overnight before immunoprecipitation and immunoblotting, or re-stimulated with FBS or arginine for 12 h before analysis.
[0180] For chemical treatments, CHX (CST 2112) or MG132 (Sigma M8699) dissolved in DMSO (VWR 97061-250) was diluted in medium to a specified concentration. Medium containing MG132 or CHX was then used to replace the original medium, and cells were cultured in the presence of MG132 for a specified time.
[0181] For transfection, Lipofectamine 2000 (Thermo 11668019) was used for transient transfection of plasmids, and RNAimax (Thermo 13778150) was used for transfection of siRNAs based on the manufacturer's instructions.
[0182] Plasmids: Plasmids purchased from Addgene included: pLKO1-TRC (10878), pcDNA3-myr-HA-AKT1 (46969), pcDNA3-HA-AKT1 (73408), pcDNA3-HA-AKT1-K179M (73409), pcDNA3-HA-AKT1-1-149aa (73410), pcDNA3-HA-AKT1-120-433aa (73411), pRK5-HA-Ubiquitin-WT (17608), pRK5-HA-Ubiquitin-K29 (22903) and pRK5-HA-Ubiquitin-K29R (17602). Plasmids p.sup.30.3 empty vector, p3.3-Myc-Ubiquitin-WT, p3.3-Myc-Ubiquitin-K48, p3.3-Myc-Ubiquitin-K63, p3.3-flag-KLHL19, p3.3-flag-KLHL21, p3.3-flag-KLHL22, p3.3-flag-ZNRF1, p3.3-flag-ZNRF2, p3.3-flag-BACURD1, p3.3-flag-BACURD2, p3.3-flag-RNF152, p.sup.30.3-flag-RNF167, p3.3-flag-β-Trcp1, p3.3-flag-FBW7, p3.3-flag-HERC5 and p3.3-flag-Skp2 were provided by Jie Chen at Beijing University in China. pcDNA3 empty vector was purchased from Invitrogen. pMD.G and p8.74 were from PlasmidFactory. Human pITA-flag-CASTOR1 WT was cloned from 293T cells. Rat pITA-flag-CASTOR1 WT was previously described. The mutants of human pITA-flag-CASTOR1 including S14A, S14D, K61R, K96R, K213R, K61R/K96R, K61R/K213R and K61R/K96R/K213R were generated using a mutagenesis kit (NEB E0554) based on the manufacturer's instructions. The primer sequences used for the cloning are listed in Table 1 and the sequences of all plasmids were confirmed by direct sequencing. The siRNAs used for the disclosed subject matter are listed in Table 2.
TABLE-US-00001 TABLE 1 Summary of PCR primers and shRNAs Rat 5′TATGCGGCCGCGCCACCATG Flag- GACTACAAAGACGATGACGA CAST CAAGATGGAACTTCACATCC OR1- AGAGC3′ forward (SEQ ID NO: 1) Rat 5′ATAGGATCCCTATGGATCTT Flag- TGGAAGCCAGG3′ CAST (SEQ ID NO: 2) OR1- reverse Human 5′TATGCGGCCGCGCCACCATG CAST GAGCTGCACATCCTAGAAC3′ OR1- (SEQID NO: 3) forward Human 5′ATAGGATCCTCAGGAAGCCA CAST GGCCTTCCT3′ OR1- (SEQ ID NO: 4) reverse Human 5′TATGCGGCCGCGCCACCATG HA- TACCCATACGATGTTCCAGA CAST TTACGCTATGGAGCTGCACA OR1- TCCTAGAAC3′ forward (SEQ ID NO: 5) Human 5′ATAGGATCCTCAGGAAGCCA HA- GGCCTTCCT3′ CAST (SEQ ID NO: 6) OR1- reverse Human 5′TATGCGGCCGCGCCACCATG Flag- GACTACAAAGACGATGACGA CAST CAAGATGGAGCTGCACATCC OR1- TAGAAC3′ forward (SEQ ID NO: 7) Human 5′ATAGGATCCTCAGGAAGCCA Flag- GGCCTTCCT3′ CAST (SEQ ID NO: 8) OR1- reverse Human 5′GCGGGTGCTGGCTGTCGCCC Flag- GTC3′ CAST (SEQ ID NO: 9) OR1- S14A- forward Human 5′ACCCGGTGTTCTAGGATG3′ Flag- (SEQ ID NO: 10) CAST OR1- S14A- reverse Human 5′GCGGGTGCTGGATGTCGCCC Flag- GTC3′ CAST (SEQ ID NO: 11) OR1- S14D- forward Human 5′ACCCGGTGTTCTAGGATG3′ Flag- (SEQ ID NO: 12) CAST OR1- S14D- reverse Human 5′GGAGGGCTTTCGAGAGCTGC Flag- CCC3′ CAST (SEQ ID NO: 13) OR1- K61R- forward Human 5′TCGTCCACCATAAGCGTG3′ Flag- (SEQ ID NO: 14) CAST OR1- K61R- reverse Human 5′TGGGGTCACCCGGATCGCCC Flag- GTTCGG3′ CAST (SEQ ID NO: 15) OR1- K96R- forward Human 5′GCAGCCTGCACTGCCGCA3′ Flag- (SEQ ID NO: 16) CAST OR1- K96R- reverse Human 5′CAGCACCCCCCGGGAGGCAG Flag- CCT3′ CAST (SEQ ID NO: 17) OR1- K213R- forward Human 5′TGCGAGTAGAAGAGGACATC Flag- TATG3′ CAST (SEQ ID NO: 18) OR1- K213R- reverse shRNA 5′TTGTACTACACAAAAGTACT non- G3′ targeting (SEQ ID NO: 19) (NT) control Human 5′GGAGCTGCACATCCTAGAAC CAST A3′ OR1- (SEQ ID NO: 20) sh1 Human 5′GCTTTGATGAATGTGGCATC CAST G3′ OR1- (SEQ ID NO: 21) sh2
TABLE-US-00002 TABLE 2 Summary of siRNAs siRNA negative control (NC) Sigma Cat#SIC001 Human AKT1 siRNA-1 Sigma Cat#SASI_Hs01_00105954 Human AKT1 siRNA-2 Sigma Cat#SASI_Hs01_00105953 Human RNF167 siRNA-1 Sigma Cat#SASI_Hs01_00201491 Human RNF167 siRNA-2 Sigma Cat#SASI_Hs01_00201493 Human TSC2 siRNA-1 Sigma Cat#SASI_Hs01_00127335 Human TSC2 siRNA-2 Sigma Cat#SASI_Hs01_00127336
[0183] Antibodies: Primary antibodies included antibodies to S6K1 (Abcam 32359), pS6K-Thr389 (CST 9205), p4EBP1-Ser65 (CST 9451), 4EBP1 (CST 9644), pan AKT (Cell Signaling Technology 4691), pAKT-Thr308 (CST 2965), AKT1 (CST 2938), pAKT substrate (RXRXXpS*/T*) (CST 10001), GAPDH (CST 5174), flag (Sigma F1804), flag (Sigma A9594), HA (CST 3724), HA (CST 3444), GST (CST 2625), Ub (Santa Cruz sc-8017), c-Myc (Santa Cruz sc-40), RNF167 (Santa Cruz sc-515405), RNF167 (Proteintech 24618-1-AP), β-actin (Santa Cruz sc-47778) and β-tubulin (Sigma 7B9). Antibodies to CASTOR1 were described as before. Secondary antibodies included mouse anti-Rabbit IgG (Light-Chain Specific) (CST 93702), rabbit anti-Mouse IgG (Light Chain Specific) (CST 58802), goat anti-rabbit HRP conjugated IgG (CST 7074), horse anti-mouse IgG HRP conjugated IgG (CST 7076), goat anti-mouse IgG DyLight 800 (Bio-Rad STAR117D800GA) and goat anti-rabbit IgG StarBright Blue700 (Bio-Rad 12004161).
