OLIGONUCLEOTIDES
20230348903 · 2023-11-02
Inventors
Cpc classification
C12N2310/3231
CHEMISTRY; METALLURGY
C12N15/111
CHEMISTRY; METALLURGY
A61K45/06
HUMAN NECESSITIES
C12N2310/344
CHEMISTRY; METALLURGY
C12N15/113
CHEMISTRY; METALLURGY
International classification
C12N15/113
CHEMISTRY; METALLURGY
C12N15/11
CHEMISTRY; METALLURGY
Abstract
The present invention relates to oligonucleotides that maintain a Toll-Like Receptor 7 (TLR7) response and/or which potentiate Toll-Like Receptor 8 (TLR8) sensing.
Claims
1-62. (canceled)
63. An oligonucleotide comprising one or more modified bases and at least four thymidines, wherein the oligonucleotide potentiates Toll-like receptor 8 (TLR8) activity when administered to an animal.
64. The oligonucleotide of claim 63 which comprises a) a 5′ region at least five bases in length which are modified and/or which have a modified backbone, b) a middle region comprising a stretch of ten bases, wherein at least four of the bases are thymidine, c) a 3′ region at least five bases in length.
65. The oligonucleotide of claim 63, wherein i) the at least four thymidine bases are in a continuous stretch, and/or ii) one, two, three or four of the at least four thymidine bases are not in a continuous stretch.
66-68. (canceled)
69. The oligonucleotide according to claim 63, comprising, consisting of or consisting essentially of a nucleic acid sequence set forth in Tables 1 to 6 or a variant thereof.
70-72. (canceled)
73. A method of reducing expression of a target gene in a cell, the method comprising contacting the cell with an oligonucleotide according to claim 63.
74. A method of treating or preventing a disease in a subject, the method comprising administering to the subject an oligonucleotide according to claim 63, wherein the oligonucleotide reduces the expression of a target gene involved in the disease.
75. The method of claim 74, wherein the animal has been, or will be, administered with an immune response modifier.
76. The method of claim 75, wherein the immune response modifier is a Toll-like receptor (TLR) agonist such as a base analog (including: a guanosine analog, a deaza-adenosine analog, an imidazoquinoline or a derivative, a hydroxyadenine compound or a derivative, a thiazoloquinolone compound or a derivative, a benzoazepine compound or a derivative), or an RNA molecule.
77-80. (canceled)
81. The oligonucleotide according to claim 63, comprising a 5′ region, a 3′ region and a middle region, comprising ribonucleic acid, or deoxyribonucleic acid bases or a combination thereof, wherein one or both of the 5′ region and the 3′ region comprise bases which are modified and/or which have a modified backbone, and at least one of the following apply; a) the 5′ region comprises three continuous pyrimidine bases which are modified and/or which have a modified backbone, b) the 5′ region comprises bases which are modified and/or which have a modified backbone and the junction between the 5′ region and middle region comprises three continuous pyrimidine bases, c) the 3′ region comprises three continuous pyrimidine bases which are modified and/or which have a modified backbone, d) the 3′ region comprises bases which are modified and/or which have a modified backbone and the junction between the 3′ region and middle region comprises three continuous pyrimidine bases, and e) the 5′ region comprises two continuous cytosine bases which are modified and/or which have a modified backbone.
82. The oligonucleotide according to claim 81, wherein the three continuous pyrimidine bases are within seven bases of the 5′ and/or 3′ end of the oligonucleotide.
83. The oligonucleotide according to claim 81, wherein the three continuous pyrimidine bases are at the 5′ and/or 3′ end of the oligonucleotide.
84. The oligonucleotide according to claim 81, wherein the 5′ three continuous pyrimidine bases have the sequence 5′-CUU-3′, 5′-CUT-3′, 5′-CCU-3′, 5′-UUC-3′, 5′-UUU-3′ or 5′-CTT-3′; or wherein the 3′three continuous pyrimidine bases have the sequence 5′-UUC-3′, 5′-TUC-3′, 5′-UCC-3′, 5′-CUU-3′, 5′-UUU-3′ or 5′-TTC-3′.
85. The oligonucleotide according to claim 81, wherein the two continuous cytosine bases comprise a 2′-LNA and a phosphorothioate backbone.
86. The oligonucleotide according to claim 81, wherein at least one of the three continuous pyrimidine bases and/or at least one of the two continuous cytosine bases does not hybridize to a target polynucleotide.
87. The oligonucleotide according to claim 63, wherein the modified base comprises a 2′-O-methyl, 2′-O-methoxyethoxy, 2′-fluoro, 2′-allyl, 2′-O-[2-(methylamino)-2-oxoethyl], 4′-thio, 4′-CH2-O-T-bridge, 4′-(CH2)2-O-2′-bridge, 2′-LNA, 2′-amino, fluoroarabinonucleotide, threose nucleic acid or 2′-O—(N-methlycarbamate).
88. The oligonucleotide according to claim 63, wherein the modified backbone comprises a phosphorothioate, a non-bridging oxygen atom substituting a sulfur atom, a phosphonate such as a methylphosphonate, a phosphodiester, a phosphoromorpholidate, a phosphoropiperazidate, amides, methylene(methylamino), fromacetal, thioformacetal, a peptide nucleic acid or a phosphoroamidate such as a morpholino phosphorodiamidate (PMO), N3′-P5′ phosphoramidite or thiophosphoroamidite.
89. The oligonucleotide according to claim 63, wherein the modified base comprises a 2′O-methyl and a phosphorothioate backbone.
90. The oligonucleotide according to claim 63, wherein the oligonucleotide is at least 10, at least about 18, at least about 20, at about least 25, between about 10 and about 50 nucleotides, between about 18 and about 50 nucleotides, between about 18 and about 30 nucleotides, between about 20 and about 30 nucleotides, between about 20 and 5,000 nucleotides, or about 20 bases in length.
91. The oligonucleotide according to claim 63, wherein the oligonucleotide is an antisense oligonucleotide or a double stranded oligonucleotide for gene silencing.
92. The oligonucleotide according to claim 63, wherein one, two or all three of the three continuous pyrimidine bases are removed by an endonuclease in vivo.
Description
BRIEF DESCRIPTION OF THE ACCOMPANYING DRAWINGS
[0155]
[0163]
[0166]
[0176]
[0182]
[0188]
[0189]
[0190]
[0191]
[0192]
[0193]
[0194]
[0195]
[0196]
[0197]
[0198]
[0199]
[0200]
[0201]
BRIEF DESCRIPTION ON THE SEQUENCES
[0202] SEQ ID NO: 1 and SEQ ID NO: 2 represent the nucleotide sequences of negative targeting controls ASOs from Table 1. SEQ ID NO:3 through SEQ ID NO:20 represent the nucleotide sequences of ASOs targeting human cGAS mRNA and modified versions thereof from Table 1. SEQ ID NO: 21 and SEQ ID NO: 22 represent the nucleotide sequences of ASO852 and ASO852-DT from Table 1. SEQ ID NO: 23 and SEQ ID NO:24 represent the nucleotide sequences of ASO2504 and ASO2504-dT from Table 1. SEQ ID NO: 25 represents the nucleotide sequences of dT20 from Table 1. SEQ ID NO:26 through SEQ ID NO:34 represent the nucleotide sequences of Hs HPRT F517, Hs HPRT R591, Hs HPRT P554 FAM, Hs SFRS9 F594, Hs SFRS9 R690, Hs SFRS9 P625 HEX, ODN 2006, ISD70-FWD and ISD70-REV respectively from Table 1.
[0203] SEQ ID NO:35 through SEQ ID NO:82 represent the nucleotide sequences of CDKN2B-AS1 ASOs from Table 2. SEQ ID NO:83 through SEQ ID NO:130 represent the nucleotide sequences of CTNNB1 ASOs from Table 2. SEQ ID NO:131 through SEQ ID NO:178 represent the nucleotide sequences of EGFR ASOs from Table 2. SEQ ID NO:179 through SEQ ID NO:226 represent the nucleotide sequences of LINC-PINT ASOs from Table 2.
[0204] SEQ ID NO:227 through SEQ ID NO:273 represent the nucleotide sequences of HPRT ASOs from Table 3. SEQ ID NO:274 through SEQ ID NO:282 represent the nucleotide sequences of ASO1-UC, ASO2 LNA, ASO2-LNA Mut1, ASO2-LNA Mut2, ASO 660, ASO 660-Mut, C2Mut-1, C2Mut1-PS, C2Mut1-20Me respectively of Table 4. SEQ ID NO:283 through SEQ ID NO:373 represent the LNA-modified nucleotide sequences of Table 5. SEQ ID NO:374 through SEQ ID NO:449 represent the 2′-MOE-modified nucleotide sequences of Table 6.
DETAILED DESCRIPTION OF THE INVENTION
General Techniques and Definitions
[0205] Unless specifically defined otherwise, all technical and scientific terms used herein shall be taken to have the same meaning as commonly understood by one of ordinary skill in the art (e.g., in oligonucleotide design, molecular genetics, antisense oligonucleotides, gene silencing, gene expression and biochemistry).
[0206] Unless otherwise indicated, the recombinant protein, cell culture, and immunological techniques utilized in the present invention are standard procedures, well known to those skilled in the art. Such techniques are described and explained throughout the literature in sources such as, J. Perbal, A Practical Guide to Molecular Cloning, John Wiley and Sons (1984), J. Sambrook et al., Molecular Cloning: A Laboratory Manual, Cold Spring Harbour Laboratory Press (1989), T. A. Brown (editor), Essential Molecular Biology: A Practical Approach, Volumes 1 and 2, IRL Press (1991), D. M. Glover and B. D. Hames (editors), DNA Cloning: A Practical Approach, Volumes 1-4, IRL Press (1995 and 1996), and F. M. Ausubel et al. (editors), Current Protocols in Molecular Biology, Greene Pub. Associates and Wiley-Interscience (1988, including all updates until present), Ed Harlow and David Lane (editors) Antibodies: A Laboratory Manual, Cold Spring Harbour Laboratory (1988), and J. E. Coligan et al. (editors) Current Protocols in Immunology, John Wiley & Sons (including all updates until present).
[0207] The term “and/or”, e.g., “X and/or Y” shall be understood to mean either “X and Y” or “X or Y” and shall be taken to provide explicit support for both meanings or for either meaning.
[0208] As used herein, the term about, unless stated to the contrary, refers to +/−10%, more preferably +/−5%, more preferably +/−1%, of the designated value.
[0209] Throughout this specification the word “comprise”, or variations such as “comprises” or “comprising”, will be understood to imply the inclusion of a stated element, integer or step, or group of elements, integers or steps, but not the exclusion of any other element, integer or step, or group of elements, integers or steps.
[0210] By “consisting essentially of” in the context of an oligonucleotide sequence is meant the recited oligonucleotide sequence together with an additional one, two or three nucleic acids at the 5′ or 3′ end thereof.
[0211] As used herein, the phrase “does not inhibit Toll-like receptor 7 (TLR7) activity” or variations thereof means that after administration to an animal of an oligonucleotide of the invention the animal is still able to elicit a TLR7 based immune response, such as to a pathogen. In an embodiment, the TLR7 based immune response in the presence of the oligonucleotide is at least about 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 85%, 90%, 95%, 97%, 99% or 100% of the response in the absence of the oligonucleotide.
[0212] Similarly, the phrase “reducing the Toll-like receptor 7 (TLR7) inhibitory activity of an oligonucleotide” or the like means that after being modified in accordance with the invention, an animal administered with the modified oligonucleotide is able to mount a stronger TLR7 based immune response when compared to the starting (unmodified) oligonucleotide.
[0213] As used herein, the phrase “potentiates Toll-like receptor 8 (TLR8) activity” and the like means that after administration to an animal of an oligonucleotide of the invention the animal has an enhanced (increased) TLR8 based immune response.
[0214] As used herein, an “immune response modifier” refers to any agent that mimics, augments, or require participation of host immune cells for optimal effectiveness, and/or has a known ability to activate, augment, or enhance specific immune responses. Examples of immune response modifiers include, but are not limited to, Toll-like receptor (TLR) agonists including Resiquimod (R848), Loxoribine, Isatoribine, Imiquimod, CL075, CL097, CL264, CL307, 852A, and/or TL8-506. Other Toll-like receptor (TLR) agonists can include a base analogue (including: a guanosine analogue, a deaza-adenosine analogue, an imidazoquinoline or a derivative, a hydroxyadenine compound or a derivative, a thiazoloquinolone compound or a derivative, a benzoazepine compound or a derivative) and/or an RNA molecule.
[0215] The phrase “pharmaceutically acceptable” is employed herein to refer to those compounds, materials, compositions, and/or dosage forms that are, within the scope of sound medical judgment, suitable for use in contact with the tissues of human beings and animals without excessive toxicity, irritation, allergic response, and/or other problem or complication, commensurate with a reasonable benefit/risk ratio.
[0216] As used herein, the terms “treating”, “treat” or “treatment” include administering a therapeutically effective amount of a compound(s) described herein sufficient to reduce or eliminate at least one symptom of a disease.
[0217] As used herein, the terms “preventing”, “prevent” or “prevention” include administering a therapeutically effective amount of a compound(s) described herein sufficient to stop or hinder the development of at least one symptom of a disease.
Oligonucleotides
[0218] In the context of this invention, the term “oligonucleotide” refers to an oligomer or polymer of ribonucleic acid (RNA) or deoxyribonucleic acid (DNA), wherein the polymer or oligomer of nucleotide monomers contains any combination of nucleobases (referred to in the art and herein as simply as “base”), modified nucleobases, sugars, modified sugars, phosphate bridges, or modified phosphorus atom bridges (also referred to herein as “internucleotidic linkage”).
[0219] Oligonucleotides can be single-stranded or double-stranded or a combination thereof. A single-stranded oligonucleotide can have double-stranded regions and a double-stranded oligonucleotide can have single-stranded regions (such as a microRNA or shRNA).
[0220] “Gapmer” refers to an oligonucleotide comprising an internal region having a plurality of nucleosides that support RNase H cleavage positioned between external regions having one or more nucleosides, wherein the nucleosides comprising the internal region are chemically distinct from the nucleoside or nucleosides comprising the external regions. The internal region may be referred to as the “gap” and the external regions may be referred to as the “wings.”
[0221] As used herein, a “target” such as a “target gene” or “target polynucleotide” refers to a molecule upon which an oligonucleotide of the invention directly or indirectly exerts its effects. Typically, the oligonucleotide of the invention or portion thereof and the target, or a product of the target such as mRNA encoded by a gene, or portion thereof, are able to hybridize under physiological conditions.
[0222] As used herein, the phrase “reduces expression of the target gene” or the like refers to an oligonucleotide of the invention reducing the ability of a gene to exert is biological effect. This can be directly or indirectly achieved by reduction in the amount of RNA encoded by the gene and/or reduction of the amount of protein translated from an RNA.
[0223] Typically, an oligonucleotide of the invention will be synthesized in vitro. However, in some instances where modified bases and backbone are not required they can be expressed in vitro or in vivo in a suitable system such as by a recombinant virus or cell.
[0224] An oligonucleotide of the invention may be conjugated to one or more moieties or groups which enhance the activity, cellular distribution or cellular uptake of the oligonucleotide. These moieties or groups may be covalently bound to functional groups such as primary or secondary hydroxyl groups. Exemplary moieties or groups include intercalators, reporter molecules, polyamines, polyamides, polyethylene glycols, polyethers, groups that enhance the pharmacodynamic properties of oligomers, and groups that enhance the pharmacokinetic properties of oligomers. Typical conjugate groups include cholesterols, lipids, phospholipids, biotin, phenazine, folate, phenanthridine, anthraquinone, acridine, fluoresceins, rhodamines, coumarins and dyes.
[0225] In particular embodiments, the oligonucleotide described herein may comprise a synthetic oligonucleotide sequence. As used herein, a “synthetic oligonucleotide sequence” refers to an oligonucleotide sequence which lacks a corresponding sequence that occurs naturally. By way of example, a synthetic oligonucleotide sequence is not complementary to a specific RNA molecule, such as one encoding an endogenous polypeptide. As such, the synthetic oligonucleotide sequence is suitably not capable of interfering with a post-transcriptional event, such as RNA translation.
[0226] As used herein, an oligonucleotide “variant” shares a definable nucleotide sequence relationship with a reference nucleic acid sequence. The reference nucleic acid sequence may be one of those provided in Tables 1 through 6 (e.g., SEQ ID NOs. 1-449), for example. The “variant” oligonucleotide may have one or a plurality of nucleic acids of the reference nucleic acid sequence deleted or substituted by different nucleic acids. Preferably, oligonucleotide variants share at least 70% or 75%, preferably at least 80% or 85% or more preferably at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% sequence identity with a reference nucleic acid sequence.
Modified Bases
[0227] Oligonucleotides of the invention may have nucleobase (“base”) modifications or substitutions.
[0228] Examples include oligonucleotides comprising one of the following at the 2′ position: OH; F; O-, S-, or N-alkyl; O-, S-, or N-alkenyl; O-, S- or N-alkynyl; or O-alkyl-O-alkyl, wherein the alkyl, alkenyl and alkynyl may be substituted or unsubstituted C1 to C10 alkyl or C2 to C10 alkenyl and alkynyl. In one embodiment, the oligonucleotide comprises one of the following at the 2′ position: O[(CH.sub.2)nO]mCH.sub.3, O(CH.sub.2)nOCH.sub.3, O(CH.sub.2)nNH.sub.2, O(CH.sub.2)nCH.sub.3, O(CH.sub.2)nONH.sub.2, and O(CH.sub.2)nON[CH.sub.2)nCH.sub.3].sub.2, where n and m are from 1 to about 10.
[0229] Further examples include of modified oligonucleotides include oligonucleotides comprising one of the following at the 2′ position: C1 to C10 lower alkyl, substituted lower alkyl, alkenyl, alkynyl, alkaryl, aralkyl, O-alkaryl or O-aralkyl, SH, SCH.sub.3, OCN, Cl, Br, CN, CF.sub.3, OCF.sub.3, SOCH.sub.3, SO.sub.2CH.sub.3, ONO.sub.2, NO.sub.2, N.sub.3, NH.sub.2, heterocycloalkyl, heterocycloalkaryl, aminoalkylamino, polyalkylamino, substituted silyl, an RNA cleaving group, a reporter group, an intercalator, a group for improving the pharmacokinetic properties of an oligonucleotide, or a group for improving the pharmacodynamic properties of an oligonucleotide, and other substituents having similar properties.
[0230] In one embodiment, the modification includes 2′-methoxyethoxy (2′-O—CH2CH2OCH3 (also known as 2′-O-(2-methoxyethyl) or 2′-MOE) (Martin et al., 1995), that is, an alkoxyalkoxy group. In some embodiments, the modification does not comprise 2′-MOE. In a further embodiment, the modification includes 2′-dimethylaminooxyethoxy, that is, a O(CH.sub.2).sub.2ON(CH.sub.3).sub.2 group (also known as 2′-DMAOE), or 2′-dimethylaminoethoxyethoxy (also known in the art as 2′-O-dimethyl-amino-ethoxy-ethyl or 2′-DMAEOE), that is, 2′-O—CH.sub.2—O—CH.sub.2—N(CH.sub.3).sub.2.
[0231] Other modifications include 2′-methoxy (2′-O—CH3), 2′-aminopropoxy (2′-OCH.sub.2CH.sub.2CH.sub.2NH.sub.2), 2′-allyl (2′-CH.sub.2—CH═CH.sub.2), 2′-O-allyl (2′-O—CH.sub.2—CH═CH.sub.2) and 2′-fluoro (2′-F). The 2′-modification may be in the arabino (up) position or ribo (down) position. In one embodiment a 2′-arabino modification is 2′-F.
[0232] Similar modifications may also be made at other positions on the oligonucleotide, particularly the 3′ position of the sugar on the 3′ terminal nucleotide or in 2′-5′ linked oligonucleotides and the 5′ position of the 5′ terminal nucleotide.
[0233] Oligonucleotides may also have sugar mimetics, such as cyclobutyl moieties in place of the pentofuranosyl sugar.
[0234] Representative United States patents that teach the preparation of such modified sugar structures include, but are not limited to, U.S. Pat. Nos. 4,981,957, 5,118,800, 5,319,080, 5,359,044, 5,393,878, 5,446,137, 5,466,786, 5,514,785, 5,519,134, 5,567,811, 5,576,427, 5,591,722, 5,597,909, 5,610,300, 5,627,053, 5,639,873, 5,646,265, 5,658,873, 5,670,633, 5,792,747, and 5,700,920.
[0235] A further modification of the sugar includes Locked Nucleic Acids (LNAs) in which the 2′-hydroxyl group is linked to the 3′ or 4′ carbon atom of the sugar ring, thereby forming a bicyclic sugar moiety. In one embodiment, the linkage is a methylene (—CH2-) n group bridging the 2′ oxygen atom and the 4′ carbon atom, wherein n is 1 or 2. LNAs and preparation thereof are described in WO 98/39352 and WO 99/14226. In some embodiments, however, the modification does not comprise LNA.
[0236] Modified nucleobases include other synthetic and natural nucleobases such as, for example, 5-methylcytosine (5-me-C), 5-hydroxymethyl cytosine, xanthine, hypoxanthine, 2-aminoadenine, 6-methyl and other alkyl derivatives of adenine and guanine, 2-propyl and other alkyl derivatives of adenine and guanine, 2-thiouracil, 2-thiothymine and 2-thiocytosine, 5-halouracil and cytosine, 5-propynyl (—CC—CH3) uracil and cytosine and other alkynyl derivatives of pyrimidine bases, 6-azo uracil, cytosine and thymine, 5-uracil (pseudouracil), 4-thiouracil, 8-halo, 8-amino, 8-thiol, 8-thioalkyl, 8-hydroxyl and other 8-substituted adenines and guanines, 5-halo particularly 5-bromo, 5-trifluoromethyl and other 5-substituted uracils and cytosines, 7-methylguanine and 7-methyladenine, 2-F-adenine, 2-amino-adenine, 8-azaguanine and 8-azaadenine, 7-deazaguanine and 7-deazaadenine and 3-deazaguanine and 3-deazaadenine.
[0237] Further modified nucleobases include tricyclic pyrimidines, such as phenoxazine cytidine(1H-pyrimido[5,4-b][1,4]benzoxazin-2(3H)-one), phenothiazine cytidine (1H-pyrimido[5,4-b][1,4]benzothiazin-2(3H)-one), G-clamps such as, for example, a substituted phenoxazine cytidine (e.g., 9-(2-aminoethoxy)-H-pyrimido [5,4-b][1,4]benzoxazin-2(3H)-one), carbazole cytidine (2H-pyrimido[4,5-b]indol-2-one), pyridoindole cytidine (H-pyrido[3′,2′:4,5]pyrrolo[2,3-d]pyrimidin-2-one).
[0238] Modified nucleobases may also include those in which the purine or pyrimidine base is replaced with other heterocycles, for example, 7-deaza-adenine, 7-deazaguanosine, 2-aminopyridine and 2-pyridone. Further nucleobases include those disclosed in U.S. Pat. No. 3,687,808, those disclosed in J. I. Kroschwitz (editor), The Concise Encyclopedia of Polymer Science and Engineering, pages 858-859, John Wiley and Sons (1990), those disclosed by Englisch et al. (1991), and those disclosed by Y. S. Sanghvi, Chapter 15: Antisense Research and Applications, pages 289-302, S. T. Crooke, B. Lebleu (editors), CRC Press, 1993.
[0239] Certain of these nucleobases are particularly useful for increasing the binding affinity of the oligonucleotide. These include 5-substituted pyrimidines, 6-azapyrimidines and N-2, N-6 and 0-6 substituted purines, including 2-aminopropyladenine, 5-propynyluracil and 5-propynylcytosine. 5-methylcytosine substitutions have been shown to increase nucleic acid duplex stability by 0.6-1.2° C. In one embodiment, these nucleobase substitutions are combined with 2′-O-methoxyethyl sugar modifications.
