MICROORGANISMS HAVING CAPABILITY OF PRODUCING 3-HYDROXYPROPIONIC ACID FROM GLUCOSE AND USES THEREOF

Abstract

Provided is a microorganism having the capability of producing 3-hydroxypropionic acid from glucose and a method for producing 3-hydroxypropionic acid from glucose by using the microorganism. The microorganism can include a mutation adapted to utilize intracellularly introduced glucose in 3HP production rather than cell growth, and thus increases in 3HP productivity (3HP production capacity) can be achieved. Also provided is a method that can increase 3HP production yield by controlling the time of adding an inducer and/or kinds of an alkaline aqueous solution during culturing.

Claims

1. A microorganism of the genus Escherichia, in which: (1) an activity of adenosyltransferase is enhanced; or, and (2) an activity of glycerol-3-phosphate dehydrogenase (GPD), glycerol-3-phosphate phosphatase (GPP), or both GDP and GPP are enhanced compared to a parent strain.

2. The microorganism according to claim 1, further having one or more characteristics selected from among the following: (3) enhancement of activity of one or more enzymes selected from the group consisting of glycerol dehydratase, glycerol dehydratase reactivase, and aldehyde dehydrogenase; (4) enhancement of activity of galactose permease, glucokinase, or both of them; and (5) weakening or inactivation of activity of a glucose-specific transporter of the phosphotransferase system.

3. The microorganism according to claim 1, wherein the activity of one or more enzymes selected from the group consisting of (1) to (6) below is weakened or inactivated: (1) 1,3-propanediol dehydrogenase; (2) glycerol kinase; (3) acetate kinase; (4) phosphotransacetylase; (5) lactate dehydrogenase; and (6) glycerol dehydrogenase.

4. The microorganism according to claim 2, having all the following characteristics: (1) enhancement of activity of adenosyltransferase; (2) enhancement of activity of glycerol-3-phosphate dehydrogenase (GPD) and glycerol-3-phosphate phosphatase (GPP); (3) enhancement of activity of glycerol dehydratase, glycerol dehydratase reactivase, and aldehyde dehydrogenase; (4) enhancement of activity of galactose permease and glucokinase; and (5) weakening or inactivation of activity of a glucose-specific transporter of the phosphotransferase system.

5. The microorganism according to claim 1, wherein the enhancement of activity of adenosyltransferase is due to increased expression of a btuR gene.

6. The microorganism according to claim 1, wherein the enhancement of activity of glycerol-3-phosphate dehydrogenase and glycerol-3-phosphate phosphatase is due to increased expression of a gene encoding glycerol-3-phosphate dehydrogenase and a gene encoding glycerol-3-phosphate phosphatase.

7. The microorganism according to claim 1, wherein the microorganism is an E. coli.

8. The microorganism according to claim 1, wherein the microorganism exhibits inhibited cell growth .

9. The microorganism according to claim 1, having production capability of 3-hydroxypropionic acid from glucose.

10. A composition for producing 3-hydroxypropionic acid from glucose, comprising the microorganism according to claim 1.

11. A method for production of 3-hydroxypropionic acid from glucose, comprising culturing the microorganism according to claim 1 in a medium containing glucose.

12. The method of claim 11, wherein the culturing is performed under a controlled pH condition by adjusting pH to 6.5 to 7.0 using a basic solution.

13. The method of claim 12, wherein the basic solution is a magnesium hydroxide solution.

14. The method of claim 11, wherein the culturing comprises adding an inducer for promoting glycerol production into a culture medium before the microorganism consumes all of the glucose.

15. The method of claim 14, wherein the inducer is added into a culture medium from the beginning of the culturing.

16. The method of claim 11, wherein the inducer is 3-hydroxypropionic acid.

17. A culture obtained by culturing the microorganism of claim 1 in a medium comprising glucose.

18. The culture according to claim 17, comprising 3-hydroxypropionic acid at a concentration of 60 g/L to 200 g/L and comprising glycerol at a concentration of 10 g/L or less.

