Nucleic acid detection using type III CRISPR complex
11814689 · 2023-11-14
Assignee
Inventors
- Blake A. WIEDENHEFT (Bozeman, MT, US)
- Andrew SANTIAGO-FRANGOS (Bozeman, MT, US)
- Anna A. NEMUDRAIA (Bozeman, MT, US)
- Artem A. NEMUDRYI (Bozeman, MT, US)
Cpc classification
C12Q2565/107
CHEMISTRY; METALLURGY
C12Q1/6818
CHEMISTRY; METALLURGY
C12Q2565/107
CHEMISTRY; METALLURGY
C12Q1/6806
CHEMISTRY; METALLURGY
International classification
C12N9/22
CHEMISTRY; METALLURGY
C12N15/10
CHEMISTRY; METALLURGY
C12Q1/6806
CHEMISTRY; METALLURGY
C12Q1/6876
CHEMISTRY; METALLURGY
Abstract
The disclosure relates to engineered systems and methods for detecting target nucleic acid in a sample, which may be a complex mixture. The systems and methods may improve sensitivity of target nucleic acid detection by enhancing signal generation. For example, signal generation may be enhanced through programmable capture and concentration of the target nucleic acid using an engineered type III CRISPR complex. Various ancillary nucleases such as Can1, Can2, and NucC are identified and may be used for detection. For example, binding of the engineered type III CRISPR complex may produce products that activate the identified ancillary nucleases. Different activators trigger changes in the substrate specificity of these nucleases. The activated nucleases may be used to detect programmatic detection of the target nucleic in the sample. The systems and methods are shown to detect viral RNA directly from nasopharyngeal swab samples.
Claims
1. A method of programmatically capturing and detecting target nucleic acid in a sample based on an engineered type III Clustered Regularly Interspaced Short Palindromic Repeat (CRISPR) complex, the method comprising: capturing the target nucleic acid in the sample using the engineered type III CRISPR-Cas complex, the engineered type III CRISPR-Cas complex comprising: a CRISPR guide comprising a CRISPR guide sequence engineered to be complementary to the target nucleic acid; concentrating the captured target nucleic acid to amplify detectable activity of the engineered type III CRISPR-Cas complex; and detecting the captured and concentrated target nucleic acid based on the detectable activity of the engineered type III CRISPR-Cas complex.
2. The method of claim 1, wherein the sample comprises a complex mixture and wherein the capturing and concentrating are performed without prior amplification of the target nucleic acid in the complex mixture.
3. The method of claim 1, wherein the detectable activity comprises generation of a linear or cyclic oligonucleotide.
4. The method of claim 3, wherein the generation of the linear or cyclic oligonucleotide is detectable via a nuclease that is activated by the linear or cyclic oligonucleotide.
5. The method of claim 4, wherein the nuclease comprises a Can nuclease and wherein the type III CRISPR system comprises the Can nuclease.
6. The method of claim 5, wherein the Can nuclease comprises Can1 and/or Can2.
7. The method of claim 4, wherein the nuclease comprises a NucC nuclease and wherein the type III CRISPR system comprises the NucC nuclease.
8. The method of claim 7, wherein contacting the nucleic acid in the sample with the engineered type III CRISPR-Cas complex comprises: contacting the captured and concentrated nucleic acid with a fluorophore and a quencher tethered together by a nucleic acid tether, wherein the activated nuclease cleaves the nucleic acid tether to thereby release the fluorophore from the quencher; and detecting a level of fluorescence of the released fluorophore.
9. The method of claim 8, wherein the tether comprises a ribonucleic acid and/or a deoxyribonucleic acid tether.
10. The method of claim 1, wherein the engineered type III CRISPR complex is Histidine-tagged (His-tagged), and wherein capturing the target nucleic acid comprises: incubating the sample with the His-tagged engineered type III CRISPR complex to bind the His-tagged engineered type III CRISPR complex with the target nucleic acid; and binding the His-tagged engineered type III CRISPR complex with bound target nucleic acid to magnetic particles.
11. The method of claim 10, wherein the magnetic particles comprise Ni-NTA beads.
12. The method of claim 10, wherein concentrating the captured target nucleic acid comprises: applying a magnet to generate a pellet comprising the His-tagged engineered type III CRISPR complex bound to the target nucleic acid and the magnetic particles.
13. The method of claim 12, wherein the detectable activity comprises generation of a linear or cyclic oligonucleotide that is detectable via a nuclease activated by the linear or cyclic oligonucleotide, the method further comprising: resuspending the pellet in a solution comprising reaction buffer containing ATP to activate polymerase activity of the His-tagged engineered type III CRISPR complex, wherein the polymerase activity generates the linear or cyclic oligonucleotide that activates the nuclease.
14. The method of claim 13, further comprising: adding the nuclease, a fluorophore, and a quencher tethered together by a nucleic acid tether, wherein the activated nuclease cleaves the nucleic acid tether to release the fluorophore; and detecting a level of fluorescence of the released fluorophore.
15. The method of claim 14, wherein the linear or cyclic oligonucleotide comprises cA3 and/or cA4 that activates a NucC nuclease.
16. The method of claim 14, wherein the linear or cyclic oligonucleotide comprises cA3 and/or cA4 that activates Can nuclease.
17. The method of claim 1, wherein the sample is a complex mixture obtained from a subject.
18. The method of claim 17, wherein the sample comprises a nasopharyngeal swab sample.
19. The method of claim 1, wherein the target nucleic acid in the sample comprises ribonucleic acid (RNA).
20. The method of claim 19, wherein the RNA comprises at least a portion of an RNA genome of a virus.
21. The method of claim 20, wherein the viral RNA comprises an RNA from the genome of severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2).
22. The method of claim 1, wherein the CRISPR guide further comprises a 3′ protospacer flanking sequence that activates or enhances generation of linear or cyclic oligonucleotides.
Description
BRIEF DESCRIPTION OF THE FIGURES
(1) Features of the present disclosure may be illustrated by way of example and not limited in the following figure(s), in which like numerals indicate like elements, in which:
(2)
(3)
(4)
(5)
(6)
(7)
(8)
(9)
(10)
(11)
(12)
(13)
(14)
(15)
(16)
(17)
(18)
(19)
(20)
(21)
(22)
(23)
(24)
(25)
(26)
(27)
(28)
(29)
(30)
(31)
(32)
(33)
(34)
(35)
(36)
(37)
(38)
(39)
(40)
(41)
(42)
(43)
(44)
(45)
(46)
(47)
(48)
(49)
(50)
(51)
(52)
(53)
(54)
(55)
(56)
(57)
(58)
(59)
(60)
(61)
(62)
(63)
(64)
(65)
(66)
(67)
(68)
(69)
(70)
(71)
(72)
(73)
(74)
(75)
(76)
(77)
(78)
(79)
(80)
(81)
(82)
(83)
(84)
(85)
(86)
(87)
(88)
(89)
(90)
(91)
(92)
(93)
(94)
(95)
(96)
(97)
(98)
(99)
(100)
(101)
DETAILED DESCRIPTION
(102) There is an urgent need for inexpensive new technologies that enable fast, reliable, and scalable detection of RNA. U.S. patent application Ser. No. 17/240,858, filed Apr. 26, 2021, the entirety of which is incorporated by reference for all purposes, disclosed repurposing the type III CRISPR-Cas system for sequence specific detection of SARS-CoV-2 in an assay that can be performed in one hour or less. However, direct detection of RNA using type III CRISPR-based diagnostics (T3D) may not be sufficiently sensitive for many applications. To improve T3D sensitivity, we have developed a method that enables target RNA concentration and combines ancillary nucleases (i.e., Csm6, NucC and Can1), which are activated by cA4 and cA3, respectively.
(103) Although qPCR (quantitative polymerase chain reaction) remains the “gold standard” for nucleic acid detection, it requires sophisticated equipment, trained personnel, efficient specimen transport to high-complexity labs, and reliable reporting systems [Reference 1]. While the complexity and turnaround times necessary for qPCR are acceptable for many diagnostic applications, the SARS-CoV-2 (Severe Acute Respiratory Syndrome Coronavirus 2) pandemic reveals an urgent need for diagnostics that are easy to distribute, simple to perform, and fast enough to stop transmission of a contagious disease [Reference 1]. Although rapid antigen tests and isothermal amplification methods have helped address this need, these and other emerging methods have limitations related to sensitivity, versatility, or specificity [References 2,3].
(104) CRISPR RNA-guided diagnostics (CRISPR-dx) are a diverse group of nascent technologies that aim to address current limitations by providing a versatile and programmable platform that is sufficiently sensitive for clinical applications and stable enough for distribution [References 4,5]. The first CRISPR-based viral diagnostic came from Collins and colleagues in 2016, when they demonstrated that Cas9 could be used to discriminate between different variants of the Zika virus [Reference 6]. This approach relies on converting viral RNA to DNA using reverse transcriptase, followed by isothermal DNA amplification prior to sequence-based discrimination by Cas9. The exclusive recognition of double-stranded DNA (dsDNA) by Cas9 seemed to be an intrinsic limitation for diagnostic applications that require RNA detection. However, Beisel and colleagues recently developed a creative method that uses the trans-acting CRISPR-RNA (tracrRNA) to capture complementary RNA guides derived from RNA viruses [Reference 7]. In this system, the engineered tracrRNA-crRNA hybrid guides Cas9 to a complementarity dsDNA reporter. While this approach enables RNA detection, Cas9 is a single turn-over enzyme, which may limit sensitivity. In contrast to Cas9, target recognition by type V (Cas12-DETECTR) and type VI (Cas13-SHERLOCK) CRISPR-systems activates a multi-turnover non-sequence-specific “collateral nuclease” activity that amplifies the signal by cleaving thousands of reporter molecules for every target bound [References 8,9].
(105) Like type VI, type III systems also recognize complementary RNA. However, unlike any other CRISPR system, target recognition by type III complexes simultaneously activates polymerase and HD-nuclease domains in the Cas10 subunit [References 10-12]. The polymerase domain has been estimated to generate ˜1000 cyclic oligoadenylates per bound RNA [Reference 13], which trans-activate and allosterically regulate diverse multi-turnover ancillary nucleases that provide defense from invading genetic parasites [References 14,15]. This biochemical cascade exponentially amplifies the signal when type III complex detects target RNA, suggesting that these systems have the potential to enhance the sensitivity of CRISPR-based diagnostics. However, initial efforts to implement this approach failed to be sufficiently sensitive for clinical applications without prior amplification of the target RNA [References 16-18]. Part of what was limiting sensitivity in this first-generation diagnostic was the use of Csm6, an ancillary nuclease that also degrades the cyclic nucleotide activator [References 19-23].
(106) Recently, Malcolm White's lab demonstrated that alternative ancillary nucleases, which efficiently cleave reporters but do not cleave the signaling molecule, can be used to enhance the sensitivity of type III-based diagnostics [Reference 24].
(107) Despite innovations leading to new and improved CRISPR-based diagnostics, point-of-care testing requires new strategies that simplify the workflow and increase the sensitivity without prior RNA purification or amplification (e.g., PCR, LAMP, NASB, RPA, etc.). Here, we bring CRISPR-dx closer to a deployable diagnostic by developing a type III CRISPR-based method for sequence-specific capture and concentration of RNA from heterogeneous samples. To improve sensitivity, we purify several different ancillary nucleases (i.e., Can1, Can2, and NucC), systemically test nuclease activation using a series of cyclic oligoadenylates (i.e., cA3-cA6), test for ring nuclease activity and determine how cyclic oligoadenylates, as well as metal-preferences impact substrate cleavage activities. We show that the Can1 nuclease from T. thermophilus (TtCan1) and the Can2 ortholog from Archaeoglobi (AaCan2) are activated by more than one cyclic nucleotide species (i.e., cA3 and cA4) and that substrate specificity of these nucleases changes according to the bound activator. This observation helps explain how diverse cyclic nucleotides (i.e., cA3-cA6) produced by a single type III surveillance complex integrate distinct activities from a single effector. Finally, we demonstrate how the type III complex can be used to bypass RNA extraction methods, and that coupling type-III-based RNA capture with the AaCan2 nuclease further increases the sensitivity of SARS-CoV-2 RNA detection in patient swabs to 5×10.sup.4 copies/ul.
(108)
(109)
(110)
(111)
(112)
(113)
(114)
(115)
(116)
(117)
(118)
(119)
(120)
(121)
(122)
(123)
(124) Can1 and Can2 ancillary nucleases demonstrate different substrate specificity depending on the activator.
(125)
(126)
(127)
(128)
(129)
(130)
(131)
(132) Referring to both
(133) Incorporation of cA3-Activated Nucleases into a Csm-Based RNA Detection Assay.
(134)
(135)
(136)
(137)
(138) TtCsm-Based RNA Capture Directly Detects SARS-CoV-2 in Clinical Samples
(139)
(140) Vertical dotted lines show timepoints that were used to analyze type III detection results. Error bars show detection threshold set as mean (n=6) of negative samples±2.33 SD (p-value<0.01). Samples with fluorescence higher than upper boundary of this interval were considered positive in type III detection assay.
(141)
(142)
(143)
(144) Detection of Small RNAs (miRNA, siRNA, piRNA, Etc.)
(145) MicroRNAs (miRNAs) are important early biomarkers of cancer, glaucoma and infectious diseases [References 7-10]. However, the small size (˜22 nucleotides) and sequence homology (e.g. single-nucleotide variation) of these biomarkers makes them difficult to detect using traditional PCR, Cas13 or isothermal amplification methods [References 11-13]. Small type III surveillance complexes can be produced with guide RNAs that are shorter (i.e., 20-30 nts) than the median size of spacers sequences typically seen in type III CRISPR systems (˜40 bp) (as shown in
(146)
(147)
(148)
(149)
(150) Purification and Biochemical Characterization of Thermus thermophilus Can1 (TtCan1) Nuclease Activities
(151)
(152)
(153)
(154)
(155)
(156)
(157)
(158)
(159) Purification and Biochemical Characterization of Archaeoglobi Archaeon JdFR-42 Can2 (AaCan2) Nuclease Activities.
