SALMONELLA STRAIN FOR TREATING CANCER AND USE THEREOF

Abstract

The present invention relates to a Salmonella strain that selectively acts on cancer for the treatment of cancer, and a composition for preventing or treating cancer containing the same. In particular, the Salmonella strain according to the present invention has a tumor-suppressing effect, but has a significantly low viability in normal organs, and thus may have a significant anticancer effect compared to conventional inventions.

Claims

1. A Salmonella sp. mutant strain in which Salmonella pathogenicity island-1 (SPI-1) and Salmonella pathogenicity island-2 (SPI-2) are deleted.

2. The Salmonella sp. mutant strain according to claim 1, wherein the Salmonella pathogenicity island-1 (SPI-1) consists of the nucleotide sequence set forth in SEQ ID NO: 1.

3. The Salmonella sp. mutant strain according to claim 1, wherein the Salmonella pathogenicity island-2 (SPI-2) consists of the nucleotide sequence set forth in SEQ ID NO: 2.

4. The Salmonella sp. mutant strain according to claim 1, wherein the Salmonella sp. mutant strain is one into which a gene encoding an anticancer protein has been additionally introduced.

5. The Salmonella sp. mutant strain according to claim 4, wherein the anticancer protein is at least one selected from the group consisting of a toxin protein, an antibody specific for a cancer antigen or a fragment of the antibody, a tumor suppressor protein, an angiogenesis inhibitor, a cancer antigen, a prodrug-converting enzyme, and a pro-apoptotic protein.

6. The Salmonella sp. mutant strain according to claim 5, wherein the toxin protein is at least one selected from the group consisting of ricin, saporin, gelonin, momordin, debouganin, diphtheria toxin, Pseudomonas toxin, hemolysin (HlyA), FAS ligand (FASL), tumor necrosis factor-α (TNF-α), TNF-related apoptosis-inducing ligand (TRAIL), and cytolysin A (ClyA).

7. The Salmonella sp. mutant strain according to claim 6, wherein the cytolysin A consists of the nucleotide sequence set forth in SEQ ID NO: 15.

8. The Salmonella sp. mutant strain according to claim 5, wherein the tumor suppressor protein is at least one selected from the group consisting of retinoblastoma (RB) protein, p53 protein, adenomatous polyposis coli (APC) protein, phosphatase and tensin homologue (PTEN) protein, and cyclin dependent kinase inhibitor 2A (CDKN2A) protein.

9. The Salmonella sp. mutant strain according to claim 5, wherein the angiogenesis inhibitor is at least one selected from the group consisting of angiostatin, endostatin, thrombospondin, and protease inhibitory proteins.

10. The Salmonella sp. mutant strain according to claim 5, wherein the cancer antigen is at least one selected from the group consisting of α-fetoprotein (AFP), vascular endothelial growth factor receptor 2 (VEGFR2), Survivin, Legumain, and prostate cancer-specific antigen (PCSA).

11. The Salmonella sp. mutant strain according to claim 5, wherein the prodrug-converting enzyme is at least one selected from the group consisting of thymidine kinase, cytosine deaminase, nitroreductase, purine nucleoside phosphorylase, carboxypeptidase G2, chromate reductase YieF, herpes simplex virus type I thymidine kinase/ganciclovir (HSV1-TK/GCV), and β-glucuronidase.

12. The Salmonella sp. mutant strain according to claim 5, wherein the pro-apoptotic protein is L-ASNase or RNA-binding motif protein 5 (RBM5).

13. The Salmonella sp. mutant strain according to claim 1, wherein the Salmonella sp. mutant strain is derived from at least one selected from the group consisting of Salmonella typhimurium, Salmonella choleraesuis, Salmonella enteritidis, Salmonella infantis, Salmonella paratyphi, and Salmonella typhi.

14. The Salmonella sp. mutant strain according to claim 1, wherein the Salmonella sp. mutant strain is a mutant strain lacking ability to synthesize guanosine polyphosphate.