Description

BRIEF DESCRIPTION OF THE DRAWINGS

[0124] FIG. 1A to FIG. 1C show the results of measuring growth (OD) and the amount of substances produced by the mutant strain of Experimental group 1 (FIG. 1B) and Experimental group 2 (FIG. 1C) of Table 8, which are mutant strains according to Comparative example of Table 8 (FIG. 1A), and one example over time.

[0125] FIG. 2A and FIG. 2B are results of measuring growth (OD) and the amount of substances produced by the mutant strain according to one example over time, and specifically, FIG. 2A shows the result in the case of adjusting pH using NH.sub.4(OH) in the culturing (Experimental group 3 of Table 9), and FIG. 2B shows the result of adjusting pH using Mg(OH).sub.2 in the culturing (Experimental group 4 of Table 9).

EXAMPLES

[0126] The present invention will be described in more detail by the following examples, but the scope is not intended to be limited by the following examples.

Example 1. Mutant Strain Construction

Example 1-1. pRSF-pLTTR-GPD-GPP

[0127] GPD1 and GPP2 genes derived from Saccharomyces cerevisiae were under PCR (preliminary denaturation at 95° C. for 2 minutes; repeating denaturation at 95° C. for 1 minute, annealing at 55° C. for 30 seconds and elongation at 72° C. for 2 minutes 28 times; final elongation at 72° C. for 5 minutes; stored maintained at 4 degrees) using the primer pair of ID NOs: 1 and 2 or SEQ ID NOs: 3 and 4 of Table 2 below, respectively, and treated with BamHI/SacI and KpnI/XhoI restriction enzymes, respectively, and cloned into pRSFDuet-1 vector (Invitrogen) comprising LTTR promoter, to produce a vector comprising pRSF-pLTTR-GPD-GPP (hereinafter, “pRSF-pLTTR-GPD-GPP vector”; the vector names described herein indicate the gene/promoter comprised in the vector and their position (order) from the 5′ end). The sequence of the LTTR promoter used is described in Table 3 below.

TABLE-US-00002 Name Sequence (5′->3′) SEQ ID NO: GPD1-F CATCATCATGGATCCATAGCAGTAAGAAAGGAGCATCCATCatgagcgctgcggctg 1 GPD1-R CATCATCATGAGCTCtcaatcttcatgaaggtctaattcttcaatcatg 2 GPP2-F CATCATCATGGTACCACAGTTTTAGTAAAGGAGCATCAAAAatgggactcactacgaaaccg 3 GPP2-R catcatcatCTCGAGttaccatttcagcagatcgtctttgg 4

TABLE-US-00003 Name Sequence (5′->3′) SEQ ID NO: LTTR GTCAGCCTCAGCGCACCTCGAATGTGCAAAAACGCAGACCATACTTGCACATCACCGCATTGAGTACATCAAAAATGCACTGTTAGGATCGATCCAGACAACAAAAAAGCCACA 5

Example 1-2. pCDF_J23101_dhaB_gdrAB_J23100_aldH_btuR Construction

[0128] A gene encoding glycerol dehydratase (dhaB), a gene encoding aldehyde dehydrogenase (aldH) and a gene encoding glycerol dehydratase reactivase (gdrAB) were cloned into a plasmid pCDF to produce ‘pCDF_J23101_dhaB_gdrAB_J23100_aldH’, and a gene encoding adenosyltransferase (btuR) was cloned thereto to produce ‘pCDF_J23101_dhaB_gdrAB_J23100_aldH_btuR’.

[0129] Specifically, the promoter part of the pCDFDuet-1 vector (Novagen, USA) was substituted with J23101 and J23100 promoters. The dhaB (U30903.1; about 2.7 kb; dhaB1, dhaB2, dhaB3) and gdrAB gene (about 2.2 kb; gdrA, gdrB) were amplified using the primer pair of SEQ ID NOs: 6 and 7 or SEQ ID NOs: 8 and 9 of Table 4 below in the chromosome of Klebsiella pneumoniae (ATCC 25955) using the condition provided by NEB:

TABLE-US-00004 Name Sequence (5′->3′) SEQ ID NO: dhaB-gdrA-F GAATTCATGAAAAGATCAAAACGATTTGCAGTCCT SEQ ID NO: 6 dhaB-gdrA-R AAGCTTGATCTCCCACTGACCAAAGCTGG SEQ ID NO: 7 gdrB-F AAGCTTAGAGGGGGCCGTCATGTCGCTTTCACCGCCAG SEQ ID NO: 8 gdrB-R CTTAAGTCAGTTTCTCTCACTTAACGGC SEQ ID NO: 9

[0130] The dhaB123 and gdrA genes were positioned side by side on the chromosome of Klebsiella pneumonia, and therefore, they were amplified together, and gdrB was positioned on the opposite direction to dhaB123, gdrA, and therefore, gdrB was amplified separately, and then, NEB Q5 DNA polymerase was used, and for the condition, the condition provided by NEB was used. After that, the dhaB123, gdrA genes were cloned using restriction enzymes EcoRI and HindIII, and the gdrB gene was cloned using restriction enzymes HindIII and AfIII under the J23101 promoter (3′ end).

[0131] aldH was cloned under the J23100 promoter (3′ end), and using primers below, it was amplified from E. coli K12 MG1655 chromosome, and then the primers of Table 5 and NEB Q5 DNA polymerase were used, and for the condition, the condition provided by NEB was used. aldH was cloned on the bottom of the J23100 promoter using restriction enzymes Kpn I and Nde I. btuR was cloned below aldH, and it was amplified from E. coli K12 MG1655 Chromosome using promoters below, and then, the primers of Table 5 and NEB Q5 DNA polymerase were used, and for the condition, the condition provided by NEB was used. Cloning of btuR was performed under aldH using In-Fusion Kit of Takara. Through the above cloning, ‘pCDF_J23101_dhaB_gdrAB_J23100_aldH_btuR’ vector was produced.

TABLE-US-00005 Name Sequence (5′->3′) SEQ ID NO: aldH-F ggtaccatgaattttc atcatctggc SEQ ID NO: 10 aldH-R catatgtcaggcctccaggcttat SEQ ID NO: 11 btuR-F tggaggcctgacataatgagtgatgaacgctaccaacag SEQ ID NO: 12 btuR-R ttgagatctgccatattaataatcgatccctatctgcgc SEQ ID NO: 13

[0132] As a control group, a microorganism in which a plasmid pCDF comprising a gene encoding glycerol dehydratase (dhaB), a gene encoding aldehyde dehydrogenase (aldH) and a gene encoding glycerol dehydratase reactivase (gdrAB), in which btuR gene was not cloned, was introduced by the same method was used.

[0133] The prepared vector was introduced into E. coli W3110 (KCCM 40219) by electroporation using an electroporation device (Bio-Rad, Gene Pulser Xcell), and thereby, the 3-HP producing strain according to one example of the present application and the control strain were produced, respectively. The strains were cultured in a shaking incubator under the condition of 37° C. and 250 rpm after inoculating a single colony of the corresponding strain to a LB medium comprising 25 mg/L streptomycin (containing yeast extract 5 g/L, tryptone 10 g/L, and NaCl 10 g/L).

Example 1-3. Deletion of ptsG Gene and Overexpression of galP and Glk Genes

[0134] ptsG gene was deleted using Cas9 system. Specifically, an expression vector comprising Cas9 gene (Quick&easy E. coli gene deletion kit (K006) of Gene Bridges) was transformed into DKAPG strain (strain which yqhD, glpK, IdhA, ack-pta and gldA genes were deleted from W3110 strain), and a guide RNA vector targeting the ptsG gene part and repair DNA (Quick&easy E. coli gene deletion kit (K006) of Gene Bridges) were transformed simultaneously thereto to obtain DKALGP::PK. The ptsG front part (1000 bp at the 5′ end) and back part (1000 bp at the 3′ end) were amplified from E. coli K12 MG1655 chromosome using primers of SEQ ID NOs: 14 and 15 and SEQ ID NOs: 18 and 19.