(160)
(161)
(162)
(163)
(164) Referring to both
(165)
(166) Screening a library of synthetic RNA reporters reveals sequence cleavage preference for AaCan2 and TtCan1.
(167) Referring to
(168) Nucleases AaCan2, TtCsm6 and TtCan1 Demonstrate Different Sensitivity to cA4.
(169)
(170) Purification and Biochemical Characterization of Thermostable NucC Orthologs
(171)
(172)
(173)
(174)
(175)
(176)
(177) Thermostable NucC homologs Amtb01NucC, EsNucC, and CtNucC demonstrate sequence cleavage preference of plasmid DNA
(178)
(179)
(180)
(181)
(182)
(183) Integration of cA3-Activated Nucleases into Csm-Based RNA Detection Assay.
(184)
(185)
(186) TtCsm-Based RNA Capture Assay Directly Detects SARS-CoV-2 in Clinical Patient Samples
(187)
(188)
(189)
(190)
(191)
(192)
(193) Use of Type III Csm-Complexes for Enrichment and Direct Sequencing of Target RNAs from Complex Mixtures
(194)
(195)
(196)
(197)
(198)
(199) Type-III-Based RNA Capture & Seq and Type-III-Based RNA Cleavage & Seq
(200) Direct sequencing of RNA (without synthesis) is a powerful technology that enables unbiased detection and quantification of native RNAs, as well as detecting base modifications. However, these sequencing methods are often untargeted, which limits the utility for studying RNAs that are not highly abundant. Current techniques for RNA enrichment (i.e., oligo-capture) rely on hybridization between the nucleic acid probe and target sequence. Oligo-capture requires thermal annealing and is prone to off-targets, which restricts its applications. CRISPR-Cas complexes preorder the guide RNA (i.e., CRISPR RNA, crRNA) into a helical configuration, which facilitates hybridization with the complementary target. We have developed two approaches for sequence-specific enrichment of rare RNAs from complex mixtures (e.g., total RNA extracted from clinical samples) using type III CRISPR RNA-guided complexes (Type-III-based RNA Capture & Seq and Type-III-based RNA Cleavage & Seq;
(201) The Capture & Seq approach uses type-III Csm-complexes to pull down specific RNAs from total RNA, and then all RNAs in the enriched sample are sequenced (as shown in
(202) In the Cleavage & Seq approach, the type III-complex (i.e., Csm or Cmr) is used to cleave off the polyA tail from target mRNA and then sequence-specific DNA adapter is ligated with T4 ligase. In this case, only target RNA is passed through the pore and sequenced in the Oxford Nanopore device (as shown in
(203) Improving Sensitivity and Demonstrating Quantitative Detection of RNA Using Type III CRISPR Systems
(204) The Type III CRISPR-Cas systems have recently been repurposed for sequence-specific detection of SARS-CoV-2 genomic RNA. Here we present new information that enables more sensitive, rapid, and specific detection RNA with Type III CRISPR-Cas systems.
(205) The binding of Type III surveillance complexes to target RNA, activates two activities in the Cas10 subunit, an HD nuclease activity and a polymerase activity. The activated Cas10 subunit polymerizes nucleotide triphosphates (e.g., ATP) into a mixture of linear (e.g., Ax, where “x” is the number of adenosines in the polymer) and cyclic oligonucleotides (cAx). The addition of a single NTP (e.g., ATP) to any growing oligonucleotide causes the release of pyrophosphate and a proton. Each of the three Cas10 products can be measured to detect RNA [References 1-4].
(206) Type III CRISPR Diagnostics for Quantitative Detection of RNA
(207) Quantitative reverse transcription PCR (RT-qPCR) remains the “gold standard” for RNA quantification. However, in this method RNA is not measured directly but first is converted to DNA. Therefore, results depend on the efficiency of the reverse transcription, which complicates data interpretation. Here, we develop type III CRISPR based technology to directly detect and quantify RNA in biological samples. Target recognition by type III complexes activates polymerase domain in the Cas10 subunit that generates ˜1000 cyclic oligoadenylates per bound RNA. The cyclic oligoadenylates trans-activate and allosterically regulate diverse multi-turnover ancillary nucleases that provide defense against invading genetic parasites (as shown in
(208) The rate of fluorescent signal released upon ssRNA reporter cleavage by ancillary nuclease Can2 is proportional to the amount of cyclic activator (i.e., cA4) in the 1-10 nM range (as shown in
(209) There is a linear relationship between the amount of bound target, the cyclic oligoadenylate generated, and cleavage by the ancillary nuclease. Our data shows that fluorescence generated in a type III CRISPR detection reaction is proportional to the concentration of the input target RNA (as shown in
(210) Titration of ATP to Tailor the Cyclic Oligoadenylate Profile Produced by Cas10
(211) Target RNA-bound Type III surveillance complexes polymerize ATPs into a mixture of linear and cyclic oligoadenylates. However, the enzymatic effectors (e.g. nucleases, peptidases, pore-forming toxins) that are allosterically activated by cyclic oligoadenylates (cOAs) tend to be preferentially activated by specific oligoadenylate species. Therefore, a method to modify or tune the cOA profile produced by Type III surveillance complexes to match the preferred cOA activator of enzymatic effectors of interest is key to developing sensitive Type III CRISPR-based diagnostics. Here we show that titration of ATP enables tuning of the proportion of cA4 and cA3 produced by the TtCsm complex (as shown in
(212) TLC (Thin Layer Chromatography) Analysis of TtCsm-Polymerized cOAs Over a Range of ATP Concentrations
(213)
(214)
(215) Type III CRISPR Chain Reaction
(216) The high sensitivity of PCR (Polymerase Chain Reaction) stems from the exponential amplification of DNA. Each newly polymerized DNA duplex is used as a template for further replication in successive extension steps, setting up the “chain reaction” of PCR.
(217) In the Type III CRISPR Chain Reaction, a target-bound Type III surveillance complex (e.g. Csm or Cmr) polymerizes ATP into cOAs. cOAs bind and activate enzymatic effectors, (e.g. nucleases). The cOA-activated DNase or RNase cleaves a “blocking” DNA or RNA that acts as both a i) fluorescent reporter, and ii) a physical obstruction that blocks access to a mimic of the target RNA sequence. Cleavage of the DNA relieves the previously blocked target RNA mimic to be accessible for binding by the Csm or Cmr complex, which becomes activated and generates more cOAs. This sets off a chain reaction, where more type III effectors are activated (i.e., target bound), more cOAs are generated, more nucleases are activated, blocking reporters are cleaved, and more of the blocked RNA target is liberated, which continues to feed the chain reaction (as schematically shown in
(218) In another version of Type III CRISPR Chain Reaction, a target-bound Csm/Cmr complex directly cleaves the blocking DNA or RNA via the Cas10 HD domain. A similar chain reaction is set off, that does not require ATP or an ancillary enzyme effector. This format also allows for multiplexing against different targets. Using Csm/Cmr complexes that have HD domains with different nucleotide specificities, individual blocking DNA or RNA containing different reporters (e.g. fluorophores), that are base paired with an RNA target can be programmed for simultaneous detection of multiple RNAs in a single reaction. The DNase activity of Cas10 from either TtCsm and SthCsm complexes is specifically activated when bound to a complementary RNA target, and these two type III complexes possess different ssDNA sequence cleavage preferences (as shown in
(219) In all versions of the Type III CRISPR Chain Reaction, all three Cas10 products can be measured for sensitive detection of RNA.
(220) Pyrophosphates can be measured by methods that detect the precipitation of insoluble complexes formed between pyrophosphates and divalent metal ions, for example Calcein-based assays [References 1,2].
(221) The protons produced by target RNA-bound Type III surveillance complexes reduces the pH. The decrease in pH can be measured by colorimetric pH indicators (e.g., Phenol Red), fluorescent pH indicators (e.g., BCECF-AM) [Reference 5] or by field-effect transistors—including ion-sensitive field-effect transistors (U.S. Pat. No. 9,365,904, issued on Jun. 14, 2016, which is incorporated by reference in its entirety for all purposes) and graphene field-effect transistors [Reference 6]. Colorimetric pH indicator color change can be detected by eye, or absorbance plate reader. Fluorescent pH indicator change can be detected by a fluorescent plate reader. Field-effect transistors can be used to make quantitative and sensitive readouts of proton concentration.
(222) Cyclic oligoadenylates can be indirectly measured by the activation of effectors with different enzymatic activities (e.g. nucleases, peptidases, pore-forming toxins). The activity of nucleases [References 1-4] and peptidases can be measured by cleavage of an RNA, DNA or peptide tether that is labelled i) on either end with a fluorophore-quencher pair (cleavage detected by bulk fluorescence or digital enzymology), ii) on either end with a fluorophore and/or digoxigenin and/or biotin (cleavage detected by lateral flow, surface-enhanced Raman spectroscopy lateral flow), iii) with multiple gold nanoparticles (cleavage detected by bulk colorimetric or digital enzymology), iv) on one end with a redox-active molecule (e.g., methylene blue) and linked on the other end to a gold electrode (cleavage detected by amperometric bio sensor).
(223)
(224)
(225)
(226) Chimeric Type III CRISPR Surveillance Complexes of a Defined Length and Tethered Nuclease
(227) Type III surveillance complexes that are purified from expression in native or heterogeneous host bacteria or archaea are often contain guides crRNA-guides of various lengths. Precise control over the size of the guide RNA will improve homogeneity and consistent performance of this diagnostic, where the “seed” regions changes along with the length of the crRNA-guide. We developed a strategy to control the size of the type III surveillance complexes that involves the design of a chimeric type III and type I CRISPR system (
(228) In addition, to adding a type I CRISPR RNA processing enzyme (Cas6 family protein) to the type III Csm or Cmr complexes, we are also fusing ancillary nucleases to these type III complex as a way to increase the concentration and proximity to the nucleases to the type III complexes (
(229) Type III CRISPR Surveillance Complexes of a Defined Length.
(230)
(231)
(232)
(233)
(234) Fusion of TtCsm Complex with AaCan2 Ancillary Nuclease to Increase the Sensitivity of Type-III-Based Detection.
(235)
(236)
(237) Detection of Small RNAs (miRNA, siRNA, piRNA, Etc.)
(238) MicroRNAs (miRNAs) are important early biomarkers of cancer, glaucoma and infectious diseases [References 7-10]. However, the small size (˜22 nucleotides) and sequence homology (e.g. single-nucleotide variation) of these biomarkers makes them difficult to detect using traditional PCR, Cas13 or isothermal amplification methods [References 11-13]. Small type III surveillance complexes can be produced with guide RNAs that are shorter (i.e., 20-30 nts) than the median size of spacers sequences typically seen in type III CRISPR systems (˜40 bp) (
(239) Discussion of Results
(240) Type III-Mediated Sequence-Specific Enrichment of RNA
(241) Type III CRISPR RNA-guided complexes (i.e., Csm and Cmr) bind and cleave complementary single-stranded RNA (ssRNA) targets [Reference 25]. Complementary RNA is cleaved in six-nucleotide increments by metal-independent nucleases (Csm3 or Cmr4) that form the oligomeric “backbone” of the complex26. Type III complexes release fragments of the cleaved target, which inactivates ATP polymerization by the Cas10 subunit26. Previously, we mutated residues in the Csm3 subunit responsible for target RNA cleavage (D34A), purified the RNase-dead complex (TtCsm.sup.Csm3-D34A), and showed that the mutant complex provides more sensitive detection of viral RNA than the wild-type complex [Reference 16]. To further increase the sensitivity, we set out to determine if TtCsm.sup.Csm3-D34A could be used to concentrate sequence-specific RNAs. To test this approach, we mixed P32-labeled target or non-target RNAs with TtCsm.sup.Csm3-D34A, incubated for 20 minutes, and concentrated the His-tagged complex using nickel-derivatized magnetic beads (
(242) Previously, we repurposed TtCsm6, a cA4-activated ribonuclease, to generate a real-time fluorescent readout for Csm-based RNA detection16 (
(243) CARF-Nucleases Can1 and Can2 Exhibit cA3- and cA4-Specific Nuclease Activities
(244) Csm6 proteins contain an amino-terminal CARF (CRISPR-associated Rosman Fold) and a carboxy-terminal HEPN (Higher Eukaryotes and Prokaryotes Nucleotide-binding) domains [References 10, 12]. Csm6 family proteins form homodimers, and the two CARF-domains bind cA4 [References 23,27] or cA6 [Reference 22], which activate the C-terminal HEPN nuclease domain. However, the CARF domain of Csm6 proteins also degrades the cyclic nucleotide, which inactivates the nuclease and limits the sensitivity of Csm6-based assays [Reference 28]. To improve sensitivity, we sought to identify and incorporate a CARF-nuclease that is activated by but does not degrade cA4.