15. The Salmonella sp. mutant strain according to claim 1, wherein the Salmonella sp. mutant strain is at least one in which ppGpp synthase-encoding Salmonella-relA gene is inactivated, or Salmonella-spoT gene is inactivated.

16. A method for producing a Salmonella sp. mutant strain, the method comprising a step of removing Salmonella pathogenicity island-1 (SPI-1) and Salmonella pathogenicity island-2 (SPI-2) genes from a Salmonella sp. strain to obtain a transformed strain.

17-27. (canceled)

28. pharmaceutical composition for preventing or treating cancer, the pharmaceutical composition containing, as an active ingredient, the Salmonella sp. mutant strain according to claim 1.

29. (canceled)

30. A composition for diagnosing cancer, the composition containing, as an active ingredient, the Salmonella sp. mutant strain according to claim 1.

31. A method for providing information for diagnosing cancer, the method comprising a step of treating a biological sample, isolated from a subject of interest, with the strain according to claim 1.

32. The method according to claim 31, further comprising a step of diagnosing cancer when a reporter protein is expressed from the strain.

33. A method for preventing or treating cancer, the method comprising a step of administering to a subject an effective amount of the Salmonella sp. mutant strain according to claim 1.

34. The method according to claim 33, wherein the cancer is selected from the group consisting of melanoma, fallopian tube cancer, brain cancer, small intestine cancer, esophageal cancer, lymph adenocarcinoma, gallbladder cancer, blood cancer, thyroid cancer, endocrine adenocarcinoma, oral cancer, liver cancer, biliary tract cancer, colorectal cancer, rectal cancer, cervical cancer, ovarian cancer, kidney cancer, stomach cancer, duodenal cancer, prostate cancer, breast cancer, brain tumor, lung cancer, undifferentiated thyroid cancer, uterine cancer, colon cancer, bladder cancer, ureter cancer, pancreatic cancer, bone/soft tissue sarcoma, skin cancer, non-Hodgkin's lymphoma, Hodgkin's lymphoma, multiple myeloma, leukemia, myelodysplastic syndrome, acute lymphoblastic leukemia, acute myeloid leukemia, chronic lymphocytic leukemia, chronic myelogenous leukemia, and solitary myeloma.

Description

BRIEF DESCRIPTION OF DRAWINGS

[0113] FIG. 1 is a schematic view showing a method for constructing a pJH18 plasmid.

[0114] FIG. 2 is a graph showing the growth rates of recombinant strains containing the pJH18 plasmid.

[0115] FIG. 3 is a graph showing the growth rates of strains.

[0116] FIG. 4 shows the results of analyzing the expression of the reporter protein of each Salmonella strain.

[0117] FIG. 5 shows the results of imaging performed by adding coelenterazine to measure the luciferase activity in each cultured strain.

[0118] FIG. 6 is a graph showing the luciferase activity in each cultured strain.

[0119] FIG. 7 shows the results of measuring the degree of hemolytic activity of a strain against blood agar.

[0120] FIG. 8 is a graph showing the results of measuring ATP in cultures according to an example of the present invention.

[0121] FIG. 9 shows the results of analyzing the distribution of Salmonella in a mouse liver.

[0122] FIG. 10 shows the results of analyzing the distribution of Salmonella in a mouse tumor.

[0123] FIG. 11 shows a process of extracting a spleen from each strain-treated tumor animal model.

[0124] FIG. 12 shows the results of measuring the size of the spleen of each strain-treated tumor animal model.

[0125] FIG. 13 is a graph showing the results of measuring the weight of the spleen of each strain-treated tumor animal model.

[0126] FIG. 14 is a graph showing the tumor volume measured after inoculation of a CT26-injected tumor animal model with each of CNC18 as an embodiment of the present invention and PBS and SHJ2037 as controls.

[0127] FIG. 15 is a graph showing the results of analyzing the viability after inoculation of each strain in the CT26-injected tumor animal model.