[0240] Representative United States patents that teach the preparation of certain of the above noted modified nucleobases as well as other modified nucleobases include, but are not limited to, U.S. Pat. Nos. 3,687,808, 4,845,205, 5,130,302, 5,134,066, 5,175,273, 5,367,066, 5,432,272, 5,457,187, 5,459,255, 5,484,908, 5,502,177, 5,525,711, 5,552,540, 5,587,469, 5,594,121, 5,596,091, 5,614,617, 5,645,985, 5,830,653, 5,763,588, 6,005,096, 5,681,941 and 5,750,692.
[0241] Unless stated to the contrary, reference to an A, T, G, U or C can either mean a naturally occurring base or a modified version thereof.
[0242] In particular embodiments, two or more bases (e.g., 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20 bases inclusive of any range therein) of the oligonucleotide described herein are modified. In some embodiments, all bases of the oligonucleotide described herein are modified. In alternative embodiments, no bases of the oligonucleotide described herein are modified.
Backbones
[0243] Oligonucleotides of the present disclosure include those having modified backbones or non-natural internucleotide linkages. Oligonucleotides having modified backbones include those that retain a phosphorus atom in the backbone and those that do not have a phosphorus atom in the backbone.
[0244] Modified oligonucleotide backbones containing a phosphorus atom therein include, for example, phosphorothioates, chiral phosphorothioates, phosphorodithioates, phosphotriesters, aminoalkylphosphotriesters, methyl and other alkyl phosphonates including 3′-alkylene phosphonates, 5′-alkylene phosphonates and chiral phosphonates, phosphinates, phosphoramidates including 3′-amino phosphoramidate and aminoalkylphosphoramidates, thionophosphoramidates, thionoalkylphosphonates, thionoalkylphosphotriesters, selenophosphates, and boranophosphates having normal 3′-5′ linkages, 2′-5′ linked analogs of these, and those having inverted polarity wherein one or more internucleotide linkages is a 3′ to 3′, 5′ to 5′ or 2′ to 2′ linkage. Oligonucleotides having inverted polarity comprise a single 3′ to 3′ linkage at the 3′-most internucleotide linkage, that is, a single inverted nucleoside residue which may be abasic (the nucleobase is missing or has a hydroxyl group in place thereof). Various salts, mixed salts and free acid forms are also included.
[0245] Representative United States patents that teach the preparation of the above phosphorus-containing linkages include, but are not limited to, U.S. Pat. Nos. 3,687,808, 4,469,863, 4,476,301, 5,023,243, 5,177,196, 5,188,897, 5,264,423, 5,276,019, 5,278,302, 5,286,717, 5,321,131, 5,399,676, 5,405,939, 5,453,496, 5,455,233, 5,466,677, 5,476,925, 5,519,126, 5,536,821, 5,541,306, 5,550,111, 5,563,253, 5,571,799, 5,587,361, 5,194,599, 5,565,555, 5,527,899, 5,721,218, 5,672,697 and 5,625,050.
[0246] Modified oligonucleotide backbones that do not include a phosphorus atom therein include, for example, backbones formed by short chain alkyl or cycloalkyl internucleoside linkages, mixed heteroatom and alkyl or cycloalkyl internucleoside linkages, or one or more short chain heteroatomic or heterocyclic internucleoside linkages. These include those having morpholino linkages (formed in part from the sugar portion of a nucleoside); siloxane backbones; sulfide, sulfoxide and sulfone backbones; formacetyl and thioformacetyl backbones; methylene formacetyl and thioformacetyl backbones; riboacetyl backbones; alkene containing backbones; sulfamate backbones; methyleneimino and methylenehydrazino backbones; sulfonate and sulfonamide backbones; amide backbones; and others having mixed N, O, S and CH2 component parts.
[0247] Representative United States patents that teach the preparation of the above oligonucleotides include, but are not limited to, U.S. Pat. Nos. 5,034,506, 5,166,315, 5,185,444, 5,214,134, 5,216,141, 5,235,033, 5,264,562, 5,264,564, 5,405,938, 5,434,257, 5,466,677, 5,470,967, 5,489,677, 5,541,307, 5,561,225, 5,596,086, 5,602,240, 5,610,289, 5,602,240, 5,608,046, 5,610,289, 5,618,704, 5,623,070, 5,663,312, 5,633,360, 5,677,437, 5,792,608, 5,646,269 and 5,677,439.
Antisense Oligonucleotides
[0248] The term “antisense oligonucleotide” shall be taken to mean an oligonucleotide that is complementary to at least a portion of a specific mRNA molecule, such as encoding an endogenous polypeptide and capable of interfering with a post-transcriptional event such as mRNA translation. The use of antisense methods is well known in the art (see for example, G. Hartmann and S. Endres, Manual of Antisense Methodology, Kluwer (1999)).
[0249] In one embodiment, the antisense oligonucleotide hybridises under physiological conditions, that is, the antisense oligonucleotide (which is fully or partially single stranded) is at least capable of forming a double stranded polynucleotide with mRNA, such as encoding an endogenous polypeptide, under normal conditions in a cell.
[0250] Antisense oligonucleotides may include sequences that correspond to the structural genes or for sequences that effect control over the gene expression or splicing event. For example, the antisense sequence may correspond to the targeted coding region of endogenous gene, or the 5′-untranslated region (UTR) or the 3′-UTR or combination of these. It may be complementary in part to intron sequences, which may be spliced out during or after transcription, preferably only to exon sequences of the target gene. In view of the generally greater divergence of the UTRs, targeting these regions provides greater specificity of gene inhibition.
[0251] The antisense oligonucleotide may be complementary to the entire gene transcript, or part thereof. The degree of identity of the antisense sequence to the targeted transcript should be at least 90% and more preferably 95-100%. The antisense RNA or DNA molecule may of course comprise unrelated sequences which may function to stabilize the molecule such as described herein.
Gene Silencing
[0252] Oligonucleotide molecules, particularly RNA, may be employed to regulate gene expression. The terms “RNA interference”, “RNAi” or “gene silencing” refer generally to a process in which a dsRNA molecule reduces the expression of a nucleic acid sequence with which the double-stranded RNA molecule shares substantial or total homology. However, it has been shown that RNA interference can be achieved using non-RNA double stranded molecules (see, for example, US 20070004667).
[0253] The double-stranded regions should be at least 19 contiguous nucleotides, for example about 19 to 23 nucleotides, or may be longer, for example 30 or 50 nucleotides, or 100 nucleotides or more. The full-length sequence corresponding to the entire gene transcript may be used. Preferably, they are about 19 to about 23 nucleotides in length.
[0254] The degree of identity of a double-stranded region of a nucleic acid molecule to the targeted transcript should be at least 90% and more preferably 95-100%. The nucleic acid molecule may of course comprise unrelated sequences which may function to stabilize the molecule.
[0255] The term “short interfering RNA” or “siRNA” as used herein refers to a polynucleotide which comprises ribonucleotides capable of inhibiting or down regulating gene expression, for example by mediating RNAi in a sequence-specific manner, wherein the double stranded portion is less than 50 nucleotides in length, preferably about 19 to about 23 nucleotides in length. For example the siRNA can be a nucleic acid molecule comprising self-complementary sense and antisense regions, wherein the antisense region comprises nucleotide sequence that is complementary to nucleotide sequence in a target nucleic acid molecule or a portion thereof and the sense region having nucleotide sequence corresponding to the target nucleic acid sequence or a portion thereof. The siRNA can be assembled from two separate oligonucleotides, where one strand is the sense strand and the other is the antisense strand, wherein the antisense and sense strands are self-complementary. The two strands can be of different length.
[0256] As used herein, the term siRNA is meant to be equivalent to other terms used to describe polynucleotides that are capable of mediating sequence specific RNAi, for example micro-RNA (miRNA), short hairpin RNA (shRNA), short interfering oligonucleotide, short interfering nucleic acid (siNA), short interfering modified oligonucleotide, chemically-modified siRNA, post-transcriptional gene silencing RNA (ptgsRNA), and others. In addition, as used herein, the term RNAi is meant to be equivalent to other terms used to describe sequence specific RNA interference, such as post transcriptional gene silencing, translational inhibition, or epigenetics. For example, siRNA molecules can be used to epigenetically silence genes at both the post-transcriptional level or the pre-transcriptional level. In a non-limiting example, epigenetic regulation of gene expression by siRNA molecules can result from siRNA mediated modification of chromatin structure to alter gene expression.
[0257] By “shRNA” or “short-hairpin RNA” is meant an RNA molecule where less than about 50 nucleotides, preferably about 19 to about 23 nucleotides, is base paired with a complementary sequence located on the same RNA molecule, and where said sequence and complementary sequence are separated by an unpaired region of at least about 4 to about 15 nucleotides which forms a single-stranded loop above the stem structure created by the two regions of base complementarity. An Example of a sequence of a single-stranded loop includes: 5′ UUCAAGAGA 3′.
[0258] Included shRNAs are dual or bi-finger and multi-finger hairpin dsRNAs, in which the RNA molecule comprises two or more of such stem-loop structures separated by single-stranded spacer regions.
Design and Testing of Candidate Oligonucleotides
[0259] As the skilled person is aware, in addition to design elements of the invention, there are many known factors to be considered when producing an oligonucleotide. The specifics depend on the purpose of the oligonucleotide but include features such as strength and stability of the oligonucleotide-target nucleic acid interaction, such as the mRNA secondary structure, thermodynamic stability, the position of the hybridization site, and/or functional motifs.
[0260] Some methods the invention involve scanning a target polynucleotide, or complement thereof, for specific features. This can be done by eye or using computer programs known in the art. Software programs which can be used to design, analyse and predict functional properties of antisense oligonucleotides include Mfold, Sfold, NUPACK, Nanofolder, Hyperfold, and/or RNA designer. Software programs which can be used to design, analyse and predict functional properties of oligonucleotides for gene silencing include dsCheck, E-RNAi and/or siRNA-Finder.
[0261] In one embodiment, available software is used to select potentially useful oligonucleotides, and then these are scanned for desired features as described herein. Alternatively, software could readily be developed to scan a target polynucleotide, or complement thereof, for desired features as described herein.
[0262] Once synthesized, candidate oligonucleotides can be tested for their desired activity using standard procedures in the art. This may involve administering the candidate to cells in vitro expressing the gene of interest and analysing the amount of gene product such as RNA and/or protein. In another example, the candidate is administered to an animal, and the animal screened for the amount of target RNA and/or protein and/or using a functional assay. In another embodiment, the oligonucleotide is tested for its ability to hybridize to a target polynucleotide (such as mRNA).
[0263] In some examples expression and oligonucleotide activity can be determined by mRNA reverse transcription quantitative real-time PCR (RT-qPCR). For example, RNA can be extracted and purified from cells which have been incubated with a candidate oligonucleotide. cDNA is then synthesized from isolated RNA and RT-qPCR can be performed, using methods and reagents known the art. In one example, RNA can be purified from cells using the ISOLATE II RNA Mini Kit (Bioline) and cDNA can be synthesized from isolated RNA using the High-Capacity cDNA Archive kit (Thermo Fisher Scientific) according to the manufacturer's instructions. RT-qPCR can be performed using the Power SYBR Green Master Mix (Thermo Fisher Scientific) on the HT7900 and QuantStudio 6 RT-PCR system (Thermo Fisher Scientific), according to manufacturer's instructions.
Testing for Inhibition of TLR7 Activity
[0264] Some aspects of the present invention involve testing for inhibition of TLR7 activity which can be determined using any method known in the art. In some embodiments, TLR7 activity in cells may be measured by expression and/or secretion of one or more proinflammatory cytokines (e.g. TNFα, IP-10), and/or activation or expression of transcription factors (e.g. NF-κB).
[0265] The ability of an oligonucleotide to inhibit TLR7 activity can, for example, be analysed by incubating cells which express TLR7 with an oligonucleotide, then stimulating said cells with a TLR7 agonist, and analysing the overall TLR7 response in the cell population, or analysing the proportion of cells having TLR7-positive activity after a defined period of time.
[0266] In such examples, inhibition of TLR7 activity can be identified by observation of an overall decreased TLR7 response of the cell population, or a lower proportion of cells having TLR7-positive activity as compared to positive control condition in which cells are treated with a TLR7 agonist in the absence of the oligonucleotide (or in the presence of an appropriate control inhibitory agent). In one example, 293XLhTLR7 (referred to as HEK-TLR7) cells are transfected with pNF-κB-Luc4 reporter, incubated with an oligonucleotide, and then stimulated with R848. TLR7 activity can be determined by a luciferase assay, which measures activated NF-κB by luminescence. TLR7 activity can also be analysed by measuring cytokine levels, for example by ELISA.
Testing for Potentiating TLR8 Activity
[0267] Some aspects of the present invention involve testing for potentiation of TLR8 activity which can be determined using any method known in the art. In some embodiments TLR8 activity in cells may be measured by expression and/or secretion of one or more proinflammatory cytokines (e.g. TNFα, IP-10), and/or activation or expression of transcription factors (e.g. NF-κB).
[0268] The ability of an oligonucleotide to potentiate TLR8 activity can, for example, be analysed by incubating cells which express TLR8 with an oligonucleotide, then stimulating said cells with a TLR8 agonist, and analysing the overall TLR8 response in the cell population, or analysing the proportion of cells having TLR8-positive activity after a defined period of time.
[0269] In such examples, potentiation of TLR8 activity can be identified by observation of an overall decreased TLR8 response of the cell population, or a higher proportion of cells having TLR8-positive activity as compared to a negative control condition in which cells are treated with TLR8 agonist in the absence of the oligonucleotide (or in the presence of an appropriate control non-potentiating agent). In one example, 293XLhTLR8 (referred to as HEK-TLR8) cells are transfected with pNF-κB-Luc4 reporter, incubated with an oligonucleotide, and then stimulated with R848. TLR8 activity can be determined by a luciferase assay, which measures activated NF-κB by luminescence. TLR8 activity can also be analysed by measuring cytokine levels, for example by ELISA.
[0270] ‘Potentiation’ refers to an increase in a functional property relative to a control condition. Potentiation of TLR8 activity may be greater than about 100%, e.g. about 2 fold, about 3 fold, about 4 fold, about 5 fold, about 6 fold, about 7 fold, about 8 fold, about 9 fold, about 10 fold, about 11 fold, about 12 fold, about 13 fold, about 14 fold, about 15 fold, about 20 fold or about 50 fold. Preferably, the level of TLR8 potentiation is between about 2 fold and 50 fold, between about 2 fold and 20 fold, and/or between about 5 fold and 20 fold greater.
Uses
[0271] Oligonucleotides of the invention are designed to be administered to an animal. In one example, the animal is a vertebrate. For example, the animal can be a mammal, avian, chordate, amphibian or reptile. Exemplary subjects include but are not limited to human, primate, livestock (e.g. sheep, cow, chicken, horse, donkey, pig), companion animals (e.g. dogs, cats), laboratory test animals (e.g. mice, rabbits, rats, guinea pigs, hamsters), captive wild animal (e.g. fox, deer). In one example, the mammal is a human.
[0272] Oligonucleotides of the invention can be used to target any gene/polynucleotide/function of interest. Typically, the oligonucleotide is used to modify a trait of an animal, more typically to treat or prevent a disease. In a preferred embodiment, the disease will benefit from the animal being able to mount a TLR7 and/or TLR8 response following administration of the oligonucleotide, in particular where the TLR7 response is not inhibited and/or the TLR8 response is potentiated.
[0273] Diseases which can be treated or prevented using an oligonucleotide of the invention include, but are not limited, to cancer (for example breast cancer, ovarian cancer, cancers of the central nervous system, gastrointestinal cancer, bladder cancer, skin cancer, lung cancer, head and neck cancers, haematological and lymphoid cancers, bone cancer) rare genetic diseases, neuromuscular and neurological diseases (for example, spinal muscular atrophy, Amyotrophic Lateral Sclerosis, Duchenne muscular dystrophy, Huntington's disease, Batten disease, Parkinson's disease, amyotrophic lateral sclerosis, Ataxia-telangiectasia, cerebral palsy) viruses (for example, cytomegalovirus, hepatitis C virus, Ebola hemorrhagic fever virus, human immunodeficiency virus, coronaviruses), cardiovascular disease (for example, familial hypercholesterolemia, hypertriglyceridemia), autoimmune and inflammatory diseases (for example arthritis, lupus, pouchitis, psoriasis, asthma), and non-alcoholic and alcoholic fatty liver diseases.
[0274] Examples of target genes (polynucleotides) of oligonucleotides of the invention include, but not limited to, PLK1ERBB2, PIK3CA, ERBB3, HDAC1, MET, EGFR, TYMS, TUBB4B, FGFR2, ESR1, FASN, CDK4, CDK6, NDUFB4, PPAT, NDUFB7, DNMT1, BCL2, ATP1A1, HDAC3, FGFR1, NDUFS2, HDAC2, NDUFS3, HMGCR, IGF1R, AKT1, BCL2L1, CDK2, MTOR, PDPK1, CSNK2A1, PIK3CB, CDK12, MCL1, ATR, PLK4, MEN1, PTK2, FZD5, KRAS, WRN, CREBBP, NRAS, MAT2A, RHOA, TPX2, PPP2CA, ALDOA, RAE1, SKP1, ATP5A1, EIF4G1, CTNNB1, TFRC, CDH1, CCNE1, CLTC, METAP2, GRB2, MDM4, SLC16A1, FERMT2, ENO1, STX4, SF3B1, RBBP4, FEN1, MRPL28, CCNA2, PTPN11, SAE1, KMT2D, APC, CAD, NAMPT, OGT, HSPA8, USP5, CSNK1A1, PGD, VRK1, SEPSECS, SUPT4H1, DNAJC9, TRIAP1, DLD, PTPN7, VDAC1, STAT3, TCEB2, ADSL, GMPS, DHPS, METAP1, TAF13, CFL1, SCD, RBM39, PGAM1, FNTB, PPP2R1A, ARF1, UBE2T, UMPS, MYC, PRMT5, EIF4G2, SKP2, STAG2, ATF4, WDR77, ILK, METTL16, SOD1, DDX6, FURIN, AARS, FNTA, PABPC1, RANBP2, CDC25B, SLC2A1, CENPE, ADAR, CDC42, RNF31, CCNC, PRIM1, SLC38A2, SNUPN, PDCD6IP, RTN4IP1, VMP1, TGFBR1, TXN, UBE2N, UAP1, RAC1, GGPS1, RAB10, RAB6A, TPI1, RPE, THG1L, UBE2D3, RHEB, PKM, GMNN, HGS, NCKAP1, NUP98, SMARCA2, RNF4, DDX39B, ACLY, XPO1, PPP1R8, YAP1, MTHFD1, LPAR1, TAF1, UROD, STXBP3, HSP90B1, VHL, EFR3A, FECH, MRPL44, AIFM1, MAGOH, MRPL17, SUZ12, RNMT, RAB1B, PNPT1, RAD1, WDR48, PITRM1, MRPL47, AP2M1, EIF4A1, UBE2C, LONP1, VPS4A, SNRNP25, TUBGCP6, DNM2, UBE2M, EXOSC9, TAF1B, CDC37, ATP6V1G1, POP1, JUP, PRPS1, GPX4, CFLAR, CHMP4B, ACTB, ACTR1A, PTPN23, SHC1, TRPM7, SLC4A7, HSPD1, XRN1, WDR1, ITGB5, UBR4, ATP5B, CPD, TUFM, MYH9, ATP5F1, ATP6V1C1, SOD2, PFAS, NFE2L2, ARF4, ITGAV, DHX36, KIF18A, DDX5, XRCC5, DNAJC11, ZBTB8OS, NCL, SDHB, ATP5C1, NDC1, SNF8, CUL3, SLC7A1, ASNA1, EDF1, TMED10, CHMP6, ARIH1, DDOST, RPL28, DIMT1, CMPK1, PPIL1, PPA2, SMAD7, CEP55, MVD, MVK, PDS5A, KNTC1, CAPZB, GMPPB, TPT1, ACIN1, SAR1A, TAF6L, PTBP1, PAK2, CRKL, NHLRC2, INO80, SLC25A3, ACTR3, DDX3X, HUWE1, TBCA, IK, SSBP1, ARPC4, SLC7A5, OSGEP, PDCD2, TRAF2, SNAP23, RPN1, EIF5A, GEMIN4, BMPR1A, AHCYL1, CHMP5, TRAPPC1, LRP8, ARID2, UBE2L3, STAMBP, KDSR, UQCRC2, PNN, USP7, TBCD, ATP6V0E1, PCYT1A, TAZ, POLRMT, CELSR2, TERF1, BUB1, YRDC, SMG6, TBX3, SLC39A10, IPO13, CDIPT, UBA5, EMC7, FERMT1, VEZT, CCND1, CCND2, FPGS, JUN, PPM1D, PGGT1B, NPM1, GTF2A1, MBTPS1, HMGCS1, LRR1, HSD17B12, LCE2A, NUP153, FOSL1, IRS2, CYB5R4, PMPCB, ARHGEF7, TRRAP, NRBP1, ARMC7, MOCS3, TIPARP, SEC61A1, PFDN5, MYB, IRF4, STX5, MYCN, FOXA1, SOX10, GATA3, ZEB2, MYBL2, MFN2, TBCB, KLF4, TRIM37, CEBPA, STAG1, POU2AF1, HYPK, FLI1, NCAPD2, MAF, NUP93, RBBP8, HJURP, SMARCB1, SOCS3, GRWD1, NKX2-1, FDXR, SPDEF, SBDS, SH3GL1, KLF5, CNOT3, ZNF407, CPSF1, RPTOR, EXT1, SMC1A, GUK1, TIMM23, FAU, ACO2, ALG1, CCNL1, SCAP, SRSF6, SPAG5, SOX9, LDB1, ASPM, LIG1, TFDP1, RPAIN, CENPA, MIS12, ILF3, HSCB, ERCC2, SOX2, ARFRP1, PMF1, POLR3E, MAD2L2, PELP1, NXT1, WDHD1, ZWINT, E2F3, FZR1, JUNB, OGDH, NOB1, SKA3, TACC3, UTP14A, XRN2, SMG5, IDH3A, CIAO1, COQ4, ZFP36L1, CDCA5, PRKRA, PFDN6, PAK1IP1, PSTK, EDC4, UTP18, TOMM22, CASC5, PTTG1, RBBP5, PPP1R12A, FARS2, FOXM1, SIN3A, BUB1B, GNB1L, SMC5, SARS2, SYNCRIP, IPPK, FANCD2, WDR46, FANCI, DCP2, RFC2, RNF20, DMAP1, MED23, MBNL1, CTPS1, TBP, MMS19, RAD51C, CDS2, NONO, USP18, PARS2, FBXW11, SUM02, RRP12, FAM50A, URB2, MCM4, SLC25A28, IP07, MAX, SFSWAP, SBNO1, DPAGT1, TINF2, BRCA2, NUP50, RPIA, EP400, IKBKAP, KIF14, RTTN, CCDC115, GEMIN6, WWTR1, BCS1L, GTF3A, SCYL1, NELFB, DDX39A, TRA2B, SYVN1, ISL1, CYB5B, ACSL3, DPH3, E2F1, IREB2, SREBF1, SMC6, IRF8, ID1, PDCD11, SNAPC2, TIMM17A, ANAPC10, NUP85, SEH1L, VBP1, NUDC, MTX2, RPP25L, ISY1, LEMD2, ATP5D, EXOSC2, TAF1C, PPIL4, SEPHS2, HNRNPH1, CTR9, CDC26, TIMM13, FAM96B, CEBPZ, UFL1, ZNF236, COPG1, TPR, MIOS, UBE2G2, MED12, GTF3C1, PPP2R2A, UBIAD1, WTAP, MYBBP1A, NUP88, NELFCD, WDR73, RTCB, CEP192, GTF3C5, LENG1, RINT1, MED24, COX6B1, DCTN6, SLC25A38, LYRM4, STRAP, TTF2, DDX27, GTF2F1, ZNHIT2, BCLAF1, WDR18, GTF2H2C, NDE1, TIMM9, CHMP7, IPO11, TGIF1, NOC4L, EXOSC6, WDR24, INTS6, DDX41, UBE2S, ARGLU1, SHOC2, ATP5J, CSTF2, RPP30, NHP2, GRHL2, RPL22L1, WDR74, UTP23, CCDC174, RPP21, UBE2J2, GEMIN8, ATP6V0B, KIAA1429, PNO1, MED22, ENY2, THOC7, DDX19A, SUGP1, PELO, ELAC2, CHCHD4, RNPC3, INTS3, PSMG4, UQCRC1, TAF1A, TSR1, UTP6, TRMT5, EIF1AD, GTF3C2, DCTN3, GPS1, WDR7, EXOSC8, KANSL1, SPRTN, KANSL3, EXOSC5, PRCC, TRNAU1AP, EIF3J, TAMM41, HAUS6, OIP5, HAUS5, TAF6, MRPS22, MRPS34, WBP11, COGS, DHX38, DNLZ, LAGE3, FUBP1, MED26, SLC7A6OS, MARS2, RBM28, ASCC3, PSMG3, TUBGCP5, PCF11, or LAS1L.