(245) CRISPR ancillary nucleases (Can) are another family of recently identified proteins that are activated by cyclic oligoadenylates and lack ring nuclease activity. [References 29-31]. Like Csm6 proteins, these proteins also contain amino-terminal CARF domains, but the carboxy-terminal nucleases are distinct. The Can1 protein from Thermus thermophilus (TtCan1) has a unique monomeric architecture with two non-identical CARF domains, one nuclease-like domain (NLD) and one restriction endonuclease domain (PD-[D/E]XK) [Reference 31], while Can2 nucleases contain a single CARF domain and form symmetrical homodimers [Reference 29,30] (
(246) To identify Can1 and Can2 orthologs compatible with the TtCsm complex, we generated profile Hidden Markov models (HMMs) to query publicly available microbial genomes and metagenomes from NCBI and JGI. This analysis identified 204 Can1 and 3,121 Can2 proteins. Based on this analysis, we selected TtCan1 and three Can2 orthologs from thermophilic organisms for cloning and expression (
(247) Can2 genes from Clostridium thermobutyricum, Thermus thermophilus, and Archaeoglobi archaeon JdFR-42 were cloned and expressed in E. coli. However, only the Can2 protein from Archaeoglobi archaeon JdFR-42 (AaCan2) purified in quantities sufficient for biochemical assays (
(248) Can2 Ancillary Nuclease Provides Sensitive Csm-Based SARS-CoV-2 Detection
(249) To determine whether incorporating TtCan1 or AaCan2 improves sensitivity of the Csm-based RNA detection assay, we screened a library of synthetic RNA reporters designed to identify sequences that might be preferred by these nucleases (Table 1, SEQ ID NOS. 1-47,
(250) Having established that AaCan2 is more active than TtCan1, we set out to compare AaCan2 to the sensitivity of TtCsm6, which we used previously. This comparison was performed by measuring cA4 concentration-dependent activity for AaCan2 and TtCsm6 using the preferred RNA reporter for each of the respective enzymes (
(251) Finally, we incorporated AaCan2 into the type III-based detection assay and benchmarked this combination against TtCsm6-based detection (
(252) Incorporating cA3-Dependent Nuclease Activity does not Provide Additional Sensitivity of Viral RNA Detection
(253) While our assay uses cA4-activated collateral cleavage of ssRNA reporters, the TtCsm.sup.Csm3-D34A-complex also produces cA3 (
(254) Unlike CARF-nucleases, NucC nucleases adopt a homotrimeric structure forming a 3- fold symmetric pocket for cA3 binding. Binding to cA3 triggers dimerization of NucC homotrimers positioning restriction endonuclease-like domains for dsDNA cleavage [References 32, 33]. We purified three thermophilic NucC orthologs and tested cA3-dependent dsDNA cleavage (
(255) Next, we set out to determine if CtNucC and AaCan2 could be combined into a single reaction to improve the sensitivity of detection with TtCsm.sup.Csm3-D34A. To perform fluorescent assays with CtNucC, we designed a 31-bp dsDNA probe comprising six repeats of the optimal cleavage site (Table 1, SEQ ID NOS. 1-47). The lowest concentration of cA3 detected by CtNucC is 0.5 nM, which is 10-fold more sensitive than TtCan1 and 100-fold more sensitive than AaCan2 (
(256) Type III CRISPR Based RNA Capture and Detection from Patient Samples
(257) RNA extracted from nasopharyngeal swabs of COVID-19 patients are complex mixtures of nucleic acids derived from the host, the virus, and microbial communities residing in the upper respiratory tract. To determine if TtCsm complex can capture SARS-CoV-2 RNA in such mixtures, we extracted total RNA from nasopharyngeal swabs of 17 positive and 6 negative patients diagnosed with RT-qPCR (
(258) We used 3 μL of each RNA sample to perform the TtCsm-AaCan2 reaction and 120 μL as input for Csm-based RNA capture followed by a polymerization reaction and fluorometric detection with AaCan2. Only samples with the highest viral RNA load (Ct<17) tested positive in TtCsm-AaCan2 reaction, while Csm-based RNA capture assay detected RNA of SARS-CoV-2 in 10 samples (60% of the qPCR positive samples) (
(259) RNA extraction kits are expensive, time-consuming, and require specialized equipment. To eliminate this step, we tested if the TtCsm complex can capture and concentrate target RNA directly from a nasopharyngeal swab sample without prior RNA extraction. To identify lysis conditions that do not inhibit activity of the TtCsm-complex, we tested 10 lysis buffer compositions with varying concentrations of detergents (i.e., Triton X-100 or NP-40) and chelators (i.e., EDTA or EGTA) (
(260) Finally, to assess the sensitivity of the direct viral detection in swab samples with RNA capture and AaCan2-based readout (
Discussion
(261) CRISPR-based diagnostics have been progressing at a remarkable pace since the start of the COVID-19 pandemic [Reference 4]. However, most CRISPR-based SARS-CoV-2 diagnostics described to date still require nucleic acid extraction and pre-amplification to reach clinically relevant sensitivity [Reference 4]. Ongoing efforts focus on improving the sensitivity, ease of execution, and speed of the viral detection. Previous efforts have leveraged the intrinsic signal amplification of type III CRISPR systems to detect SARS-CoV-2 in RNA extracted from clinical samples [References 16-18, 24]. Here, we demonstrate how type III CRISPR systems can be used for viral RNA capture and detection directly from unprocessed patient samples. This approach, coupled with a Can2-based fluorescent readout, allows direct detection of 5×10.sup.4 viral RNA copies per μL in clinical samples without RNA extraction and pre-amplification steps.
(262) The natural capacity and programmability of Cas9 have been previously adopted for target DNA capture and concentration [References 36-38]. In addition, Cas9 was repurposed to bind and pull down specific mRNAs with a protospacer adjacent motif (PAM) grafted in trans on a complementary DNA oligonucleotide [Reference 39]. While such approaches seem preordained to be incorporated in molecular testing, CRISPR-based nucleic acid enrichment has not been previously explored to increase the sensitivity and streamline CRISPR-based diagnostics. Cas13-based CRISPR diagnostics rely on collateral nuclease activity triggered by nucleic acid binding [References 8, 40]. However, the same metal-independent HEPN (Higher Eukaryotes and Prokaryotes Nucleotide-binding domain) nuclease domain that executes collateral activity also cleaves the bound target [Reference 41]. These activities cannot be decoupled, making Cas13-based RNA capture and subsequent detection unavailable. In type III CRISPR systems, target binding and collateral RNase activities are performed by separate proteins and coordinated through a secondary messenger signaling mechanism. Binding target RNA triggers Cas10 subunit of type III Csm and Cmr complexes to convert ATP to cyclic oligoadenylates (cOAs) licensing indiscriminate cleavage by trans-acting nucleases [References 10, 12]. Target cleavage acts as an off switch for cyclase activity and downstream effectors. Mutations in the catalytic site of backbone RNase (i.e., Csm3) subunit abolish target RNA cleavage and boost target-dependent cOA synthesis [Reference 13]. We have taken advantage of this feature and developed a Csm-based RNA enrichment method using RNase-dead (TtCsm.sup.Csm3-D33A) TtCsm complex.
(263) Incorporating RNA capture increases the sensitivity of type III CRISPR-based diagnostic and allows direct detection in clinical samples without RNA extraction prerequisite for most current platforms. To further improve sensitivity, we identify and test ancillary nucleases Can1, Can2, and NucC. Most ancillary nucleases in type III CRISPR have a single CARF domain fused to the C-terminal effector and homodimerize to bind cyclic oligoadenylates (cOAs) with two-fold symmetry, i.e., cA4 and cA6 [References 27, 29, 30, 42]. TtCan1 is an exception to this pattern and has a monomeric structure with two non-identical CARF domains forming an allosteric pocket accommodating cyclic oligoadenylates [Reference 31]. Contrary to previous work, our biochemical data suggest that nuclease activities of TtCan1 are primarily regulated by cA3 rather than cA4. TtCan1 is proposed to emerge as Can2 gene duplication, fusion, and subsequent divergent evolution [References 30, 31]. Similar fusion of two ancient CARF-like domains into a SAVED (SMODS-Associated and fused to Various Effector Domains) domain was recently discovered in Cap4 nucleases that are part of CBASS (Cyclic oligonucleotide-Based Antiphage Signaling System) immunity and are activated by cyclic trinucleotides [Reference 43]. We hypothesize that duplication and subsequent fusion of Can2 genes exemplifies an evolutionary mechanism for diversifying cyclic nucleotide signaling in bacterial immune systems. Our phylogenetic comparison of Can1 and Can2 nucleases identifies that the emergence of Can1 proteins follows a polyphyletic fashion and appears multiple times over the evolutionary timeline.
(264) The genome of T. thermophilus (i.e., HB8 and HB27 strains) encodes both Csm6 and Can1 CARF-nucleases [Reference 31]. While the Cas10 cyclase subunit in the type III-A TtCsm complex primarily produces cA4, which is sensed by TtCsm6 RNase, we also detected substantial synthesis of cA3. We hypothesize that in vivo, this secondary product activates TtCan1 DNase, providing an additional layer of immune defense. RNA cleavage by Csm6 nucleases results in host cell senescence facilitating phage clearance [References 15,44]. We further hypothesize that failure to clear the infection results in continuous polymerization by Cas10 and accumulation of cA3 licensing TtCan1 to degrade dsDNA in the cell. Our data shows that TtCan1 has no sequence preference, suggesting that this nuclease might degrade the host genome leading to cell suicide. Therefore, cOA ratios generated by type III complexes might have evolved as a fine-tuned immune mechanism regulating ancillary nuclease activities and infection outcomes.
(265) In the second iteration of the TtCsm-based SARS-CoV-2 diagnostic presented here, we increase the sensitivity of amplification-free viral detection 1000-fold and eliminate the RNA extraction step, significantly limiting sample handling. The improved assay detects SARS-CoV-2 directly in nasopharyngeal swabs at concentrations as low as 5×10.sup.4 viral RNA copies per μL (Ct˜21.2). Recent works have repurposed type III complexes of Lactococcus lactis (L1Csm) [Reference 18] and the Vibrio metoecus (VmeCmr) [Reference 24] to achieve ˜2-4 fM (1-2×10.sup.3 copies/μL) sensitivity of SARS-CoV-2 detection in RNA samples. While these levels of sensitivity are still inferior to RT-qPCR, they are sufficient to identify infected individuals capable of spreading the virus [Reference 45] and comparable to rapid antigen tests [Reference 2]. We anticipate that further incorporating Type III-based RNA pull-down technique to bypass RNA extraction, optimizing sample lysis conditions, and using the next generation of readouts will further boost the sensitivity and minimize time-to-result, bringing type III CRISPR diagnostic to current standards of rapid molecular testing.
Methods (Examples)
(266) Human Clinical Sample Collection and Preparation
(267) Clinical samples were obtained with local IRB approval (protocol #DB033020) and informed consent from patients undergoing testing for SARS-CoV-2 Bozeman Health Deaconess Hospital. Nasopharyngeal swabs from patients that either tested negative or positive for SARS-CoV-2 were collected in viral transport media. RNA was extracted from all patient samples using QIAamp Viral RNA Mini Kit (QIAGEN).
(268) Nucleic Acids
(269) Sodium salt of cyclic di-, tri-, tetra-, penta- and hexaadenosine monophosphates (cA2-6) were purchased from Biolog Life Science Institute. Fluorescent reporters (RNA and DNA) were purchased from IDT (Table 1, SEQ ID NOS. 1-47). dsDNA reporter was made by heating and slow cooling of the 5′-FAM- and 3′-BHQ-labelled strands. Target and non-target RNAs of SARS-CoV-2 N-gene were in vitro transcribed with MEGAscript T7 (THERMO FISHER SCIENTIFIC) from PCR products generated from pairs of synthesized overlapping DNA oligos (Table 1, SEQ ID NOS. 1-47) (EUROFINS). Transcribed RNAs were purified by denaturing PAGE. Total RNA from HEK 293T cells was extracted using TRIzol reagent.
(270) Non-Targeting Control (NTC)
(271) Total RNA extracted from nasopharyngeal swabs previously tested negative for SARS-CoV-2 with RT-qPCR or total RNA extracted from HEK 293T cells were used as negative controls. RNA extracted from HEK 293T cells was diluted to match the average Ct level (˜27) obtained for RNAseP mRNA in RNA samples extracted from nasopharyngeal swabs (Table 2). The RT-qPCR for RNase P mRNA was performed using CDC RP primers and probe (2019-nCoV CDC EUA Kit, IDT #10006606).
(272) Plasmids
(273) Plasmids pCDF-5xT7-TtCsm (Addgene #128572) and pACYC-TtCas6-4xcrRNA4.5 (Addgene #127764) encoding for Thermus thermophilus type III-A csm1-csm5 genes and CRISPR locus, respectively, were a gift from Jennifer Doudna. Vector pCDF-5xT7-TtCsm was used as a template for site-directed mutagenesis to mutate the D33 residue in Csm3 to alanine (D33A) and inactivate Csm3-mediated cleavage of target RNA (pCDF-5xT7- TtCsm.sup.Csm3-D34A) [Reference 35]. The CRISPR array in pACYC-TtCas6-4xcrRNA4.5 was replaced with a synthetic CRISPR array (GeneArt) containing five repeats and four identical spacers, designed to target the N-gene of SARS-CoV-2 (i.e., pACYC-TtCas6-4xgCoV2N1) [Reference 16]. TtCas6 was PCR was PCR-amplified from the pACYC-TtCas6-4xcrRNA4.5 plasmid and cloned between the NcoI and XhoI sites in the pRSF-1b backbone (Millipore Sigma) (pRSF-TtCas6). Expression vector encoding TtCsm6 nuclease, pC0075 TtCsm6 His6-TwinStrep-SUMO-BsaI, was a gift from Feng Zhang (Addgene plasmid #115270) [Reference 46].