[0135] For overexpression of galP and glk genes, galP and glk genes were amplified using primers of SEQ ID NOs: 16 and 17 from the pRSF-J23106-galP-glk-LTTR-GPD-GPP vector. The amplified three fragments (ptsG front part, ptsG back part, and galP and glk genes) were used as Repair-DNA by Overlap-PCR using SEQ ID NOs: 14 and 19. The sequences of the primers used in the present example are described in Table 6 below. In case of the pRSF-J23106-galP-glk-LTTR-GPD-GPP vector, galP and glk genes were amplified by PCR using the genomic DNA of W3110 strain and primers of SEQ ID NOs: 20 and 21 and the primer pair of SEQ ID Nos: 22 and 23, respectively, and amplified by Overlap-PCR using a template in which the amplified two PCR products were mixed and the primer pair of SEQ ID NOs: 20 and 23, and the final galP-glk fusion gene constructed by amplifying by Overlap-PCR was constructed through pRSF-pLTTR-GPD-GPP vector linearized with Kpnl/Ndel restriction enzymes and In-fusion reaction (50° C. 30 minutes).

TABLE-US-00006 Name Sequence (5′->3′) SEQ ID NO: ptsG-1000-F ACGCGATGTGAAATTTTGTC SEQ ID NO: 14 ptsG-1000-R CACTATACCTAGGACTGAGCTAGCCGTAAAAATTGAGAGTGCTCCTGAGTATG SEQ ID NO: 15 J23-over-F TTTACGGCTAGCTCAGTCC SEQ ID NO: 16 glk-over-R ttacagaatgtgacctaaggtctg SEQ ID NO: 17 ptsG+1000-F catttacgccagaccttaggtcacattctgtaaTCCGTAAGACGTTGGGGAG SEQ ID NO: 18 ptsG+1000-R CCAACATCTTCCCGGATG SEQ ID NO: 19 galP_infu_F tagtgctagcGGTACatgcctgacgctaaaaaacaggggc SEQ ID NO: 20 galP_infu_R GTCAAAATAATTAATCGTGAGCGCCTATTTC SEQ ID NO: 21 glk_infu_F TCACGATTAATTATTTTGACTTTAGCGGAGCAG SEQ ID NO: 22 glk_infu_R TCCAATTGAGATCTGCCATATTACAGAATGTGACCTAAGGTCTGG SEQ ID NO: 23

Example 1-4. Mutant Strain Construction

[0136] Using Quick&easy E. coli gene deletion kit of Gene Bridges, according to the manual of the manufacturer, a strain W3110 which yqhD, glpK, IdhA, ack-pta and gldA genes were deleted from W3110 (purchased from KCTC) strain (ΔyqhD, ΔglpK, ΔldhA, Δack-pta and ΔgldA) (named DKALG strain) was constructed, and as the method of Example 1-3, ptsG gene was deleted from the DKALG strain using Cas9 system, and at the ptsG gene position, galP and glk genes were inserted and thereby, a strain in which galP and glk genes were overexpressed (named DKALGP::PK strain) was constructed.

[0137] The pRSF-pLTTR-GPD-GPP vector and pCDF_J23101_dhaB_gdrAB_J23100_aldH_btuR vector produced in Example 1-1 and Example 1-2 were introduced by electroporation using an electroporation device (Bio-Rad, Gene Pulser Xcell) into the DKALGP::PK strain and transformed, to construct a strain comprising a gene encoding glycerol dehydratase (dhaB), a gene encoding aldehyde dehydrogenase (aldH), a gene encoding glycerol dehydratase reactivase (gdrAB) and a gene encoding adenosyltransferase.

[0138] As a control group, by introducing the pRSF-pLTTR-GPD-GPP vector and pCDF_J23101_dhaB_gdrAB_J23100_aldH vector constructed in Example 1-1 and Example 1-2 into the DKALGP::PK strain by the same method, a microorganism, in which a plasmid pCDF in which a gene encoding glycerol dehydratase (dhaB), a gene encoding aldehyde dehydrogenase (aldH), and a gene encoding glycerol dehydratase reactivase (gdrAB) were comprised and btuR gene was not cloned, was used.