[0184] Immunoprecipitation. Cells were lysed in lysis buffer (50 mM Tris-HCl, with 150 mM NaCl, 1 mM EDTA, and 1% Triton X-100, pH 7.4) supplemented with a complete protease inhibitor cocktail (Thermo 78438) and phosphatase inhibitor (Thermo 78427), followed by centrifugation at 4° C. for 5 min. The supernatant was then precleared with mouse IgG agarose beads (Sigma A0919) at 4° C. for 4 h, and subsequently mixed with washed agarose beads conjugated with anti-Flag (Sigma A2220), anti-HA (Thermo 26182), anti-Myc (Sigma A7470, anti-AKT (Cell Signaling Technology 3653) or mouse IgG antibodies (Sigma A0919) at 4 C° overnight. Immunocomplexes were washed extensively 3 times with washing buffer (50 mM Tris-HCl, 150 mM NaCl, pH 7.4). The immunoprecipitates were eluted with 2×SDS, and then subjected to immunoblotting analysis.
[0185] For transfection experiments, 6×10.sup.8 cells were seeded in 10 cm dishes and transfected with 5 μg of each plasmid using Lipofectamine 2000 (Thermo 11668019) for 48 h. Cells were then treated and lysed as described above.
[0186] Immunoblotting analysis: To detect all proteins except CASTOR1, samples were separated with 4%-20% SDS-polyacrylamide gels (Genscript M00656 and M00657). To detect CASTOR1 protein, samples were resolved with 10% SDS-polyacrylamide gels (Genscript M00665 and M00666). Proteins resolved in gels were then transferred to nitrocellulose membranes (GE Healthcare 10600004), which were incubated with primary and secondary antibodies overnight and for 1 h at room temperature, respectively. The signals were developed using the Luminiata Crescendo Western HRP Substrate (EMD Millipore WBLUR0500) and SuperSignal West Femto Maximum Sensitivity Substrate (Thermo 34096) or fluorescence secondary antibodies. The images were recorded with a ChemiDoc MP Imaging System (Bio-Rad 17001402) at either Chemi, Dylight 500, DyLight 800, or StarBright B700 channels.
[0187] In vitro kinase assay: Recombinant GST-AKT1 protein (Novus Biologicals, 1775-KS) was mixed with GST-CASTOR1 protein (Novus Biologicals, H00652968-P01) in a 30 μl reaction mixture at room temperature for 1 h. The reaction mixture contained protease inhibitors, 100 mM HEPES (pH 7.4), 150 mM NaCl, 50 mM MgCl.sub.2,1 mM DTT, 0.01% NaN.sub.3, 1 mM ATP, 0.2 μg GST-AKT1 and 1 μg GST-CASTOR1.
[0188] Lentivirus-mediated overexpression and knockdown of genes: CASTOR1 shRNAs, non-targeting control (NT), Flag-tagged CASTOR1 WT, S14A, and S14D expression lentiviral plasmids or the empty vector control pITA was cotransfected with pMDG and p8.74 packaging plasmids into 293T cells using the Lipofectamine 2000 (Thermo 11668019). At day 2 and 3 post-transfection, the supernatant of 293T cells was collected and filtered with a 0.45 μM filter. The transduction of cells was done by spinning infection at 1,500 rpm at room temperature for 1 h with 10 μg/ml polybrene (Sigma A5431). The expression of CASTOR1 was confirmed by immunoblotting at day 3 post-transduction.
[0189] Colony formation in softagar: A total of 2×10.sup.4 MCF7 or HCC1569 cells were suspended in 1 ml of 0.3% top agar (Sigma A5431) and then plated onto one well of 0.5% base agar in 6 well plates, which were maintained for 10 or 30 days, respectively. Colonies were photographed with a 4×objective with an inverted microscope.
[0190] BrdUincorporation and apoptosis assay: For BrdU incorporation, MCF7 or HCC1569 cells were pulsed with 10 μM BrdU (Sigma B5002) for 2 h, and then fixed with 70% ethanol, permeabilized with 2 M hydrochloric acid and stained with an anti-BrdU monoclonal antibody (Thermo B35129). Apoptotic cells were detected by co-staining with DAPI (Sigma D9542) and PE-Cy7 Annexin V Apoptosis Detection kit (eBioscience 88810374) following the instructions of the manufacturer. Flow cytometry was performed in a BD LSRFortessa system (BD Biosciences) and the analysis was done with FlowJo.