(274) E. coli codon optimized dsDNA gene fragments encoding for Can1 from Thermus thermophilus (TtCan1; NCBI accession=WP_011229147.1), Can2 from Archaeoglobi archaeon JdFR-42 (AaCan2; (JGI) IMG gene accession=2730024700), Clostridium thermobutyricum (CtCan2; NCBI accession=WP_195972101.1), and Thermus thermophilus (TtCan2; NCBI accession=WP_143585921.1) were synthesized (GenScript) and cloned into pC0075 vector (Addgene #) in frame with the N-terminal His6- TwinStrep-SUMO tag using NcoI and XhoI restriction sites to replace the TtCsm6 gene. NucC from Clostridium tepidum BSD2780120874b_170522_A10 (CtNucC; NCBI accession=WP_195923598.1), Elioraea sp. Yellowstone (EsNucC; NCBI accession=WP_141855040.1) and Acidimicrobiales bacterium mtb01 (Amtb01NucC; NCBI accession=TEX45487.1), were cloned into pC0075 backbone using the same restriction sites as for Can1 and Can2 genes.
(275) Protein Expression and Purification
(276) Expression and purification of the TtCsm.sup.Csm3-D34A complex and TtCsm6 were performed as previously described [Reference 16]. To express and purify ancillary nucleases (TtCan1, AaCan2, CtCan2, TtCan2, CtNucC, EsNucC, and Amtb01NucC) the following protocol was used. The protein expression vector was transformed into Escherichia coli BL21(DE3) cells and grown in LB Broth (Lennox) (Thermo Fisher Scientific) at 37° C. to an OD600 of 0.5. Cultures were then incubated on ice for 1 hour, and then induced with 0.5 mM IPTG for overnight expression at 16° C. Cells were lysed with sonication in Lysis buffer (20 mM Tris-HCl pH 8, 500 mM NaCl, 1 mM TCEP) and lysate was clarified by centrifugation at 10,000 g for 25 mins, 4° C. The lysate was heat-treated at 55° C. for 45 minutes and clarified by centrifugation at 10,000 g for 25 minutes at 4° C. His6-TwinStrep-tagged protein was bound to StrepTrap HP column (Cytiva) and washed with Lysis buffer. The protein was eluted with Lysis buffer supplemented with 2.5 mM desthiobiotin and concentrated (10 k MWCO Corning Spin-X concentrators) at 4° C. Affinity tags were removed from the protein using His-tagged SUMO protease (100 μL of 2.5 mg/mL protease per 20 mg of protein) during dialysis against SUMO digest buffer (30 mM Tris-HCl pH 8, 500 mM NaCl,1 mM DTT, 0.15% Igepal) at 4° C. overnight. To remove the tag and the protease, dialyzed protein was applied to HisTrap HP column (Cytiva), and the flow-through was concentrated using Corning Spin-X concentrators at 4° C. Finally, the protein was purified using a HiLoad Superdex 200 26/600 size-exclusion column (Cytiva) in storage buffer)20 mM Tris-HCl pH 7.5, 1 mM DTT, 400 mM monopotassium glutamate, 5% glycerol). Fractions containing the target protein were pooled, concentrated, aliquoted, flash frozen in liquid nitrogen, and stored at −80° C.
(277) P32-Labeling of RNA Oligos
(278) Target (SARS-CoV-2 N1) and non-target RNAs were transcribed from PCR extended duplex oligos using home-made T7 RNA polymerase (Table 1, SEQ ID NOS. 48-51) (EUROFINS). The IVT RNAs were gel purified and dephosphorylated with Quick CIP (NEB) for 20 min at 37° C. in 1× CutSmart Buffer (NEB). The phosphatase was inactivated by heating at 80° C. for 5 min before 5′ end-labeling the RNAs with T4 polynucleotide kinase (NEB) and [γ-.sup.32P]-ATP (PerkinElmer) for 30 min at 37° C. The kinase was heat inactivated by heating at 65° C. for 20 minutes.
(279) Binding and pull-down of RNA oligos with TtCsm. For the experiments shown in
(280) Complexing of TtCsm with Magnetic Beads
(281) The HisPur Ni-NTA Magnetic beads (ThermoFisher) were washed two times with a 1× Binding Buffer (25 mM HEPES, pH 7.5, 150 mM NaCl, 1 mM TCEP). For one reaction, 5 μL of equilibrated beads were mixed with TtCsm.sup.dead complex (25 nM) in 1× Binding Buffer (V=50 μL) and incubated for 30 min on ice. The beads with the complex (Csm-beads) were concentrated with a magnet and resuspended in 5 μL of 1× Binding Buffer.
(282) Thin-Layer Chromatography (TLC)
(283) For the experiments shown in
(284) Samples (1 μL) were mixed with 100 mM sodium acetate, pH 5.2 (2 μL) and spotted 1.5 cm above the bottom of the TLC plate. The plate was placed inside a 2 L beaker filled to ˜0.5 cm with developing solvent (0.2 M ammonium bicarbonate pH 9.3, 70% ethanol and 30% water) and capped with aluminum foil. The plate was run for 2 h at room temperature and dried. TLC plate was exposed to a phosphor screen and imaged with Typhoon phosphor imager. Chemically synthesized standards (2 uM) were resolved on the same TLC plate and visualized using UV shadowing.
(285) To test cA3 and cA4 hydrolysis in the presence of ancillary nuclease, radiolabeled cA3 and cA4 produced above were mixed with nuclease (500 nM) in the reaction buffer and incubated for 1 hour at 55° C. Reaction products were phenol-chloroform extracted and resolved using thin-layer chromatography (TLC) for 45 min as described above.
(286) Type III-Based RNA Detection
(287) 3 μL of RNA sample was mixed with 250 uM ATP, 25 nM TtCsm.sup.dead complex, 300 nM of nuclease (TtCsm6, AaCan2, or CtNucC) with corresponding reporter in a reaction buffer (20 mM Tris-HCl pH 7.8, 250 mM monopotassium glutamate, 10 mM ammonium sulfate, 1 mM TCEP (tris(2-carboxyethyl)phosphine)), 5 mM magnesium sulfate (for TtCsm6 and CtNucC) or 5 mM manganese(II) chloride (for AaCan2) in a 30 μL reaction. The reporter B8 (300 nM) was used for the reaction with TtCsm6, D7 (300 nM)—with AaCan2, and dsDNA probe (300 nM)—with CtNucC. Reactions were incubated at 55° C. Cleavage of fluorescent reporters was detected by measuring fluorescence every 10 sec in a real-time PCR instrument QuantStudio 3.
(288) Type III-Based RNA Pull-Down and Detection
(289) To bind TtCsm.sup.dead complex with the magnetic beads, the HisPur Ni-NTA Magnetic beads (ThermoFisher) were washed two times with a 1× Binding Buffer (25 mM HEPES, pH 7.5, 150 mM NaCl, 1 mM TCEP). For one reaction, 5 μL of equilibrated beads were mixed with TtCsm.sup.dead complex (30 nM) in 1× Binding Buffer (V=50 μL) and incubated for 30 min on ice. The beads with the complex (Csm-beads) were concentrated with a magnet and resuspended in 5 μL of 1× Binding Buffer.
(290) Pull-down and detection from RNA sample: 120 μL of sample was mixed with 5 μL of Csm-beads in 1× Binding Buffer for 10 min at 60° C. The Csm-beads were concentrated with a magnet and the supernatant was discarded. The Csm-beads pellet was resuspended in 20 μL of the 1× reaction buffer (20 mM Tris-HCl pH 7.8, 250 mM monopotassium glutamate, 10 mM ammonium sulfate, 1 mM TCEP (tris(2-carboxyethyl)phosphine)), 5 mM magnesium sulfate/manganese(II) chloride) containing ATP (250 uM). The reaction was incubated 10 min at 60° C., the Csm-beads were pelleted, and the supernatant (10 μL) was transferred to a new reaction with TtCsm6 (300 nM) and B8 RNA Reporter (300 nM) or AaCan2 (300 nM) and D7 RNA Reporter (300 nM) in 1× reaction buffer (V=30 μL). Reactions were incubated at 55° C. Cleavage of the fluorescent RNA reporter was detected by measuring fluorescence every 10 sec in a real-time PCR instrument QuantStudio 3.
(291) Pull-down and detection from nasopharyngeal swab: 120 μL of a nasopharyngeal swab was mixed with 5 μL of Csm-beads in 1× Lysis Buffer and incubated for 20 min at 65° C. Ten lysis buffers compositions were tested. All buffer contained 25 mM HEPES, pH 7.5, 150 mM NaCl, 1 mM TCEP and were supplemented with (A) 0.025% Triton X-100, (B) 0.025% Triton X-100 and 1 mM EDTA, (C1) 0.025% Triton X-100 and 1 mM EGTA, (C2) 0.05% Triton X-100 and 1 mM EGTA, (C3) 0.1% Triton X-100 and 1 mM EGTA, (I) 0.025% NP-40, (J) 0.025% NP-40 and 1 mM EDTA, (K1) 0.025% NP-40 and 1 mM EGTA, (K2) 0.05% NP-40 and 1 mM EGTA, or (K3) 0.1% NP-40 and 1 mM EGTA. The Csm-beads were concentrated with a magnet and the supernatant was discarded. The Csm-beads pellet was resuspend in 20 μL of the 1× reaction buffer (20 mM Tris-HCl pH 7.8, 250 mM monopotassium glutamate, 10 mM ammonium sulfate, 1 mM TCEP (tris(2-carboxyethyl)phosphine)), 5 mM magnesium sulfate/manganese(II) chloride) containing ATP (250 uM). The reaction was incubated 10 min at 65° C., the Csm-beads were pelleted, and the supernatant (10 μL) was transferred to a new reaction with TtCsm6 (300 nM) and B8 RNA Reporter (300 nM) or AaCan2 (300 nM) and D7 RNA Reporter (300 nM) in 1× reaction buffer (the final volume of a reaction 30 μL). Reactions were incubated at 55° C. Cleavage of fluorescent RNA reporter was detected by measuring fluorescence every 10 sec in a real-time PCR instrument QuantStudio 3.
(292) RT-qPCR
(293) RT-qPCR was performed using N1 and RP CDC primers (2019-nCoV CDC EUA Kit, IDT #10006606). RNA was extracted from patient samples with QIAamp Viral RNA Mini Kit (QIAGEN, #52906) and used for one-step RT-qPCR in ABI 7500 Fast Real-Time PCR Syste according to CDC guidelines and protocols (https[colon][doubleslash] www[dot]fda[dot]gov[slash]media[slash]134922[slash]download). In brief, 20 μL reaction included 8.5 μL of Nuclease-free Water, 1.5 μL of Primer and Probe mix (IDT, 10006713), 5 μL of TaqPath 1-Step RT-qPCR Master Mix (ThermoFisher, A15299) and 5 μL of the RNA. Nuclease-free water was used as negative template control (NTC). Amplification was performed as follows: 25° C. for 2 min, 50° C. for 15 min, 95° C. for 2 min followed by 45 cycles of 95° C. for 3 s and 55° C. for 30 s. To quantify viral RNA in the samples, standard curve for N1 primers was generated using a dilution series of a SARS-CoV-2 synthetic RNA fragment (RTGM 10169, NIST) spanning N gene with concentrations ranging from 10 to 10.sup.6 copies per μL. Three technical replicates were performed at each dilution. The NTC showed no amplification throughout the 45 cycles of qPCR.
(294) Nanopore Sequencing of DNA Cleavage Fragments
(295) DNA cleavage fragments were sequenced using Oxford Nanopore with Ligation Sequencing Kit (SQK-LSK109). After incubation with TtCan1 or NucC nucleases, cleavage fragments were column-purified using DNA Clean & Concentrator-5 kit (Zymo Research, D4004) as instructed. Next, for each sample 50 ng of purified DNA was used to prepare sequencing libraries with NEBNext® Ultra™ II DNA Library Prep Kit (NEB, E7645S). Briefly, DNA was end-repaired with NEBNext Ultra II End Prep Enzyme Mix, which fills 5′- and removes 3′-overhangs. Next, end-repaired fragments were barcoded with Native Barcoding Expansion kit (ONT, EXP-NBD104) using Ultra II Ligation Master Mix (NEB). Barcoded DNA fragments were pooled together and purified with magnetic beads (Omega Bio-tek, M1378-01). Freshly mixed 80% ethanol was used to wash magnetic bead pellet. Sequencing adapters (AMII) were ligated to barcoded DNA using NEBNext® Quick Ligation Module (NEB, E6056S). Ligation reactions were purified with magnetic beads. SFB buffer (ONT, EXP-SFB001) was used for washes. Resulting DNA library was eluted from the beads in 20 μL of EB buffer (QIAGEN, #19086). DNA concentration was measured with Qubit dsDNA HS Assay (ThermoFisher, Q32851), and 20 ng was loaded on the Nanopore MinION (R9.4.1 flow cell). The flow cell was primed, and library was loaded according to Oxford Nanopore protocol (SQK-LSK109 kit). The sequencing run was performed in the high-accuracy base calling mode in the MinKNOW software.