[0275] In an embodiment, the gene to be targeted includes PKN3, VEGFA, KIF11, MYC, EPHA2, KRAS (G12), ERBB3, BIRC5, HIF1A, BCL2, STAT3, AR, EPAS1, BRCA2, or CLU.
[0276] Examples of commercial oligonucleotides which can be modified as described herein include, but are not limited to, inclisiran, mipomersen (Kynamro), nusinersen (Spinraza), eteplirsen (Exondys51), miravirsen (SPC3649), RG6042 (IONIS-HTTRx), inotersen, volanesorsen, golodirsen (Vyondys53), fomivirsen (Vitravene), patisiran, givosiran, inclisiran, danvatirsen and IONIS-AR-2.5Rx.
Compositions
[0277] Oligonucleotides of the disclosure may be admixed, encapsulated, conjugated (such as fused) or otherwise associated with other molecules, molecule structures or mixtures of compounds, resulting in, for example, liposomes, receptor-targeted molecules, oral, rectal, topical or other formulations, for assisting in uptake, distribution and/or absorption. Representative United States patents that teach the preparation of such uptake, distribution and/or absorption-assisting formulations include, but are not limited to, U.S. Pat. Nos. 5,108,921, 5,354,844, 5,416,016, 5,459,127, 5,521,291, 5,543,158, 5,547,932, 5,583,020, 5,591,721, 4,426,330, 4,534,899, 5,013,556, 5,108,921, 5,213,804, 5,227,170, 5,264,221, 5,356,633, 5,395,619, 5,416,016, 5,417,978, 5,462,854, 5,469,854, 5,512,295, 5,527,528, 5,534,259, 5,543,152, 5,556,948, 5,580,575, and 5,595,756.
[0278] Oligonucleotides of the disclosure may be administered in a pharmaceutically acceptable carrier. The pharmaceutically acceptable carrier may be solid or liquid. Useful examples of pharmaceutically acceptable carriers include, but are not limited to, diluents, solvents, surfactants, excipients, suspending agents, buffering agents, lubricating agents, adjuvants, vehicles, emulsifiers, absorbants, dispersion media, coatings, stabilizers, protective colloids, adhesives, thickeners, thixotropic agents, penetration agents, sequestering agents, isotonic and absorption delaying agents that do not affect the activity of the active agents of the disclosure.
[0279] In one embodiment, the pharmaceutical carrier is water for injection (WFI) and the pharmaceutical composition is adjusted to pH 7.4, 7.2-7.6. In one embodiment, the salt is a sodium or potassium salt.
[0280] The oligonucleotides may contain chiral (asymmetric) centers or the molecule as a whole may be chiral. The individual stereoisomers (enantiomers and diastereoisomers) and mixtures of these are within the scope of the present disclosure.
[0281] Oligonucleotides of the disclosure may be pharmaceutically acceptable salts, esters, or salts of the esters, or any other compounds which, upon administration are capable of providing (directly or indirectly) the biologically active metabolite. The term “pharmaceutically acceptable salts” as used herein refers to physiologically and pharmaceutically acceptable salts of the oligonucleotide that retain the desired biological activities of the parent compounds and do not impart undesired toxicological effects upon administration. Examples of pharmaceutically acceptable salts and their uses are further described in U.S. Pat. No. 6,287,860.
[0282] Oligonucleotides of the disclosure may be prodrugs or pharmaceutically acceptable salts of the prodrugs, or other bioequivalents. The term “prodrugs” as used herein refers to therapeutic agents that are prepared in an inactive form that is converted to an active form (i.e., drug) upon administration by the action of endogenous enzymes or other chemicals and/or conditions. In particular, prodrug forms of the oligonucleotide of the disclosure are prepared as SATE [S acetyl-2-thioethyl) phosphate] derivatives according to the methods disclosed in WO 93/24510, WO 94/26764 and U.S. Pat. No. 5,770,713.
[0283] A prodrug may, for example, be converted within the body, e. g. by hydrolysis in the blood, into its active form that has medical effects. Pharmaceutical acceptable prodrugs are described in T. Higuchi and V. Stella, Prodrugs as Novel Delivery Systems, Vol. 14 of the A. C. S. Symposium Series (1976); “Design of Prodrugs” ed. H. Bundgaard, Elsevier, 1985; and in Edward B. Roche, ed., Bioreversible Carriers in Drug Design, American Pharmaceutical Association and Pergamon Press, 1987. Those skilled in the art of organic chemistry will appreciate that many organic compounds can form complexes with solvents in which they are reacted or from which they are precipitated or crystallized. These complexes are known as “solvates”. For example, a complex with water is known as a “hydrate”.
[0284] In one embodiment, oligonucleotides of the invention can be complexed with a complexing agent to increase cellular uptake of oligonucleotides. An example of a complexing agent includes cationic lipids. Cationic lipids can be used to deliver oligonucleotides to cells.
[0285] The term “cationic lipid” includes lipids and synthetic lipids having both polar and non-polar domains and which are capable of being positively charged at or around physiological pH and which bind to polyanions, such as nucleic acids, and facilitate the delivery of nucleic acids into cells. In general cationic lipids include saturated and unsaturated alkyl and alicyclic ethers and esters of amines, amides, or derivatives thereof. Straight-chain and branched alkyl and alkenyl groups of cationic lipids can contain, e.g., from 1 to about 25 carbon atoms. Preferred straight chain or branched alkyl or alkene groups have six or more carbon atoms. Alicyclic groups include cholesterol and other steroid groups. Cationic lipids can be prepared with a variety of counterions (anions) including, e.g., Cl—, Br—, I—, F—, acetate, trifluoroacetate, sulfate, nitrite, and nitrate.
[0286] Examples of cationic lipids include polyethylenimine, polyamidoamine (PAMAM) starburst dendrimers, Lipofectin (a combination of DOTMA and DOPE), Lipofectase, LIPOFECTAMINE™ (e.g., LIPOFECTAMINE™ 2000), DOPE, Cytofectin (Gilead Sciences, Foster City, Calif.), and Eufectins (JBL, San Luis Obispo, Calif.). Exemplary cationic liposomes can be made from N-[1-(2,3-dioleoloxy)-propyl]-N,N,N-trimethylammonium chloride (DOTMA), N-[1-(2,3-dioleoloxy)-propyl]-N,N,N-trimethylammonium methylsulfate (DOTAP), 3.Math.beta.Math.-[N—(N′,N′-dimethylaminoethane)carbamoyl]cholesterol (DC-Chol), 2,3,-dioleyloxy-N-[2(sperminecarboxamido)ethyl]-N,N-dimethyl-1-propanaminium trifluoroacetate (DOSPA), 1,2-dimyristyloxypropyl-3-dimethyl-hydroxyethyl ammonium bromide; and dimethyldioctadecylammonium bromide (DDAB). Oligonucleotides can also be complexed with, e.g., poly (L-lysine) or avidin and lipids may, or may not, be included in this mixture, e.g., steryl-poly (L-lysine).
[0287] Cationic lipids have been used in the art to deliver oligonucleotides to cells (see, e.g., U.S. Pat. Nos. 5,855,910; 5,851,548; 5,830,430; 5,780,053; 5,767,099; Lewis et al., 1996; Hope et al., 1998). Other lipid compositions which can be used to facilitate uptake of the instant oligonucleotides can be used in connection with the methods of the invention. In addition to those listed above, other lipid compositions are also known in the art and include, e.g., those taught in U.S. Pat. Nos. 4,235,871; 4,501,728; 4,837,028; 4,737,323.
[0288] In one embodiment lipid compositions can further comprise agents, e.g., viral proteins to enhance lipid-mediated transfections of oligonucleotides. In another embodiment N-substituted glycine oligonucleotides (peptoids) can be used to optimize uptake of oligonucleotides.
[0289] In another embodiment, a composition for delivering oligonucleotides of the invention comprises a peptide having from between about one to about four basic residues. These basic residues can be located, e.g., on the amino terminal, C-terminal, or internal region of the peptide. Families of amino acid residues having similar side chains have been defined in the art. These families include amino acids with basic side chains (e.g., lysine, arginine, histidine), acidic side chains (e.g., aspartic acid, glutamic acid), uncharged polar side chains (e.g., glycine (can also be considered non-polar), asparagine, glutamine, serine, threonine, tyrosine, cysteine), nonpolar side chains (e.g., alanine, valine, leucine, isoleucine, proline, phenylalanine, methionine, tryptophan), beta-branched side chains (e.g., threonine, valine, isoleucine) and aromatic side chains (e.g., tyrosine, phenylalanine, tryptophan, histidine). Apart from the basic amino acids, a majority or all of the other residues of the peptide can be selected from the non-basic amino acids, e.g., amino acids other than lysine, arginine, or histidine. Preferably a preponderance of neutral amino acids with long neutral side chains are used.
[0290] In one embodiment, oligonucleotides are modified by attaching a peptide sequence that transports the oligonucleotide into a cell, referred to herein as a “transporting peptide.” In one embodiment, the composition includes an oligonucleotide which is complementary to a target nucleic acid molecule encoding the protein, and a covalently attached transporting peptide.
[0291] In a further embodiment, the oligonucleotide is attached to a targeting moiety such as N-acetylgalactosamine (GalNAc), an antibody, antibody-like molecule or aptamer (see, for example, Toloue and Ford (2011) and Esposito et al. (2018)).
Administration
[0292] In one embodiment, the oligonucleotide of the disclosure is administered systemically. As used herein “systemic administration” is a route of administration that is either enteral or parenteral.
[0293] As used herein “enteral” refers to a form of administration that involves any part of the gastrointestinal tract and includes oral administration of, for example, the oligonucleotide in tablet, capsule or drop form; gastric feeding tube, duodenal feeding tube, or gastrostomy; and rectal administration of, for example, the oligonucleotide in suppository or enema form.
[0294] As used herein “parenteral” includes administration by injection or infusion. Examples include, intravenous (into a vein), intraarterial (into an artery), intramuscular (into a muscle), intracardiac (into the heart), subcutaneous (under the skin), intraosseous infusion (into the bone marrow), intradermal, (into the skin itself), intrathecal (into the spinal canal), intraperitoneal (infusion or injection into the peritoneum), intravesical (infusion into the urinary bladder). transdermal (diffusion through the intact skin), transmucosal (diffusion through a mucous membrane), inhalational.
[0295] In one embodiment, administration of the pharmaceutical composition is subcutaneous.
[0296] The oligonucleotide may be administered as single dose or as repeated doses on a period basis, for example, daily, once every two days, three, four, five, six seven, eight, nine, ten, eleven, twelve, thirteen or fourteen days, once weekly, twice weekly, three times weekly, every two weeks, every three weeks, every month, every two months, every three months to six months or every 12 months.
[0297] In one embodiment, administration is 1 to 3 times per week, or once every week, two weeks, three weeks, four weeks, or once every two months.
[0298] In one embodiment, administration is once weekly.
[0299] In one embodiment, a low dose administered for 3 to 6 months, such as about 25-50 mg/week for at least three to six months and then up to 12 months and chronically.
[0300] Illustrative doses are between about 10 to 5,000 mg. Illustrative doses include 25, 50, 100, 150, 200, 1,000, 2,000 mg. Illustrative doses include 1.5 mg/kg (about 50 to 100 mg) and 3 mg/kg (100-200 mg), 4.5 mg/kg (150-300 mg), 10 mg/kg, 20 mg/kg or 30 mg/kg. In one embodiment doses are administered once per week. Thus in one embodiment, a low dose of approximately 10 to 30, or 20 to 40, or 20 to 28 mg may be administered to subjects typically weighing between about 25 and 65 kg. In one embodiment the oligonucleotide is administered at a dose of less than 50 mg, or less than 30 mg, or about 25 mg per dose to produce a therapeutic effect.
EXAMPLES
Example 1—Methods
Ethics Statement
[0301] Collection of peripheral blood mononuclear cells (PBMCs) from healthy donors was approved by Monash Health under the HREC reference 02052A.
Cell Isolation, Culture and Stimulation
[0302] PBMCs were isolated from whole blood donations via density centrifugation using Histopaque-1770 (Sigma-Aldrich) as previously reported (Gantier et al., 2010), and plated in RPMI 1640 plus L-glutamine medium (Thermo Fisher Scientific) complemented with 1× antibiotic/antimycotic and 10% heat-inactivated foetal bovine serum (referred to as complete RPMI).
[0303] 293XL-hTLR8-HA (referred to as HEK-TLR8) and 293XL-hTLR7-HA (referred to as HEK-TLR7) and 293XL-hTLR9-HA stably expressing TLR8, TLR7, and TLR9 respectively, were purchased from Invivogen, and were maintained in Dulbecco's modified Eagle's medium (Thermo Fisher Scientific) supplemented with 10% heat-inactivated foetal bovine serum (Thermo Fisher Scientific) and 1× antibiotic/antimycotic (Thermo Fisher Scientific) (referred to as complete DMEM) supplemented with 10 μg/ml Blasticidin (Invivogen). Parental wild-type (WT) THP-1, UNC93B1-deficient THP-1 (Schmid-Burgk et al., 2014) and matched clones reconstituted with fluorescent wild-type UNC93B1 (Pelka et al., 2014) were grown in complete RPMI. OCI-AML3 and MOLM13 were grown in RPMI supplemented with 20% heat inactivated foetal bovine serum and 1× antibiotic/antimycotic (their identity was confirmed by in house cell line identification service relying on PowerPlex HS16 System kit, Promega). All the cells were cultured at 37° C. with 5% CO2. Cell lines were passaged 2-3 times a week and tested for mycoplasma contamination on routine basis by PCR.
[0304] For stimulations, THP-1, MOLM13 and OCI-AML3 were treated overnight with ASOs, prior to stimulation with 1 μg/ml R848 (Invivogen). HEK-TLR7 and HEKTLR8 were treated with indicated concentration of ASOs for 20-50 min, prior to stimulation with R848, CL075, Gardiquimod (all from Invivogen), or 7-Allyl-7,8-dihydro-8-oxoguanosine (Loxoribine—SigmaAldrich). All ASOs were synthesised by Integrated DNA Technologies (IDT), and resuspended in RNase-free TE buffer, pH 8.0 (Thermo Fisher Scientific). ASO sequences and modifications are provided in Table 1, 2 and 3. The cGAS ligand ISD70 (Table 1) was prepared as previously described (Pepin et al., 2020) and transfected with lipofectamine 2000 at 2.5 μg/ml final concentration. The Class B CpG oligonucleotide human TLR9 ligand ODN 2006 was synthesised by IDT and resuspended in RNase-free TE buffer
Luciferase Assays
[0305] HEK293 cells stably expressing TLR7, 8 or 9 were transfected with pNF-κB-Luc4 reporter (Clontech), pLuc-IFN-β (a kind gift from K. Fitzgerald, University of Massachusetts) or pCCL5[RANTES]-Luc (a kind gift from G. Scholz, University of Melbourne) with lipofectamine 2000 (Thermo Fisher Scientific), according to the manufacturer's protocol. Briefly, 500,000-700,000 cells were reverse-transfected with 400 ng of reporter with 1.2 μl of lipofectamine 2000 per well of a 6-well plate, and incubated for 3-24 h at 37° C. with 5% CO2. Following transfection, the cells were collected from the 6-wells and aliquoted into 96-wells, just before ASO and overnight TLR stimulation (as above described). The next day, the cells were lysed in 40 μl (for a 96-well plate) of 1X Glo Lysis buffer (Promega) for 10 min at room temperature. 15 μl of the lysate was then subjected to firefly luciferase assay using 40 μl of Luciferase Assay Reagent (Promega). Luminescence was quantified with a Fluostar OPTIMA (BMG LABTECH) luminometer.
Down-Regulation of HPRT with ASOs in HeLa Cells
[0306] Each ASO was reverse-transfected in biological triplicate in 96-well plates by complexing the various ASO doses with 0.5 μl Lipofectamine 2000 (Thermo Fisher Scientific) in OptiMEM I (Thermo Fisher Scientific) for a total volume of 50 μl in each well. HeLa cells (20,000) were suspended in 100 μl DMEM supplemented with 10% foetal calf serum (FCS), added to the lipid-ASO complexes, then incubated for 24 h at 37° C. and 5% CO2. RNA was collected with the SV Total RNA Isolation Kit (Promega) with DNase 1 treatment. cDNA was synthesized from ˜200 ng total RNA with anchored oligonucleotide dT and random hexamer primers (Integrated DNA Technologies) using SuperScript II Reverse Transcriptase (Thermo Fisher Scientific) as per the manufacturer's instructions. qPCR reactions were performed using ˜10 ng cDNA with Immolase DNA polymerase (Bioline), 500 nM of each primer and 250 nM probe in 10 μl reactions in 384-well plate format. Amplification reactions were run on an Applied Biosystems 7900HT (Thermo Fisher Scientific). All qPCR reactions were performed in triplicate for each sample and averaged.
[0307] Linearized cloned amplicons were used as copy number standards to establish absolute quantitative measurements for each assay. HPRT (NM 000194) and SFRS9 (NM 003769) expression levels were quantified by multiplexing 5′-nuclease assays, and HPRT levels normalized against SFRS9—used as internal reference control. Sequences of the primers and probe assays used are provided in Table 1. Knock-down efficiency was calculated relative to NC1 and NC5 negative control ASOs.
Detection of Cytokines
[0308] Human TNF-α and IP-10 were measured using BD OptEIA ELISA sets (BD Biosciences, #555212 and #550926, respectively), according to the manufacturers' instructions. Human IFN-α detection was carried out as previously reported (Gantier, 2013). Tetramethylbenzidine substrate (Thermo Fisher Scientific) was used for quantification of the cytokines on a Fluostar OPTIMA (BMG LABTECH) plate-reader.
mRNA Reverse Transcription Quantitative Real-Time PCR (RT-qPCR)
[0309] Total RNA was purified from cells using the ISOLATE II RNA Mini Kit (Bioline). Random hexamer cDNA was synthesized from isolated RNA using the High-Capacity cDNA Archive kit (Thermo Fisher Scientific) according to the manufacturer's instructions. RT-qPCR was carried out with the Power SYBR Green Master Mix (Thermo Fisher Scientific) on the HT7900 and QuantStudio 6 RT-PCR system (Thermo Fisher Scientific). Each PCR was carried out in technical duplicate and human 18S was used as reference gene. Each amplicon was gel-purified and used to generate a standard curve for the quantification of gene expression (used in each run). Melting curves were used in each run to confirm specificity of amplification.
[0310] The primers used were the following: Human RSAD2: hRSAD2-RT-FWD TGGTGAGGTTCTGCAAAGTAG; hRSAD2-RT-REV GTCACAGGAGATAGCGAGAATG; hIFIT1: hIFIT1-FWD TCACCAGATAGGGCTTTGCT; hIFIT1-REV CACCTCAAATGTGGGCTTTT; h18S: h18S-FWD CGGCTACCACATCCAAGGAA; h18S-REV GCTGGAATTACCGCGGCT; hIFI44: hIFI44-FWD ATGGCAGTGACAACTCGTTTG; hIFI44: TCCTGGTAACTCTCTTCTGCATA; hIFNB: hIFNB-FWD GCTTGGATTCCTACAAAGAAGCA; hIFNBREV: ATAGATGGTCAATGCGGCGTC; hHPRT-FWD: GACTTTGCTTTCCTTGGTCAG; hHPRT-REV GGCTTATATCCAACACTTCGTGGG; amplicons from RSAD2, IFIT1, and 18S PCRs were verified by Sanger sequencing. IFI44 and IFNB primers were from the Primer Bank (Wang et al., 2012), and HPRT primers were designed by IDT.
Statistical Analyses
[0311] Statistical analyses were carried out using Prism 8 (GraphPad Software Inc.). Every experiment was carried out in biological triplicate (except
Example 2: Sequence and Backbone-Dependent Effects of ASOs on TLR7/8 Sensing
[0312] The inventors initially investigated the activity of a panel of 11 2′OMe gapmer ASOs targeted to the mRNA of the innate immune sensor cGAS, on immune responses of undifferentiated THP-1 cells. Surprisingly, overnight pre-treatment with the ASOs led to strong potentiation of IP-10 and TNF-α production upon R848 stimulation of TLR7/8 in the cells, for select ASOs (e.g. ASO2, ASO9, ASO11, but not ASO4—
[0313] Interestingly, the inventors found that most ASOs strongly inhibited TLR7 sensing of R848, with the exception of ASO8 and ASO11, which were less potent inhibitors (
[0314] To define whether this effect of the ASOs on TLR7/8 was dependent on their backbone or base modifications, the inventors next studied a series of ASO variants based on the sequence of ASO2 (
[0315] Potentiation was not limited to the dual TLR7/8 agonist R848 and was also seen with CL075 (TLR8 agonist), Loxoribine (TLR7 agonist), and to some extent with Gardiquimod (TLR7 agonist) (
[0316] Similar to the effect observed on TLR7, the PS backbone was also necessary for TLR8 potentiation; it was not, however, sufficient for this effect by itself, since the TOME and LNA ASO2 variants were also synthesised on a PS backbone, and only limited potentiation was seen with the variant featuring the PS modification only (ASO2-PS). Collectively these results demonstrated that PS ASOs could display potent TLR7/8 immunomodulation, in a sequence-dependent manner.