[0128] FIG. 16 is a graph showing the tumor volume measured after inoculation of an MC38-injected tumor animal model with CNC18 as an embodiment of the present invention and PBS and SHJ2037 as controls.

[0129] FIG. 17 is a graph showing the results of analyzing the viability after inoculation of each strain in the MC38-injected tumor animal model.

[0130] FIG. 18 is a graph showing the results of measuring and comparing the proportion of leukocytes in a tumor after injecting each strain into a tumor animal model.

[0131] FIG. 19 is a graph showing the results of measuring and comparing the proportion of neutrophils in a tumor after injecting each strain into a tumor animal model.

[0132] FIG. 20 is a graph showing the results of measuring and comparing the proportion of natural killer cells in a tumor after injecting each strain into a tumor animal model.

[0133] FIG. 21 is a graph showing the results of measuring and comparing the proportion of CD8+ T cells in a tumor after injecting each strain into a tumor animal model.

[0134] FIG. 22 is a graph showing the results of measuring and comparing the proportion of dendritic cells in a lymph node after injecting each strain into a tumor animal model.

[0135] FIG. 23 is a graph showing the results of measuring and comparing the proportion of M2 macrophages in a tumor after injecting each strain into a tumor animal model.

[0136] FIG. 24 is a graph showing the results of measuring and comparing the proportion of regulatory T (Treg) cells in a tumor after injecting each strain into a tumor animal model.

[0137] FIG. 25 shows images obtained using an in vivo imaging system (IVIS) for tumors and organs extracted on day 1 after injection of each of SHJ2037lux and CNC18lux strains into a tumor animal model.

[0138] FIG. 26 shows images obtained using an in vivo imaging system (IVIS) for tumors and organs extracted on day 3 after injection of each of SHJ2037lux and CNC18lux strains into a tumor animal model.

[0139] FIG. 27 shows images obtained using an in vivo imaging system (IVIS) for tumors and organs extracted on day 5 after injection of each of SHJ2037lux and CNC18lux strains into a tumor animal model.

[0140] FIG. 28 shows images obtained using an in vivo imaging system (IVIS) after injection of each of SHJ2037lux and CNC18lux strains into a multiple myeloma animal model.

[0141] FIG. 29 shows images obtained using an in vivo imaging system (IVIS) after injection of each of SHJ2037lux and CNC18lux strains into a multiple myeloma animal model.

BEST MODE

[0142] According to an embodiment of the present invention, the present invention is directed to a Salmonella sp. mutant strain in which Salmonella pathogenicity island-1 (SPI-1) and Salmonella pathogenicity island-2 (SPI-2) are deleted.

Mode for Invention

[0143] Hereinafter, the present invention will be described in more detail with respect to examples. These examples are only for explaining the present invention in more detail, and it will be obvious to those of ordinary skill in the art that the scope of the present invention according to the subject matter of the present invention is not limited by these examples.

PREPARATION EXAMPLE 1

Construction of Attenuated Salmonella

[0144] An attenuated Salmonella strain of the present invention was constructed by using the SHJ2037 strain as a template and deleting a pathogenicity-related gene or gene cluster by homologous recombination using lambda (λ) phage.

[0145] Specifically, a DNA fragment having a Kan cassette at the position of the open reading frame of each gene was amplified by PCR using the pKD13 plasmid. The PCR primer sequences used for removal of a total of three genes (clusters) are shown in Table 1 below. The PCR product pKD46 was introduced into a Salmonella typhimurium SMR2130 (SHJ2037, DrelA, DspoT) suspension containing cells by an electroporation method, and colonies were selected by culturing in a kanamycin medium. Then, a pCP20 plasmid (Datsenko K A, et al., Proc Natl Acad Sci USA. 2000, June; 97(12):6640-5) was introduced into the transformed strains by electroporation, and the kan cassette was removed by FLP recombinase, thereby constructing strains.