(296) Sequencing Data Analysis
(297) Base called reads were demultiplexed using guppy-barcoder (ONT) and aligned with minimap2 v2.17-r954-dirty (ax map-ont mode) to the reference plasmid sequence that was modified by adding 1000 bp overlaps at the 5′- and 3′-ends. Overlapping regions were introduced to account for circular nature of the plasmid. Resulting alignments (BAM files) were sorted and indexed using samtools v1.13. Next, bamtobed function in bedtools package was used to generate BED files and read coordinates were extracted. Oxford Nanopore platform reads through a more than a hundred kilobase pairs long DNA sequences47. Therefore, we regarded generated reads as complete sequences of cleavage fragments and read ends as cut sites. Read end coordinates were used to calculate cleavage fragment length distributions and map frequencies of cuts at specific locations (
(298) RNA Reporter's Library
(299) To determine the optimal RNA reporter for each cOA-activated nuclease, we constructed a library of variable RNA sequences tethering a FAM fluorophore to an Iowa Black quencher. These reporters were designed as single-stranded RNA molecules (i.e., 5′-FAM-AUNNNNNNAU-IABkFQ-3′; variable region underlined) or to produce a structured RNA (e.g., 5′-FAM-CGCGNNNNNNCGCG-IABkFQ-3′; variable region underlined). The Biostrings package in R was used to construct a library of reporter sequences containing each of the 64 unique trinucleotide combinations possible. Since multiple unique trinucleotides could be included in a single reporter (e.g. 5′-FAM-AUAGAAGAAU-IABkFQ-3′ contains AGA, GAA and AAG), we narrowed our initial library of 64 reporters to remove redundant sequences. This resulted in a library of 24 unique reporter sequences, each of which were integrated into both a single-stranded RNA reporter and a structured RNA reporter (Table 1). The R-script used to design these reporters is accessible on GitHub (WiedenheftLab/RNA_reporter_design).
(300) In Vitro DNA and RNA Cleavage Assays
(301) All reactions were performed in a buffer containing 20 mM Tris-HCl pH 7.8, 250 mM monopotassium glutamate, 10 mM ammonium sulfate, 1 mM TCEP, 5 mM magnesium sulfate or 5 mM manganese chloride. Plasmid DNA cleavage assays were performed by incubating 1 μg of Lenti-luciferase-P2A-Neo (Addgene #105621) plasmid with TtCan1, AaCan2 or CtNucC (15-200 nM) in the presence of cOAx (15-45 nM) in 10 μL reaction. After 5-15 min incubation at 60° C. for TtCan1 and 55° C. for both AaCan2 and CtNucC, Gel Loading Dye, Purple (6×) (NEB) was added and 4 μL was loaded on 1% agarose gel. For ssDNA and ssRNA cleavage assays, 0.425 uM of 71 nt DNA oligo (CGTCGTACCGGTTAGAGGATGGTGCAAGCGTAATCTGGAACATCGTATGGGTATG CCCACGGTGTCCACGGCG, Eurofins) or 0.425 uM of 74 nt IVT RNA SARS-CoV-2 N-gene (Table 1, SEQ ID NOS. 48-51) were incubated with TtCan1 (200 nM) or AaCan2 (200 nM) in the presence of cOAx (20-45 nM) in 10 μL. After 5-15 min incubation at 60° C. for TtCan1 and at 55° C. for AaCan2, 2×RNA Loading Dye (NEB) was added and 10 μL was loaded on 12% UREA PAGE.
(302) Phylogenetic Analysis of Can1 and Can2 Proteins
(303) A DELTA-BLAST was initiated, using previously described Can1 and Can2 proteins as queries29-31 to generate individual lists of closely related proteins with an e-value cutoff of 10-4 and 50% query coverage. The resulting sequences were then used as queries to initiate a PSI-BLAST search with an e-value cutoff of 10-4 and 50% query coverage. This step was repeated until convergence and redundant sequences were removed with CD-HIT v4.748. Can1 sequences, which contain two CARF domains and a nuclease domain, were also retrieved from a previously published dataset14 and were merge with non-redundant sequences identified via PSI-BLAST to generate multiple sequence alignments. In total, 29 sequences of Can1-related proteins and 2,531 sequences of Can2-related proteins were used separately to generate multiple sequence alignment with a local version of MAFFT v7.42949 (--localpair --maxiterate 1000). The generated alignments for Can1 and Can2 were curated with MaxAlign v1.150 to remove misaligned or non-homologous sequences. The resulting dataset—comprised of 29 Can1-like and 1,283 Can2-like proteins, respectively—were then individually realigned with MAFFT and HMMbuild51 (HMMER v3.2.1) was used to generate HMM profiles from each alignment. The resulting profiles were used to search a local database of prokaryotic genomes from NCBI (downloaded on Jun. 11, 2021). An initial search performed with these HMM profiles identified 1,442 Can1 and 5,431 Can2 homologs, which were manually filtered according to the presence of domains that define each protein, as well as the presence of conserved residues found in CARF and nuclease domains. The resulting set of 204 Can1 and 3,121 Can2 proteins were merged into a single file and aligned in MAFFT (LINSI option) for downstream phylogenetic analyses. Next, Trimal v1.452 was used to remove columns in the alignment comprised of ≥70% gaps. ProtTest v3.4.253 was used to select an evolutionary model, and a phylogenetic tree was constructed in IQ-TREE v1.6.154 using the recommended model (i.e., LG+G+F). The phylogenetic tree was plotted using the ggTree package in R55.
(304) Phylogenetic Analysis of NucC
(305) A phylogenetic tree of NucC proteins was generated using the same methods as described above for Can1/Can2 proteins. Briefly, DELTA-BLAST and PSI-BLAST searches with previously identified NucC proteins [Reference 32] generated a list of closely related proteins (e-value cutoff of 10-4 and minimum 50% query coverage). The resulting dataset was filtered with CD-HIT v4.7 to remove redundant sequences. The resulting 1,230 NucC sequences were aligned with MAFFT (--localpair --maxiterate 1000), and poorly aligned and highly gapped sequences were removed with MaxAlign. The resulting set of 896 NucC sequences were re-aligned with MAFFT as previously described, and the resulting alignment was used to generate a NucC HMM profile which we used to search within prokaryotic genomes from NCBI. This search identified 1,774 hits, which were filtered according to the presence of restriction endonuclease-like domain (i.e., IDx30EAK-motif containing), gate-loop and cA3 binding domains and were aligned with MAFFT. The resulting alignment of 1,510 NucC proteins was used to generate a phylogenetic tree with FastTree v2.1.1056 and was plotted using the ggTree package in R.
(306) Quantification and Statistical Analysis
(307) All statistical analyses were performed in RStudio. Analysis of Variance Models (ANOVA) were calculated with aov( ) function in stats R package. Multiple comparisons between positive samples and negative controls were performed using Dunnett's test with multcomp R package. Reaction slopes were determined by extracting coefficients from linear models fitted to fluorescence data with lm( ) function in R. The linear regions of the fluorescence curves were identified using rolling regression with auto_rate( ) function in respR package. Patient samples (n=17) for viral detection assays were randomly selected from a sample database (n=858) with base R function sample( ).
(308) Statistical threshold for detecting SARS-CoV-2 in patient samples with Csm-based assay was set as mean of negative control ±2.33 SD, which captures 98% of variation in negative samples (2% false positive). Samples with z-score>2.33 were considered positive for SARS-CoV-2. Z-scores were calculated in R using following formula: Z=(Fsample−μneg)/σneg, where Fsample is fluorescence measured in a sample, μneg is mean of negative control, σneg is standard deviation of negative control. Statistical significance levels used in the figures are *** p<0.001, ** p<0.01, and * p<0.05.
(309) Lateral-Flow Based Readouts of Type III CRISPR Diagnostics
(310) Type III CRISPR-Based RNA Detection with Lateral-Flow Assay Readout.
(311)
(312) At panel c, if TtCsm.sup.Csm3-D34A detects target RNA (+) and polymerizes ATP, cA4-activated TtCsm6 cleaves RNA reporter and releases FITC (F) from biotin (B). All anti-FITC Abs migrate to the control line and the test line remains uncolored. At panel d, an lateral-flow assay is used to detect SARS-CoV-2 N-gene RNA diluted in total human RNA (HEK 293T cells) as shown in panel a.
(313)
(314)
(315)
(316)
(317) The protospacer flanking sequence and length affects ATP polymerization by type III CRISPR surveillance complexes.
(318)
(319)
(320)
(321) Discussion of
(322) The Type III CRISPR-Cas systems have recently been repurposed for sequence-specific detection of SARS-CoV-2 genomic RNA. Here, we show that type III CRISPR diagnostics can be modified for a lateral-flow-based readout.
(323) The binding of Type III surveillance complexes to target RNA, activates two activities in the Cas10 subunit, an HD nuclease activity and a polymerase activity. The activated Cas10 subunit polymerizes nucleotide triphosphates (e.g., ATP) into a mixture of linear (e.g., Ax, where “x” is the number of adenosines in the polymer) and cyclic oligonucleotides (cAx).
(324) Cyclic oligoadenylates can be indirectly measured by the activation of effectors with different enzymatic activities (e.g. nucleases, peptidases, pore-forming toxins). The activity of nucleases [References 57-60] and peptidases can be measured by cleavage of an RNA, DNA or peptide tether that is labelled i) on either end with a fluorophore-quencher pair (cleavage detected by bulk fluorescence or digital enzymology), ii) on either end with a fluorophore and/or digoxigenin and/or biotin (cleavage detected by lateral flow, surface-enhanced Raman spectroscopy lateral flow), iii) with multiple gold nanoparticles (cleavage detected by bulk colorimetric or digital enzymology), iv) on one end with a redox-active molecule (e.g., methylene blue) and linked on the other end to a gold electrode (cleavage detected by amperometric bio sensor).
(325) After type III CRISPR-based capture and concentration of target RNA from a complex sample (
(326) There is often a concern of RNase contamination when non-experts perform diagnostic assays which may lead to a false positive result in diagnostics that rely on RNA reporters. To get around this issue we can repurpose ancillary DNases that are activated by the cyclic oligoadenylates synthesized by type III CRISPR surveillance complexes. As a proof-of-concept, we show that low amounts (10 nM) of pure cA3 activate TtCan1 to rapidly (5 minutes) cleave a DNA reporter labelled with biotin and digoxigenin (
(327) The sequence and length of the Protospacer Flanking Sequence impacts ATP polymerization by type III CRISPR surveillance complexes
(328) The sequence identity of nucleotides located downstream (3′) of the protospacer sequence can impact the production of cyclic oligoadenylates by target RNA-bound type III CRISPR surveillance complexes [References 61, 62]. Here, we computationally predict the protospacer flanking sequences (PFS) for one type III CRISPR surveillance complex (TtCsm) and experimentally test the impact of PFS sequences on Cas10-mediated polymerization, by measuring pyrophosphate production using a Calcein-based assay.
(329) A PFS motif that is predicted to stimulate the Cas10 polymerase of the TtCsm type III CRISPR surveillance complex was bioinformatically identified by collating a list of type III CRISPR arrays with repeats similar (80% sequence identity) to the CRISPR repeat associated with the TtCsm complex (
(330) The polymerization of ATP into cyclic oligoadenylates by target RNA-bound type III CRISPR surveillance complexes can be measured with a Calcein-based assay 8 (
(331) Collectively, these results enable the design of sensitive crRNA-guides which target sequences with PFSs that stimulates robust cyclic oligoadenylate production by the type III CRISPR surveillance complex. Second, the design of specific guide RNA sequences will be assisted by ensuring that off-target RNAs have a PFS that inhibits cyclic oligoadenylate production. Third, robust detection of short RNA sequences (e.g., microRNAs, siRNAs, etc.) via methods that require Cas10-mediated polymerase activity will require a PFS.