[0139] Specifically, the DKALGP::PK strain was plated on an LB plate (comprising 10 g tryptone, 5 g yeast extract, 10 g NaCl, 15 g agar per 1 L), respectively, and cultured at 37° C. overnight. The cultured single colony was inoculated in a 3 to 5 mL LB liquid medium (same medium composition as above, not comprising agar) and cultured at 37° C. overnight with stirring. Next morning, the culture solution was diluted in the LB liquid medium of 0.05 liters by 1:100 and cultured for 3-6 hours until an OD of ~0.5. After cooling on ice for 10 to 15 minutes, cells were collected by centrifuging at 4° C. at 4000 rpm for 10 minutes. The cells were resuspended in sterile DI water 1 volume cooled on ice and washed, and then centrifuged at 4° C. at 4000 rpm for 10 minutes to collect the cells. The collected cells were resuspended in DI water 0.5 volume and washed and then centrifuged at 4° C. at 4000 rpm for 10 minutes to collect the cells again. The collected cells were resuspended in sterile 10% glycerol 1 mL cooled on ice, and cell aliquots were put in an individual pre-chilled microfuge tube (90 .Math.l per transformation in a cuvette for gap electroporation of 0.1 cm). Salt-free DNA (vector) 1-5 .Math.L was added by pipetting, and then the mixture was moved into a pre-chilled electroporation cuvette. Immediately after electroporation at 1.8 kV and pulse, 1 mL of the LB liquid medium at a room temperature was added to the cells and cultured at 37° C. for 1 hour. The culture solution was plated on an LB plate comprising kanamycin and streptomycin and excess liquid was allowed to dry/absorb into the plate. The plate was inverted and cultured at 37° C.

[0140] A strain into which the pRSF-pLTTR-GPD-GPP vector (GG) and pCDF_J23101_dhaB_gdrAB_J23100_aldH vector (DGA) were introduced into the DKALGP::PK strain (hereinafter, named DKALGP::PK + GG-DGA strain) and a strain into which the pRSF-pLTTR-GPD-GPP vector (GG) and pCDF_J23101_dhaB_gdrAB_J23100_aldH_btuR vector (DGAB) were introduced into the DKALGP::PK strain (hereinafter, named DKALGP::PK + GG-DGAB strain) were constructed.

Example 2. 3-HP Production Measurement

Example 2-1. Mutation Introduction and Measurement of 3-HP Production According To Time of Addition of Inducer

[0141] A single colony of the strain prepared in Example 1 was inoculated in an LB medium and was under seed culture under the condition of 37° C. for 18 hours.

[0142] Then, in a 5 L fermenter, seed culture 150 mL was inoculated into a modified MR medium of 2 L comprising 20 g/L glucose and 25 mg/L streptomycin and 50 mg/L kanamycin (containing MgSO.sub.4 .Math. 7H.sub.2O 0.8 g/L, (NH.sub.4).sub.2HPO.sub.4 4 g/L, KH.sub.2PO.sub.4 6.67 g/L and citrate 0.8 g/L) in a flask, and in a fermenter of 35° C., 500 rpm, it was cultured under the condition of maintaining pH as 6.95 using NH.sub.4(OH) or Mg(OH).sub.2.

[0143] At the time of Condition 1 or Condition 2 below, by adding 100 g/L 3HP 10 mL, 5 mM B12 10 mL, 3HP production was induced, and after exhausting glucose comprised in the medium, Feeding Solution (comprising glucose 700 g/L, MgSO.sub.4 15 g/L, Trace metal 10 mL/1 L, 10x MR salt 100 mL/1 L, 25 mg/L streptomycin, and 50 mg/L kanamycin) was added at a rate of 40.5 mL/hr. Under Condition 1 and Condition 2, the time points at which glucose was all consumed were 10.5 H (hour) and 11.5 H (hour) after the start of culture, respectively. [0144] Condition 1: at 10.5 H when glucose was all consumed, adding 100 g/L 3HP 10 mL, 5 mM B12 10 mL [0145] Condition 2: at the beginning of culture (0 hour), adding 100 g/L 3HP 10 mL, and at 11.5 H when glucose was all consumed, adding 5 mM B12 10 mL

[0146] After centrifuging (12,300 rpm, 1 minute) the culture solution 1 mL cultured under each condition for 24 hours, the supernatant was prepared using a filter in a 0.45 .Math.m size. Then, using HPLC (High-Performance Liquid Chromatography), the 3-HP, glycerol production and production of by-products (acetate and PDO) in the culture solution were analyzed, and the result was shown in Table 8 and FIG. 1A (Comparative example of Table 8) and FIG. 1B (Example 1 of Table 8). Specifically, HPLC was performed under the condition of Table 7 below.