TABLE-US-00001 TABLE 1 Primer sequence Primer sequence Mutant strain Gene (forward: 5′ .fwdarw. 3′) (reverse: 5′ .fwdarw. 3′) CNC16 hilD SEQ ID NO: 3 SEQ ID NO: 4 CNC17 SPI 1 SEQ ID NO: 5 SEQ ID NO: 6 CNC18 SPI 1 and 2 SEQ ID NO: 7 SEQ ID NO: 8

PREPARATION EXAMPLE 2

Construction of Recombinant Salmonella for Gene Expression

[0146] FIG. 1 is a schematic view showing a method for constructing a pJH18 plasmid. Using a pJL39 plasmid (Mol Ther., 21(11), p. 1985-1995, (2013)) as a template strand, a tetR gene was amplified using a forward primer (5′-CGGAATTCACCATGTCTAGATTAGATAAAAGTAAAGTGATTAACAG-3′; SEQ ID NO: 9) constructed to contain the restriction enzyme EcoRI site and a reverse primer (5′-GCTCTAGACAGCTGTTAAGACCCACTTTCACATTTAAGTTGTTTTTCT-3′; SEQ ID NO: 10) constructed to contain the restriction enzyme PvuII-XbaI site. Next, the amplification product was cleaved with the restriction enzymes EcoRI and XbaI and purified to obtain a tetR gene amplification product which was then introduced into a pBAD24 (Catalog No. ATCC® 87399™, ATCC, USA) plasmid, thereby constructing a pBAD-TetR plasmid.

[0147] Thereafter, through PvuII and HindIII fragments of the pJL39 plasmid, a divergent promoter region containing a multiple cloning site was introduced into the pBAD-TetR plasmid, thereby constructing a pTetR-BAD plasmid. Using NheI and Pcil restriction enzymes, the araC and araBAD promoters were removed from the pTetR-BAD plasmid, thereby constructing a pTetII plasmid.

[0148] In addition, the constitutive promoter OXB1, obtained by amplification using pSF-OXB1 (Oxford Genetics, England) as a template and a forward primer (5′-CTACTCCGTCAAGCCGTCAAGCTGTTGTGACCGCTTGCT-3; SEQ ID NO: 11) and a reverse primer (5′-TGAATTCCTCCTGCTAGCTAGTTGGTAACGAATCAGACGCCGGGTAATACCG GATAG-3′; SEQ ID NO: 12), was introduced into the pTetII plasmid by the Gibson assembly method, thereby constructing a pJH18 plasmid comprising the OXB1, tetA and tetR promoters.

[0149] Using the pJH18 plasmid as a template, the genes encoding Rluc8 and cytolysin A (ClyA) were introduced downstream of the promoters in the combination shown in FIG. 1, thereby constructing a pJH18-CR plasmid. Here, the cytolysin A (ClyA) gene was introduced using a forward primer (5′-AGTCCATGGTTATGACCGGAATATTTGC-3′ (SEQ ID NO: 13)) and a reverse primer (5′-GATGTTTAAACTCAGACGTCAGGAACCTC-3′ (SEQ ID NO: 14)).

PREPARATION EXAMPLE 3

Construction of Transformed Salmonella sp. Mutant Strain

[0150] The plasmid constructed in Preparation Example 2 was transformed by electroporation into the Salmonella strains constructed in Preparation Example 1, and then each of the transformed strains was cultured overnight using a lysogeny broth (LB) solid medium containing 100 μg/ml of ampicillin. Thereafter, the resulting colonies were cultured in LB liquid media containing ampicillin and used in the experiment. Table 2 below summarizes the transformed contents in the Salmonella sp. mutant strains constructed as described above.