(332) TABLE-US-00001 TABLE 1 Sequence Listing. Fluorescent RNA and DNA reporters in which variable regions of sequence are underlined. All sequences each have 5-Carboxyfluorescein (FAM) dye at the 5′ end. SEQ ID NOS. 1-46 each have Iowa Black FQ quencher (IABkFQ) at the 3′ end. SEQ ID NO. 47 has Black Hole Quencher (BHQ) dye at the 3′ end. SEQ ID NOS. 48-51 include oligonucleotide primers used to generate DNA templates for in vitro transcription with T7 polymerase. SEQ ID NO. Sequence Description 1 5′-FAM-AUAAAAAAAU-IABkFQ ssRNA Reporter (Variable region underlined); Trinucleotides: AAA; class: non-structured 2 5′-FAM-AUAACAACAU-IABkFQ ssRNA Reporter (Variable region underlined); Trinucleotides: AAC, ACA, CAA; class: non-structured 3 5′-FAM-AUAAGAAGAU-IABkFQ ssRNA Reporter (Variable region underlined); Trinucleotides: AAG, AGA, GAA; class: non-structured 4 5′-FAM-AUAAUAAUAU-IABkFQ ssRNA Reporter (Variable region underlined); Trinucleotides: AAU, AUA, UAA; class: non-structured 5 5′-FAM-AUACCACCAU-IABkFQ ssRNA Reporter (Variable region underlined); Trinucleotides: ACC, CCA, CAC; class: non-structured 6 5′-FAM-AUACGACGAU-IABkFQ ssRNA Reporter (Variable region underlined); Trinucleotides: ACG, CGA, GAC; class: non-structured 7 5′-FAM-AUACUACUAU-IABkFQ ssRNA Reporter (Variable region underlined); Trinucleotides: ACU, CUA, UAC; class: non-structured 8 5′-FAM-AUAGCAGCAU-IABkFQ ssRNA Reporter (Variable region underlined); Trinucleotides: AGC, GCA, CAG; class: non-structured 9 5′-FAM-AUAGGAGGAU-IABkFQ ssRNA Reporter (Variable region underlined); Trinucleotides: AGG, GGA, GAG; class: non-structured 10 5′-FAM-AUAGUAGUAU-IABkFQ ssRNA Reporter (Variable region underlined); Trinucleotides: AGU, GUA, UAG; class: non-structured 11 5′-FAM-AUAUCAUCAU-IABkFQ ssRNA Reporter (Variable region underlined); Trinucleotides: AUC, UCA, CAU; class: non-structured 12 5′-FAM-AUAUGAUGAU-IABkFQ ssRNA Reporter (Variable region underlined); Trinucleotides: AUG, UGA, GAU; class: non-structured 13 5′-FAM-AUAUUAUUAU-IABkFQ ssRNA Reporter (Variable region underlined); Trinucleotides: AUU, UUA, UAU; class: non-structured 14 5′-FAM-AUCCCCCCAU-IABkFQ ssRNA Reporter (Variable region underlined); Trinucleotides: CCC; class: non-structured 15 5′-FAM-AUCCGCCGAU-IABkFQ ssRNA Reporter (Variable region underlined); Trinucleotides: CCG, CGC, GCC; class: non-structured 16 5′-FAM-AUCCUCCUAU-IABkFQ ssRNA Reporter (Variable region underlined); Trinucleotides: CCU, CUC, UCC; class: non-structured 17 5′-FAM-AUCGGCGGAU-IABkFQ ssRNA Reporter (Variable region underlined); Trinucleotides: CGG, GGC, GCG; class: non-structured 18 5′-FAM-AUCGUCGUAU-IABkFQ ssRNA Reporter (Variable region underlined); Trinucleotides: CGU, GUC, UCG; class: non-structured 19 5′-FAM-AUCUGCUGAU-IABkFQ ssRNA Reporter (Variable region underlined); Trinucleotides: CUG, UGC, GCU; class: non-structured 20 5′-FAM-AUCUUCUUAU-IABkFQ ssRNA Reporter (Variable region underlined); Trinucleotides: CUU, UUC, UCU; class: non-structured 21 5′-FAM-AUGGUGGUAU-IABkFQ ssRNA Reporter (Variable region underlined); Trinucleotides: GGU, GUG, UGG; class: non-structured 22 5′-FAM-AUGUUGUUAU-IABkFQ ssRNA Reporter (Variable region underlined); Trinucleotides: GUU, UUG, UGU; class: non-structured 23 5′-FAM-AUUUUUUUAU-IABkFQ ssRNA Reporter (Variable region underlined); Trinucleotides: UUU; class: non-structured 24 5′-FAM-CGCGAAAAAACGCG- ssRNA Reporter (Variable region IABkFQ-3 underlined); Trinucleotides: AAA; class: Structured 25 5′-FAM-CGCGAACAACCGCG- ssRNA Reporter (Variable region IABkFQ-3′ underlined); Trinucleotides: AAC, ACA, CAA; class: Structured 26 5′-FAM-CGCGAAGAAGCGCG- ssRNA Reporter (Variable region IABkFQ-3′ underlined); Trinucleotides: AAG, AGA, GAA; class: Structured 27 5′-FAM-CGCGAAUAAUCGCG- ssRNA Reporter (Variable region IABkFQ-3′ underlined); Trinucleotides: AAU, AUA, UAA; class: Structured 28 5′-FAM-AUAUACCACCAUAU- ssRNA Reporter (Variable region IABkFQ-3′ underlined); Trinucleotides: ACC, CCA, CAC; class: Structured 29 5′-FAM-AUAUACGACGAUAU- ssRNA Reporter (Variable region IABkFQ-3′ underlined); Trinucleotides: ACG, CGA, GAC; class: Structured 30 5′-FAM-CGCGACUACUCGCG- ssRNA Reporter (Variable region IABkFQ-3′ underlined); Trinucleotides: ACU, CUA, UAC; class: Structured 31 5′-FAM-AUAUAGCAGCAUAU- ssRNA Reporter (Variable region IABkFQ-3′ underlined); Trinucleotides: AGC, GCA, CAG; class: Structured 32 5′-FAM-AUAUAGGAGGAUAU- ssRNA Reporter (Variable region IABkFQ-3′ underlined); Trinucleotides: AGG, GGA, GAG; class: Structured 33 5′-FAM-CGCGAGUAGUCGCG- ssRNA Reporter (Variable region IABkFQ-3′ underlined); Trinucleotides: AGU, GUA, UAG; class: Structured 34 5′-FAM-CGCGAUCAUCCGCG- ssRNA Reporter (Variable region IABkFQ-3′ underlined); Trinucleotides: AUC, UCA, CAU; class: Structured 35 5′-FAM-CGCGAUGAUGCGCG- ssRNA Reporter (Variable region IABkFQ-3′ underlined); Trinucleotides: AUG, UGA, GAU; class: Structured 36 5′-FAM-CGCGAUUAUUCGCG- ssRNA Reporter (Variable region IABkFQ-3′ underlined); Trinucleotides: AUU, UUA, UAU; class: Structured 37 5′-FAM-AUAUCCCCCCAUAU- ssRNA Reporter (Variable region IABkFQ-3 underlined); Trinucleotides: CCC; class: Structured 38 5′-FAM-AUAUCCGCCGAUAU- ssRNA Reporter (Variable region IABkFQ-3′ underlined); Trinucleotides: CCG, CGC, GCC; class: Structured 39 5′-FAM-AUAUCCUCCUAUAU- ssRNA Reporter (Variable region IABkFQ-3′ underlined); Trinucleotides: CCU, CUC, UCC; class: Structured 40 5′-FAM-AUAUCGGCGGAUAU- ssRNA Reporter (Variable region IABkFQ-3′ underlined); Trinucleotides: CGG, GGC, GCG; class: Structured 41 5′-FAM-AUAUCGUCGUAUAU- ssRNA Reporter (Variable region IABkFQ-3′ underlined); Trinucleotides: CGU, GUC, UCG; class: Structured 42 5′-FAM-AUAUCUGCUGAUAU- ssRNA Reporter (Variable region IABkFQ-3′ underlined); Trinucleotides: CUG, UGC, GCU; class: Structured 43 5′-FAM-CGCGCUUCUUCGCG- ssRNA Reporter (Variable region IABkFQ-3′ underlined); Trinucleotides: CUU, UUC, UCU; class: Structured 44 5′-FAM-AUAUGGUGGUAUAU- ssRNA Reporter (Variable region IABkFQ-3′ underlined); Trinucleotides: GGU, GUG, UGG; class: Structured 45 5′-FAM-CGCGGUUGUUCGCG- ssRNA Reporter (Variable region IABkFQ-3′ underlined); Trinucleotides: GUU, UUG, UGU; class: Structured 46 5′-FAM-CGCGUUUUUUCGCG- ssRNA Reporter (Variable region IABkFQ-3′ underlined); Trinucleotides: UUU; class: Structured 47 5′-FAM- dsDNA Reporter TGAACTGAACTGAACTGAACTG AACTGAACTAGTTCAGTTCAGT TCAGTTCAGTTCAGTTCA-BHQ- 3′ 48 GATAATACGACTCACTATAGGG SARS-CoV-2 N1 T7 template Forward; AACTGATTACAAACATTGGCCG Oligonucleotide primer used to generate CAAATTGCACAATT DNA templates for in vitro transcription with T7 polymerase 49 GCGCGACATTCCGAAGAACGCT SARS-CoV-2 N1 T7 template Reverse; GAAGCGCTGGGGGCAAATTGTG Oligonucleotide primer used to generate CAATTTGCGGCC DNA templates for in vitro transcription with T7 polymerase 50 GATAATACGACTCACTATAGGG SARS-CoV-1 N1 T7 template Forward; AACTGATTACAAACATTGGCCG Oligonucleotide primer used to generate CAAATTGCACAATT DNA templates for in vitro transcription with T7 polymerase 51 GCGTGACATTCCAAAGAATGCA SARS-CoV-1 N1 T7 template Reverse; GAGGCACTTGGAGCAAATTGTG Oligonucleotide primer used to generate CAATTTGCGGCC DNA templates for in vitro transcription with T7 polymerase
(333) TABLE-US-00002 TABLE 2 RNase P RNA levels in nasopharyngeal swab samples and diluted total RNA from HEK 293T cells used as negative control. Ct value (RP primers, 2019-nCoV CDC Sample EUA Kit, IDT#10006606) RNA patient sample 1 26.85 RNA patient sample 2 24.73 RNA patient sample 3 35.41 RNA patient sample 4 28.29 RNA patient sample 5 28.58 RNA patient sample 6 20.36 RNA patient sample 7 25.24 RNA patient sample 8 25.14 RNA patient sample 9 28.15 RNA patient sample 10 30.37 Total RNA from HEK293T 23.35 (diluted)
(334) TABLE-US-00003 TABLE 3 Examples of nuclease sequences. SEQ ID NO: Gene sequence, codon optimized for expression SEQ ID NO: Protein Nuclease Organism Accession in E. coli sequence Amtb01NucC Acidimicrobiales NCBI: SEQ ID NO.: 52 SEQ ID NO.: 53 (TexNucC) bacterium TEX45487.1 atgACACCAGCCAATGGAC MTPANGLEAYFAALQD mtb01 TTGAGGCTTATTTCGCGGC RLQASIKVAAVLDHPGA TCTTCAAGACCGTTTGCAG KGDETEISWERLLDGHL GCGTCGATTAAAGTTGCAG PRRYQVVPKCMFVDHT CAGTATTGGATCACCCGGG GKLSQEVDLALCDRQYS TGCGAAAGGAGATGAGAC TLALESQSRTVVPAEAA GGAGATTAGTTGGGAACG YAVFEVKPELNRENVLY CCTGTTGGACGGTCACCTT AAEKAASVRVLARTSAP CCCCGCCGCTACCAAGTTG ITDARGVIEEPRRPSPIIA TACCGAAGTGCATGTTTGT GLLTTRAGWSPTLGDA TGATCATACCGGGAAGTTA FSAALKDQNSNGLLNLG TCACAAGAAGTAGACTTG CVLGEIGWEVKYENNIP GCACTTTGTGATCGTCAAT RWAASTPSRALVFFYLR ATAGCACTCTGGCTCTGGA LLSALQRVGTVPAMDY ATCTCAGTCGCGTACAGTC DQWSAFLSHD GTCCCTGCGGAAGCGGCTT ACGCCGTGTTTGAGGTAAA ACCGGAACTTAACCGTGAA AATGTTTTATATGCTGCGG AAAAAGCTGCTTCCGTGCG CGTTTTAGCCCGCACGTCT GCACCGATTACGGATGCTC GTGGTGTTATTGAGGAGC CCCGCCGTCCGTCGCCGAT TATTGCGGGACTTCTTACG ACGCGTGCAGGTTGGTCTC CTACTTTGGGCGATGCCTT CTCGGCGGCGCTTAAAGAT CAGAACAGCAATGGATTA CTGAACTTGGGCTGTGTAC TGGGAGAGATCGGCTGGG AGGTGAAATATGAAAACA ACATCCCACGCTGGGCCGC CTCGACTCCCAGTCGCGCG CTGGTGTTTTTTTATTTGCG TCTGCTGTCCGCTCTTCAG CGTGTGGGCACAGTACCC GCTATGGACTACGACCAAT GGTCAGCATTTTTATCGCA TGACTGA CtNucC Clostridium NCBI: SEQ ID NO.: 54 SEQ ID NO.: 55 tepidum WP_195923598.1 atgAAATCCACAGGACGTC MGQIDIKSLFYSLQTQM GTCTTTTTGGCAAGCAAGG CAKLSTNRQHIQHPGIK GGGGTCGGACATGGGTCA GDSSELNWIEWLKTYLP GATTGATATCAAGAGCTTG KRYSVDKAFIIDCDGNM TTCTATAGCCTTCAAACGC SDQIDVVIYDQQYSPFV AGATGTGTGCAAAATTATC FNQDNAYYIPAESVYAI TACCAACCGTCAGCACATC FEVKQEINKENIIYAGDK CAACACCCTGGGATTAAAG TKSVRSLKRTSTAIPHAG GGGACTCATCCGAGTTGA GYYAPKPHNKILSGILTL ATTGGATTGAGTGGCTTAA SSVWNPPLGKSFEEAIY AACGTACCTGCCTAAACGC SLEDESKLDIGCILAEGSF TACAGTGTCGATAAAGCAT LADYKNDVLMKSTEEES TTATCATTGATTGTGACGG LIFFFLKLLIELQSLGTTP AAATATGTCTGACCAAATC AIDINCYGRALDSI GACGTAGTAATCTACGATC AACAGTATTCGCCCTTCGT TTTCAACCAGGATAACGCC TATTATATCCCAGCCGAGT CGGTGTACGCTATTTTCGA AGTTAAGCAAGAAATCAA CAAAGAGAACATTATCTAC GCCGGTGATAAGACCAAG TCGGTCCGCAGTCTGAAAC GCACTTCCACGGCCATTCC TCACGCAGGAGGTTACTAT GCGCCTAAACCGCACAACA AAATCCTGAGCGGCATCTT AACTTTATCGAGCGTATGG AATCCGCCTTTAGGCAAGT CATTTGAAGAAGCTATCTA CTCTTTAGAAGATGAGTCA AAGTTAGATATCGGCTGTA TCTTAGCTGAAGGGTCATT CCTTGCAGATTATAAGAAT GATGTTCTGATGAAATCGA CCGAAGAAGAATCCTTGAT TTTTTTCTTTCTGAAATTAC TGATCGAGTTACAATCTCT GGGGACCACTCCGGCAAT TGATATTAATTGCTACGGT