[0191] Reverse transcription real-time quantitative polymerase-chain reaction (RT-qPCR): Total RNA was extracted by using TRI Reagent (Sigma T9424) based on the manufacturer's instructions. Total RNA was subjected to reverse transcription using the Maxima H Minus First Strand cDNA Synthesis Kit (Thermo K1652). SsoAdvanced™ Universal SYBR® Green Supermix Kit (Bio-Rad 172-5272) was applied for qPCR analysis. The relative mRNA levels were normalized to a house-keeping gene, which yielded 2.sup.−ΔΔCt values. For qPCR reaction, each sample was run in triplicates with cycle threshold (Ct) values within 0.5 Ct differences among the triplicates. The primers used for gene expression were 5′GCCACCACCCTCATAGATGT3′ (forward; SEQ ID NO: 22) and 5′AGGAGGTCACTGGGGAACTT3′ (reverse; SEQ ID NO: 23) for human CASTOR1; and ATCATTGCTCCTCCTGAGCG (forward; SEQ ID NO: 24) and CGGACTCGTCATACTCCTGC (reverse; SEQ ID NO: 25) for human β-actin.
[0192] Mouse experiments: Athymic Nude-Foxn1nu mice were purchased from Envigen. Mice were raised under 12 h light/dark cycle and with a standard diet at the University of Pittsburgh. MCF7 cells transduced with either a vector control, Flag-CASTOR1 WT, S14A, or S14D were trypsinized and concentrated by centrifugation to 5×10.sup.6 per 100 μl in DMEM supplemented with 10% FBS. An equal volume of cells was mixed with an equal volume of Matrigel (VWR 47743-720), and then 5×10.sup.6 cells were subcutaneously injected into each flank of the mouse. The mice were inserted with an estrogen pellet (Sigma 8875) before injection. Tumor volume was measured twice a week and calculated based on the formula (V=L×W×W×0.5). Mice were euthanized when the tumor size reached the upper limit of 1,500 mm.sup.3.
[0193] Quantification, statistical analysis, and reproducibility: The intensity of a protein band was quantified with Image Lab Software (Bio-Rad). Data were presented as mean±SEM (standard error of the mean) and analyzed by Student's t-test or one-way analysis of variance (ANOVA) if multiple samples were involved, followed by Tukey post-hoc test if P<0.05. All statistical analyses were done with the Prism software package (PRISM 6.0, GraphPad Software, USA). A P<0.05 was considered as statistically significant. Statistical symbols “*”, “**” and “***” indicate P-values <0.05, <0.01 and <0.001, respectively, and “NS” denotes “not significant”.
Results
[0194] RNF167 mediates K29-linked polvubiquitination and degradation of CASTOR1 in response to growth factors: To reveal the environmental cue that activates mTORC1 by modulating the expression of CASTOR1, cells were deprived of either fetal bovine serum (FBS) or arginine. The kinetic analysis demonstrated that CASTOR1 protein level but not mRNA level was increased following 16 h of FBS deprivation in 293T cells, which was correlated with a decreased mTORC1 activity as shown by the reduced phosphorylation level of its downstream targets S6K and 4EBP1 (
[0195] The above results showed a negative correlation of AKT activation with the CASTOR1 protein level, which was strongly regulated by FBS deprivation but only marginally by arginine deprivation, suggesting an important regulatory role of growth factors in CASTOR1 protein level. Treatment with AKT inhibitor MK2206 in 293T cells upregulated CASTOR1 protein but not mRNA level, and decreased mTORC1 activation, mimicking FBS deprivation (
[0196] AKT1 phosphorylation of CASTOR1 promotes RNF167-mediated ubiquitination and degradation of CASTOR1. Since these results suggested that the CASTOR1 protein level was strongly regulated by FBS, potentially through AKT activation, the mechanism mediating CASTOR1 degradation was examined. Consistent with the observed CASTOR1 protein level, FBS deprivation reduced CASTOR1 ubiquitination, while arginine deprivation had no noticeable effect (
[0197] Covalent conjugation of ubiquitin is a key step in proteasome-mediated degradation of target proteins. CASTOR1 was only labeled by wild-type (WT) ubiquitin or K29 ubiquitin, a ubiquitin mutant containing only the K29 lysine but not by K48 and K63 ubiquitin (