TABLE-US-00002 TABLE 2 Mutant Inserted strain Deleted genes genes Comparative Example 1 SHJ2037 relA, spoT ClyA, Rluc8 Comparative Example 2 CNC16 relA, spoT, hilD ClyA, Rluc8 Comparative Example 3 CNC17 relA, spoT, SPI 1 ClyA, Rluc8 Preparation Example CNC18 relA, spoT, SPI 1, 2 ClyA, Rluc8

EXPERIMENTAL EXAMPLE 1

Evaluation of Protein Expression and Activity of Recombinant Salmonella

[1-1] Comparison of Growth Between of Salmonella Mutant Strains and Existing Strains

[0151] Each of the recombinant SHJ2037 and CNC18 colonies prepared in Comparative Example 1 and the Preparation Example was grown overnight in an LB liquid medium containing ampicillin, and then diluted at a ratio of 1:100 with a fresh LB medium and further cultured. When the OD.sub.600 value reached 0.5 to 0.7, doxycycline diluted with ethanol to a final concentration of 200 ng/ml was added to the cultures which were then cultured in a shaking incubator under conditions of 200 rpm and 37° C. The growth patterns of the strains were analyzed by measuring the OD.sub.600 value at different culture time points, and the results are shown in FIG. 2.

[0152] Meanwhile, the non-recombinant existing Salmonella colonies were treated in the same way as described above, and the results are shown in FIG. 3.

[0153] As shown in FIGS. 2 and 3, recombinant Salmonella CNC18 had little difference in growth rate from the existing attenuated Salmonella SHJ2037 and the wild-type Salmonella strain, and the growth thereof was not particularly inhibited even during protein expression using doxycycline. Therefore, it was confirmed that the deletion of the pathogenicity genes in the Salmonella strain constructed as described above did not affect the growth and gene expression of the Salmonella strain.

[1-2] Comparison of Protein Expression Levels by Western Blot Analysis

[0154] In order to compare the expression level of the cytolysin A (ClyA) gene between the recombinant Salmonella strains SHJ2037 and CNC18 constructed in Comparative Example 1 and the Preparation Example, expression of Rluc8 protein in the strains cultured as described in Experimental Example [1-1] was analyzed by Western blot analysis using an antibody specific to the protein.

[0155] Specifically, the cultures of each strain cultured in Experimental Example [1-1] was diluted with PBS to a concentration of 4×10.sup.7 CFU/ml and centrifuged at 13,000 rpm for 5 minutes, and the pellet fraction was collected. The pellet fraction was washed with PBS and mixed with an SDS sample buffer containing 0.2% β-mercaptoethanol (Catalog No. EBA-1052. ELPIS BIOTECH) to obtain a strain lysate. Thereafter, the strain lysate was electrophoresed on 12% SDS-PAGE gel, and the protein on the gel was transferred to a nitrocellulose membrane and blocked with 5% skim milk at room temperature. Thereafter, the expression level of the Rluc8 protein was analyzed using Rluc8 antibody (Catalog No. AB3256, Millipore, USA), and the results are shown in FIG. 4.

[0156] As shown in FIG. 4, it was confirmed that the two recombinant Salmonella strains SHJ2037 and CNC18 overexpressed the Rluc8 gene, and there was no significant difference in the expression level of the Rluc8 gene between the strains.

[1-3] Comparison of Functional Expression Level of Protein by Activity Assay

[0157] In order to measure the luciferase activity in the strains cultured in Experimental Example 1, each of the strains was resuspended in 1 ml of PBS. Next, 1 μg/ml of the substrate coelenterazine diluted in ethanol was added to the resuspended strain, and then the luciferase activity value in the strain was measured for an exposure time of 1 second using NightOWL II LB 983 In Vivo imaging system (Berthold technologies, GmbH & Co. KG, Germany) or Biorad Imager ChemoDoc™ XRS+ system. The measured value was normalized by the CFU of each strain, and the normalized value was calculated as relative luminescence units (RLUs), and the results are shown in FIG. 6.

[0158] As shown in FIG. 6, it was confirmed that the luciferase activity value was found only in the presence of doxycycline, and sensitivity to doxycycline and the maximum activity value were similar between the strains.