CGCGCCCTGGATTCAATTT AA EsNucC Elioraea sp. NCBI: SEQ ID NO.: 56 SEQ ID NO.: 57 WP_141855040.1 atgAGTGGTTTCAGTTTACC MSGFSLPKLLAGLHDTI AAAGTTGCTGGCGGGGCT EHRLKLARETMGHPVN GCACGACACCATTGAACAT KGDASEAVWLDLLQTY CGCCTTAAGCTGGCCCGTG LPRRYKAAKAHVVDST AAACGATGGGACATCCGG GAFSEQIDVVVFDRQYS TTAACAAAGGCGATGCTTC PLVFQHEGQTIIPAESVY TGAGGCAGTATGGCTGGA AVFEAKQSIAAPEITYAH TCTGTTACAAACGTATCTG RKVASVRRLHRTSLPIPH CCCCGTCGCTACAAAGCGG AGGTYPPKPLSRILAGLL CCAAGGCGCATGTAGTTG TLESAWNPPLGQTLIDN ATAGTACCGGGGCATTCTC LCAGDDDSRLDLGCVA CGAGCAGATTGATGTAGTC AHGVFACDQAGVYWIR GTTTTCGATCGCCAGTACA PQGKAATAFLFELIARL GCCCATTGGTTTTCCAACA QETATVSMIDIRAYAR TGAGGGGCAAACAATCAT WLTAAPEQPST TCCAGCCGAAAGTGTATAT GCAGTCTTTGAGGCTAAGC AGAGTATTGCTGCACCTGA GATCACTTACGCACACCGC AAGGTAGCGAGCGTGCGC CGCTTGCATCGCACGAGCC TTCCGATCCCACATGCAGG CGGAACATATCCTCCGAAG CCGTTATCGCGTATCTTGG CAGGATTATTAACGTTGGA GTCGGCATGGAACCCGCC GCTTGGGCAAACGCTTATT GACAACTTGTGTGCCGGC GACGACGATTCCCGTCTTG ACTTAGGATGTGTTGCAGC ACATGGCGTCTTTGCCTGT GACCAGGCGGGTGTATAT TGGATTCGTCCGCAAGGG AAGGCGGCGACAGCATTC TTATTCGAGTTAATCGCCC GTTTGCAGGAGACGGCTA CCGTCTCGATGATCGACAT TCGCGCGTACGCTCGCTGG TTAACCGCTGCCCCAGAAC AGCCTTCCACCTGA AaCan2 Archaeoglobi JGI: SEQ ID NO.: 58 SEQ ID NO.: 59 archaeon JdFR- 2730024700 ATGAGTCACATTCATGTCT MSHIHVCLVSDQAIPNL 42 GTCTTGTATCTGACCAAGC TTALQFNPDTTVLLSTN AATTCCAAATCTGACAACA EMKDKAKRLETVLKNK GCTCTTCAATTTAACCCCG GLKVKTLKISAYDINDVI ATACTACGGTGTTATTATC TVSESLLNDCKGCKVSL CACAAACGAAATGAAGGA NITGGTKIGTLGTFQVFY CAAAGCCAAACGTTTGGA TASKPIFYVNTKDNEIIKL AACCGTATTGAAGAACAA YPEKEQQKYPIEISISIKD AGGTTTAAAGGTAAAAAC YLAVYGFNVKSYVKDDS CTTGAAGATCTCGGCGTAT YIYKRKKVTDYLANLVIH GACATCAACGACGTGATTA RPNIIGEINYKLQNFEEK CAGTTTCGGAATCCTTGTT SYPLKINITKNKQVIKLY GAATGATTGTAAAGGCTG DILKDSGLVKIRNKSTIEI CAAAGTGTCCCTTAACATT PDVETAKYLNGIWFEEY ACAGGGGGCACTAAGATT VYMMAKSLGADEVKLN GGGACGCTTGGTACCTTCC VKGVWDTVGKHPPTN AGGTCTTTTACACTGCGAG EFDILISKGNRLFYISCKT CAAACCGATTTTTTATGTC ANPDRKIDDTDETIGKE AACACGAAGGACAACGAG YLYELDSISDSALGLFGK ATCATTAAACTGTATCCCG RMLASARAIKNDYVRK AGAAAGAACAGCAGAAGT RAEILKIDIADGQNIATL ACCCGATTGAGATTAGCAT KGKLQQWLSK TTCAATCAAGGACTATTTG GCAGTGTACGGATTCAAC GTTAAGAGTTATGTCAAGG ACGACTCCTACATCTACAA ACGTAAGAAGGTAACTGA CTATCTTGCAAATCTGGTA ATCCATCGTCCCAATATCA TCGGTGAAATCAACTATAA GTTACAAAATTTTGAAGAA AAGTCCTATCCTCTGAAGA TTAACATCACTAAAAATAA GCAGGTCATTAAGCTTTAT GATATTTTAAAGGATTCCG GCCTTGTTAAAATCCGCAA TAAAAGTACGATCGAAATC CCAGATGTTGAGACTGCAA AGTATTTGAATGGCATTTG GTTCGAGGAATATGTTTAT ATGATGGCTAAGTCCCTTG GCGCCGATGAAGTGAAAT TGAATGTGAAAGGGGTAT GGGACACAGTCGGAAAGC ATCCGCCGACTAACGAGTT TGATATTTTGATTAGCAAG GGTAACCGTTTATTTTATA TCAGTTGTAAGACTGCGAA TCCGGATCGTAAGATTGAT GATACGGATGAGACAATC GGGAAGGAATACCTGTAC GAACTTGACTCAATTAGCG ATTCAGCGTTGGGGCTTTT TGGTAAACGTATGCTGGCT TCAGCCCGCGCGATTAAGA ATGACTACGTCCGTAAGCG TGCAGAGATCCTGAAGATC GACATTGCCGACGGCCAA AACATCGCCACTCTGAAGG GGAAACTTCAACAGTGGCT TTCGAAATGA TthCan1 Thermus NCBI: SEQ ID NO.: 60 SEQ ID NO.: 61 thermophilus WP_011229147.1 ATGCAAGCCCCGGTGTATC MQAPVYLCLLGNDPAP TGTGCTTGCTGGGAAACG AYLGLKVVEREAGRVAK ACCCAGCTCCTGCCTACCT AVFYSFPAWNEEYGKK GGGTCTGAAGGTTGTGGA RQAFFRLLSEKGVLYEER ACGTGAGGCTGGCCGCGT PLEKGLEEAEAREVWV GGCGAAGGCCGTGTTCTAT NLTGGAKYWAVRFLGH TCCTTTCCCGCATGGAATG WRRPGARVFLVEGHRA AGGAATATGGGAAGAAAC LEAPRALFLWPREEERS GCCAGGCTTTCTTCCGTTT LEAEALTLEEYARLYLEPL ATTGTCGGAGAAGGGGGT GEAWERVSPPGAFPPG GTTATATGAGGAACGTCCT AQAARLPGREGGVFVV TTGGAGAAAGGTCTTGAA HRGLPYWYWVRPHLG GAGGCGGAGGCCCGTGAA GEAKDMSRKALSAFSG GTCTGGGTTAATCTTACGG EAKRLGGQLCLPVVPYH GTGGGGCTAAGTATTGGG KAHLRSRHPKERENVFA CGGTCCGCTTTTTGGGTCA RWRAWAREYGVFLVD CTGGCGCCGTCCTGGTGC PGRPLEEEVASLIKGKAS GCGTGTATTCTTGGTCGAA KKALPLPQEGPLLLALVS GGCCACCGCGCTCTGGAG EQAVPLYAAYLHAGPRE GCACCGCGTGCGCTTTTCC VYLLTTPEMESRLRWAE TTTGGCCGCGCGAAGAGG AFFRGKGVRVHRSFLSG AGCGCTCATTGGAGGCGG PWALREVRDLLAPVVEE AAGCGCTTACTCTTGAAGA ALRRGHPVHANLNSGT GTATGCCCGCTTATATCTT TAMALGLYLALRDGAR GAGCCCTTGGGCGAAGCC AHYLDGDRLLLLDGGEA TGGGAGCGTGTCTCTCCGC EVPWEEGRPEDLLALR CAGGAGCTTTTCCGCCCGG GYRFEEEYPDARPDPGL AGCGCAGGCTGCGCGTCTT LALAEEILRRWDEVQTS CCGGGCCGCGAGGGCGGT WEASPLVRRFLKFWKK GTTTTCGTTGTACACCGCG RFGQAFPPKRLSRLKGL GCCTGCCGTACTGGTATTG PLEYAVYSHLNAHLAPK GGTGCGTCCTCACTTGGGC GGQARMGGHLVPLGG GGCGAAGCAAAAGACATG NEALAPQSTEVDGVFF TCCCGTAAAGCTCTGAGTG HRGALWFVECKPTDEG CTTTCAGCGGTGAGGCGA LRERAPIMAELVRSVGG AGCGCCTGGGGGGACAGT VEARGLMVARRWRGA TATGTCTTCCTGTCGTTCCC PPPASPNLVYMALEGG TATCACAAAGCGCATTTGC EGVGVYRFPEELEKALS GCTCCCGCCACCCGAAGG RNPAPRRG AACGTGAAAATGTTTTTGC TCGCTGGCGTGCATGGGC GCGTGAATACGGGGTATTT TTAGTAGATCCAGGGCGTC CCCTGGAGGAAGAAGTCG CGTCCCTGATCAAGGGTAA AGCCTCCAAGAAAGCTTTG CCGCTGCCCCAGGAAGGT CCGCTGTTACTTGCGCTGG TGTCGGAGCAAGCCGTGC CCCTTTATGCCGCCTATCT GCACGCAGGACCTCGTGA AGTCTATCTGTTGACGACA CCCGAAATGGAATCACGTC TGCGTTGGGCCGAAGCCTT CTTCCGTGGAAAGGGTGT ACGTGTCCATCGTTCTTTCC TTTCCGGTCCTTGGGCGTT GCGCGAGGTCCGTGACTT GTTGGCACCGGTGGTAGA AGAAGCGTTGCGTCGTGG CCATCCAGTACACGCCAAT CTTAACAGTGGAACAACTG CAATGGCCTTGGGCCTGTA TCTGGCATTACGTGATGGA GCCCGCGCGCATTATCTGG ATGGAGATCGTTTATTGCT TTTAGACGGGGGAGAGGC GGAGGTCCCATGGGAAGA GGGCCGCCCAGAGGATCT TCTTGCTCTGCGTGGTTAC CGTTTTGAGGAGGAATATC CCGACGCTCGCCCCGATCC TGGCTTATTGGCGCTGGCA GAGGAGATCTTACGTCGCT GGGATGAGGTTCAAACTA GTTGGGAGGCTTCTCCACT GGTTCGTCGTTTTCTTAAG TTCTGGAAAAAACGTTTTG GACAAGCGTTTCCCCCGAA GCGTTTAAGCCGCCTGAAG GGGTTACCGTTGGAATATG CAGTGTACTCTCATTTAAA TGCACATTTAGCTCCCAAG GGCGGCCAGGCTCGTATG GGCGGACACCTTGTACCTT TGGGTGGGAATGAAGCCC TTGCTCCCCAATCGACTGA AGTAGATGGCGTCTTCTTT CACCGCGGCGCGTTATGGT TCGTCGAGTGCAAGCCCAC GGATGAAGGACTTCGTGA GCGTGCTCCGATCATGGCG GAGTTGGTCCGTAGCGTA GGCGGCGTTGAAGCTCGC GGTTTAATGGTCGCACGCC GTTGGCGCGGGGCACCCC CTCCTGCCTCTCCAAACTTA GTTTATATGGCACTGGAAG GCGGAGAAGGAGTAGGG GTATACCGCTTCCCAGAAG AATTAGAGAAAGCACTTTC TCGTAATCCTGCACCACGC CGTGGGTAA
REFERENCE LISTING
(335) 1. Drain, P. K. Rapid Diagnostic Testing for SARS-CoV-2. https://doi.org/10.1056/NEJMcp2117115 (2022) doi:10.1056/NEJMCP2117115. 2. Allan-Blitz, L. T. & Klausner, J. D. A Real-World Comparison of SARS-CoV-2 Rapid Antigen Testing versus PCR Testing in Florida. Journal of Clinical Microbiology 59, (2021). 3. Jessica L. Prince-Guerra, P. O. A. et al. Evaluation of Abbott BinaxNOW Rapid Antigen Test for SARS-CoV-2 Infection at Two Community-Based Testing Sites—Pima County, Arizona, Nov. 3-17, 2020. https://www.cdc.gov/mmwr/volumes/70/wr/pdfs/mm7003e3-H.pdf. 4. Kaminski, M. M., Abudayyeh, O. O., Gootenberg, J. S., Zhang, F. & Collins, J. J. CRISPR-based diagnostics. Nature Biomedical Engineering 2021 5:7 5, 643-656 (2021). 5. Abudayyeh, O. O. & Gootenberg, J. S. CRISPR diagnostics. Science 372, 914-915 (2021). 6. Pardee, K. et al. Rapid, Low-Cost Detection of Zika Virus Using Programmable Biomolecular Components. Cell 165, 1255-1266 (2016). 7. Jiao, C. et al. Noncanonical crRNAs derived from host transcripts enable multiplexable RNA detection by Cas9. Science 372, 941-948 (2021). 8. Gootenberg, J. S. et al. Nucleic acid detection with CRISPR-Cas13a/C2c2. Science 356, 438-442 (2017). 9. Chen, J. S. et al. CRISPR-Cas12a target binding unleashes indiscriminate single-stranded DNase activity. Science (New York, N.Y.) 360, 436 (2018). 10. Kazlauskiene, M., Kostiuk, G., Venclovas, a., Tamulaitis, G. & Siksnys, V. A cyclic oligonucleotide signaling pathway in type III CRISPR-Cas systems. Science 357, 605-609 (2017). 11. Kazlauskiene, M., Tamulaitis, G., Kostiuk, G., Venclovas, C. & Siksnys, V. Spatiotemporal Control of Type III-A CRISPR-Cas Immunity: Coupling DNA Degradation with the Target RNA Recognition. Molecular cell 62, 295-306 (2016). 12. Niewoehner, O. et al. Type III CRISPR-Cas systems produce cyclic oligoadenylate second messengers. Nature 2017 548:7669 548, 543-548 (2017). 13. Athukoralage, J. S. et al. The dynamic interplay of host and viral enzymes in type iii crispr-mediated cyclic nucleotide signalling. eLife 9, (2020). 14. Makarova, K. S. et al. Evolutionary and functional classification of the CARF domain superfamily, key sensors in prokaryotic antivirus defense. Nucleic Acids Research 48, 8828-8847 (2020). 15. Rostol, J. T. & Marraffini, L. A. Non-specific degradation of transcripts promotes plasmid clearance during type III-A CRISPR-Cas immunity. Nature Microbiology 2019 4:4 4, 656-662 (2019). 16. Santiago-Frangos, A. et al. Intrinsic signal amplification by type III CRISPR-Cas systems provides a sequence-specific SARS-CoV-2 diagnostic. Cell Reports Medicine 2, 100319 (2021). 17. Steens, J. A. et al. SCOPE enables type III CRISPR-Cas diagnostics using flexible targeting and stringent CARF ribonuclease activation. Nature Communications 2021 12:1 12, 1-12 (2021). 18. Sridhara, S., Goswami, H. N., Whyms, C., Dennis, J. H. & Li, H. Virus detection via programmable Type III-A CRISPR-Cas systems. doi:10.1038/s41467-021-25977-7. 19. Smalakyte, D. et al. Type III-A CRISPR-associated protein Csm6 degrades cyclic hexa-adenylate activator using both CARF and HEPN domains. Nucleic Acids Research 48, 9204-9217 (2020). 20. Athukoralage, J. S., Graham, S., Grüschow, S., Rouillon, C. & White, M. F. A Type III CRISPR Ancillary Ribonuclease Degrades Its Cyclic Oligoadenylate Activator. Journal of Molecular Biology 431, 2894-2899 (2019). 21. Athukoralage, J. S., Rouillon, C., Graham, S., Grüschow, S. & White, M. F. Ring nucleases deactivate type III CRISPR ribonucleases by degrading cyclic oligoadenylate. Nature 2018 562:7726 562, 277-280 (2018). 22. Garcia-Doval, C. et al. Activation and self-inactivation mechanisms of the cyclic oligoadenylate-dependent CRISPR ribonuclease Csm6. Nature Communications 2020 11:1 11, 1-9 (2020). 23. Jia, N., Jones, R., Yang, G., Ouerfelli, O. & Patel, D. J. CRISPR-Cas III-A Csm6 CARF Domain Is a Ring Nuclease Triggering Stepwise cA4 Cleavage with ApA>p Formation Terminating RNase Activity. Molecular Cell 75, 944-956.e6 (2019). 24. Grüschow, S., Grüschow, G., Adamson, C. S. & White, M. F. Specificity and sensitivity of an RNA targeting type III CRISPR complex coupled with a NucC endonuclease effector. Nucleic Acids Research (2021) doi:10.1093/NAR/GKAB 1190. 25. Hale, C. R. et al. RNA-Guided RNA Cleavage by a CRISPR RNA-Cas Protein Complex. Cell 139, 945-956 (2009). 26. Rouillon, C., Athukoralage, J. S., Graham, S., Grüschow, S. & White, M. F. Control of cyclic oligoadenylate synthesis in a type III CRISPR system. eLife 7, (2018). 