TABLE-US-00001 TABLE 1 Various oligonucleotides used in this study (all in 5′-3′). UPPERCASE alone for DNA, ‘m’ indicates 2′OMe base, ‘/i2MOEr’ indicates 2′MOE base, ‘+’ indicates LNA base, and * denotes the phosphorothioate backbone. Cy3Sp denotes the Cy3 tag. FAM, HEX, ZEN, 3IABKFQ are qPCR probe modifications. SEQ ID Name Sequence NO. NC1 2OMe/PS mG*mC*mG*mU*mA*T*T*A*T*A*G*C*C*G*A*mU*mU*mA* 1 ASO mA*mC (Neg Cont) NC5 2OMe/PS mG*mC*mG*mA*mC*T*A*T*A*C*G*C*G*C*A*mA*mU*mA* 2 ASO mU*mG (Neg Cont) [cGAS]ASO1 mA*mU*mG*mG*mC*C*T*T*T*C*C*G*T*G*C*mC*mA*mA*m 3 G*mG [cGAS]ASO2 mU*mC*mC*mG*mG*C*C*T*C*G*G*A*A*G*C*mU*mC*mU* 4 mC*mU [cGAS]ASO3 mG*mC*mA*mU*mU*C*C*G*T*G*C*G*G*A*A*mG*mC*mC* 5 mU*mU [cGAS]ASO4 mG*mG*mC*mC*mG*A*A*C*T*T*T*C*C*C*G*mC*mC*mU* 6 mU*mA [CGAS]ASO5 mG*mG*mU*mC*mU*T*G*G*C*T*T*C*G*T*G*mG*mA*mG* 7 mC*mA [CGAS]ASO6 mG*mG*mA*mG*mC*T*T*C*G*A*G*G*C*C*C*mC*mA*mG* 8 mG*mC [cGAS]ASO7 mG*mG*mU*mG*mG*T*C*C*A*C*A*A*C*C*C*mC*mU*mU* 9 mU*mC [cGAS]ASO8 mC*mA*mU*mU*mA*G*G*T*G*C*A*G*A*A*A*mU*mC*mU 10 *mU*mC [cGAS]ASO9 mU*mU*mC*mU*mG*G*G*G*A*C*T*T*C*C*A*mG*mU*mU 11 *mU*mA [cGAS]ASO10 mU*mG*mA*mU*mU*C*C*A*A*A*G*C*C*A*G*mG*mG*mU 12 *mU*mA [cGAS]ASO11 mC*mU*mU*mU*mA*G*T*C*G*T*A*G*T*T*G*mC*mU*mU* 13 mC*mC ASO2-Cy3 mU*mC*mC*mG*mG*C*C*T*C*G*G*A*A*G*C*mU*mC*mU* 14 mC*mU/3Cy3Sp/ ASO2-PS T*C*C*G*G*C*C*T*C*G*G*A*A*G*C*T*C*T*C*T 15 ASO2-PO mUmCmCmGmGCCTCGGAAGCmUmCmUmCmU 16 ASO2-LNA +C*+G*+G*C*C*T*C*G*G*A*A*G*C*+T*+C*+T 17 ASO2-2MOE /52MOErT/*/i2MOErC/*/i2MOErC/*/i2MOErG/*/i2MOErG/*C*C 18 *T*C*G*G*A*A*G*C*/i2MOErT/*/i2MOErC/* /i2MOErT/*/i2MOErC/*/32MOErT/ ASO11-Mut1 mC*mU*mU*mU*mA*G*T*C*G*T*A*G*T*T*G*mU*mC*mU* 19 mC*mU ASO11-Mut2 mU*mC*mC*mG*mG*G*T*C*G*T*A*G*T*T*G*mC*mU*mU* 20 mC*mC ASO852 mC*mU*mC*mU*mC*T*T*T*C*T*G*T*G*G*T*mU*mU*mC* 21 mU*mC ASO852-dT mC*mU*mC*mU*mC*T*T*T*T*T*T*T*T*T*T*mU*mU*mC*m 22 U*mC ASO2504 mC*mC*mU*mA*mU*T*A*A*A*A*A*A*A*T*T*mU*mA*mU 23 *mA*mC ASO2504-Mut mC*mC*mU*mA*mU*T*T*T*C*T*G*T*G*G*T*mU*mA*mU* 24 mA*mC dT20 T*T*T*T*T*T*T*T*T*T*T*T*T*T*T*T*T*T*T*T 25 Hs HPRT F517 GACTTTGCTTTCCTTGGTCAG 26 Hs HPRT R591 GGCTTATATCCAACACTTCGTGGG 27 Hs HPRT P554 /56- 28 FAM FAM/ATGGTCAAG/ZEN/GTCGCAAGCTTGCTGGT/3IABKFQ/ Hs SFRS9 F594 GTCGAGTATCTCAGAAAAGAAGACA 29 Hs SFRS9 R690 CTCGGATGTAGGAAGTTTCACC 30 Hs SFRS9 P625 /5HEX/ATGCCCTGC/ZEN/GTAAACTGGATGACA/3IABKFQ/ 31 HEX ODN 2006 T*C*G* T*C*G* T*T*T* T*G*T* C*G*T* T*T*T* G*T*C* 32 G*T*T ISD70-FWD CCA TCA GAA AGA GGT TTA ATA TTT TTG TGA GAC CAT 33 CGA AGA GAG AAA GAG ATA AAA CTT TTT TAC GAC T ISD70-REV AGT CGT AAA AAA GTT TTA TCT CTT TCT CTC TTC GAT 34 GGT CTC ACA AAA ATA TTA AAC CTC TTT CTG ATG G
Example 3: Screen to Identify ASOs with Low TLR7 Inhibition and High TLR8 Potentiation
[0317] The observation of TLR7 inhibition and TLR8 potentiation by select PS ASOs aligned with the previous reports that T-rich PS oligonucleotides could promote similar activities (Gorden et al., 2006; Jurk et al., 2006). However, the finding that some 2′ OMe ASO sequences had less inhibitory activity on TLR7 (e.g. ASO8 and ASO11) suggested that TLR7 inhibition promoted by the PS backbone may be counterbalanced in select 2′OMe gapmer ASOs. The inventors reasoned that defining the modalities of this activity could help design ASOs with reduced immunosuppressive activities towards TLR7. In addition, the observation that ASO11 was able to potentiate TLR8 sensing of R848 while preserving TLR7 activity, suggested that the activities on TLR7 and 8 were not governed by the same sequence determinants.
[0318] To characterize these observations further, the inventors screened a library of 192 2′OMe ASOs. It is noteworthy that these ASOs were designed to target 4 different transcripts (48 ASOs each), with a minimum of single base increments between the ASOs (Table 2). The screen was performed at two different ASO concentrations for each TLR and measured their impact on NF-κB luciferase induction by R848 in HEK-TLR7 and HEK-TLR8 cells (
[0319] In agreement with the initial panel of ASOs, the inventors found that the majority of ASOs used at 500 nM strongly suppressed TLR7 sensing. As such, 78% of the ASOs reduced R848 activity on TLR7 by more than 80%, and only 2 ASOs reduced TLR7 sensing by less than 40% at both concentrations (
TABLE-US-00002 TABLE 2 196 ASO screen data. The targeted gene names are provided in brackets (e.g. [EGFR]). ASOs were synthesised with the following modifications: UPPERCASE alone for DNA, ‘m’ indicates 2′OMe base modifications, and * denotes the phosphorothioate backbone. Averaged NF-κB- Luciferase data from each screen at indicated ASO concentration is given (using 1 μg/ml R848 co-stimulation). Underlined sequences from the PINT family were studied further in FIG. 3B and 3F. Sequences in black bold were used as 17 low TLR7 inhibitors and analysed with MEME for motif enrichment (along with [cGAS]ASO8 and ASO11) shown in FIG. 3A. [Transcript SEQ Name] and TLR8- TLR8- TLR7- TLR7- ID Reference Sequence 500 nM 100 nM 500 nM 100 nM NO. [CDKN2B- mG*mU*mC*mU*mC*T* 5.79 2.41 16.16 19.16 35 AS1]1240 A*C*T*G*T*T*A*C*C*m U*mC*mU*mG*mA [CDKN2B- mU*mU*mA*mA*mA*T* 6.43 3.96 15.33 25.66 36 AS1]132 A*A*T*C*T*A*G*T*T*m U*mG*mA*mA*mG [CDKN2B- mG*mU*mG*mU*mC*C* 1.60 1.33 12.24 18.05 37 AS1]1415 T*T*C*A*T*G*C*T*T*m U*mG*mG*mA*mU [CDKN2B- mA*mG*mA*mA*mA*G* 2.78 1.96 17.19 42.99 38 AS1]1519 A*A*G*C*A*A*A*G*A* mU*mU*mC*mA*mA [CDKN2B- mC*mC*mU*mA*mG*A* 4.94 3.58 24.37 57.20 39 AS1]1522 A*A*G*A*A*G*C*A*A* mA*mG*mA*mU*mU [CDKN2B- mG*mU*mC*mA*mA*A* 1.85 1.60 16.51 23.64 40 AS1]1528 C*C*T*A*G*A*A*A*G* mA*mA*mG*mC*mA [CDKN2B- mG*mA*mU*mU*mA*A* 1.48 0.73 15.20 21.92 41 AS1]1773 A*A*C*A*G*A*T*T*A* mA*mU*mA*mC*mA [CDKN2B- mG*mG*mA*mU*mU*A* 1.67 1.16 14.92 27.16 42 AS1]1774 A*A*A*C*A*G*A*T*T* mA*mA*mU*mA*mC [CDKN2B- mA*mG*mG*mA*mU*T* 2.63 2.19 58.42 36.28 43 AS1]1775 A*A*A*A*C*A*G*A*T* mU*mA*mA*mU*mA [CDKN2B- mG*mA*mG*mU*mU*C* 1.23 0.96 15.37 25.86 44 AS1]2108 T*T*C*G*T*A*G*G*C*m U*mU*mC*mU*mG [CDKN2B- mA*mG*mA*mU*mU*A* 6.26 3.02 19.91 37.10 45 AS1]2130 T*C*T*T*C*T*T*T*T*m A*mA*mU*mU*mU [CDKN2B- mA*mA*mG*mA*mU*T* 5.62 2.91 20.16 42.09 46 AS1]2131 A*T*C*T*T*C*T*T*T*m U*mA*mA*mU*mU [CDKN2B- mA*mA*mA*mG*mA*T* 5.04 2.96 24.62 49.28 47 AS1]2132 T*A*T*C*T*T*C*T*T*m U*mU*mA*mA*mU [CDKN2B- mA*mA*mA*mA*mG*A* 4.68 3.19 20.33 47.41 48 AS1]2133 T*T*A*T*C*T*T*C*T*m U*mU*mU*mA*mA [CDKN2B- mG*mA*mA*mA*mA*G* 1.87 1.31 18.57 34.44 49 AS1]2134 A*T*T*A*T*C*T*T*C*m U*mU*mU*mU*mA [CDKN2B- mU*mG*mU*mG*mA*A* 4.97 2.79 18.34 34.51 50 AS1]2137 A*A*G*A*T*T*A*T*C*m U*mU*mC*mU*mU [CDKN2B- mU*mU*mG*mU*mG*A* 1.94 1.05 19.49 35.02 51 AS1]2138 A*A*A*G*A*T*T*A*T*m C*mU*mU*mC*mU [CDKN2B- mC*mU*mU*mG*mU*G 6.02 3.89 49.18 85.33 52 AS1]2139 *A*A*A*A*G*A*T*T*A* mU*mC*mU*mU*mC [CDKN2B- mG*mG*mU*mG*mG*C* 0.98 0.80 16.65 39.07 53 AS1]2196 C*A*C*A*G*G*C*A*A* mC*mG*mU*mC*mA [CDKN2B- mA*mA*mG*mG*mU*G* 0.78 0.58 14.95 57.85 54 AS1]2198 G*C*C*A*C*A*G*G*C* mA*mA*mC*mG*mU [CDKN2B- mA*mG*mG*mC*mC*T* 4.66 2.19 21.33 44.73 55 AS1]2218 C*C*A*G*T*G*T*C*T*m U*mC*mU*mC*mC [CDKN2B- mC*mA*mG*mG*mC*C* 3.89 2.02 23.06 54.11 56 AS1]2219 T*C*C*A*G*T*G*T*C*m U*mU*mC*mU*mC [CDKN2B- mG*mU*mC*mC*mC*A* 2.17 1.05 12.54 19.01 57 AS1]2223 G*G*C*C*T*C*C*A*G*m U*mG*mU*mC*mU [CDKN2B- mC*mC*mA*mU*mG*T* 1.46 1.24 17.53 41.39 58 AS1]2227 C*C*C*A*G*G*C*C*T*m C*mC*mA*mG*mU [CDKN2B- mU*mC*mU*mC*mC*A* 9.17 3.41 21.16 43.45 59 AS1]2230 T*G*T*C*C*C*A*G*G*m C*mC*mU*mC*mC [CDKN2B- mG*mU*mC*mU*mC*C* 1.25 1.01 16.91 23.75 60 AS1]2231 A*T*G*T*C*C*C*A*G*m G*mC*mC*mU*mC [CDKN2B- mA*mG*mU*mC*mU*C* 2.28 1.64 14.11 35.77 61 AS1]2232 C*A*T*G*T*C*C*C*A*m G*mG*mC*mC*mU [CDKN2B- mC*mA*mG*mU*mC*T* 3.81 2.73 16.62 47.75 62 AS1]2233 C*C*A*T*G*T*C*C*C*m A*mG*mG*mC*mC [CDKN2B- mG*mC*mA*mG*mU*C* 2.25 1.79 13.30 20.30 63 AS1]2234 T*C*C*A*T*G*T*C*C*m C*mA*mG*mG*mC [CDKN2B- mA*mG*mC*mA*mG*T* 4.93 2.81 14.78 25.50 64 AS1]2235 C*T*C*C*A*T*G*T*C*m C*mC*mA*mG*mG [CDKN2B- mA*mA*mG*mC*mA*G* 2.62 1.79 15.46 35.69 65 AS1]2236 T*C*T*C*C*A*T*G*T*m C*mC*mC*mA*mG [CDKN2B- mA*mA*mA*mG*mC*A* 3.38 1.90 15.95 27.16 66 AS1]2237 G*T*C*T*C*C*A*T*G*m U*mC*mC*mC*mA [CDKN2B- mG*mU*mC*mG*mU*G* 3.24 2.12 14.09 27.52 67 AS1]368 G*C*A*A*A*T*A*G*T* mC*mC*mU*mA*mG [CDKN2B- mG*mG*mA*mG*mA*T* 1.67 1.05 15.77 26.34 68 AS1]442 C*A*G*A*T*G*A*G*A* mG*mG*mA*mG*mC [CDKN2B- mA*mG*mU*mG*mG*C* 4.48 2.24 16.83 41.95 69 AS1]495 A*C*A*T*A*C*C*A*C*m A*mC*mC*mC*mU [CDKN2B- mC*mU*mU*mC*mA*C* 7.23 2.26 25.10 55.01 70 AS1]568 A*T*C*C*A*A*G*A*C* mA*mG*mC*mA*mA [CDKN2B- mG*mU*mG*mU*mU*T* 1.88 1.31 18.82 23.63 71 AS1]611 T*T*A*A*T*T*T*T*G*m U*mA*mG*mA*mG [CDKN2B- mC*mA*mG*mU*mG*T* 6.73 3.18 45.63 62.68 72 AS1]613 T*T*T*T*A*A*T*T*T*m U*mG*mU*mA*mG [CDKN2B- mA*mU*mU*mU*mC*C* 4.09 2.06 16.15 32.05 73 AS1]626 A*C*A*T*G*C*C*C*A*m G*mU*mG*mU*mU [CDKN2B- mU*mA*mU*mU*mU*C* 3.87 2.77 15.14 30.54 74 AS1]627 C*A*C*A*T*G*C*C*C*m A*mG*mU*mG*mU [CDKN2B- mA*mA*mU*mU*mU*A* 5.02 3.29 21.11 46.75 75 AS1]645 A*A*G*C*A*T*G*A*A* mU*mA*mU*mU*mA [CDKN2B- mA*mA*mA*mA*mU*A* 0.71 0.86 19.79 68.45 76 AS1]79 A*G*G*G*G*A*A*T*A* mG*mG*mG*mG*mA [CDKN2B- mU*mA*mA*mA*mA*T* 1.30 1.28 20.64 40.95 77 AS1]80 A*A*G*G*G*G*A*A*T* mA*mG*mG*mG*mG [CDKN2B- mA*mU*mA*mU*mC*T* 5.89 2.55 18.61 47.52 78 AS1]831 G*C*T*G*C*C*C*A*C*m C*mU*mU*mC*mU [CDKN2B- mA*mA*mU*mA*mU*C* 4.45 1.79 20.07 43.66 79 AS1]832 T*G*C*T*G*C*C*C*A*m C*mC*mU*mU*mC [CDKN2B- mC*mU*mC*mU*mC*T* 12.67 3.82 61.82 92.33 80 AS1]852 T*T*C*T*G*T*G*G*T* mU*mU*mC*mU*mC [CDKN2B- mG*mU*mG*mG*mU*T* 0.83 0.59 15.50 21.58 81 AS1]924 A*A*G*T*A*C*A*T*G* mA*mG*mC*mU*mC [CDKN2B- mG*mG*mA*mC*mA*C* 2.62 1.13 20.92 45.77 82 AS1]965 T*T*A*G*C*T*G*T*T*m C*mC*mU*mC*mG [CTNNB1]12 mG*mG*mG*mU*mC*C* 1.95 1.18 1.57 33.47 83 12 A*C*C*A*C*T*A*G*C*m C*mA*mG*mU*mA [CTNNB1]12 mU*mC*mA*mU*mU*A* 7.84 4.22 6.03 65.47 84 34 T*A*T*T*T*A*C*T*A*m A*mA*mG*mC*mU [CTNNB1]12 mC*mU*mC*mA*mU*T* 7.60 3.46 5.53 93.53 85 35 A*T*A*T*T*T*A*C*T* mA*mA*mA*mG*mC [CTNNB1]12 mC*mA*mG*mA*mU*A 5.89 3.22 4.55 126.50 86 94 *G*C*A*C*C*T*T*C*A* mG*mC*mA*mC*mU [CTNNB1]14 mU*mC*mC*mA*mU*C 7.84 4.57 6.21 96.37 87 45 *C*C*T*T*C*C*T*G*T* mU*mU*mA*mG*mU [CTNNB1]15 mC*mU*mU*mA*mU*A* 6.45 2.78 4.61 74.91 88 48 A*T*T*A*T*T*G*C*A*m A*mG*mU*mG*mA [CTNNB1]15 mU*mC*mU*mU*mA*T* 7.36 4.58 5.97 110.24 89 49 A*A*T*T*A*T*T*G*C* mA*mA*mG*mU*mG [CTNNB1]15 mA*mC*mC*mC*mA*C* 6.80 2.74 4.77 65.83 90 75 T*T*G*G*C*A*G*A*C*m C*mA*mU*mC*mA [CTNNB1]15 mC*mA*mC*mC*mC*A 3.00 1.12 2.06 91.47 91 76 *C*T*T*G*G*C*A*G*A *mC*mC*mA*mU*mC [CTNNB1]15 mC*mC*mA*mC*mC*C* 2.23 0.99 1.61 86.93 92 77 A*C*T*T*G*G*C*A*G*m A*mC*mC*mA*mU [CTNNB1]15 mA*mC*mC*mA*mC*C* 5.55 1.71 3.63 63.40 93 78 C*A*C*T*T*G*G*C*A*m G*mA*mC*mC*mA [CTNNB1]16 mU*mG*mG*mC*mA*G* 3.26 1.73 2.49 50.44 94 42 G*C*T*C*A*G*T*G*A*m U*mG*mU*mC*mU [CTNNB1]16 mC*mU*mU*mG*mG*T* 3.77 2.15 2.96 79.82 95 78 G*T*C*G*G*C*T*G*G*m U*mC*mA*mG*mA [CTNNB1]16 mG*mG*mC*mC*mA*T* 0.86 0.82 0.84 35.92 96 92 C*T*C*T*G*C*T*T*C*m U*mU*mG*mG*mU [CTNNB1]17 mA*mC*mU*mG*mC*A* 5.59 2.96 4.28 73.17 97 03 T*T*C*T*G*G*G*C*C*m A*mU*mC*mU*mC [CTNNB1]20 mC*mA*mA*mU*mG*G* 5.40 2.50 3.95 73.67 98 71 G*A*G*A*A*T*A*A*A* mG*mC*mA*mG*mC [CTNNB1]20 mU*mC*mA*mA*mU*G* 7.05 3.97 5.51 68.89 99 72 G*G*A*G*A*A*T*A*A* mA*mG*mC*mA*mG [CTNNB1]20 mU*mU*mC*mA*mA*T* 6.41 3.03 4.72 32.94 100 73 G*G*G*A*G*A*A*T*A* mA*mA*mG*mC*mA [CTNNB1]21 mU*mU*mC*mU*mG*C* 7.56 4.06 5.81 42.72 101 36 A*G*C*T*T*C*C*T*T*m G*mU*mC*mC*mU [CTNNB1]22 mU*mG*mU*mG*mG*C* 3.61 1.57 2.59 47.10 102 52 T*T*G*T*C*C*T*C*A*m G*mA*mC*mA*mU [CTNNB1]23 mG*mU*mC*mC*mA*A* 3.61 1.96 2.78 32.61 103 41 G*A*T*C*A*G*C*A*G* mU*mC*mU*mC*mA [CTNNB1]24 mA*mC*mC*mC*mA*A* 4.62 2.29 3.45 70.66 104 39 G*G*C*A*T*C*C*T*G*m G*mC*mC*mA*mU [CTNNB1]24 mG*mG*mU*mC*mC*A 1.65 1.00 1.33 104.51 105 46 *T*A*C*C*C*A*A*G*G *mC*mA*mU*mC*mC [CTNNB1]24 mG*mG*mG*mU*mC*C* 1.85 1.08 1.46 47.61 106 47 A*T*A*C*C*C*A*A*G* mG*mC*mA*mU*mC [CTNNB1]24 mG*mG*mU*mG*mG*T* 1.78 1.11 1.44 75.57 107 79 G*G*C*C*A*C*C*C*A* mU*mC*mU*mC*mA [CTNNB1]25 mA*mG*mA*mU*mC*T* 3.15 1.89 2.52 55.37 108 16 G*G*C*A*G*C*C*C*A* mU*mC*mA*mA*mC [CTNNB1]25 mG*mC*mC*mC*mA*T* 2.41 1.46 1.94 31.68 109 45 C*C*A*T*G*A*G*G*T*m C*mC*mU*mG*mG [CTNNB1]27 mU*mC*mA*mA*mA*G* 7.84 4.27 6.06 64.39 110 42 T*A*T*A*T*A*C*C*T*m G*mU*mU*mU*mU [CTNNB1]31 mG*mC*mC*mG*mC*T* 3.29 2.00 2.64 70.52 111 1 T*T*T*C*T*G*T*C*T*m G*mG*mU*mU*mC [CTNNB1]33 mC*mA*mG*mA*mU*T* 4.38 2.76 3.57 80.81 112 95 A*C*A*A*T*T*A*A*T*m U*mA*mG*mA*mG [CTNNB1]34 mU*mU*mU*mA*mU*T* 6.77 3.68 5.23 53.38 113 01 C*A*G*A*T*T*A*C*A*m A*mU*mU*mA*mA [CTNNB1]34 mU*mC*mU*mA*mU*T* 7.84 4.61 6.22 92.76 114 45 T*G*T*C*T*A*T*T*T* mU*mA*mU*mA*mC [CTNNB1]34 mC*mA*mU*mA*mU*T* 5.60 2.31 3.95 108.39 115 76 A*A*A*A*A*G*G*A*A* mA*mC*mU*mA*mA [CTNNB1]34 mU*mU*mU*mU*mA*A* 7.17 3.67 5.42 59.36 116 83 G*C*A*T*A*T*T*A*A*m A*mA*mA*mG*mG [CTNNB1]34 mA*mU*mU*mU*mU*A* 5.91 2.37 4.14 47.01 117 84 A*G*C*A*T*A*T*T*A*m A*mA*mA*mA*mG [CTNNB1]34 mU*mA*mU*mU*mU*T* 6.24 2.61 4.43 62.33 118 85 A*A*G*C*A*T*A*T*T*m A*mA*mA*mA*mA [CTNNB1]34 mU*mU*mA*mU*mU*T* 7.17 2.97 5.07 41.46 119 86 T*A*A*G*C*A*T*A*T*m U*mA*mA*mA*mA [CTNNB1]34 mC*mU*mU*mA*mU*T* 6.72 2.88 