SOLUBLE ACE2 AND FUSION PROTEIN, AND APPLICATIONS THEREOF

Abstract

A soluble ACF and a truncated form thereof, a fusion protein thereof and preparation methods therefor. A soluble ACEI and a truncated form thereof, as well as a use of the fusion protein in the preparation of a drug for an ACEI-related disease.

Claims

1-42. (canceled)

43. A soluble ACE2 or truncated form thereof, comprising or consisting of an extracellular domain of ACE2, or a fragment of the extracellular domain of ACE2 that retains an ability of binding to a coronavirus.

44. The soluble ACE2 or truncated form thereof according to claim 43, wherein the soluble ACE2 or truncated form thereof comprises a metalloprotease domain in the extracellular region of human ACE2, and comprises an amino acid sequence from positions 19 to 615 of human ACE2.

45. The soluble ACE2 or truncated form thereof according to claim 43, wherein the soluble ACE2 or truncated form thereof comprises the following amino acids of human ACE2: Q24, T27, F28, D30, K31, H34, E37, D38, Y41, Q42, L45, M82, Y83, Q325, E329, N330, K353, G354, D355, R357 and R393.

46. The soluble ACE2 or truncated form thereof according to claim 43, wherein the soluble ACE2 or truncated form thereof comprises ACE2 containing one or more mutation(s) in an enzyme active center or truncated form thereof, preferably, comprises one or more mutation at position(s) 374 and/or 378 corresponding to human ACE2.

47. The soluble ACE2 or truncated form thereof according to claim 43, wherein the soluble ACE2 or a truncated form thereof has an enzymatic activity of ACE2.

48. The soluble ACE2 or truncated form thereof according to claim 43, wherein the soluble ACE2 or a truncated form thereof is glycosylated at position(s) 53, 90, 103, 322, 432, 546 and/or 690 of human ACE2.

49. The soluble ACE2 or a truncated form thereof according to claim 43, wherein the truncated form of the soluble ACE2 comprises an amino acid sequence as shown by SEQ ID NO: 1 or SEQ ID NO: 2.

50. A fusion protein of a soluble ACE2, comprising the soluble ACE2 or truncated form thereof of claim 43, and an antibody Fc domain.

51. The fusion protein according to claim 50, wherein the antibody Fc domain comprises a heavy chain Fc domain derived from IgG1, IgG2, IgG3 or IgG4, preferably IgG1, preferably, the heavy chain Fc domain has a hinge region at its N-terminal, a CH2 domain and/or a CH3 domain.

52. The fusion protein according to claim 50, wherein two fusion proteins form a dimer via the heavy chain Fc domain, and wherein 1, 2 or 3 of the soluble ACE2(s) or truncated form(s) thereof are linked to C- and/or N-terminal end(s) of the heavy chain Fc domain.

53. The fusion protein according to claim 52, wherein one soluble ACE2 or truncated form thereof is linked to the N-terminal end of the heavy chain Fc domain, and another soluble ACE2 or truncated form thereof is linked to the C-terminal end of the heavy chain Fc domain, resulting in a ACE2-Fc fusion protein which is capable of forming a dimer containing tetrameric ACE2s, optionally, the soluble ACE2 or truncated form thereof at the N-terminal of the ACE2-Fc fusion protein further, at its N-terminal end, links to a soluble ACE2 or truncated form thereof in tandem, resulting in an ACE2-Fc fusion protein which is capable of forming a dimer containing hexameric ACE2s; or, the soluble ACE2 or truncated form thereof at the C-terminal of the ACE2-Fc fusion protein further, at its C-terminal end, links to a soluble ACE2 or truncated form thereof in tandem, resulting in an ACE2-Fc fusion protein which is capable of forming a dimer containing hexameric ACE2s.