27. Molina, R. et al. Structure of Csx1-cOA4 complex reveals the basis of RNA decay in Type III-B CRISPR-Cas. Nature Communications 2019 10:1 10, 1-14 (2019). 28. Liu, T. Y. et al. Accelerated RNA detection using tandem CRISPR nucleases. Nature Chemical Biology 2021 17:9 17, 982-988 (2021). 29. Rostol, J. T. et al. The Card1 nuclease provides defence during type III CRISPR immunity. Nature 2021 590:7847 590, 624-629 (2021). 30. Zhu, W. et al. The CRISPR ancillary effector Can2 is a dual-specificity nuclease potentiating type III CRISPR defence. Nucleic Acids Research 49, 2777-2789 (2021). 31. McMahon, S. A. et al. Structure and mechanism of a Type III CRISPR defence DNA nuclease activated by cyclic oligoadenylate. Nature Communications 2020 11:1 11, 1-11 (2020). 32. Ye, Q. et al. HORMA Domain Proteins and a Trip13-like ATPase Regulate Bacterial cGAS-like Enzymes to Mediate Bacteriophage Immunity. Molecular Cell 77, 709-722.e7 (2020). 33. Lau, R. K. et al. Structure and Mechanism of a Cyclic Trinucleotide-Activated Bacterial Endonuclease Mediating Bacteriophage Immunity. Molecular Cell 77, 723-733.e6 (2020). 34. Batéjat, C., Grassin, Q., Manuguerra, J.-C. & Leclercq, I. Heat inactivation of the severe acute respiratory syndrome coronavirus 2. Journal of Biosafety and Biosecurity 3, 1 (2021). 35. Liu, T. Y., Iavarone, A. T. & Doudna, J. A. RNA and DNA Targeting by a Reconstituted Thermus thermophilus Type III-A CRISPR-Cas System. PLOS ONE 12, e0170552 (2017). 36. Lee, J. et al. CRISPR-Cap: multiplexed double-stranded DNA enrichment based on the CRISPR system. Nucleic acids research 47, (2019). 37. Schultzhaus, Z., Wang, Z. & Stenger, D. CRISPR-based enrichment strategies for targeted sequencing. Biotechnology Advances 46, 107672 (2021). 38. Lee, J. et al. CRISPR-Cap: multiplexed double-stranded DNA enrichment based on the CRISPR system. Nucleic Acids Research 47, el-el (2019). 39. O'Connell, M. R. et al. Programmable RNA recognition and cleavage by CRISPR/Cas9. Nature 516, 263 (2014). 40. East-Seletsky, A. et al. Two distinct RNase activities of CRISPR-C2c2 enable guide-RNA processing and RNA detection. Nature 2016 538:7624 538, 270-273 (2016). 41. Liu, L. et al. The Molecular Architecture for RNA-Guided RNA Cleavage by Cas13a. Cell 170, 714-726.e10 (2017). 42. Jia, N., Jones, R., Sukenick, G. & Patel, D. J. Second Messenger cA4 Formation within the Composite Csm1 Palm Pocket of Type III-A CRISPR-Cas Csm Complex and Its Release Path. Molecular Cell 75, 933-943.e6 (2019). 43. Lowey, B. et al. CBASS Immunity Uses CARF-Related Effectors to Sense 3 0-5 0- and 2 0-5 0-Linked Cyclic Oligonucleotide Signals and Protect Bacteria from Phage Infection In Brief. Cell 182, 38-49 (2020). 44. Jiang, W., Samai, P. & Marraffini, L. A. Degradation of Phage Transcripts by CRISPR-Associated RNases Enables Type III CRISPR-Cas Immunity. Cell 164, 710-721 (2016). 45. Larremore, D. B. et al. Test sensitivity is secondary to frequency and turnaround time for COVID-19 screening. Science Advances 7, (2021). 46. Gootenberg, J. S. et al. Multiplexed and portable nucleic acid detection platform with Cas13, Cas12a and Csm6. Science 360, 439-444 (2018). 47. Jain, M. et al. Nanopore sequencing and assembly of a human genome with ultra-long reads. Nature Biotechnology 2018 36:4 36, 338-345 (2018). 48. Li, W. & Godzik, A. Cd-hit: a fast program for clustering and comparing large sets of protein or nucleotide sequences. Bioinformatics 22, 1658-1659 (2006). 49. Katoh, K. & Standley, D. M. MAFFT Multiple Sequence Alignment Software Version 7: Improvements in Performance and Usability. Molecular Biology and Evolution 30, 772— 780 (2013). 50. Gouveia-Oliveira, R., Sackett, P. W. & Pedersen, A. G. MaxAlign: Maximizing usable data in an alignment. BMC Bioinformatics 8, 1-8 (2007). 51. Finn, R. D., Clements, J. & Eddy, S. R. HMMER web server: interactive sequence similarity searching. Nucleic Acids Research 39, W29—W37 (2011). 52. Capella-Gutiérrez, S., Silla-Martinez, J. M. & Gabaldón, T. trimA1: a tool for automated alignment trimming in large-scale phylogenetic analyses. Bioinformatics 25, 1972-1973 (2009). 53. Darriba, D., Taboada, G. L., Doallo, R. & Posada, D. ProtTest 3: fast selection of best-fit models of protein evolution. Bioinformatics 27, 1164-1165 (2011). 54. Minh, B. Q. et al. IQ-TREE 2: New Models and Efficient Methods for Phylogenetic Inference in the Genomic Era. Molecular Biology and Evolution 37, 1530-1534 (2020). 55. Yu, G., Lam, T. T. Y., Zhu, H. & Guan, Y. Two Methods for Mapping and Visualizing Associated Data on Phylogeny Using Ggtree. Molecular Biology and Evolution 35, 3041-3043 (2018). 56. Price, M. N., Dehal, P. S. & Arkin, A. P. FastTree 2— Approximately Maximum-Likelihood Trees for Large Alignments. PLOS ONE 5, e9490 (2010). 57. Steens, J. A. et al. SCOPE enables type III CRISPR-Cas diagnostics using flexible targeting and stringent CARF ribonuclease activation. Nat. Commun. 12, 1-12 (2021). 58. Santiago-Frangos, A. et al. Intrinsic signal amplification by type III CRISPR-Cas systems provides a sequence-specific SARS-CoV-2 diagnostic. Cell Rep. Med. 2, 100319 (2021). 59. Grüschow, S., Adamson, C. S. & White, M. F. Specificity and sensitivity of an RNA targeting type III CRISPR complex coupled with a NucC endonuclease effector. Nucleic Acids Res. 49, 13122-13134 (2021). 60. Sridhara, S., Goswami, H. N., Whyms, C., Dennis, J. H. & Li, H. Virus detection via programmable Type III-A CRISPR-Cas systems. Nat. Commun. 12, 1-10 (2021). 61. Foster, K., Grüschow, S., Bailey, S., White, M. F. & Terns, M. P. Regulation of the RNA and DNA nuclease activities required for Pyrococcus furiosus Type III-B CRISPR—Cas immunity. Nucleic Acids Res. 48, 4418-4434 (2020). 62. Grüschow, S., Adamson, C. S. & White, M. F. Specificity and sensitivity of an RNA targeting type III CRISPR complex coupled with a NucC endonuclease effector. Nucleic Acids Res. 49, 13122-13134 (2021). 63. Bailey, T. L. & Elkan, C. Fitting a mixture model by expectation maximization to discover motifs in biopolymers. Proc. Int. Conf. Intell. Syst. Mol. Biol. 2, 28-36 (1994). 64. Santiago-Frangos, A. et al. Intrinsic signal amplification by type III CRISPR-Cas systems provides a sequence-specific SARS-CoV-2 diagnostic. Cell Rep. Med. 2, 100319 (2021).
(336) Target nucleic acid such as RNA and/or DNA may be obtained from a subject. For example, target RNA may be an RNA of an organism that infects a host organism. In particular, the target RNA may be an RNA genome of a virus that has infected the subject. In another example, the target RNA may be the RNA of the subject. A subject may refer to an animal, such as a mammalian species (preferably human) or avian (e.g., bird) species, or other organism, such as a plant. More specifically, a subject can be a vertebrate, e.g., a mammal such as a mouse, a primate, a simian or a human. Animals include farm animals, sport animals, and pets. A subject can be a healthy individual, an individual that has symptoms or signs or is suspected of having a disease or a predisposition to the disease, or an individual that is in need of therapy or suspected of needing therapy.
(337) A genetic modification or mutation in the context of an engineered system may refer to an alteration, variant or polymorphism in a nucleic acid that may result in altered or disabled functionality of a corresponding protein. Such alteration, variant or polymorphism can be with respect to a reference genome, the subject or other individual. Variations include one or more single nucleotide variations (SNVs), insertions, deletions, repeats, small insertions, small deletions, small repeats, structural variant junctions, variable length tandem repeats, and/or flanking sequences, CNVs, transversions, gene fusions and other rearrangements may also be considered forms of genetic variation. A variation can be a base change, insertion, deletion, repeat, copy number variation, transversion, or a combination thereof.
(338) A “polynucleotide”, “nucleic acid”, “nucleic acid molecule”, or “oligonucleotide” may each refer to a polymer of nucleosides (including deoxyribonucleosides, ribonucleosides, or analogs thereof) joined by inter-nucleosidic linkages. Typically, a polynucleotide comprises at least three nucleosides. Oligonucleotides often range in size from a few monomeric units, e.g. 3-4, to hundreds of monomeric units. Whenever a polynucleotide is represented by a sequence of letters, such as “AUGCCUG,” it will be understood that the nucleotides are in 5′ to 3′ order from left to right and that “A” denotes adenosine, “C” denotes cytidine, “G” denotes guanosine, and “U” denotes uracil, unless otherwise noted. The letters A, C, G, and U (or “T” denoting thymine in DNA) may be used to refer to the bases themselves, to nucleosides, or to nucleotides comprising the bases, as is standard in the art.
(339) All patent filings, websites, other publications, sequence listings, accession numbers and the like cited above or below are incorporated by reference in their entirety for all purposes to the same extent as if each individual item were specifically and individually indicated to be so incorporated by reference.
(340) If different versions of a sequence are associated with an accession number at different times, the version associated with the accession number at the effective filing date of this application is meant. The effective filing date means the earlier of the actual filing date or filing date of a priority application referring to the accession number if applicable. Likewise, if different versions of a publication, website or the like are published at different times, the version most recently published at the effective filing date of the application is meant unless otherwise indicated. Any feature, step, element, embodiment, or aspect of the disclosure can be used in combination with any other unless specifically indicated otherwise. Although the present disclosure has been described in some detail by way of illustration and example for purposes of clarity and understanding, it will be apparent that certain changes and modifications may be practiced within the scope of the appended claims.