4.80 123.13 120 87 T*T*A*A*G*C*A*T*A* mU*mU*mA*mA*mA [CTNNB1]34 mG*mC*mU*mU*mA*T* 5.17 1.90 3.53 41.08 121 88 T*T*T*A*A*G*C*A*T*m A*mU*mU*mA*mA [CTNNB1]34 mU*mG*mC*mU*mU*A* 6.87 2.73 4.80 66.36 122 89 T*T*T*T*A*A*G*C*A*m U*mA*mU*mU*mA [CTNNIB1]36 mC*mU*mC*mU*mU*G* 5.00 2.71 3.86 93.38 123 48 A*A*G*C*A*T*C*G*T*m A*mU*mC*mA*mC [CTNNB1]36 mC*mG*mA*mA*mU*G 5.93 3.01 4.47 104.39 124 97 *A*A*T*T*A*A*A*A*G* mU*mU*mU*mA*mA [CTNNB1]57 mG*mG*mA*mU*mC*T* 2.02 1.15 1.59 47.92 125 7 G*C*A*T*G*C*C*C*T*m C*mA*mU*mC*mU [CTNNB1]58 mA*mC*mU*mG*mU*G 4.97 3.43 4.20 99.81 126 9 *T*A*G*A*T*G*G*G*A *mU*mC*mU*mG*mC [CTNNB1]80 mC*mG*mU*mG*mU*C* 5.09 2.89 3.99 66.99 127 8 T*G*G*A*A*G*C*T*T*m C*mC*mU*mU*mU [CTNNB1]80 mG*mC*mG*mU*mG*T* 1.28 0.91 1.10 40.74 128 9 C*T*G*G*A*A*G*C*T*m U*mC*mC*mU*mU [CTNNB1]81 mU*mA*mG*mC*mG*T* 2.85 1.56 2.21 60.29 129 1 G*T*C*T*G*G*A*A*G* mC*mU*mU*mC*mC [CTNNB1]91 mG*mG*mG*mA*mA*A* 2.82 1.76 2.29 51.43 130 6 G*G*T*T*A*T*G*C*A*m A*mG*mG*mU*mC [EGFR]1010 mC*mU*mU*mG*mC*A* 4.70 3.06 3.88 28.14 131 C*G*T*G*G*C*T*T*C*m G*mU*mC*mU*mC [EGFR]1013 mG*mU*mC*mC*mU*T* 1.59 0.80 1.19 31.52 132 G*C*A*C*G*T*G*G*C* mU*mU*mC*mG*mU [EGFR]1014 mU*mG*mU*mC*mC*T* 6.13 2.61 4.37 62.73 133 T*G*C*A*C*G*T*G*G*m C*mU*mU*mC*mG [EGFR]1015 mG*mU*mG*mU*mC*C* 1.55 0.80 1.17 28.29 134 T*T*G*C*A*C*G*T*G*m G*mC*mU*mU*mC [EGFR]1016 mG*mG*mU*mG*mU*C* 1.58 0.88 1.23 72.16 135 C*T*T*G*C*A*C*G*T*m G*mG*mC*mU*mU [EGFR]1017 mA*mG*mG*mU*mG*T* 2.42 1.27 1.84 76.42 136 C*C*T*T*G*C*A*C*G*m U*mG*mG*mC*mU [EGFR]1018 mC*mA*mG*mG*mU*G* 3.41 1.95 2.68 55.43 137 T*C*C*T*T*G*C*A*C*m G*mU*mG*mG*mC [EGFR]1115 mG*mG*mG*mA*mC*A* 2.13 1.24 1.69 52.15 138 C*T*T*C*T*T*C*A*C*m G*mC*mA*mG*mG [EGFR]1224 mA*mA*mG*mG*mC*C* 2.54 1.49 2.02 31.16 139 C*T*T*C*G*C*A*C*T*m U*mC*mU*mU*mA [EGFR]1225 mC*mA*mA*mG*mG*C* 4.44 2.42 3.43 79.44 140 C*C*T*T*C*G*C*A*C*m U*mU*mC*mU*mU [EGFR]1226 mG*mC*mA*mA*mG*G* 4.33 2.55 3.44 33.01 141 C*C*C*T*T*C*G*C*A*m C*mU*mU*mC*mU [EGFR]2313 mC*mA*mC*mU*mG*G* 3.94 2.44 3.19 87.28 142 G*T*G*T*A*A*G*A*G* mG*mC*mU*mC*mC [EGFR]2790 mC*mU*mG*mU*mG*A* 5.24 3.44 4.34 53.32 143 T*C*T*T*G*A*C*A*T*m G*mC*mU*mG*mC [EGFR]2859 mU*mA*mG*mG*mC*A* 5.45 2.29 3.87 58.92 144 C*T*T*T*G*C*C*T*C*m C*mU*mU*mC*mU [EGFR]2874 mA*mU*mG*mC*mC*A* 2.49 1.16 1.83 29.28 145 T*C*C*A*C*T*T*G*A*m U*mA*mG*mG*mC [EGFR]3263 mA*mU*mC*mC*mA*C* 1.79 1.06 1.42 34.71 146 C*A*C*G*T*C*G*T*C*m C*mA*mU*mG*mU [EGFR]3266 mG*mG*mC*mA*mU*C* 1.53 0.85 1.19 34.94 147 C*A*C*C*A*C*G*T*C*m G*mU*mC*mC*mA [EGFR]3267 mC*mG*mG*mC*mA*T* 2.97 1.33 2.15 56.74 148 C*C*A*C*C*A*C*G*T*m C*mG*mU*mC*mC [EGFR]3268 mU*mC*mG*mG*mC*A* 2.37 1.39 1.88 53.73 149 T*C*C*A*C*C*A*C*G*m U*mC*mG*mU*mC [EGFR]3274 mU*mA*mC*mU*mC*G* 2.71 1.08 1.90 70.15 150 T*C*G*G*C*A*T*C*C*m A*mC*mC*mA*mC [EGFR]3275 mG*mU*mA*mC*mU*C* 2.11 1.25 1.68 31.46 151 G*T*C*G*G*C*A*T*C*m C*mA*mC*mC*mA [EGFR]335 mG*mU*mU*mA*mC*T* 1.93 1.17 1.55 32.34 152 C*G*T*G*C*C*T*T*G*m G*mC*mA*mA*mA [EGFR]3526 mC*mU*mU*mU*mU*G* 3.17 1.91 2.54 53.24 153 G*G*A*A*C*G*G*A*C* mU*mG*mG*mU*mU [EGFR]3652 mA*mC*mA*mG*mU*G* 5.02 2.73 3.88 47.65 154 T*T*G*A*G*A*T*A*C*m U*mC*mG*mG*mG [EGFR]3908 mG*mG*mG*mU*mA*T* 1.35 0.91 1.13 27.08 155 C*G*A*A*A*G*A*G*T* mC*mU*mG*mG*mA [EGFR]4705 mU*mG*mG*mG*mC*T* 2.93 1.92 2.42 36.11 156 G*G*A*A*T*C*C*G*A* mG*mU*mU*mA*mU [EGFR]4885 mG*mG*mA*mG*mA*T* 1.87 1.25 1.56 36.25 157 T*T*C*A*G*A*G*C*A*m G*mC*mU*mU*mC [EGFR]5094 mU*mU*mA*mC*mU*T* 5.74 2.27 4.00 34.97 158 T*A*A*A*A*G*C*A*A* mA*mA*mG*mG*mA [EGFR]5095 mU*mG*mA*mA*mG*T* 3.99 1.96 2.97 29.97 159 A*A*A*A*A*T*C*A*A* mU*mA*mG*mC*mG [EGFR]5101 mG*mU*mA*mA*mA*A* 3.82 1.62 2.72 29.11 160 A*G*C*T*T*T*T*G*A*m A*mG*mU*mG*mA [EGFR]5102 mU*mU*mG*mA*mA*G* 1.31 0.96 1.13 31.83 161 T*G*A*A*G*T*A*A*A* mA*mG*mG*mA*mG [EGFR]5103 mU*mU*mU*mU*mG*A* 7.84 4.09 5.96 78.92 162 A*G*T*G*T*T*T*A*A*m U*mA*mU*mU*mC [EGFR]5104 mG*mU*mA*mA*mA*A* 3.05 1.14 2.10 31.74 163 G*G*A*G*A*A*A*A*C* mU*mA*mU*mC*mU [EGFR]5105 mU*mU*mU*mG*mA*A* 5.70 2.58 4.14 35.25 164 G*T*G*A*A*G*T*A*A* mA*mA*mG*mG*mA [EGFR]5106 mU*mU*mU*mA*mC*G* 7.84 3.63 5.74 40.61 165 G*T*T*T*T*C*A*G*A*m A*mU*mA*mU*mC [EGFR]5107 mG*mA*mA*mG*mU*G* 0.78 0.57 0.67 35.65 166 A*A*G*T*A*A*A*A*G* mG*mA*mG*mA*mA [EGFR]5108 mA*mA*mA*mA*mG*G* 4.36 1.65 3.01 47.60 167 A*G*A*A*A*A*C*T*A* mU*mC*mU*mU*mC [EGFR]5110 mA*mA*mA*mA*mA*T* 3.90 1.32 2.61 71.09 168 T*A*C*T*T*T*A*A*A*m A*mG*mC*mA*mA [EGFR]5111 mA*mG*mU*mA*mA*A* 5.34 2.70 4.02 48.30 169 A*A*G*C*T*T*T*T*G*m A*mA*mG*mU*mG [EGFR]5112 mU*mU*mU*mU*mG*A* 6.17 3.08 4.62 51.65 170 A*G*T*G*A*A*G*T*A* mA*mA*mA*mG*mG [EGFR]5113 mG*mU*mA*mG*mA*G* 4.92 2.47 3.70 34.45 171 A*A*A*T*T*A*T*T*T*m U*mA*mG*mG*mA [EGFR]5114 mA*mA*mU*mU*mA*C* 5.13 2.07 3.60 77.10 172 T*T*T*A*A*A*A*G*C*m A*mA*mA*mA*mG [EGFR]5115 mU*mG*mU*mA*mG*A* 6.58 2.99 4.78 61.44 173 G*A*A*A*T*T*A*T*T*m U*mU*mA*mG*mG [EGFR]5118 mA*mU*mU*mA*mC*T* 5.43 2.17 3.80 42.87 174 T*T*A*A*A*A*G*C*A* mA*mA*mA*mG*mG [EGFR]5119 mU*mU*mU*mU*mU*G* 7.84 3.43 5.63 59.02 175 A*A*G*T*G*T*T*T*A*m A*mU*mA*mU*mU [EGFR]5120 mU*mA*mA*mA*mA*G* 3.93 1.69 2.81 58.22 176 G*A*G*A*A*A*A*C*T* mA*mU*mC*mU*mU [EGFR]5121 mC*mU*mU*mU*mU*G* 3.76 1.98 2.87 79.85 177 A*A*G*T*G*A*A*G*T* mA*mA*mA*mA*mG [EGFR]727 mA*mU*mG*mU*mC*C* 1.58 0.84 1.21 71.68 178 C*G*C*C*A*C*T*G*G*m A*mU*mG*mC*mU [LINC- mU*mC*mC*mC*mA*T* 10.88 3.95 17.01 43.08 179 PINT]101 C*C*C*T*T*C*T*G*C*m U*mG*mC*mC*mA [LINC- mG*mU*mC*mC*mC*A* 5.07 1.37 17.73 22.47 180 PINT]102 T*C*C*C*T*T*C*T*G*m C*mU*mG*mC*mC [LINC- mG*mG*mU*mC*mC*C* 1.87 1.28 16.85 20.75 181 PINT]103 A*T*C*C*C*T*T*C*T*m G*mC*mU*mG*mC [LINC- mU*mC*mU*mG*mG*T* 5.25 3.36 16.79 29.42 182 PINT]106 C*C*C*A*T*C*C*C*T*m U*mC*mU*mG*mC [LINC- mU*mC*mU*mC*mU*G* 11.42 5.44 33.24 78.25 183 PINT]108 G*T*C*C*C*A*T*C*C*m C*mU*mU*mC*mU [LINC- mC*mU*mC*mU*mC*T* 10.10 2.73 40.55 84.97 184 PINT]109 G*G*T*C*C*C*A*T*C* mC*mC*mU*mU*mC [LINC- mU*mC*mU*mC*mU*C* 11.27 3.68 20.35 43.82 185 PINT]110 T*G*G*T*C*C*C*A*T*m C*mC*mC*mU*mU [LINC- mU*mU*mC*mU*mC*T* 9.51 2.83 17.22 26.22 186 PINT]111 C*T*G*G*T*C*C*C*A*m U*mC*mC*mC*mU [LINC- mC*mU*mU*mC*mU*C* 9.21 2.92 22.69 56.20 187 PINT]112 T*C*T*G*G*T*C*C*C*m A*mU*mC*mC*mC [LINC- mC*mC*mU*mU*mC*T* 3.51 3.01 23.33 60.90 188 PINT]113 C*T*C*T*G*G*T*C*C*m C*mA*mU*mC*mC [LINC- mC*mC*mC*mU*mU*C* 8.12 2.60 18.76 49.59 189 PINT]114 T*C*T*C*T*G*G*T*C*m C*mC*mA*mU*mC [LINC- mA*mC*mC*mC*mU*T* 7.57 2.55 18.30 43.37 190 PINT]115 C*T*C*T*C*T*G*G*T*m C*mC*mC*mA*mU [LINC- mC*mA*mC*mC*mC*T* 5.97 1.85 27.63 73.30 191 PINT]116 T*C*T*C*T*C*T*G*G*m U*mC*mC*mC*mA [LINC- mU*mU*mA*mG*mC*T* 8.41 3.43 19.40 31.67 192 PINT]1222 C*C*T*T*G*C*C*T*C*m G*mU*mU*mC*mC [LINC- mG*mU*mC*mU*mC*C* 7.17 1.98 18.29 25.01 193 PINT]126 T*C*C*A*C*A*C*C*C*m U*mU*mC*mU*mC [LINC- mG*mG*mU*mC*mU*C* 3.72 1.29 19.32 23.66 194 PINT]127 C*T*C*C*A*C*A*C*C*m C*mU*mU*mC*mU [LINC- mG*mG*mG*mU*mC*T* 1.23 0.87 18.20 21.47 195 PINT]128 C*C*T*C*C*A*C*A*C*m C*mC*mU*mU*mC [LINC- mU*mC*mC*mC*mA*A* 13.35 3.70 19.85 40.79 196 PINT]1284 C*T*C*T*T*C*T*A*A*m C*mU*mC*mG*mU [LINC- mG*mC*mA*mA*mG*G* 2.69 1.45 17.16 19.99 197 PINT]1315 C*A*G*A*G*A*A*A*C* mU*mC*mC*mA*mG [LINC- mA*mA*mA*mU*mG*T* 1.56 1.45 15.38 46.45 198 PINT]148.1 C*C*T*G*G*C*C*C*T*m C*mA*mC*mU*mG [LINC- mG*mA*mU*mG*mG*T* 1.01 0.84 15.35 22.32 199 PINT]1497.1 T*C*C*A*G*T*C*C*C*m U*mC*mU*mU*mC [LINC- mC*mC*mU*mA*mU*T* 6.09 2.19 76.27 108.68 200 PINT]2504 A*A*A*A*A*A*A*T*T* mU*mA*mU*mA*mC [LINC- mU*mA*mU*mU*mC*A 10.13 4.47 45.95 87.12 201 PINT]2524 *T*A*T*T*T*T*T*A*T* mU*mU*mC*mA*mG [LINC- mU*mG*mC*mU*mA*T* 9.02 3.01 18.42 42.38 202 PINT]2527 T*C*A*T*A*T*T*T*T*m U*mA*mU*mU*mU [LINC- mU*mU*mG*mG*mC*C* 0.94 0.75 13.85 21.43 203 PINT]2673.1 T*G*T*G*G*A*T*G*C*m U*mU*mU*mG*mU [LINC- mU*mU*mU*mG*mA*A* 4.93 2.57 20.33 35.07 204 PINT]2690 A*T*T*C*A*G*A*A*G* mA*mU*mU*mU*mG [LINC- mU*mU*mU*mA*mU*A* 6.45 2.71 16.54 33.70 205 PINT]2754 T*T*A*C*A*A*A*G*C*m U*mA*mC*mU*mU [LINC- mC*mU*mU*mU*mA*T* 6.37 2.11 22.54 54.83 206 PINT]2755 A*T*T*A*C*A*A*A*G* mC*mU*mA*mC*mU [LINC- mA*mA*mA*mA*mG*T* 2.33 1.48 14.66 30.90 207 PINT]2811 G*G*G*A*A*A*T*A*A* mA*mG*mG*mU*mU [LINC- mA*mA*mA*mA*mA*G* 1.83 1.34 15.63 28.76 208 PINT]2812 T*G*G*G*A*A*A*T*A* mA*mA*mG*mG*mU [LINC- mU*mG*mA*mU*mG*A* 1.57 1.18 16.66 25.50 209 PINT]283.1 T*G*C*T*T*G*C*A*G*m G*mA*mG*mG*mC [LINC- mC*mA*mC*mU*mG*T* 4.86 2.67 18.87 58.13 210 PINT]2990 A*T*T*T*T*A*T*T*A*m C*mA*mG*mA*mA [LINC- mA*mG*mU*mU*mU*A* 5.28 3.06 17.44 37.64 211 PINT]3011 T*A*G*A*T*T*T*C*A*m A*mG*mU*mA*mG [LINC- mU*mG*mA*mC*mA*A* 2.57 1.31 18.59 36.68 212 PINT]384 A*A*C*A*A*T*A*A*T* mA*mA*mC*mA*mG [LINC- mG*mU*mU*mC*mA*G* 1.70 1.55 16.42 17.46 213 PINT]412 T*C*A*G*A*T*C*G*C*m U*mG*mG*mG*mA [LINC- mA*mA*mA*mG*mU*C* 2.72 1.62 18.78 45.57 214 PINT]450 A*A*A*A*A*G*A*A*A* mA*mA*mC*mU*mG [LINC- mU*mG*mU*mU*mU*C* 2.04 1.62 15.46 30.90 215 PINT]501 C*C*C*G*G*A*G*A*G* mC*mA*mA*mU*mG [LINC- mU*mG*mA*mC*mA*T* 4.34 1.73 15.98 33.56 216 PINT]523 T*T*C*G*T*G*G*C*T*m C*mC*mU*mA*mC [LINC- mA*mU*mG*mA*mC*A* 1.20 0.88 17.18 32.53 217 PINT]524.1 T*T*T*C*G*T*G*G*C*m U*mC*mC*mU*mA [LINC- mA*mG*mC*mC*mG*A* 3.73 2.54 17.17 27.70 218 PINT]587 A*C*A*G*A*A*G*G*A* mG*mC*mG*mU*mC [LINC- mG*mU*mC*mC*mG*T* 3.70 1.70 15.34 22.79 219 PINT]727.1 A*C*C*T*C*C*A*C*C*m C*mA*mC*mC*mG [LINC- mC*mA*mA*mG*mC*C* 4.44 2.74 23.97 45.20 220 PINT]83.1 C*C*A*G*C*G*T*T*C*m C*mU*mC*mC*mG [LINC- mC*mC*mC*mU*mA*A* 8.39 2.70 32.41 58.39 221 PINT]877 T*G*C*T*T*T*C*C*T*m C*mU*mC*mC*mA [LINC- mG*mC*mG*mU*mA*G* 4.12 1.86 18.79 27.23 222 PINT]935 T*T*T*C*T*C*T*T*C*m C*mU*mC*mC*mC [LINC- mU*mG*mG*mC*mG*T* 4.25 2.48 15.25 32.81 223 PINT]937.1 A*G*T*T*T*C*T*C*T*m U*mC*mC*mU*mC [LINC- mC*mC*mU*mU*mC*T* 3.71 1.45 33.74 85.57 224 PINT]94 G*C*T*G*C*C*A*A*G* mC*mC*mC*mC*mA [LINC- mC*mA*mU*mC*mC*C* 8.23 2.95 24.38 54.34 225 PINT]98 T*T*C*T*G*C*T*G*C*m C*mA*mA*mG*mC [LINC- mC*mC*mA*mU*mC*C* 5.67 2.38 17.14 52.57 226 PINT]99 C*T*T*C*T*G*C*T*G*m C*mC*mA*mA*mG R848 only 1.00 1.00 100.00 100.00 NT 0.20 0.07 13.17 26.54
Example 4: TLR7 Inhibition by 2′OMe ASOs can be Reverted by CUU Terminal Motifs
[0320] MEME motif discovery analysis (Bailey and Elkan, 1994) of 19 ASOs with lowest TLR7 inhibitory activity based on the above screens led to the observation that the 2′OMe regions of the ASOs exhibiting terminal 5′ and 3′ “C” bases were over-represented in 8 sequences, along with uridine residues (
[0321] Validation of the PINT family of ASOs in HEK293-TLR7 cells confirmed that ASO111 only was capable of blocking TLR7 activation by R848 in this family (
Example 5: TLR8 Potentiation is Driven by the Central DNA Region and the 5′ End of 2′OMe PS ASOs
[0322] The inventors also analysed the PINT family (ASO108-116) and [cGAS]ASO11 mutants for TLR8 potentiation. While two sequences were more potent (e.g. ASO108 and ASO110), most of the sequences displayed similar TLR8 potentiation, suggesting that the central region of these molecules was predominantly involved in TLR8 modulation (
[0323] In further support of a contribution for the 5′-end region of the ASOs, the inventors noticed that most of the top 20 potentiators of TLR8 sensing in our screen had a terminal 5′-U (14 out of 20), while occurrence of such terminal 5′-U was much less frequent among the bottom 20 potentiators (3 out of 20) (Table 2). Analyses of TLR8 potentiation on the 192 ASOs comparing sequences with or without terminal 5′-U confirmed a significantly increased potentiation of TLR8 sensing for sequences harbouring a terminal 5′-U (
[0324] The inventors also noted that the central 10-mer DNA region of the TLR8 potentiating ASO852 contained a central T-rich region (TTTCTGTGGT), while that of ASO2504 was A-rich (TAAAAAAATT). Comparison of the central DNA regions of the top and bottom 20 potentiators of TLR8 sensing confirmed a significant increased proportion of thymidine residues in the ASOs potentiating TLR8 sensing the most—with a median of 4 central thymidines (
Example 6: TLR8 Potentiation of R848 by ASOs Leads to IRF Activation
[0325] The capacity of ASO852-dT to strongly potentiate IP-10 production upon R848 sensing was confirmed in two other TLR8 expressing AML cell lines (MOLM13 and OCI-AML3;
[0326] To further support induction of an IRF-driven response, the inventors carried out RT-qPCR analyses of several IRF-driven genes including IFNB1, at 4 h after R848 stimulation of THP-1 cells. While little induction of IFIT1, RSAD2, IFI44 and IFNB1 was seen with R848 only, all these genes were significantly increased by co-stimulation with ASO852-dT (
[0327] Collectively these results suggested that ASO such as ASO852-dT facilitated activation of IRF-driven response otherwise only achievable with very high doses of R848.
Example 7: Identification of Gene-Targeting ASOs Potentiating TLR8 Sensing
[0328] The inventors next sought to establish proof-of-principle that bi-functional ASOs combining gene-targeting and TLR8 potentiation (while avoiding TLR7 inhibition) could be achieved. For this purpose, the inventors tested a panel of 48 2′OMe ASOs designed against the mRNA of the human HPRT gene.