54. The fusion protein according to claim 52, wherein two soluble ACE2s or truncated forms thereof, which are linked in tandem, are linked to the N-terminal end of the heavy chain Fc domain, resulting in an ACE2-Fc fusion protein which is capable of forming a dimer containing tetrameric ACE2s, optionally, the soluble ACE2 or truncated form thereof is further, at the N-terminal end of the ACE2-Fc fusion protein, linked to a soluble ACE2 or a truncated form thereof in tandem, resulting in an ACE2-Fc fusion protein which is capable of forming a dimer containing hexameric ACE2s; or, the heavy chain Fc domain of the ACE2-Fc fusion protein is, at its C-terminal end, linked to a soluble ACE2 or truncated form thereof, resulting in an ACE2-Fc fusion protein which is capable of forming a dimer containing hexameric ACE2s.

55. The fusion protein according to claim 52, wherein the heavy chain Fc domains is, at its C-terminal end, linked to two soluble ACE2s or truncated forms thereof which are linked in tandem, resulting in an ACE2-Fc fusion protein which is capable of forming a dimer containing tetrameric ACE2s, optionally, the heavy chain Fc domain of the ACE2-Fc fusion protein is, at its N-terminal end, linked to a soluble ACE2 or truncated form thereof, resulting in an ACE2-Fc fusion protein which is capable of forming a dimer containing hexameric ACE2s.

56. The fusion protein according to claim 52, wherein a linker is used for linking two soluble ACE2s or truncated forms thereof in tandem.

57. The fusion protein according to claim 50, wherein one ACE2 truncated form and one heavy chain Fc domain have an amino acid sequence represented by SEQ ID NO: 3 or SEQ ID NO: 4.

58. The fusion protein according to claim 50, further comprising a signal peptide, which preferably is selected from a CD33 signal peptide, and preferably one ACE2 truncated form and the heavy chain Fc domain have an amino acid sequence as shown by SEQ ID NO: 5 or SEQ ID NO: 6.

59. The fusion protein according to claim 52, wherein one ACE2 truncated form is linked to the heavy chain Fc domain which is further linked to another soluble ACE2, resulting in an ACE2-Fc fusion protein having an amino acid sequence as shown by SEQ ID NO: 13; or, two soluble ACE2s or truncated forms thereof are linked to the heavy chain Fc domain, resulting in an ACE2-Fc fusion protein having an amino acid sequence as shown by SEQ ID NO: 14.

60. The fusion protein according to claim 50, wherein two fusion proteins form a dimer via the heavy chain Fc domain, and one dimer is a polypeptide monomer unit and n polypeptide monomer units are further assembled into an Fc fusion protein multimer ACE2-hFc(n) via a tail located at each of the C-terminal of the heavy chain Fc-domain.

61. The fusion protein according to claim 60, wherein the C-terminal end of the heavy chain Fc domain is linked to the tail, and the n polypeptide monomer units have a total of 2n tails, which are connected to each other to form the Fc fusion protein multimer, preferably the tail is an IgM and/or IgA derived tail and, more preferably, the tail comprises a sequence as shown by SEQ ID NO: 17.