[0159] In addition, the PBS-diluted recombinant Salmonella strain selected in Preparation Example 3 was plated on a blood agar plate containing 0 or 20 ng/ml of doxycycline, and cultured overnight at 37° C., and the plates were imaged. The results are shown in FIG. 7.

[0160] As shown in FIG. 7, it was confirmed that the blood agar hemolytic activity of the strain appeared only in the case in which doxycycline for the gene encoding cytolysin A was included (+).

[0161] From the above results, it is confirmed that the recombinant Salmonella strain CNC18 according to the present invention can regulate cytolysin A (ClyA) gene expression and functions as an anticancer gene vehicle.

EXPERIMENTAL EXAMPLE 2

Examination of Release of DAMP Signals from Tumor Cells by Recombinant Salmonella Treatment

[0162] In order to evaluate the effects of the recombinant Salmonella strains on tumor cells, changes in damage-associated molecular patterns (DAMP) that can cause an immune response in the tumor cells treated with each of the SHJ2037 and CNC18 strains were examined. Among the DAMPs, ATP that is released extracellularly was measured. Specifically, the mouse CT26 colon cancer cell lines CRL-2638 and HB-8064 (ATCC, USA) were cultured with high-glucose DMEM (Dulbecco's Modified Eagles Medium) medium (catalog number: #LM 001-05, Welgene, Korea) containing 10% fetal bovine serum (FBS) and 1% penicillin-streptomycin in a 5% CO.sub.2 incubator at 37° C., and then the tumor cells were treated and co-cultured with the recombinant Salmonella. The ATP from each of the cultures was measured using an assay kit at different time points, and the results are shown in FIG. 8.

[0163] As shown in FIG. 8, it was confirmed that the ATP released from the tumor cells increased in the case of Salmonella treatment, indicating that the Salmonella strain itself according to the present invention may be used for tumor treatment.

EXPERIMENTAL EXAMPLE 3

Analysis of Distribution of Recombinant Salmonella in Small Animal Tumor Models

[0164] The attenuated Salmonella strain was injected into small animal mouse models, which are used in research on anticancer treatment, and the growth rate and distribution of the strain in the host were examined.

[0165] Specifically, four kinds of strains (SHJ2037, CNC16, CNC17, and CNC18) were each cultured in LB liquid medium, and then washed and diluted with PBS. Each of the strains was injected into the tail vein of each mouse to a final strain concentration is 2×10.sup.7 CFU/mouse, and 3 mice per strain were euthanized. Then, the organs of the host were extracted, minced, and diluted. Each dilution was plated and incubated on solid LB medium, and viable cells were counted. The results are shown in FIG. 9. In addition, mice bearing tumors were treated in the same way as described above, the tumors of the host were extracted, minced, and diluted, and plated and incubated on solid LB medium, viable cells were counted, and the results are shown in FIG. 10.

[0166] As a result, as shown in FIGS. 9 and 10, it was confirmed that the strain CNC18 died rapidly while showing very low viability in the liver, but remained in the tumor, indicating that it has a specific and selective targeting ability.

[0167] On the other hand, as shown in FIG. 9, it was confirmed that the strain CNC16 strain had a higher viability than the strain SHJ2037 in the liver, and had at least 100 times higher viability than the strain CNC18. That is, it was confirmed that the strain CNC16 has non-specific targeting ability in organs other than tumors.

[0168] In addition, CNC17 also showed higher viability than the strain SHJ2037 in the liver, indicating that the strain CNC17 also has non-specific targeting ability.

[0169] As shown in FIG. 10, the strain CNC17 had at least 10 times lower viability than the strain CNC18 in the tumor. That is, it was confirmed that the strain CNC17 had a lower effect than the strain CNC18 against tumors.