[0147] In addition, the growth of the strain under each culture condition was measured by measuring OD600 (optical density (O.D.) of the strain culture solution at 600 nm) using a UV Spectrometer, and the result was shown in Table 8 and FIG. 1A (Comparative example of Table 8), FIG. 1B (Experimental group 1 of Table 8) and FIG. 1C (Experimental group 2 of Table 8).

TABLE-US-00007 HPLC Model Agilent Technologies 1200 Series Column Bio-Rad Aminex HPX-87H Ion Exclusion Column300 mm × 7.8 mm Detector Refractive Index (RI) / Ultraviolet (UV) Detector Mobile Phase 0.5 mM H.sub.2SO.sub.4 Flow rate 0.4 mL/min Run time 35 min Column temperature 35° C. Detector temperature 35° C. Injection volume 10.sub..Math.ℓ

TABLE-US-00008 Strain Culture condition O.D. Glycerol (g/L) 3HP yield (g-3HP/g-glucose) 3HP (g/L) pH adjustment 3HP addition time Comparative example DKALGP::PK + GG-DGA NH.sub.4(OH) Condition 1 64.0 13.4 0.399 51.4 Experimental group 1 DKALGP::PK + GG-DGAB NH.sub.4(OH) Condition 1 49.6 1.01 0.545 75.2 Experimental group 2 DKALGP::PK + GG-DGAB Mg(OH).sub.2 Condition 2 25.6 0 0.761 59.5

[0148] As shown in Table 8, and FIG. 1A to FIG. 1C, in case of the strain in which the btuR gene was overexpressed (DKALGP::PK + GG-DGAB; Experimental group 1 and Experimental group 2), compared to Comparative example (DKALGP::PK+ GG-DGA), the accumulated amount of glycerol and cell growth were reduced, and the 3HP production and 3HP yield (ratio of 3HP production to added glucose; g/g) were significantly increased. In addition, in Experimental group 1 (FIG. 1B) and Experimental group 2 (FIG. 1C), production of by-products was hardly observed. In addition, as shown in Table 8, it could be confirmed that the accumulated amount of glycerol and cell growth were reduced and the 3HP yield (ratio of 3HP production to added glucose) was significantly increased, in case of Experimental group 2, compared to Comparative example and Experimental group 1.

[0149] Accordingly, it could be confirmed that the mutant strain (btuR gene overexpression) according to one example and/or method for producing 3HP using the mutant strain significantly increased the 3HP production yield from glucose, and glucose could be utilized for 3HP production rather than cell growth.

Example 2-2. Measurement of 3HP Production According to Kind f Aqueous Basic Solution

[0150] Similar to the method of Example 2-1, the strain in which the btuR gene was overexpressed constructed in Example 1 (DKALGP::PK + GG-DGAB) was cultured under Condition 1, using NH.sub.4(OH) or Mg(OH).sub.2, under a condition of maintaining pH as 6.95 for 42 hours, and the production of 3-HP, glycerol and by-products (acetate and PDO) in the culture solution and the growth of the strain were measured, and the result was shown in Table 9 and FIG. 2A (Experimental group 3 of Table 9) and FIG. 2B (Experimental group 4 of Table 9) below.

[0151] - Condition 1: at 10.5H when glucose was all consumed, adding 100 g/L 3HP 10 mL, 5 mM B12 10 mL

TABLE-US-00009 Strain Culture condition 3HP (g/L) pH adjustment 3HP addition time Experimental group 3 DKALGP::PK + GG-DGAB NH.sub.4(OH) Condition 1 75.6 Experimental group 4 Mg(OH).sub.2 98.7

[0152] As shown in Table 9, FIG. 2A and FIG. 2B above, it could be confirmed that the 3HP production was significantly increased in Experimental group 4 using Mg(OH).sub.2 compared to Experimental group 3 using NH.sub.4(OH) to adjust pH in the culturing.