[0198] To identify the E3 ubiquitin ligase(s) that might regulate CASTOR1 polyubiquitination and degradation, a panel of E3 ubiquitin ligases implicated in mTORC1 regulation was screened. Although ectopic expression of numerous E3 ubiquitin ligases decreased CASTOR1 protein level (
[0199] By providing growth factors, FBS activates numerous kinases, which could be the reason that it regulates the CASTOR1 level. Since the effect of AKT inhibitor MK2206 on the CASTOR1 protein level was the same as FBS starvation (
[0200] In vitro kinase assay was performed to confirm AKT direct phosphorylation of CASTOR1. Purified glutathione S-transferase (GST)-AKT1 efficiently phosphorylated purified GST-tagged CASTOR1 (GST-CASTOR1) recombinant protein only in the presence of ATP, which was abolished by AKT inhibitor MK2206 (
[0201] As phosphorylation is intimately linked to protein ubiquitination and degradation, the consequence of AKT1-mediated CASTOR1 phosphorylation was examined, and myristoylated constitutively active AKT1 (myr-HA-AKT1) decreased CASTOR1 protein level in a dose-dependent manner (
[0202] To test whether AKT1 regulates CASTOR1 stability, cells were co-transfected with both Flag-CASTOR1 WT and myr-HA-AKT1, then treated them with de novo protein synthesis inhibitor cycloheximide (CHX), and observed faster degradation of CASTOR1 protein in cells expressing myr-HA-AKT1 than the vector control (
[0203] To clarify the link between AKT1-mediated phosphorylation and RNF167-mediated ubiquitination of CASTOR1, the effect of CASTOR1 phosphorylation on CASTOR1-RNF167 interaction was examined. CASTOR1 S14D had a much stronger affinity to RNF167 and a higher level of ubiquitination than WT or S14A had (
[0204] Examination of CASTOR1 with the Ubisite and UbPreb program identified numerous lysine residues as putative ubiquitination sites including K61, K96, and K213 (
[0205] High CASTOR1 protein level overrides arginine activation of mTORC1: Next, the downstream effects of AKT1-mediated phosphorylation and RNF167-targeting degradation of CASTOR1 protein were assessed. Consistent with the previous report, a high level of CASTOR1 protein rendered cells insensitive to arginine-mediated activation of mTORC1 in 293T cells (
[0206] RNF167-mediated ubiquitination and AKT-mediated phosphorylation of CASTOR1 release mTORC1 inactivation: Mechanistically, binding of CASTOR1 to MIOS, the core component of GATOR2 complex, was positively correlated with the CASTOR1 protein level, further demonstrating that mTORC1 activation was regulated by CASTOR1 protein level in addition to arginine (
[0207] Since CASTOR1 S14D was constitutively phosphorylated and hence was prone to degradation whereas CASTOR1 S14A was non-phosphorylatable and resistant to degradation, these constructs were used to assess the effect on mTORC1 activation. Consistently, the protein level was lower, which led to a lower pull down yield in co-immunoprecipitation, for S14D than WT and S14A (
[0208] RNF167-mediated ubiquitination and AKT1-mediated phosphorylation of CASTOR1 promote breast cancer progression: the prognostic value of CASTOR1 mRNA expression in cancer was predicted using the TCGA database. Consistent with CASTOR1's inhibitory function on mTORC1 and tumor suppressive role, a lower CASTOR1 expression level was correlated with overall poor survival in pan-cancer analyses (
[0209] Breast cancer represents 12% of cancer diagnosed and is a major life threat for women in the United States. A high RNF167 expression level was found in breast tumors compared to the adjacent normal tissues (
[0210] Consistent with 293T cells, the affinity to exogenous and endogenous RNF167 was stronger for CASTOR1 S14D than WT and S14A in ER+ MCF7 and T47D cells, respectively (
[0211] To examine the importance of AKT1-mediated phosphorylation and RNF167-mediated degradation of CASTOR1 in breast cancer cells, Flag-CASTOR1 WT, S14A, and S14D were overexpressed in HCC1569, MCF7, and T47D cells. CASTOR1 S14D had much lower expression level than WT and S14A had in all three cell lines examined (
[0212] MCF7 cells that were transduced with a vector control, Flag-tagged CASTOR1 WT, S14A or S14D are subcutaneously engrafted into both flanks of nude mice. Ectopic expression of CASTOR1 WT and S14A significantly inhibited tumor growth in vivo, whereas S14D had a relatively less effect (