[0329] Preliminary studies in HeLa cells suggested that 29 out of the 48 ASOs significantly reduced HPRT mRNA levels by at least 50% at 10 nM (
TABLE-US-00003 TABLE 3 HPRT-targeting ASO sequences. ASOs were synthesised with the following modifications: UPPERCASE alone for DNA, ′m′ indicates 2′OMe base modifications, and * denotes the phosphorothioate backbone. The 29 sequences used in FIG. 5 are in bold. [Transcript SEQ Name] and ID Reference Sequence NO. [HPRT]1027 mAmA*mUmC*mC*G*C*C*C*A*A*A*G*G*G*mA*mA*mC*mU* 227 mG [HPRT]1353 mG*mC*mU*mG*mA*C*A*A*A*G*A*T*T*C*A*mC*mU*mG*mG* 228 mU [HPRT]292 mA*mC*mG*mU*mU*C*A*G*T*C*C*T*G*T*C*mC*mA*mU*mA*m 229 A [HPRT]294 mA*mG*mA*mC*mG*T*T*C*A*G*T*C*C*T*G*mU*mC*mC*mA*m 230 U [HPRT]326 mG*mG*mC*mC*mU*C*C*C*A*T*C*T*C*C*T*mU*mC*mA*mU*m 231 C [HPRT]329 mG*mA*mUmG*mG*C*C*T*C*C*C*A*T*C*T*mC*mC*mU*mU*m 232 C [HPRT]330 mUmG*mA*mU*mG*G*C*C*T*C*C*C*A*T*C*mU*mC*mC*mU*m 233 U [HPRT]331 mG*mUmG*mA*mU*G*G*C*C*T*C*C*C*A*T*mC*mU*mC*mC*m 234 U [HPRT]332 mUmG*mU*mG*mA*T*G*G*C*C*T*C*C*C*A*mU*mC*mU*mC*m 235 C [HPRT]333 mA*mUmG*mU*mG*A*T*G*G*C*C*T*C*C*C*mA*mU*mC*mU*m 236 C [HPRT]334 mA*mA*mUmG*mU*G*A*T*G*G*C*C*T*C*C*mC*mA*mU*mC*m 237 U [HPRT]335 mC*mA*mA*mU*mG*T*G*A*T*G*G*C*C*T*C*mC*mC*mA*mU*m 238 C [HPRT]388 mA*mUmC*mC*mA*G*C*A*G*G*T*C*A*G*C*mA*mA*mA*mG* 239 mA [HPRT]475 mC*mU*mG*mG*mU*C*A*T*T*A*C*A*A*T*A*mG*mC*mU*mC*m 240 U [HPRT]489 mA*mU*mG*mU*mC*C*C*C*T*G*T*T*G*A*C*mU*mG*mG*mU*m 241 C [HPRT]551 mC*mU*mU*mC*mC*A*C*A*A*T*C*A*A*G*A*mC*mA*mU*mU*m 242 C [HPRT]660 mC*mUmUmC*mG*T*G*G*G*G*T*C*C*T*T*mU*mU*mC*mA*m 243 C [HPRT]661 mA*mC*mU*mU*mC*G*T*G*G*G*G*T*C*C*T*mU*mU*mU*mC*m 244 A [HPRT]662 mC*mA*mC*mU*mU*C*G*T*G*G*G*G*T*C*C*mU*mU*mU*mU* 245 mc [HPRT]663 mA*mC*mA*mC*mU*T*C*G*T*G*G*G*G*T*C*mC*mU*mU*mU*m 246 U [HPRT]664 mAmA*mC*mA*mC*T*T*C*G*T*G*G*G*G*T*mC*mC*mU*mU*m 247 U [HPRT]665 mC*mA*mA*mC*mA*C*T*T*C*G*T*G*G*G*G*mU*mC*mC*mU*m 248 U [HPRT]666 mC*mC*mA*mA*mC*A*C*T*T*C*G*T*G*G*G*mG*mU*mC*mC*m 249 U [HPRT]667 mUmC*mC*mA*mA*C*A*C*T*T*C*G*T*G*G*mG*mG*mU*mC*m 250 C [HPRT]668 mA*mU*mC*mC*mA*A*C*A*C*T*T*C*G*T*G*mG*mG*mG*mU*m 251 C [HPRT]669 mU*mA*mU*mC*mC*A*A*C*A*C*T*T*C*G*T*mG*mG*mG*mG*m 252 U [HPRT]692 mC*mA*mA*mA*mU*C*C*A*A*C*A*A*A*G*T*mC*mU*mG*mG*m 253 C [HPRT]732 mU*mA*mG*mU*mC*A*A*G*G*G*C*A*T*A*T*mC*mC*mU*mA*m 254 C [HPRT]847 mA*mU*mA*mG*mG*A*C*T*C*C*A*G*A*T*G*mU*mU*mU*mC*m 255 C [HPRT]950 mC*mU*mA*mA*mA*G*T*A*C*A*A*A*A*C*A*mG*mA*mU*mA*mA 256 [HPRT]1292 mA*mA*mC*mA*mC*T*A*C*T*A*A*A*A*T*A*mA*mU*mU*mC*mC 257 [HPRT]1335 mG*mU*mA*mA*mU*A*A*T*T*T*G*A*A*C*A*mA*mG*mU*mU*mG 258 [HPRT]1126 mC*mU*mA*mA*mU*A*T*A*T*C*T*T*C*T*C*mU*mU*mU*mA*mU 259 [HPRT]1123 mA*mU*mA*mU*mA*T*C*T*T*C*T*C*T*T*T*mA*mU*mU*mU*mC 260 [HPRT]225 mU*mU*mA*mG*mG*T*A*T*G*C*A*A*A*A*T*mA*mA*mA*mU*mC 261 [HPRT]1121 mA*mU*mA*mU*mC*T*T*C*T*C*T*T*T*A*T*mU*mU*mC*mU*mU 262 [HPRT]1194 mU*mA*mA*mU*mU*A*A*C*A*A*T*A*T*T*C*mA*mA*mU*mC*mA 263 [HPRT]939 mA*mA*mC*mA*mG*A*T*A*A*A*A*T*T*C*T*mU*mA*mG*mA*mA 264 [HPRT]944 mU*mA*mC*mA*mA*A*A*C*A*G*A*T*A*A*A*mA*mU*mU*mC*mU 265 [HPRT]1244 mUmC*mU*mU*mU*G*A*T*G*T*G*A*A*A*A*mU*mU*mG*mA*mC 266 [HPRT]1133 mU*mA*mA*mA*mA*A*A*C*T*A*A*T*A*T*A*mU*mC*mU*mU*mC 267 [HPRT]938 mA*mC*mA*mG*mA*T*A*A*A*A*T*T*C*T*T*mA*mG*mA*mA*mG 268 [HPRT]934 mA*mU*mA*mA*mA*A*T*T*C*T*T*A*G*A*A*mG*mA*mU*mA*mC 269 [HPRT]1135 mA*mU*mU*mA*mA*A*A*A*A*C*T*A*A*T*A*mU*mA*mU*mC*mU 270 [HPRT]1124 mA*mA*mU*mA*mU*A*T*C*T*T*C*T*C*T*T*mU*mA*mU*mU*mU 271 [HPRT]1134 mU*mU*mA*mA*mA*A*A*A*C*T*A*A*T*A*T*mA*mU*mC*mU*mU 272 [HPRT]1195 mA*mU*mA*mA*mU*T*A*A*C*A*A*T*A*T*T*mC*mA*mA*mU*mC 273
[0330] In addition, most ASOs significantly potentiated TLR8 sensing to varying degrees, with the exception of 4 HPRT ASOs (ASO329, ASO321, ASO333, ASO666) (
Example 8: TLR8 Potentiation—Modulation by 5′End Motifs
[0331] It has been previously observed that 2′OMe ASOs could potentiate TLR8 sensing of R848 through the sensing of the central 10 DNA bases, and that “T” rich regions were better potentiators (as seen with ASO-852 and its variant ASO-852dT) (
[0332] In addition, the inventors showed that changing the 5′end 2′OMe region of ASO11, to include the 5′UCCGG region of ASO2, led to a significant increase in TLR8 potentiation (
[0333] To directly implicate the role of 5′U/UC in the modulation of TLR8 sensing, the inventors next tested the effect of adding a terminal 2′OMe UC motif to an otherwise non-TLR8 potentiating ASOs. The first molecule the inventors tested was ASO1-UC, which is a 22 nt molecule with appended 5′UC motif (with 7 2′OMe bases on the 5′ end). While ASO1 did not potentiate TLR8 in HEKTLR8 or THP-1 cells, its 5′end variant significantly promoted TLR8 potentiation in both models (
[0334] The inventors also tested the effect of 5′end modification of ASO HPRT-660, which the inventors previously found was a strong potentiator of TLR8 (
[0335] To further these results, the inventors tested the effect of the same strategy on ASO2 LNA, which the inventors previously found did not potentiate TLR8 (
TABLE-US-00004 TABLE 4 Various oligonucleotides used in the below examples (all in 5′-3′). UPPERCASE alone for DNA, ‘m’ indicates 2′OMe base, ‘/12MOEr’ indicates 2′MOE base, ‘+’ indicates LNA base, and * denotes the phosphorothioate backbone. SEQ ID Name Sequence NO. ASO1-UC ImUmC*mA*mU*mG*mG*mC*C*T*T*T*C*C*G*T*G*C* 274 ImC*mA*mA*mG*mG ASO2 LNA +C*+G*+G*C*C*T*C*G*G*A*A*G*C*+T*+C*+T 275 ASO2-LNA mUmC*+C*+G*+G*C*C*T*C*G*G*A*A*G*C*+T*+C*+ 276 Mut1 T ASO2-LNA mC*mU*mU*+C*+G*+G*C*C*T*C*G*G*A*A*G*C*+T*+ 277 Mut2 C*+T*mU*mU*mC ASO 660 mC*mU*mUmC*mG*T*G*G*G*G*T*C*C*T*T*mU*mU* 278 mC*mA*mC ASO 660-Mut mG*mA*mA*mC*mG*T*G*G*G*G*T*C*C*T*T*mU*mU* 279 mC*mA*mC C2Mut-1 mG*mC*mG*mG*mU*A*T*C*C*A*T*G*T*C*C*mC*mA 280 *mG*mG*mC C2Mut1-PS G*C*G*G*T*A*T*C*C*A*T*G*T*C*C*C*A*G*G*C 281 C2Mut1-2OMe mG*mC*mG*mG*mU*mA*mU*mC*mC*mA*mU*mG*mU 282 *mC*mC*mC*mA*mG*mG*mC
Example 9: TLR8 Potentiation is not Limited to R848-Like Molecules
[0336] Previous reports have demonstrated that R848-dependent activation of TLR8 is reliant on its binding to a site where uridine is normally binding (Tanji et al., 2015) (referred to as site 1). On the other hand, degradation products of uridine-containing RNAs are binding to a second site of the TLR8 dimer (site 2), generally as short di-nucleotides (e.g. UG or UUG or CG) (Tanji et al., 2015).
[0337] Uridine residues in the short RNAs binding to site 2 are not essential for TLR8 activation by uridine/R848 binding to site 1 as sensing of TLR8 by PS-ssRNA41 (lacking uridine) along with the TLR13 ligand Sa19 (with a single uridine residue) was potentiated with uridine (Shibata et al., 2016). Interestingly, PS-polyA, polyC or polyG failed to potentiate TLR8 sensing of uridine—aligning with the structural data and rather suggesting binding to selective RNA motifs (Shibata et al., 2016).
[0338] Speculating that the present 2′OMe ASOs (or their degradation products) potentiated R848 sensing by binding to site 2 of TLR8, the inventors next tested whether 2′ OMe ASOs could potentiate TLR8 sensing of free uridine. In agreement with this, the inventors observed a sequence-specific TLR8 potentiation of uridine sensing with select 2′OMe (ASO 660, 852dT) and dT20, in HEK-TLR8 (with NF-κB-luciferase) and THP-1 cells (with IP-10) (
[0339] The inventors have previously shown that ASO potentiation of R848 sensing resulted in increased IRF activation (presumably IRF5 through TASL recruitment). In agreement with this, ASO-potentiation of uridine sensing by TLR8 resulted in RANTES-luciferase induction (in a sequence-specific manner—compare ASO 660 and ASO 660-Mut) (
[0340] Collectively these results confirm that TLR8 potentiation by 2′OMe ASOs is not limited to synthetic imidazoquinoline compounds and is also visible with natural uridine (which binds to site 1 of TLR8).
[0341] Importantly, since the effect of ASO 660 on R848 and uridine potentiation is entirely ablated by the substitution of its 5′ CUU motif with a GAA motif in ASO 660 Mut, the present results suggest that the short di-nucleotide required to potentiate TLR8 needs to originate from the 5′end of this ASO (with a similar finding for ASO1 and ASO1-UC). The importance of the CUU seen for potentiation in ASO 660 does not appear to be consistent with a role for RNase T2, which preferentially cleaved GU or AU motifs in ssRNAs (on both PS and phosphodiester backbone) (Greulich et al., 2019). Critically, the CUU motif in ASO 660 is in a 5′ mCmUmU/mCmG context (all 2′OMe).
[0342] LNA ASO2 Mut2 also contains a 5′ mCmUmU/+C+G context (where + is an LNA base). Since this does not result in TLR8 potentiation, the inventors speculate that the endonuclease necessary to release the CUU fragment is not effective in the context of an LNA base—noting that if the cleavage was operating at the 5′ mCmU/mU position, there would not be a difference of TLR8 potentiation between the LNA ASO2 Mut2 and ASO 660, which both have this sequence.
Example 10: TLR8 Potentiation by LNA and 2MOE Gapmer ASOs
[0343] The inventors previously demonstrated that gapmer ASO2 ASOs with LNA or 2′MOE modifications did not significantly potentiate TLR8 sensing of R848 (
[0344] To gain a broader insight into the effect of LNA and 2′MOE ASOs on TLR8 sensing, the inventors screened a panel of 91 LNA ASOs, and 76 2′MOE ASOs at 100 and 500 nM, in HEK-TLR8 cells treated with R848 (
[0345] For 2′MOE ASOs, the inventors found that TLR8 potentiation was greater than with LNA, but lesser than 2′OMe, with 50% ( 38/76) of the ASOs leading to >2 fold increased NF-κB luciferase at 500 nM, and with 34% ( 26/76) ASOs potentiating over 2 fold at 100 nM (
[0346] The inventors next sought to validate these results in repeat experiments in HEK TLR8 cells, using a few molecules from the screens. For LNA ASOs, the inventors confirmed that A7 and H11 significantly potentiated TLR8 sensing of R848 (
[0347] The inventors also validated the results from the 2′MOE screen in a preliminary experiment in HEK-TLR8 cells (
[0348] Since the 2′OMe and 2′MOE gapmer ASOs the inventors used have the same length/sequence and only differ by the nature of the bases used in the 5′ and 3′ 5 nt regions, these results suggest that the pattern of endonuclease cleavage is conserved (sequence targeting by the nuclease is not prevented), although probably less efficient for 2′MOE ASOs compared to 2′OMe ASOs.
TABLE-US-00005 TABLE 5 TLR7 and TLR8 modulation by LNA ASOs SEQ ID TLR8 TLR8 TLR7 TLR7 Well NO. Name Sequence 500 nM 100 nM 500 nM 100 nM A1 283 CTNN2B-311 LNA KL +C*+G*+C*T*T*T*T*C*T*G*T*C*T*+G*+G* 2.896068751 0.919880555 0.14185991 0.39318604 +T A10 284 HPRT LNA-665 V1 +A*+C*+A*C*T*T*C*G*T*G*G*G*G*+T*+C* 1.028907862 0.421771896 0.08615711 0.54796744 +C A11 285 HPRT LNA-332 V1 +T*+G*+A*T*G*G*C*C*T*C″C*C*A*+T*+C* 0.262861964 0.373889035 0.15275009 0.65650092 +T A12 286 HPRT LNA-330 V1 +A*+T″+G*G*C*C*T*C*C*C*A*T*C*+T*+C* 1.355861146 0.368856109 0.11716763 0.55013319 +C A2 287 CTNN2B-1575 LNA V1 +C*+C*+A*C*T*T*G*G*C*A*G*A*C*+C*+A* 1.212622978 0.633935484 0.46952034 0.76506387 +T A3 288 EGFR-2790 LNA KL +G*+T*+G*A*T*C*T*T*G*A*C*A*T*+G*+C* 1.806415165 0.583370618 0.06022367 0.43756054 +T A4 289 EGFR-1225 LNA V1 +A*+G*+G*C*C*C*T*T*C*G*C*A*C*+T*+T* 0.967416317 0.506563128 0.16370864 0.73745623 +C A5 290 CAMSAP1-1635 LNA +A*+C*+C*A*C*G*T*C*T*G*C*T*C*+T*+A* 4.259168003 0.933486362 0.53224953 1.07818714 KL +Å A6 291 CAMSAP1-4915 LNA +G*+C*+A*C*A*C*T*T*C*G*T*A*C*+C*+C* 1.091460322 0.318981952 0.22110651 0.65677278 V1 +A A7 292 MB21D1-689 LNA KL +A*+A*+C*C*C*C*T*T*T*C*A*C*C*+A*+T* 8.653942007 1.871330912 0.42631118 0.77147456 +C A8 293 MB21D1-525 LNA V1 +G*+A*+G*G*T*C*T*T*G*G*C*T*T*+C*+G* 0.641705492 0.573508016 0.06662907 0.79308061 +T A9 294 HPRT LNA-388 KL +C*+C*+A*G*C*A*G*G*T*C*A*G*C*+A*+A* 1.499436456 0.411543502 0.94211591 1.10083724 +A B1 295 CTNN2B-916 LNA KL +G*+A*+A*A*G*G*T*T*A*T*G*C*A*+A*+G* 4.109748834 1.156212285 0.10098192 0.16623017 +G B10 296 HPRT LNA-333 V1 +G*+T*+G*A*T*G*G*C*C*T*C*C*C*+A*+T* 1.111733994 0.516764822 0.13894737 0.66514369 +C B11 297 HPRT LNA-335 V1 +A*+T*+G*T*G*A*T*G*G*C*C*T*C*+C*+C* 1.839717337 0.637113907 0.12778074 0.49883046 +A B12 298 HPRT LNA-660 V1 +T*+C*+G*T*G*G*G*G*T*C*C*T*T*+T*+T* 2.965725774 0.778445594 0.31788966 0.54005514 +C B2 299 CTNN2B-808 LNA V1 +T*+G*+T*C*T*G*G*A*A*G*C*T*T*+C*+C* 0.871122112 0.600080893 0.27787327 0.49453053 +T B3 300 EGFR-3652 LNA KL +A*+G*+T*G*T*T*G*A*G*A*T*A*C*+T*+C* 0.599083955 0.427018507 0.11539072 0.55864079 +G B4 301 EGFR-1015 LNA V1 +G*+T*+C*C*T*T*G*C*A*C*G*T*G*+G*+C* 0.935849795 0.570390577 0.25053206 0.47146409 +T B5 302 CAMSAP1-1739 LNA +T*+A″+C*T*T*T*C*C*G*A*G*G*T*+G*+T* 1.585109868 0.417240354 0.4512019 0.73846497 KL +C B6 303 CAMSAP1-5594 LNA +G*+G*+C*T*C*G*G*C*T*T*G*C*C*+T*+A* 0.706148377 0.373742513 0.18619377 0.56938527 V1 +C B7 304 MB21D1-719 LNA KL +G*+C*+A*C*T*T*C*A*G*T*C*T*G*+A*+G* 0.864230705 0.495364271 0.16817036 0.71281604 +C B8 305 MB21D1-523 LNA V1 +G*+G*+T*C*T*T*G*G*C*T*T*C*G*+T*+G* 1.385506297 0.616352872 0.04178645 0.48137976 +G B9 306 HPRT LNA-475 KL +G*+G*+T*C*A*T*T*A*C*A*A*T*A*+G*+C* 1.380898459 0.49999171 0.04874837 0.57983939 +T C1 307 CTNN2B-1294 LNA +G*+A*+T*A*G*C*A*C*C*T*T*C*A*+G*+C* 2.862783595 0.820558594 0.04949276 0.43379199 KL +A C10 308 HPRT LNA-667 V1 +C*+A*+A*C*A*C*T*T*C*G*T*G*G*+G*+G* 0.689536106 0.590755294 0.47631673 0.66256341 +T C11 309 HPRT LNA-334 V1 +T*+G*+T*G*A*T*G*G*C*C*T*C*C*+C*+A* 1.595846668 0.581865191 0.09010669 0.31544459 +T C12 310 HPRT LNA-669 V1 +T*+C*+C*A*A*C*A*C*T*T*C*G*T*+G*+G* 0.490756266 0.412601982 0.24944949 0.3182419 +G C2 311 CTNN2B-2545 LNA V1 +C*+C*+A*T*C*C*A*T*G*A*G*G*T*+C*+C* 1.168812131 0.674842397 0.64432531 0.99240168 +T C3 312 EGFR-3908 LNA KL +G*+T*A*T*C*G*A*A*A*G*A*G*T*+C*+T* 1.781012065 0.636606671 0.11343983 0.56243018 +G C4 313 EGFR-2874 LNA V1 +G*+C*+C*A*T*C*C*A*C*T*T*G*A*+T*+A* 0.681322005 0.440369427 0.12292291 0.67146076 +G C5 314 CAMSAP1-4295 LNA +G*+G*+T*T*A*C*G*G*C*T*C*A*G*+T*+A* 1.84782642 0.804379463 0.14008917 0.43785909 KL +T C6 315 CAMSAP1-4916 LNA +T*+G*+C*A*C*A*C*T*T*C*G*T*A*+C*+C* 0.369671442 0.411275899 0.29939644 0.80645801 V1 +C C7 316 MB21D1-1181 LNA KL +T*+C*+G*T*A*G*T*T*G*C*T*T*C*+C*+T* 1.582702591 0.556643844 0.19842456 0.38026667 +A C8 317 MB21D1-522 LNA V1 +G*+T*+C*T*T*G*G*C*T*T*C*G*T*+G*+G* 2.137051018 0.677910736 0.05637718 0.65162009 +A C9 318 HPRT LNA-489 KL +G*+T*+C*C*C*C*T*G*T*T*G*A*C*+T*+G* 0.303537628 0.3352112 0.12271748 0.55685117 +G D1 319 CTNN2B-2341 LNA +C*+C*+A*A*G*A*T*C*A*G*C*A*G*+T*+C* 2.91994853 1.014820046 0.69656948 0.8818727 KL +T D10 320 HPRT LNA-329 V1 +T*+G*+G*C*C*T*C*C*C*A*T*C*T*+C*+C* 1.127427243 0.495491714 0.21708902 0.87696501 +T D11 321 HPRT LNA-661 V1 +T*+T*+C*G*T*G*G*G*G*T*C*C*T*+T*+T* 3.144310898 0.620585256 0.17756599 0.48728787 +T D12 322 HPRT LNA-292 V1 +G*+T*+T*C*A*G*T*C*C*T*G*T*C*+C*+A* 4.128554096 1.068508653 0.11426897 0.45597999 +T D2 323 CTNN2B-1642 LNA V1 +G*+C*+A*G*G*C*T*C*A*G*T*G*A*+T*+G* 1.439533955 0.638180016 0.18884129 0.67647223 +T D3 324 EGFR-4705 LNA KL +G*+G*+C*T*G*G*A*A*T*C*C*G*A*+G*+T* 0.577088592 0.561637084 0.04131333 0.41656083 +T D4 325 EGFR-3267 LNA V1 +G*+C*+A*T*C*C*A*C*C*A*C*G*T*+C*+G* 0.738233723 0.607383649 0.08520819 0.55525442 +T D5 326 CAMSAP1-4697 LNA +T*+T*+T*T*G*G*C*T*G*G*G*A*T*+C*+A* 1.411677311 0.542417088 0.30542713 0.56354698 KL +A D6 327 CAMSAP1-2584 LNA +G*+C*+C*A*T*G*C*T*G*G*C*T*C*+G*+G* 0.363474708 0.446408939 0.17542771 