EXPERIMENTAL EXAMPLE 4

Analysis (1) of Hyperinflammatory Response upon Salmonella Injection

[0170] First, in order to examine the hyperinflammatory response upon Salmonella injection, nine CT26 tumor model mice were injected with the strains SHJ2037 and CNC18 and PBS, respectively (three mice per strain or PBS), and the weight of the spleen of each mouse was measured at different time points and compared. As shown in FIG. 11, each mouse was laparotomized, the spleen was removed therefrom, and the size of the spleen of each mouse was measured. The results are shown in FIG. 12.

[0171] As shown in FIG. 12, it was confirmed that the strain-treated groups had an increased spleen size compared to the PBS-treated control group, but the strain CNC18-treated group had a smaller spleen size than the strain SHJ2037-treated group, indicating that the Salmonella strain according to the present invention minimized the hyperinflammatory reaction.

EXPERIMENTAL EXAMPLE 5

Analysis (2) of Hyperinflammatory Response upon Salmonella Injection

[0172] In addition, in order to examine the hyperinflammatory response upon Salmonella injection, each of the strains SHJ2037, CNC16, CNC17 and CNC18 was injected to mouse in the same way as described in Experimental Example 4, and the weight of the spleen of each mouse was measured on days 1, 3, and 5 and compared.

[0173] As a result, as shown in FIG. 13, it was confirmed that the group treated with each of the strains SHJ2037, CNC16 and CNC17 had an increased spleen weight compared to the control group treated with PBS, but the CNC18 had the smallest increase in the spleen weight among the strain-treated groups.

[0174] From the above results, it was confirmed that the attenuated Salmonella strain according to the present invention died rapidly with a significantly decreased viability in all the normal organs from the initial stage of infection while maintaining strong tumor targeting ability, indicating the minimized side effects of the strain on the host.

EXPERIMENTAL EXAMPLE 6

Analysis (1) of Anticancer Effect of Attenuated Salmonella in Small Animal Tumor Models

[0175] The tumor cells (CT26 1×10.sup.6 cell/mice) cultured as in Experimental Example 2 were injected subcutaneously into the flanks of mice (BALB/C, n=7), thereby constructing tumor animal models. Each of the Salmonella strains SHJ2037 and CNC18 was injected into the tail vein of each of the tumor animal models. To evaluate the anticancer effect of each strain in the tumor animal models, the mice were anesthetized with 2% isoflurane, and then the tumor volume (mm.sup.3) was measured using the formula (length×height×width)/2. The results are shown in FIGS. 14 and 15.

[0176] As shown in FIGS. 14 and 15, it was confirmed that, compared to the control group, cancer growth in the Salmonella-treated group was inhibited and the survival rate of the treated group increased. In particular, it was confirmed that the strain CNC18 was significantly more effective in inhibiting tumor growth than SHJ2037.

[0177] Therefore, it was confirmed that the strain CNC18, which dies rapidly with a significantly decreased viability in all normal organs from the initial stage of infection while maintaining strong tumor targeting ability, has excellent tumor treatment efficacy while minimizing side effects caused by infection in the host.

EXPERIMENTAL EXAMPLE 7

Analysis (2) of Anticancer Effect of Attenuated Salmonella in Small Animal Tumor Models

[0178] Cultured tumor cells (MC38, murine colon adenocarcinoma cells, 1×10.sup.6 cell/mice) were injected subcutaneously into the flanks of mice (C57BL/6, n=6), thereby constructing tumor animal models. Each of the Salmonella strains SHJ2037 and CNC18 was injected into the tail vein of each of the tumor animal models. To evaluate the anticancer effect of each strain in the tumor animal models, the mice were anesthetized with 2% isoflurane, and then the tumor volume (mm.sup.3) was measured using the formula (length×height×width)/2. The results are shown in FIGS. 16 and 17.

[0179] As shown in FIGS. 16 and 17, it was confirmed that, compared to the control group, cancer growth in the Salmonella-treated group was inhibited and the survival rate of the treated group increased. In particularly, it was confirmed that the strain CNC18 was more effective in inhibiting tumor growth than SHJ2037.