DISCUSSION
[0213] A general mechanism of AKT-mediated phosphorylation at S14 and RING-type E3 ligase RNF167-mediated ubiquitination at multiple lysine residues of CASTOR1 leading to its proteasome-dependent degradation and consequently mTORC1 activation is assessed. The AKT phosphorylation site in CASTOR1 is present in other vertebrate species analyzed, indicating its conserved function. Mutation of this site into a constitutively phosphorylated mutant (S14D) increases its interaction with AKT, suggesting a possible conformation change and a feed-forward negative AKT regulatory mechanism of the CASTOR1 protein. The CASTOR1 lysines, i.e., K61, K96 and K213 are marked by K29-linked polyubiquitination. Intriguingly, the constitutively phosphorylated S14D mutant has a significantly higher affinity to RNF167, explaining its faster ubiquitination and degradation, and a significantly lower affinity to MIOS. In addition, CASTOR1 phosphorylation at S14 significantly inhibits CASTOR1 dimerization, which is important for binding to the GATOR2 complex (
[0214] mTORC1 activation is tightly regulated occurring in a cascade fashion initiated by amino acids-mediated mTORC1 translocation to lysosomes followed by AKT-induced Rheb phosphorylation of mTOR. So far, several amino acid sensors including Sestrin2, SLC39A9, TM4SF5, and SAMTOR are known to modulate mTORC1 activity in response to amino acid status. CASTOR1 is a newly discovered arginine sensor, which interplays with arginine to modulate mTORC1 signaling pathway. Hence, these findings reveal a cross talk between two previously independent signaling pathways, i.e., the growth factor-dependent AKT and arginine-regulated CASTOR1 signaling pathways, which fine-tunes mTORC1 activation. This regulatory mechanism is likely essential for controlling the homeostasis and proliferation of normal cells. In normal cells that are quiescent or at a low proliferating rate, AKT is inactivated, leading to upregulated CASTOR1, mTORC1 inactivation, and a decreased uptake of nutrients including arginine, which would have a minimal effect on CASTOR1's function and mTORC1 activation (
[0215] The mTORC1 pathway is often dysregulated in cancer, which is critical for the progression of cancer. While CASTOR1's mTORC1 inhibitory function is negated by arginine, a high level of CASTOR1 protein evades the effect of arginine and prevents arginine-mediated mTORC1 activation (
[0216] While no consistent association of CASTOR1 mutation with any types of cancer has been identified so far, a lower mRNA expression level of CASTOR1 predicts a poor prognosis in 10 types of cancer (
[0217] CASTOR1 is tumor suppressive in KSHV-induced cellular transformation and lung adenocarcinoma.sup.9,10. In breast cancer cell lines, the protein level of CASTOR1 appears to be inversely correlated with the level of AKT activation (
[0218] In addition to extracellular arginine deficiency commonly observed in the tumor microenvironment, the rate-limiting enzyme ASS1 responsible for intracellular de novo arginine synthesis is also frequently silenced in most cancer types. These cancer cells are arginine auxotrophic, which are the basis for clinical trials with pegylated arginine deiminase (ADI-PEG20) and human recombinant arginase. These regimens are expected to deprive cancer cells of arginine, leading to CASTOR1 activation, mTORC1 suppression and tumor regression. While tumors initially respond to ADI-PEG20, ASS1-deficient tumors eventually become resistant to these treatments at least in part by activating the PI3K/AKT pathway. It can be speculated that AKT activation would result in CASTOR1 degradation and mTORC1 activation, contributing to the resistance to the therapies. Hence, AKT-mediated degradation of CASTOR1 could be an important mechanism of resistance to cancer therapies designed to deplete cancer cells of arginine. In this context, combining arginine deprivation and AKT inhibition could be an attractive approach to overcome resistance to these cancer therapies.