0.6380256 V1 +A D7 328 MB21D1-1248 LNA KL +G*+C*+C*A*T*G*T*T*T*C*T*T*C*+T*+T* 0.431182656 0.430459006 0.02075046 0.81600703 +G D8 329 MB21D1-168 LNA V1 +C*+G*+G*C*C*T*C*G*G*A*A*G*C*+T*+C* 0.21857614 0.401507928 0.1389126 0.59401711 +T D9 330 HPRT LNA-551 KL +T*+C*+C*A*C*A*A*T*C*A*A*G*A*+C*+A* 0.89344393 0.474275592 0.53322126 0.86313802 +T E1 331 CTNN2B-3648 LNA +C*+T*+T*G*A*A*G*C*A*T*C*G*T*+A*+T* 3.888648608 0.959918056 0.0438927 0.36286553 KL +C E10 332 HPRT LNA-666 V1 +A*+A*+C*A*C*T*T*C*G*T*G*G*G*+G*+T* 0.882130479 0.496305985 0.44467195 0.89893562 +C E11 333 HPRT LNA-662 V1 +C*+T*+T*C*G*T*G*G*G*G*T*C*C*+T*+T* 4.366497579 1.097412417 0.23301734 0.68538279 +T E12 334 HPRT LNA pos cont +A*+G*+G*A*C*T*C*C*A*G*A*T*G*+T*+T* 1.034353241 0.278472837 0.29310899 0.43663496 +T E2 335 CTNN2B-2516 LNA V1 +A*+T*+C*T*G*G*C*A*G*C*C*C*A*+T*+C* 2.628295796 0.807587707 0.27890078 0.66285286 +A E3 336 EGFR-4885 LNA KL +A*+G*+Å*T*T*T*C*A*G*A*G*C*A*+G*+C* 0.77018825 0.401114395 0.0206294 0.43772578 +T E4 337 EGFR-1013 LNA V1 +C*+C*+T*T*G*C*A*C*G*T*G*G*C*+T*+T* 2.414242522 1.314579837 0.28128379 0.6172155 +C E5 338 CAMSAP1-6273 LNA +A*+A*+A*G*G*A*C*T*G*A*G*G*A*+A*+A* 2.662700169 0.881982649 0.26740807 0.51270535 KL +G E6 339 CAMSAP1-2709 LNA +T*+T*+C*A*G*G*C*G*C*T*G*C*C*+T*+T* 0.764329236 0.478887514 0.18055434 0.6416398 V1 +G E7 340 MB21D1-1483 LNA KL +T*+G*+A*C*T*G*T*C*T*T*G*A*G*+G*+G* 3.209604677 0.9725735 0.14999726 0.80240327 +T E8 341 MB21D1-520 LNA V1 +C*+T*+T*G*G*C*T*T*C*G*T*G*G*+A*+G* 0.593607406 0.458104857 0.09794609 0.30632843 +C E9 342 HPRT LNA-692 KL +A*+A*+T*C*C*A*A*C*A*A*A*G*T*+C*+T* 1.899545122 0.590751475 0.4326279 0.72655691 +G F1 343 CTNN2B-809 LNA V1 +G*+T*+G*T*C*T*G*G*A*A*G*C*T*+T*+C* 2.057291617 0.922865713 0.0668831 0.3554078 +C F10 344 HPRT LNA-664 V1 +C*+A*+C*T*T*C*G*T*G*G*G*G*T*+C*+C* 1.446145761 0.424556089 0.24003633 0.86814066 +T F11 345 HPRT LNA-331 V1 +G*+A*+T*G*G*C*C*T*C*C*C*A*T*+C*+T* 0.185915879 0.278358605 0.11903826 0.55812929 +C F12 346 NC1 LNA PS 3-10-3 +C*+G*+T*A*T*T*A*T*A*G*C*C*G*+A*+T* 0.716037601 0.396066198 0.22566078 0.75412488 +T F2 347 CTNN2B-2136 LNA V1 +C*+T*+G*C*A*G*C*T*T*C*C*T*T*+G*+T* 0.935994958 0.477630621 0.05267412 0.4668655 +C F3 348 EGFR-1014 LNA V1 +T*+C*+C*T*T*G*C*A*C*G*T*G*G*+C*+T* 0.601229377 0.491267464 0.48221215 0.81167637 +T F4 349 EGFR-1016 LNA V1 +T*+G*+T*C*C*T*T*G*C*A*C*G*T*+G*+G* 1.157848602 0.635917805 0.19903806 0.50221199 +C F5 350 CAMSAP1-2112 LNA +T*+C*+T*T*C*A*T*C*G*G*C*C*C*+T*+G* 1.393172852 0.595094771 0.51085066 0.81989598 V1 +C F6 351 CAMSAP1-2456 LNA +G*+T*+C*T*C*T*G*G*A*G*C*T*T*+C*+C* 2.401950564 0.76443429 0.08440541 0.47710507 V1 +T F7 352 MB21D1-521 LNA V1 +T*+C*+T*T*G*G*C*T*T*C*G*T*G*+G*+A* 0.196973894 0.5405367 0.28768075 1.0325815 +G F8 353 MB21D1-616 LNA V1 +A*+G*+C*T*T*C*G*A*G*G*C*C*C*+C*+A* 0.864508317 0.331485279 0.11099721 0.55425805 +G F9 354 HPRT LNA-732 KL +G*+T*+C*A*A*G*G*G*C*A*T*A*T*+C*+C* 2.301162835 0.543243053 0.14162734 0.65040068 +T G1 355 CTNN2B-2446 LNA V1 +T*+C*+C*A*T*A*C*C*C*A*A*G*G*+C*+A* 1.334008584 0.595023037 0.49364331 1.05617457 +T G10 356 HPRT LNA-668 V1 +C*+C*+A*A*C*A*C*T*T*C*G*T*G*+G*+G* 0.835058763 0.534877754 0.4460221 0.80831707 +G G11 357 HPRT LNA-294 V1 +A*+C*+G*T*T*C*A*G*T*C*C*T*G*+T*+C* 0.49347248 0.356093832 0.13623624 0.60093638 +C G12 358 NCS LNA PS 3-10-3 +G*+A*+C*T*A*T*A*C*G*C*G*C*A*+A*+T* 3.375696066 0.777122568 0.09759621 0.2817351 +A G2 359 CTNN2B-2479 LNA V1 +T*+G*+G*T*G*G*C*C*A*C*C*C*A*+T*+C* 0.604463097 0.463599487 0.39295731 0.9568601 +T G3 360 EGFR-3266 LNA V1 +C*+A*+T*C*C*A*C*C*A*C*G*T*C*+G*+T* 2.417304533 0.77840921 0.35333763 0.74095298 +C G4 361 EGFR-727 LNA V1 +G*+T*+C*C*C*G*C*C*A*C*T*G*G*+A*+T* 0.744775878 0.585159169 0.31080227 0.84335141 +G G5 362 CAMSAP1-2113 LNA +G*+T*+C*T*T*C*A*T*C*G*G*C*C*+C*+T* 2.086214626 0.663716035 0.11859632 0.64096423 V1 +G G6 363 CAMSAP1-2906 LNA +C*+C*+A*C*A*T*C*C*T*G*T*G*G*+C*+T* 0.232442282 0.291365866 0.36345034 0.78888908 V1 +C G7 364 MB21D1-524 LNA V1 +A*+G*+G*T*C*T*T*G*G*C*T*T*C*+G*+T* 1.953232965 0.596247374 0.05003212 0.45714258 +G G8 365 MB21D1-697 LNA V1 +T*+G*+G*T*C*C*A*C*A*A*C*C*C*+C*+T* 1.453569312 0.558507437 0.54529597 1.00843749 +T G9 366 HPRT LNA-1027 KL +T*+C*+C*G*C*C*C*A*A*A*G*G*G*+A*+A* 0.724923765 0.540879865 0.54271738 0.86013861 +C H1 367 CTNN2B-1576 LNA V1 +C*+C*+C*A*C*T*T*G*G*C*A*G*A*+C*+C* 1.865354601 0.898697761 0.63913972 1.02415107 +A H10 368 HPRT LNA-663 V1 +A*+C8+T*T*C*G*T*G*G*G*G*T*C*+C*+T* 3.672132066 0.819821652 0.73554308 0.80396669 +T H11 369 HPRT LNA-326 V1 +C*+C*+T*C*C*C*A*T*C*T*C*C*T*+T*+C* 6.75898779 1.46930113 0.84318021 0.75846825 +A H3 370 EGFR-2859 LNA V1 +G*+G*+C*A*C*T*T*T*G*C*C*T*C*+C*+T* 0.862488571 0.651706464 0.66841118 0.77430522 +T H5 371 CAMSAP1-1850 LNA +T*+G*+C*T*C*C*T*C*G*G*T*C*T*+C*+C* 3.77079461 1.097052718 0.59461451 0.75110463 V1 +C H7 372 MB21D1-526 LNA V1 +G*+G*+A*G*G*T*C*T*T*G*G*C*T*+T*+C* 0.882197694 0.574984194 0.11943028 0.5030592 +G H9 373 HPRT LNA-1353 KL +T*+G*+A*C*A*A*A*G*A*T*T*C*A*+C*+T* 1.756020752 0.633203821 0.42963559 1.04030631 +G NT 0.022710362 0 0 0 NT 0 0.004817336 0.0112819 0.03133982
TABLE-US-00006 SEQ ID Ref TLR8 TLR8 TLR7 TLR7 Well NO. ASO ID Sequence 500 nM 100 nM 500 nM 100 nM A1 374 HPRT-489 1648 /52MOErA/*/i2MOErT/*/i2MOErG/*/i2MOErT/*/i2MOErC/*C*C*C*T*G*T* 2.1177 1.7516 0.2239 0.4264 MOE 6361 T*G*A*C*/i2MOErT/*/i2MOErG/*/i2MOErG/*/i2MOErT/*/32MOErC/ 02488 16656 852 9646 4 A10 375 MB21D1- 1648 /52MOErC/*/i2MOErG/*/i2MOErG/*/i2MOErA/*/i2MOErG/*G*T*C*T*T*G* 3.2569 2.1970 0.1384 0.5046 525 MOE 6368 G*C*T*T*/i2MOErC/*/i2MOErG/*/i2MOErT/*/i2MOErG/*/32MOErG/ 51701 37799 1623 8096 1 A2 376 HPRT-666 1648 /52MOErC/*/i2MOErC/*/i2MOErA/*/i2MOErA/*/i2MOErC/*A*C*T*T*C*G* 1.1846 1.2229 0.3341 0.8557 MOE 6362 T*G*G*G*/i2MOErG/*/i2MOErT/*/i2MOErC/*/i2MOErC/*/32MOErT/ 11684 91859 1155 367 2 A3 377 CTNN2B- 1648 /52MOErG/*/i2MOErC/*/i2MOErC/*/i2MOErG/*/i2MOErC/*T*T*T*T*C*T* 0.3686 0.9676 0.2676 0.5671 311 MOE 6362 G*T*C*T*/i2MOErG/*/i2MOErG/*/i2MOErT/*/i2MOErT/*/32MOErC/ 07182 00353 0548 2124 8 A4 378 CTNN2B- 1648 /52MOErA/*/i2MOErC/*/i2MOErC/*/i2MOErC/*/i2MOErA/*C*T*T*G*G*C* 3.9845 2.8219 0.3362 0.4731 1575 MOE 6363 A*G*A*C*/i2MOErC/*/i2MOErA/*/i2MOErT/*/i2MOErC/*/32MOErA/ 37376 29166 1214 3049 6 A5 379 EGFR-2790 1648 /52MOErC/*/i2MOErT/*/i2MOErG/*/i2MOErT/*/i2MOErG/*A*T*C*T*T*G* 1.3869 1.3077 0.2061 0.4491 MOE 6364 A*C*A*T*/i2MOErG/*/i2MOErC/*/i2MOErT/*/i2MOErG/*/32MOErC/ 21689 86303 6041 5672 3 A6 380 EGFR-1225 1648 /52MOErC/*/i2MOErA/*/i2MOErA/*/i2MOErG/*/i2MOErG/*C*C*C*T*T*C* 1.2357 1.1151 0.3359 0.5870 MOE 6365 G*C*A*C*/i2MOErT/*/i2MOErT/*/i2MOErC/*/i2MOErT/*/32MOErT/ 1091 70978 088 7138 1 A7 381 CAMSAP1- 1648 /52MOErG/*/i2MOErA/*/i2MOErA/*/i2MOErC/*/i2MOErC/*A*C*G*T*C*T* 3.8270 2.7867 0.2911 0.5972 1635 MOE 6365 G*C*T*C*/i2MOErT/*/i2MOErA/*/i2MOErA/*/i2MOErC/*/32MOErA/ 21747 19553 8238 6395 8 A8 382 CAMSAP1- 1648 /52MOErT/*/i2MOErT/*/i2MOErG/*/i2MOErC/*/i2MOErA/*C*A*C*T*T*C* 1.9723 1.5546 0.2330 0.4184 4915 MOE 6366 G*T*A*C*/i2MOErC/*/i2MOErC/*/i2MOErA/*/i2MOErA/*/32MOErA/ 89171 51541 987 5047 6 A9 383 MB21D1- 1648 /52MOErA/*/i2MOErC/*/i2MOErA/*/i2MOErA/*/i2MOErC/*C*C*C*T*T*T* 14.807 8.8411 0.5329 0.5930 689 MOE 6367 C*A*C*C*/i2MOErA/*/i2MOErT/*/i2MOErC/*/i2MOErC/*/32MOErC/ 88512 74403 865 6383 3 B1 384 HPRT-732 1648 /52MOErT/*/i2MOErA/*/i2MOErG/*/i2MOErT/*/i2MOErC/*A*A*G*G*G*C* 2.0869 1.4568 0.1914 0.4228 MOE 6361 A*T*A*T*/i2MOErC/*/i2MOErC/*/i2MOErT/*/i2MOErA/*/32MOErC/ 83549 83526 825 9281 5 B10 385 MB21D1- 1648 /52MOErG/*/i2MOErA/*/i2MOErG/*/i2MOErG/*/i2MOErT/*C*T*T*G*G*C* 2.1637 1.8216 0.0950 0.4186 523 MOE 6368 T*T*C*G*/i2MOErT/*/i2MOErG/*/i2MOErG/*/i2MOErA/*/32MOErG/ 14713 12413 8383 4296 2 B2 386 HPRT-664 1648 /52MOErA/*/i2MOErA/*/i2MOErC/*/i2MOErA/*/i2MOErC/*T*T*C*G*T*G* 3.1666 2.7253 0.2255 0.4062 MOE 6362 G*G*G*T*/i2MOErC/*/i2MOErC/*/i2MOErT/*/i2MOErT/*/32MOErT/ 31079 1571 6347 2852 3 B3 387 CTNN2B- 1648 /52MOErG/*/i2MOErG/*/i2MOErG/*/i2MOErA/*/i2MOErA/*A*G*G*T*T*A* 3.5000 3.1170 0.1629 0.5987 916 MOE 6362 T*G*C*A*/i2MOErA/*/i2MOErG/*/i2MOErG/*/i2MOErT/*/32MOErC/ 94565 83061 7177 8077 9 B 388 CTNN2B- 1648 /52MOErC/*/i2MOErG/*/i2MOErT/*/i2MOErG/*/i2MOErT/*C*T*G*G*A*A* 1.2219 1.4757 0.3498 0.5410 4 808 MOE 6363 G*C*T*T*/i2MOErC/*/i2MOErC/*/i2MOErT/*/i2MOErT/*/32MOErT/ 18629 06482 7426 3881 7 B5 389 EGFR-3652 1648 /52MOErA/*/i2MOErC/*/i2MOErA/*/i2MOErG/*/i2MOErT/*G*T*T*G*A*G* 8.2607 5.6811 0.1290 0.4203 MOE 6364 A*T*A*C*/i2MOErT/*/i2MOErC/*/i2MOErG/*/i2MOErG/*/32MOErG/ 0467 83066 7231 6229 4 B6 390 EGFR-1015 1648 /52MOErG/*/i2MOErT/*/i2MOErG/*/i2MOErT/*/i2MOErC/*C*T*T*G*C*A* 1.2739 1.3828 0.2116 0.3771 MOE 6365 C*G*T*G*/i2MOErG/*/i2MOErC/*/i2MOErT/*/i2MOErT/*/32MOErC/ 43089 78135 4122 6937 2 B7 391 CAMSAP1- 1648 /52MOErC/*/i2MOErT/*/i2MOErT/*/i2MOErA/*/i2MOErC/*T*T*T*C*C*G* 4.8268 3.8915 0.3364 0.5880 1739 MOE 6365 A*G*G*T*/i2MOErG/*/i2MOErT/*/i2MOErC/*/i2MOErC/*/32MOErA/ 15355 60253 314 2627 9 B8 392 CAMSAP1- 1648 /52MOErT/*/i2MOErT/*/i2MOErG/*/i2MOErG/*/i2MOErC/*T*C*G*G*C*T* 0.8126 1.0957 0.2039 0.5228 5594 MOE 6366 T*G*C*C*/i2MOErT/*/i2MOErA/*/i2MOErC/*/i2MOErT/*/32MOErT/ 94026 79074 8071 6129 7 B9 393 MB21D1- 1648 /52MOErT/*/i2MOErC/*/i2MOErG/*/i2MOErC/*/i2MOErA/*C*T*T*C*A*G* 2.1576 1.6969 0.2408 0.5737 719 MOE 6367 T*C*T*G*/i2MOErT/*/i2MOErA/*/i2MOErC/*/i2MOErT/*/32MOErT/ 03307 36427 5556 9492 4 C1 394 HPRT-1027 1648 /52MOErA/*/i2MOErA/*/i2MOErT/*/i2MOErC/*/i2MOErC/*G*C*C*C*A*A* 4.6587 2.6847 0.5211 0.6911 MOE 6361 A*G*G*G*/i2MOErA/*/i2MOErA/*/i2MOErC/*/i2MOErT/*/32MOErG/ 94019 16338 4226 4382 6 C10 395 MB21D1- 1648 /52MOErA/*/i2MOErG/*/i2MOErG/*/i2MOErT/*/i2MOErC/*T*T*G*G*C*T* 5.0641 3.6560 0.1500 0.5470 522 MOE 6368 T*C*G*T*/i2MOErG/*/i2MOErG/*/i2MOErA/*/i2MOErG/*/32MOErC/ 85819 69399 9547 7524 3 C2 396 HPRT-668 1648 /52MOErA/*/i2MOErT/*/i2MOErC/*/i2MOErC/*/i2MOErA/*A*C*A*C*T*T* 1.5186 1.4366 0.6113 0.7582 MOE 6362 C*G*T*G*/i2MOErG/*/i2MOErG/*/i2MOErG/*/i2MOErT/*/32MOErC/ 17414 84222 1948 2197 4 C3 397 CTNN2B- 1648 /52MOErC/*/i2MOErA/*/i2MOErG/*/i2MOErA/*/i2MOErT/*A*G*C*A*C*C* 2.3561 1.7727 0.2536 0.4971 1294 MOE 6363 T*T*C*A*/i2MOErG/*/i2MOErC/*/i2MOErA/*/i2MOErC/*/32MOErT/ 39597 78484 8781 0558 0 C4 398 CTNN2B- 1648 /52MOErG/*/i2MOErC/*/i2MOErC/*/i2MOErC/*/i2MOErA/*T*C*C*A*T*G* 0.5410 0.8992 0.1240 0.3401 2545 MOE 6363 A*G*G*T*/i2MOErC/*/i2MOErC/*/i2MOErT/*/i2MOErG/*/32MOErG/ 93814 11795 3774 1914 8 C5 399 EGFR-3908 1648 /52MOErG/*/i2MOErG/*/i2MOErG/*/i2MOErT/*/i2MOErA/*T*C*G*A*A*A* 4.0729 3.1380 0.0788 0.3502 MOE 6364 G*A*G*T*/i2MOErC/*/i2MOErT/*/i2MOErG/*/i2MOErG/*/32MOErA/ 87366 70272 0296 5342 5 C6 40 EGFR-2874 1648 /52MOErA/*/i2MOErT/*/i2MOErG/*/i2MOErC/*/i2MOErC/*A*T*C*C*A*C* 2.0250 2.0278 0.3896 0.6675 MOE 6365 T*G*G*A*/i2MOErT/*/i2MOErA/*/i2MOErG/*/i2MOErG/*/32MOErC/ 68656 27004 4998 6568 3 C7 401 CAMSAP1- 1648 /52MOErT/*/i2MOErG/*/i2MOErG/*/i2MOErG/*/i2MOErT/*T*A*C*G*G*C* 1.5383 1.6104 0.1672 0.4265 4295 MOE 6366 T*C*A*G*/i2MOErT/*/i2MOErA/*/i2MOErT/*/i2MOErG/*/32MOErG/ 68652 1232 3544 4438 0 C8 402 CAMSAP1- 1648 /52MOErT/*/i2MOErT/*/i2MOErT/*/i2MOErG/*/i2MOErC/*A*C*A*C*T*T* 2.1994 1.8771 0.1182 0.2964 4916 MOE 6366 C*G*T*A*/i2MOErC/*/i2MOErC/*/i2MOErC/*/i2MOErA/*/32MOErA/ 03059 74993 7242 3805 8 C9 403 MB21D1- 1648 /52MOErA/*/i2MOErG/*/i2MOErT/*/i2MOErC/*/i2MOErG/*T*A*G*T*T*G* 5.8885 3.0913 0.2275 0.4935 1181 MOE 6367 C*T*T*C*/i2MOErC/*/i2MOErT/*/i2MOErA/*/i2MOErA/*/32MOErC/ 50496 11197 5577 0712 5 D1 404 HPRT-1353 1648 /52MOErG/*/i2MOErC/*/i2MOErT/*/i2MOErG/*/i2MOErA/*C*A*A*A*G*A* 3.0668 1.4746 0.1898 0.3746 MOE 6361 T*T*C*A*/i2MOErC/*/i2MOErT/*/i2MOErG/*/i2MOErG/*/32MOErG/ 07993 33705 4544 3868 7 D 405 MB21DI- 1648 /52MOErT/*/i2MOErC/*/i2MOErC/*/i2MOErG/*/i2MOErG/*C*C*C*T*G*G* 0.7811 0.8156 0.1657 0.4403 10 168 MOE 6368 A*A*G*C*/i2MOErT/*/i2MOErC/*/i2MOErT/*/i2MOErC/*/32MOErT/ 95498 62848 6699 4836 4 D2 406 HPRT-663 1648 /52MOErA/*/i2MOErC/*/i2MOErA/*/i2MOErC/*/i2MOErT/*T*C*G*T*G*G* 6.3195 4.7778 0.2345 0.4030 MOE 6362 G*G*T*C*/i2MOErC/*/i2MOErT/*/i2MOErT/*/i2MOErT/*/32MOErT/ 3664 96935 3617 6039 5 D3 407 CTNN2B- 1648 /52MOErG/*/i2MOErT/*/i2MOErC/*/i2MOErC/*/i2MOErA/*A*G*A*T*C*A* 3.3641 3.0205 0.1200 0.2978 2341 MOE 6363 G*C*A*G*/i2MOErT/*/i2MOErC/*/i2MOErT/*/i2MOErC/*/32MOErA/ 92508 32585 3911 145 1 D4 408 CTNN2B- 1648 /52MOErT/*/i2MOErG/*/i2MOErG/*/i2MOErC/*/i2MOErA/*G*G*C*T*C*A* 0.9733 1.0740 0.1672 0.4151 1642 MOE 6363 G*T*G*A*/i2MOErT/*/i2MOErG/*/i2MOErT/*/i2MOErC/*/32MOErT/ 63783 12499 2499 1519 9 D5 409 EGFR-4705 1648 /52MOErT/*/i2MOErG/*/i2MOErG/*/i2MOErG/*/i2MOErC/*T*G*G*A*A*T* 2.0580 1.4515 0.0954 0.2696 MOE 6364 C*C*G*A*/i2MOErG/*/i2MOErT/*/i2MOErT/*/i2MOErA/*/32MOErT/ 11094 0796 0912 3733 6 D6 410 EGFR-3267 1648 /52MOErC/*/i2MOErG/*/i2MOErG/*/i2MOErC/*/i2MOErA/*T*C*C*A*C*C* 0.9025 1.2494 0.2021 0.4850 MOE 6365 A*C*G*T*/i2MOErC/*/i2MOErG/*/i2MOErT/*/i2MOErC/*/32MOErC/ 89252 88975 7442 9335 4 D7 411 CAMSAP1- 1648 /52MOErG/*/i2MOErG/*/i2MOErT/*/i2MOErT/*/i2MOErT/*T*G*G*C*T*G* 6.3320 5.4963 0.1912 0.3461 4697 MOE 6366 G*G*A*T*/i2MOErC/*/i2MOErA/*/i2MOErA/*/i2MOErG/*/32MOErT/ 13893 20869 5347 2049 1 D8 412 CAMSAP1- 1648 /52MOErT/*/i2MOErT/*/i2MOErG/*/i2MOErC/*/i2MOErC/*A*T*G*C*T*G* 0.5724 0.8810 0.1379 0.4446 2584 MOE 6366 G*C*T*C*/i2MOErG/*/i2MOErG/*/i2MOErA/*/i2MOErC/*/32MOErT/ 76159 35052 6921 932 9 D9 413 MB21D1- 1648 /52MOErC/*/i2MOErC/*/i2MOErG/*/i2MOErC/*/i2MOErC/*A*T*G*T*T*T* 2.7134 1.9088 0.1386 0.4017 1248 MOE 6367 C*T*T*C*/i2MOErT/*/i2MOErT/*/i2MOErG/*/i2MOErG/*/32MOErA/ 20404 13233 6161 3954 6 E1 414 HPRT-665 1648 /52MOErC/*/i2MOErA/*/i2MOErA/*/i2MOErC/*/i2MOErA/*C*T*T*C*G*T* 1.6393 1.3200 0.2854 0.4870 MOE 6361 G*G*G*G*/i2MOErT/*/i2MOErC/*/i2MOErC/*/i2MOErT/*/32MOErT/ 20542 95465 1067 7527 8 E10 415 MB21D1- 1648 /52MOErG/*/i2MOErT/*/i2MOErC/*/i2MOErT/*/i2MOErT/*G*G*C*T*T*C* 3.5355 2.3825 0.0949 0.3718 520 MOE 6368 G*T*G*G*/i2MOErA/*/i2MOErG/*/i2MOErC/*/i2MOErA/*/32MOErG/ 19673 88073 4771 5677 5 E2 416 HPRT-332 1648 /52MOErT/*/i2MOErG/*/i2MOErT/*/i2MOErG/*/i2MOErA/*T*G*G*C*C*T* 0.9379 0.9404 0.2381 0.3121 MOE 6362 C*C*C*A*/i2MOErT/*/i2MOErC/*/i2MOErT/*/i2MOErC/*/32MOErC/ 20749 98388 8484 7493 6 E3 417 CTNN2B- 1648 /52MOErC/*/i2MOErT/*/i2MOErC/*/i2MOErT/*/i2MOErT/*G*A*A*G*C*A* 2.2003 1.6496 0.3411 0.6094 3648 MOE 6363 T*C*G*T*/i2MOErA/*/i2MOErT/*/i2MOErC/*/i2MOErA/*/32MOErC/ 47878 44484 4704 458 2 E4 418 CTNN2B- 1648 /52MOErA/*/i2MOErG/*/i2MOErA/*/i2MOErT/*/i2MOErC/*T*G*G*C*A*G* 4.4653 3.0685 0.2008 0.5002 2516 MOE 6364 C*C*C*A*/i2MOErT/*/i2MOErC/*/i2MOErA/*/i2MOErA/*/32MOErC/ 54523 53658 0114 2668 0 E5 419 EGFR-4885 1648 /52MOErG/*/i2MOErG/*/i2MOErA/*/i2MOErG/*/i2MOErA/*T*T*T*C*A*G* 4.3079 3.1223 0.0879 0.3301 MOE 6364 A*G*C*A*/i2MOErG/*/i2MOErC/*/i2MOErT/*/i2MOErT/*/32MOErC/ 19558 03239 8584 3617 7 E6 420 EGFR-1013 1648 /52MOErG/*/i2MOErT/*/i2MOErC/*/i2MOErC/*/i2MOErT/*T*G*C*A*C*G* 1.5932 1.9000 0.0884 0.2160 MOE 6365 T*G*G*C*/i2MOErT/*/i2MOErT/*/i2MOErC/*/i2MOErG/*/32MOErT/ 0093 18099 8914 6611 5 E7 421 CAMSAP1- 1648 /52MOErT/*/i2MOErC/*/i2MOErA/*/i2MOErA/*/i2MOErA/*G*G*A*C*T*G* 3.4057 3.8962 0.1888 0.3969 6273 MOE 6366 A*G*G*A*/i2MOErA/*/i2MOErA/*/i2MOErG/*/i2MOErG/*/32MOErG/ 01387 27028 8792 5722 2 E8 422 CAMSAP1- 1648 /52MOErG/*/i2MOErC/*/i2MOErT/*/i2MOErT/*/i2MOErC/*A*G*G*C*G*C* 0.6195 0.9849 0.1964 0.5272 2709 MOE 6367 T*G*C*C*/i2MOErT/*/i2MOErT/*/i2MOErG/*/i2MOErC/*/32MOErC/ 0615 38855 9181 735 0 E9 423 MB21D1- 1648 /52MOErA/*/i2MOErC/*/i2MOErT/*/i2MOErG/*/i2MOErA/*C*T*G*T*C*T* 