EXPERIMENTAL EXAMPLE 8

Evaluation of Immune Activation Effect of Salmonella Injection

[0180] To evaluate the immune activation effect of Salmonella injection, immune cells were measured and compared. Each of the Salmonella strains SHJ2037 and CNC18 was injected into the tumor animal models constructed described in Experimental Example 6, and immune cells were collected on day 3. The immune cells were collected from a tumor and peri-tumor lymph nodes. The amount of the collected immune cells was measured and the results are shown in FIGS. 18 to 24.

[0181] As shown in FIGS. 18 to 22, it was confirmed that the strain CNC18-treated group showed increases in the proportions of leukocytes, neutrophils, natural killer cells and CD8+ T cells compared to the PBS control group and the SHJ2037 control group, and showed an increase in the proportion of dendritic cells in the lymph node. On the other hand, as shown in FIGS. 23 and 24, it was confirmed that the strain CNC18-treated group showed decreases in the proportions of immunosuppressive M2 macrophages and regulatory T (Treg) cells compared to the PBS control group and the SHJ2037 control group.

[0182] From the above results, it was confirmed that the attenuated Salmonella strain CNC18 according to the present invention had the effect of significantly increasing the immune function compared to the PBS control group and the SHJ2037 control group.

EXPERIMENTAL EXAMPLE 9

Analysis (1) of Tumor Imaging by Salmonella

[0183] The tumor cells cultured as described in Experimental Example 2 were injected subcutaneously into the flanks of mice, thereby constructing tumor animal models. Each of the Salmonella strains SHJ2037lux and CNC18lux was injected into these models. Here, the strains SHJ2037lux and CNC18lux were strains into which a luminescence gene has been introduced into the strain SHJ2037 and the strain CNC18. As the luminescence gene, a bacterial luciferase gene (lux) was used.

[0184] In order to evaluate the imaging effect of each strain in the tumor animal models, organs and tumors were extracted at each time points and then imaged using in vivo imaging system (IVIS). The results are shown in FIGS. 25 to 27.

[0185] As shown in FIGS. 25 to 27, it was confirmed that, like the strain SHJ2037lux, when the strain CNC18lux was injected, it enabled real-time imaging while showing tumor-specific and selective viability.

EXPERIMENTAL EXAMPLE 10

Analysis (2) of Tumor Imaging by Salmonella

[0186] Multiple myeloma models were constructed by injecting cultured MOPC cells into the shinbones of mice, and then each of the Salmonella strains SHJ2037lux and CNC18lux was injected into the models in the same manner as described in Experimental Example 9. Next, the mice were imaged at each time points using an in vivo imaging system (IVIS), and the results are shown in FIGS. 28 and 29.

[0187] As shown in FIGS. 28 and 29, it was confirmed, when the strain CNC18lux was injected, it enabled real-time imaging while showing tumor-specific and selective viability. In particular, it could be confirmed that, unlike the strain SHJ2037lux showing dispersed image signals while remaining in the periphery of the tumor, the strain CNC18lux reached the deep portion of the tumor, enabling clearer real-time imaging.

[0188] As can be seen in Experimental Examples 1 to 10, it was confirmed that the CNC18 strain dies rapidly with a significantly decreased viability in all normal organs from the initial stage of infection while maintaining strong tumor-targeting ability, and exhibits excellent tumor treatment efficacy while minimizing side effects caused by infection in the host.

[0189] Although the present invention has been described in detail with reference to the specific features, it will be apparent to those skilled in the art that this description is only of a preferred embodiment thereof, and does not limit the scope of the present invention. Thus, the substantial scope of the present invention will be defined by the appended claims and equivalents thereto.

INDUSTRIAL APPLICABILITY

[0190] The present invention is directed to a Salmonella strain selectively acting on cancer and a composition for preventing or treating cancer containing the same.