Example 2: Tumor Suppressive Function of CASTOR1
[0219] CASTOR1 is tumor suppressive in a Kras-driven mouse lung cancer model: To demonstrate the tumor-suppressive function of CASTOR1 in a genetic mouse model, a conditional Kras transgenic mouse was crossed with a CASTOR1 full-body knockout mouse. Intranasal inoculation of the mice with CRE-expressing adenoviruses of the mice induced the expression of Kras leading to the development of lung tumors. Kras induced more tumor foci and larger foci in CASTOR1 knockout mice than in mice with WT CASTOR1 (
[0220] CASTOR1 phosphorylated at S14 (p-CASTOR1) as a biomarker: CASTOR1 S14 was identified as an AKT phosphorylated site. As described in Example 1, AKT-mediated CASTOR1 phosphorylation at S14 (p-CASTOR1) targets it for ubiquitination and degradation resulting in the activation of mTORC1. p-CASTOR1 is an indicator of mTORC1 activity and can be used as a biomarker for mTORC1 activity. Examination of several types of human cancer using a phospho-specific antibody for CASTOR1 phosphorylated at S14 show that p-CASTOR1 is detected at higher levels in tumors than the control normal tissues of a Kras-driven mouse lung cancer model (
REFERENCES
[0221] Song M, Bode A M, Dong Z, Lee M H. AKT as a Therapeutic Target for Cancer. Cancer Res 79, 1019-1031 (2019). [0222] Waks A G, Winer E P. Breast Cancer Treatment: A Review. JAMA 321, 288-300 (2019). [0223] Manning B D, Toker A. AKT/PKB Signaling: Navigating the Network. Cell 169, 381-405 (2017). [0224] Manning B D, Tee A R, Logsdon M N, Blenis J, Cantley L C. Identification of the tuberous sclerosis complex-2 tumor suppressor gene product tuberin as a target of the phosphoinositide 3-kinase/akt pathway. Mol Cell 10, 151-162 (2002). [0225] Inoki K, Li Y, Zhu T, Wu J, Guan K L. TSC2 is phosphorylated and inhibited by Akt and suppresses mTOR signalling. Nat Cell Biol 4, 648-657 (2002). [0226] Alessi D R, Caudwell F B, Andjelkovic M, Hemmings B A, Cohen P. Molecular basis for the substrate specificity of protein kinase B; comparison with MAPKAP kinase-1 and p70 S6 kinase. FEBS Lett 399, 333-338 (1996). [0227] Chantranupong L, et al. The CASTOR Proteins Are Arginine Sensors for the mTORC1 Pathway. Cell 165, 153-164 (2016). [0228] Saxton R A, Chantranupong L, Knockenhauer K E, Schwartz T U, Sabatini D M. Mechanism of arginine sensing by CASTOR1 upstream of mTORC1. Nature 536, 229-233 (2016). [0229] Ward P S, Thompson C B. Metabolic reprogramming: a cancer hallmark even warburg did not anticipate. Cancer Cell 21, 297-308 (2012). [0230] Delage B, et al. Arginine deprivation and argininosuccinate synthetase expression in the treatment of cancer. Int J Cancer 126, 2762-2772 (2010). [0231] Bean G R, et al. A metabolic synthetic lethal strategy with arginine deprivation and chloroquine leads to cell death in ASS1-deficient sarcomas. Cell Death Dis 7, e2406 (2016). [0232] Sabatini D M. mTOR and cancer: insights into a complex relationship. Nat Rev Cancer 6, 729-734 (2006). [0233] Li T, Ju E, Gao S J. Kaposi sarcoma-associated herpesvirus miRNAs suppress CASTOR1-mediated mTORC1 inhibition to promote tumorigenesis. J Clin Invest 130, (2019). [0234] Obenauer J C, Cantley L C, Yaffe M B. Scansite 2.0: Proteome-wide prediction of cell signaling interactions using short sequence motifs. Nucleic Acids Res 31, 3635-3641 (2003). [0235] Hombeck P V, Zhang B, Murray B, Komhauser J M, Latham V, Skrzypek E. PhosphoSitePlus, 2014: mutations, PTMs and recalibrations. Nucleic Acids Res 43, D512-520 (2015). [0236] Pandurangan A P, Ochoa-Montano B, Ascher D B, Blundell T L. SDM: a server for predicting effects of mutations on protein stability. Nucleic Acids Res 45, W229-W235 (2017). [0237] Hunter T. The age of crosstalk: phosphorylation, ubiquitination, and beyond. Mol Cell 28, 730-738 (2007). [0238] Pickart C M, Eddins M J. Ubiquitin: structures, functions, mechanisms. Biochim Biophys Acta 1695, 55-72 (2004). [0239] Komander D, Rape M. The ubiquitin code. Annu Rev Biochem 81, 203-229 (2012). [0240] Lussier M P, et al. Ubiquitin ligase RNF167 regulates AMPA receptor-mediated synaptic transmission. Proc Natl Acad Sci USA 109, 19426-19431 (2012). [0241] Deshar R, Moon S, Yoo W, Cho E B, Yoon S K, Yoon J B. RNF167 targets Arl8B for degradation to regulate lysosome positioning and endocytic trafficking. FEBS J 283, 4583-4599 (2016). [0242] Yamazaki Y, Schonherr C, Varshney G K, Dogru M, Hallberg B, Palmer R H. Goliath family E3 ligases regulate the recycling endosome pathway via VAMP3 ubiquitylation. EMBO J 32, 524-537 (2013). [0243] Yoon S O, et al. Focal Adhesion- and IGF1R-Dependent Survival and Migratory Pathways Mediate Tumor Resistance to mTORC1/2 Inhibition. Molecular Cell 67, 512-+(2017). [0244] Hara K, Yonezawa K, Weng Q P, Kozlowski M T, Belham C, Avruch J. Amino acid sufficiency and mTOR regulate p70 S6 kinase and eIF-4E BPl through a common effector mechanism. (vol 273, pg 14484, 1998). Journal of Biological Chemistry 273, 22160-22160 (1998). [0245] Chen J, et al. KLHL22 activates amino-acid-dependent mTORC1 signalling to promote tumorigenesis and ageing. Nature 557, 585-589 (2018). [0246] Jones T, et al. Direct and efficient cellular transformation of primary rat mesenchymal precursor cells by KSHV. J Clin Invest 122, 1076-1081 (2012). [0247] Horman S R, et al. Akt-mediated phosphorylation of argonaute 2 downregulates cleavage and upregulates translational repression of microRNA targets. Mol Cell 50, 356-367 (2013). [0248] Hanada M, Feng J, Hemmings B A. Structure, regulation and function of PKB/AKT—a major therapeutic target. Biochim Biophys Acta 1697, 3-16 (2004). [0249] Radivojac P, et al. Identification, analysis, and prediction of protein ubiquitination sites. Proteins 78, 365-380 (2010). [0250] Li T, Ju E, Gao S J. Kaposi sarcoma-associated herpesvirus miRNAs suppress CASTOR1-mediated mTORC1 inhibition to promote tumorigenesis. J Clin Invest 129, 3310-3323 (2019). [0251] Zhou X F, et al. CASTOR1 suppresses the progression of lung adenocarcinoma and predicts poor prognosis. Journal of Cellular Biochemistry 119, 10186-10194 (2018). [0252] Waks A G, Winer E P. Breast Cancer Treatment A Review. Jama-J Am Med Assoc 321, 288-300 (2019). [0253] Costa RLB, Han H S, Gradishar W J. Targeting the PI3K/AKT/mTOR pathway in triple-negative breast cancer: a review. Breast Cancer Res Tr 169, 397-406 (2018).
[0254] All patents, patent applications, publications, product descriptions, and protocols, cited in this specification are hereby incorporated by reference in their entireties. In case of a conflict in terminology, the present disclosure controls.
[0255] While it will become apparent that the subject matter herein described is well calculated to achieve the benefits and advantages set forth above, the presently disclosed subject matter is not to be limited in scope by the specific embodiments described herein. It will be appreciated that the disclosed subject matter is susceptible to modification, variation, and change without departing from the spirit thereof. Those skilled in the art will recognize or be able to ascertain using no more than routine experimentation, many equivalents to the specific embodiments described herein. Such equivalents are intended to be encompassed by the following claims.
[0256] Various publications and nucleic acid and amino acid sequence accession numbers are cited herein, the contents and full sequences of which are hereby incorporated by reference herein in their entireties.