3.1849 2.4543 0.2992 0.6274 1483 MOE 6367 T*G*A*G*/i2MOErG/*/i2MOErG/*/i2MOErT/*/i2MOErT/*/32MOErC/ 27454 50233 8598 7469 7 F1 424 HPRT-333 1648 /52MOErA/*/i2MOErT/*/i2MOErG/*/i2MOErT/*/i2MOErG/*A*T*G*G*C*C* 1.4288 0.9388 0.3448 0.6431 MOE 6361 T*C*C*C*/i2MOErA/*/i2MOErT/*/i2MOErC/*/i2MOErT/*/32MOErC/ 94886 0343 9638 0603 9 F10 425 MB21D1- 1648 /52MOErG/*/i2MOErG/*/i2MOErA/*/i2MOErG/*/i2MOErC/*T*T*C*G*A*G* 0.3804 0.7602 0.1791 0.3915 616 MOE 6368 G*C*C*C*/i2MOErC/*/i2MOErA/*/i2MOErG/*/i2MOErG/*/32MOErC/ 55178 78973 8249 3905 6 F2 426 HPRT-335 1648 /52MOErC/*/i2MOErA/*/i2MOErA/*/i2MOErT/*/i2MOErG/*T*G*A*T*G*G* 1.6772 1.5179 0.2789 0.4508 MOE 6362 C*C*T*C*/i2MOErC/*/i2MOErC/*/i2MOErA/*/i2MOErT/*/32MOErC/ 20354 48246 3557 0173 7 F3 427 CTNN2B- 1648 /52MOErG/*/i2MOErC/*/i2MOErG/*/i2MOErT/*/i2MOErG/*T*C*T*G*G*A* 0.4944 1.1790 0.1335 0.4145 809 MOE 6363 A*G*C*T*/i2MOErT/*/i2MOErC/*/i2MOErC/*/i2MOErT/*/32MOErT/ 61834 3471 7737 2378 3 F4 428 CTNN2B- 1648 /52MOErT/*/i2MOErT/*/i2MOErC/*/i2MOErT/*/i2MOErG/*C*A*G*C*T*T* 2.4077 2.0486 0.0593 0.1828 2136 MOE 6364 C*C*T*T*/i2MOErG/*/i2MOErT/*/i2MOErC/*/i2MOErC/*/32MOErT/ 13432 65177 9581 7457 1 F5 429 EGFR-1014 1648 /52MOErT/*/i2MOErG/*/i2MOErT/*/i2MOErC/*/i2MOErC/*T*T*G*C*A*C* 1.4326 1.1873 0.0568 0.0286 MOE 6364 G*T*G*G*/i2MOErC/*/i2MOErT/*/i2MOErT/*/i2MOErC/*/32MOErG/ 59639 31153 6524 9936 8 F6 430 EGFR-1016 1648 /52MOErG/*/i2MOErG/*/i2MOErT/*/i2MOErG/*/i2MOErT/*C*C*T*T*G*C* 1.0187 1.5320 0.1311 0.3576 MOE 6365 A*C*G*T*/i2MOErG/*/i2MOErG/*/i2MOErC/*/i2MOErT/*/32MOErT/ 61564 76454 6798 4308 6 F7 431 CAMSAP1- 1648 /52MOErT/*/i2MOErG/*/i2MOErT/*/i2MOErC/*/i2MOErT/*T*C*A*T*C*G* 1.1777 1.3309 0.1852 0.3964 2112 MOE 6366 G*C*C*C*/i2MOErT/*/i2MOErG/*/i2MOErC/*/i2MOErC/*/32MOErT/ 29568 01789 2714 975 3 F8 432 CAMSAP1- 1648 /52MOErG/*/i2MOErA/*/i2MOErG/*/i2MOErT/*/i2MOErC/*T*C*T*G*G*A* 0.6834 0.8488 0.1698 0.4687 2456 MOE 6367 G*C*T*T*/i2MOErC/*/i2MOErC/*/i2MOErT/*/i2MOErC/*/32MOErT/ 04291 61193 508 4085 1 F9 433 MB21D1- 1648 /52MOErG/*/i2MOErG/*/i2MOErT/*/i2MOErC/*/i2MOErT/*T*G*G*C*T*T* 4.5960 3.3858 0.1705 0.4604 521 MOE 6367 C*G*T*G*/i2MOErG/*/i2MOErA/*/i2MOErG/*/i2MOErC/*/32MOErA/ 60449 15287 3262 9829 8 G1 434 HPRT-667 1648 /52MOErT/*/i2MOErC/*/i2MOErC/*/i2MOErA/*/i2MOErA/*A*A*C*T*T*C* 1.4321 1.1421 0.5781 0.9289 MOE 6362 G*T*G*G*/i2MOErG/*/i2MOErG/*/i2MOErT/*/i2MOErC/*/32MOErC/ 04366 99438 9082 2911 0 G10 435 MB21D1- 1648 /52MOErG/*/i2MOErG/*/i2MOErT/*/i2MOErG/*/i2MOErG/*T*C*C*A*C*A* 3.7000 2.1213 0.0969 0.6199 697 MOE 6368 A*C*C*C*/i2MOErC/*/i2MOErT/*/i2MOErT/*/i2MOErT/*/32MOErC/ 63727 41127 3604 5586 7 G3 436 CTNN2B- 1648 /52MOErG/*/i2MOErG/*/i2MOErT/*/i2MOErC/*/i2MOErC/*A*T*A*C*C*C* 2.1073 1.9012 0.0958 0.3639 2446 MOE 6363 A*A*G*G*/i2MOErC/*/i2MOErT/*/i2MOErT/*/i2MOErT/*/32MOErC/ 53214 17871 7341 6351 4 G4 437 CTNN2B- 1648 /52MOErG/*/i2MOErG/*/i2MOErT/*/i2MOErG/*/i2MOErG/*T*G*G*C*C*A* 0.873S 1.4914 0.1921 0.4797 2479 MOE 6364 C*C*C*A*/i2MOErT/*/i2MOErC/*/i2MOErT/*/i2MOErC/*/32MOErA/ 28497 12913 4453 7378 2 G5 438 EGFR-3266 1648 /52MOErG/*/i2MOErG/*/i2MOErC/*/i2MOErA/*/i2MOErT/*C*C*A*C*C*A* 1.5658 1.6185 0.0971 0.2157 MOE 6364 C*G*T*C*/i2MOErG/*/i2MOErT/*/i2MOErC/*/i2MOErC/*/32MOErA/ 7114 06125 6989 6031 9 G6 439 EGFR-727 1648 /52MOErA/*/i2MOErT/*/i2MOErG/*/i2MOErT/*/i2MOErC/*C*C*G*C*C*A* 1.7079 2.0287 0.1708 0.3971 MOE 6365 C*T*G*G*/i2MOErA/*/i2MOErT/*/i2MOErG/*/i2MOErC/*/32MOErT/ 82031 68596 5396 7936 7 G7 440 CAMSAP1- 1648 /52MOErG/*/i2MOErT/*/i2MOErG/*/i2MOErT/*/i2MOErC/*T*T*C*A*T*C* 1.0933 1.2471 0.1319 0.3712 2113 MOE 6366 G*G*C*C*/i2MOErC/*/i2MOErT/*/i2MOErG/*/i2MOErC/*/32MOErC/ 44915 02513 9722 7496 4 G8 441 CAMSAP1- 1648 /52MOErG/*/i2MOErT/*/i2MOErC/*/i2MOErC/*/i2MOErA/*C*A*T*C*C*T* 0.4928 0.9187 0.1189 0.2989 2906 MOE 6367 G*T*G*G*/i2MOErC/*/i2MOErT/*/i2MOErC/*/i2MOErG/*/32MOErT/ 97094 50444 2947 7614 2 G9 442 MB21D1- 1648 /52MOErG/*/i2MOErG/*/i2MOErA/*/i2MOErG/*/i2MOErG/*T*C*T*T*G*G* 5.2877 3.9755 0.0912 0.4337 524 MOE 6367 C*T*T*C*/i2MOErG/*/i2MOErT/*/i2MOErG/*/i2MOErG/*/32MOErA/ 57611 20288 4819 1803 9 H1 443 HPRT-329 1648 /52MOErG/*/i2MOErA/*/i2MOErT/*/i2MOErG/*/i2MOErG/*C*C*T*C*C*C* 1.6980 0.9786 0.3360 0.6776 MOE 6362 A*T*C*T*/i2MOErC/*/i2MOErC/*/i2MOErT/*/i2MOErT/*/32MOErC/ 23797 70686 5342 8814 1 H10 444 NC5 1576 /52MOErG/*/i2MOErC/*/i2MOErG/*/i2MOErA/*/i2MOErC/*A*A*T*A*C*G* 0.8830 1.0671 0.2942 0.9481 2′MOE 3543 C*G*C*A*/i2MOErA/*/i2MOErT/*/i2MOErA/*/i2MOErT/*/32MOErG/ 39592 59916 2227 7716 9 H3 445 CTNN2B 1648 /52MOErC/*/i2MOErA/*/i2MOErC/*/i2MOErC/*/i2MOErC/*A*C*T*T*G*G* 1.5020 1.4404 0.2270 0.6004 1576 MOE 6363 C*A*G*A*/i2MOErC/*/i2MOErC/*/i2MOErA/*/i2MOErT/*/32MOErC/ 65697 08915 2965 9629 5 H5 446 EGFR-2859 1648 /52MOErT/*/i2MOErA/*/i2MOErG/*/i2MOErG/*/i2MOErC/*A*C*T*T*T*G* 0.8844 0.7727 0.2051 0.4550 MOE 6365 C*T*T*C*/i2MOErC/*/i2MOErT/*/i2MOErT/*/i2MOErC/*/32MOErT/ 82754 87531 5584 184 0 H7 447 CAMSAP1- 1648 /52MOErG/*/i2MOErA/*/i2MOErT/*/i2MOErG/*/i2MOErC/*T*C*C*T*C*G* 1.9537 1.3917 0.1993 0.4525 1850 MOE 6366 G*T*C*T*/i2MOErC/*/i2MOErC/*/i2MOErC/*/i2MOErT/*/32MOErT/ 62836 56007 1744 4896 5 H8 448 NC1 1576 /52MOErG/*/i2MOErC/*/i2MOErG/*/i2MOErT/*/i2MOErA/*T*T*A*T*A*G* 2.7769 1.8830 0.2649 0.5652 2′MOE 3543 C*C*G*A*/i2MOErT/*/i2MOErT/*/i2MOErA/*/i2MOErA/*/32MOErC/ 93481 52499 1771 492 8 H9 449 MB21D1- 1648 /52MOErG/*/i2MOErC/*/i2MOErG/*/i2MOErG/*/i2MOErA/*G*G*T*C*T*T* 2.2264 1.5981 0.1535 0.4525 526 MOE 6368 G*G*C*T*/i2MOErT/*/i2MOErC/*/i2MOErG/*/i2MOErT/*/32MOErG/ 36415 5863 6207 2984 0 G11 NT 0.0598 0.0249 0.0144 47661 62066 466 G12 NT 0.0368 0.0134 0.0169 0.0028 60718 97566 8715 5387 H11 NT 0.1433 0.0887 0.0084 0.0488 565 29649 9868 9513 H12 NT 0 0.0182 0 0.0040 18026 5533
Example 11: TLR8 Potentiation Requires Co-Administration of Site 1 and Site 2 Ligands
[0349] In all the experiments to date, the inventors used a pre-treatment of the cells with their ASOs (˜30 min in HEKs—overnight in THP-1 cells), prior to R848 stimulation. Critically, the inventors always kept the ASOs in the supernatants during uridine or R848 stimulation. To better define whether de novo degradation of the oligonucleotides was required for the effect on R848, the inventors pre-incubated PS-dT20 with HEK-TLR8 cells, and then washed them off prior to R848 stimulation (
[0350] It is also noteworthy that the inventors noticed short incubation of their 2′OMe ASOs in THP-1 (˜2.5 h) strongly decreased their potentiating capacity compared to overnight incubation, but that this did not alter the effect of dT20 (
[0351] Collectively, these results suggest a negative correlation between ASO stability and TLR8 potentiation that requires further studies. Since 2′MOE potentiation of the HPRT 663-665 series appears to be similar to that of the 2′OMe, it indicates that 2′MOE ASOs are still processed in a similar fashion as 2′OMe (probably by the same nuclease), but probably less rapidly. This is consistent with the concept that 2′MOE ASOs are usually more potent at promoting mRNA down-regulation that 2′OMe ASOs—potentially partially relating to greater intracellular stability.
[0352] This could provide opportunities for the selection and design of ASOs potentiating TLR8 sensing of uridine or R848 for longer times—which would be of particular importance when the ASO and R848/udirine/site 1 agonist are not administered at the same time.
Example 12: TLR8 Potentiation of Co-Cultured Cells—and Implications in Cancer
[0353] Next, the inventors were interested to test whether a cell transfected with one of their 2′OMe ASOs potentiating TLR8 (using 852dT as a model), when co-cultured with phagocytes, could potentiate TLR8 sensing in phagocytes. The inventors reasoned that unprocessed ASOs or their degradation products could favor R848 sensing of TLR8, on the basis of a recent publication that showed that phagocytosis of apoptotic cells transfected with synthetic PS-modified DNA molecules resulted in phago-lysosomal delivery of the DNA in the phagocytes (Ahn et al., 2018).
[0354] Here the inventors transfected HEK cells with 2′OMe ASO3 (non TLR8 potentiating) or 852dT (strongly potentiating TLR8), prior to UV treatment and co-culture with PMA-differentiated THP-1 overnight, before 24 h R848 stimulation (
[0355] These results suggest that the intracellular ASOs in HEKs (or their degradation products), found their way to the endosome of THP-1 cells to result in potentiation of TLR8 sensing.
[0356] This observation could have implications in the context of tumor targeting ASOs. As such, bi-functional ASOs with cancer cell killing activity and TLR8 potentiating activity, could also be taken up (or their degradation products) by closely surrounding phagocytes. When stimulated with uridine/R848 site 1 ligands, these tumor phagocytes could end up being strongly activated to promote recruitment of further immune cells, while also favoring MHC presentation of cancer cell peptides they would have engulfed. Critically, tumour phagocytes that are not directly engaged in phagocytosis of dying cancer cells (and do not have endosomal ASO degradation products and cancer epitopes to present) would not be strongly activated by R848.
Example 13: TLR8 Potentiation with Fully 2′OMe ASO
[0357] The inventors also tested the capacity of fully 2′OMe-modified ASOs (with no central DNA «gap») to potentiate TLR8. For this, the inventors compared the effect of ASO C2Mut1, and its variants either fully lacking 2′OMe (referred to as C2Mut1-PS), or fully 2′OMe modified (C2Mut1-20Me). These experiments showed that even in the absence of a central DNA region, this ASO was still significantly potentiating TLR8 (noting that this family of ASOs was not a strong potentiator compared to other sequences) (
Example 14: TLR7 Inhibition—Modulation by 5′End Motifs
[0358] The inventors also tested the mutant sequences (ASO1-UC, LNA ASO2-mut1 and mut2, and ASO 660/ASO 660-Mut) on TLR7 sensing of R848. In accord with their previous finding that 5′ terminal CUU motifs were important to limit TLR7 inhibition by 2′OMe ASOs, ASO 660-Mut (lacking its 5′ end mCmUmU motif) was significantly more inhibitory than ASO-660 (
Example 15: TLR7 Inhibition—Modulation by Base Modifications
[0359] The inventors have previously observed that ASO2 LNA or 2′MOE variants were strongly inhibiting TLR7 sensing (
[0360] For LNA ASOs, the inventors found that TLR7 inhibition was predominant, with only 85% ( 78/91) of the ASOs leading to 50% decreased NF-κB luciferase at 500 nM, and 52% ( 48/91) of the ASOs leading to 80% decreased NF-κB luciferase at that dose. Such TLR7 inhibition was however a bit less frequent than what the inventors observed for 2′OMe, for which >78% of the molecules inhibited TLR7 sensing by 80% fold at 500 nM (
[0361] For 2′MOE, the inventors found 95% ( 72/76) of the ASOs leading to 50% decreased NF-κB luciferase at 500 nM, and 54% ( 41/76) of the ASOs leading to 80% decreased NF-κB luciferase at that dose (
[0362] The inventors next sought to validate these results in repeat experiments, focusing on the ASOs that did not inhibit TLR7. Specifically, the inventors noted that the LNA ASOs A9, H11, D1, H1 all had a 5′+C+C motif (+ denotes LNA modification)—and that such motif was absent in all the strong TLR7 inhibitor (i.e. with >75% inhibition at 500 nM). The inventors also included A11, B1 and C11 that inhibited TLR7. Repeat experiments confirmed the trend of the screen, validating that LNA D1 and H11 did not significantly decrease NF-κB luciferase activity (noting that A9 rather slightly increased NF-κB luciferase, and H1 only mildly reduced it) (
[0363] For 2′MOE ASOs, the inventors only ran a single preliminary experiment that confirmed the decreased TLR7 inhibition with G1, A2, C1 and A9 (compared to the other ASO tested which, in this experiment, entirely ablated TLR7 signalling). Importantly, the inventors noted that sequences with single nucleotide increments E1 (665), A2 (666), and G1 (667) exhibited different effects on TLR7. As such, only A2 and G1 2′MOE ASOs had reduced TLR7 activity (suggesting the existence of a motif regulating TLR7 inhibition, similar to what the inventors found for 2′OMe ASOs). While warranting further confirmation, this is of particular interest because the same ASO series made with 2′OMe chemistry differently inhibited TLR7-666 and 667 2′OMe ASOs inhibited more TLR7 than 665 (
[0364] Collectively these results confirm that some sequences have the capacity to be less immunosuppressive on TLR7 than others with all three gapmer ASO chemistries.
[0365] It will be appreciated by persons skilled in the art that numerous variations and/or modifications may be made to the invention as shown in the specific embodiments without departing from the spirit or scope of the invention as broadly described. The present embodiments are, therefore, to be considered in all respects as illustrative and not restrictive.
[0366] All publications discussed and/or referenced herein are incorporated herein in their entirety.
[0367] Any discussion of documents, acts, materials, devices, articles or the like which has been included in the present specification is solely for the purpose of providing a context for the present invention. It is not to be taken as an admission that any or all of these matters form part of the prior art base or were common general knowledge in the field relevant to the present invention as it existed before the priority date of each claim of this application.
REFERENCES
[0368] Ahn et al., (2018) Cancer Cell 33:862-873 [0369] Alharbi et al., (2020) Nucleic Acids Research 48:7052-7065 [0370] Al Shaer et al. (2020) Pharmaceuticals (Basel) 13:40. [0371] Bailey and Elkan (1994) Proc Int Conf Intel Syst Mol Biol. 2:28-36. [0372] Bayik et al. (2016) Pharmacol Res. 105:216-225. [0373] Beignon et al. (2005) J Clin Invest. 115:3265-3275. [0374] Chow et al. (2018) J Immunol. 201:3036-3050. [0375] Coutinho et al. (2019) Adv Exp Med Biol. 1157:133-177. [0376] Esposito et al. (2018) Genes 9:529. [0377] Frazier (2015) Toxicol Pathol. 43:78-89. [0378] Gantier (2013) Methods Mol Biol. 942:79-191. [0379] Gantier et al. (2008) J Immunol. 180:2117-2124. [0380] Gantier and Williams (2010) Methods Mol Biol. 623:21-33. [0381] Greulich et al. (2019) Cell 179:1264-1275 [0382] Gursel et al. (2003) J Immunol. 171:1393-1400. [0383] Hamm et al. (2010) Immunobiology 215:559-569. [0384] Hope et al. (1998) Molecular Membrane Biology 15:1. [0385] Hornung et al. (2005) Nat Med. 11:263-270. [0386] Jurk et al. (2006) Eur J Immunol. 36:1815-1826. [0387] Kaminski et al. (2013) J Immunol. 191:3876-3883. [0388] Kariko et al. (2005) Immunity 23:165-175. [0389] Kleinman et al. (2008) Nature 452:591-597. [0390] Krieg et al. (1995) Nature 374:546-549. [0391] Lewis et al. (1996) Proc. Natl. Acad. Sci. USA 93:3176. [0392] Pelka et al. (2014) J Immunol. 193:3257-3261 [0393] Pepin et al. (2020) mBio. 11. [0394] Schafer et al. (1998) J Biol Chem. 273:2714-2720. [0395] Schmid-Burgk et al. (2014) Genome Res. 24:1719-1723. [0396] Shibata et al. (2016) International Immunology 28:211-222 [0397] Steinhagen et al. (2018) Eur J Immunol. 48:605-611. [0398] Tanji et al. (2015) Nature Structural & Molecular Biology 22:109-115 [0399] Toloue and Ford (2011) Methods Mol Biol 764:123-130. [0400] Wang et al. (2012) Nucleic Acids Res. 40:D1144-1149. [0401] Yin and Rogge (2019) Clin Transl Sci. 12:98-112.