62. The fusion protein according to claim 60, wherein the Fc fusion protein multimer comprises one or more selected from the following group: ACE2-hFc4, being a tetramer assembled from 4 polypeptide monomer units via the tails located at the C-terminals of the Fc-domains, each of the polypeptide monomer units comprises a dimer composed of two ACE2 truncated forms and two heavy chain Fc domains, wherein one ACE2 truncated form, one heavy chain Fc domain along with the tail comprise an amino acid sequence as shown by SEQ ID NO: 7; ACE2-NN-hFc4, being a tetramer assembled from 4 polypeptide monomer units via the tails located at the C-termini of the Fc-domains, each of the polypeptide monomer units comprises a dimer composed of two ACE2 truncated forms and two heavy chain Fc domains, wherein one ACE2 truncated form, one heavy chain Fc domain along with the tail comprise an amino acid sequence as shown by SEQ ID NO: 8; ACE2-NN-hFc4-L309C, being a tetramer assembled from 4 polypeptide monomer units via the tails located at the C-terminals of the Fc-domains, each of the polypeptide monomer units comprises a dimer composed of two ACE2 truncated forms and two heavy chain Fc domains, wherein one ACE2 truncated form, one heavy chain Fc domain along with the tail comprise an amino acid sequence as shown by SEQ ID NO: 18, and the heavy chain Fc domain has an L309C mutation at position 309; ACE2-hFc5, being a pentamer assembled from 5 polypeptide monomer units via the tails located at the C-terminals of the Fc-domains, each of the polypeptide monomer units comprises a dimer composed of two ACE2 truncated forms and two heavy chain Fc domains, wherein one ACE2 truncated form, one heavy chain Fc domain along with the tail comprise an amino acid sequence as shown by SEQ ID NO: 7; ACE2-NN-hFc5, being a pentamer assembled from 5 polypeptide monomer units via the tails located at the C-terminals of the Fc-domains, each of the polypeptide monomer units comprises a dimer composed of two ACE2 truncated forms and two heavy chain Fc domains, wherein one ACE2 truncated form, one heavy chain Fc domain along with the tail comprise an amino acid sequence as shown by SEQ ID NO: 8; ACE2-NN-hFc5-L309C, being a pentamer assembled from 5 polypeptide monomer units via the tails located at the C-terminals of the Fc-domains, each of the polypeptide monomer units comprises a dimer composed of two ACE2 truncated forms and two heavy chain Fc domains, wherein one ACE2 truncated form, one heavy chain Fc domain along with the tail comprise an amino acid sequence as shown by SEQ ID NO: 18, and wherein the heavy chain Fc domain comprises an L309C mutation at position 309; ACE2-hFc6, being a hexamer assembled from 6 polypeptide monomer units via the tails located at the C-terminals of the Fc-domains, each of the polypeptide monomer units comprises a dimer composed of two ACE2 truncated forms and two heavy chain Fc domains, wherein one ACE2 truncated form, one heavy chain Fc domain along with the tail comprise an amino acid sequence as shown by SEQ ID NO: 7; ACE2-NN-hFc6, being a hexamer assembled from 6 polypeptide monomer units via the tails located at the C-terminals of the Fc-domains, each of the polypeptide monomer unit comprises a dimer composed of two ACE2 truncated forms and two heavy chain Fc domains, wherein one ACE2 truncated form, one heavy chain Fc domain along with the tail comprise an amino acid sequence as shown by SEQ ID NO: 8; ACE2-NN-hFc6-L309C, being a hexamer assembled from 6 polypeptide monomer units via the tails located at the C-terminals of the Fc-domains, each of the polypeptide monomer units comprises a dimer composed of two ACE2 truncated forms and two heavy chain Fc domains, wherein one ACE2 truncated form, one heavy chain Fc domain along with the tail comprise an amino acid sequence as shown by SEQ ID NO: 18.

63. An expression vector for expression of the soluble ACE2 or truncated form thereof of claim 43, or the fusion protein of claim 50.

64. A mammalian cell strain for expression of the soluble ACE2 or truncated form thereof of claim 43 or the fusion protein of claim 50.

65. The mammalian cell strain according to claim 64, wherein the cell strain comprises, but is not limited to, a CHO cell strain, a 293 cell strain and a Vero cell strain and a cell strain derived therefrom, preferably comprises a Vero E6 cell or an HEK293T cell.

66. A pharmaceutical composition comprising: the soluble ACE2 or truncated form thereof of claim 43 or the fusion protein of claim 50; and a pharmaceutically acceptable carrier.

67. A method for treating or preventing an ACE2-related disease, comprising administrating to a subject a therapeutically effective amount of the pharmaceutical composition of claim 66.

68. The method according to claim 67, wherein the disease is caused by an infection of a virus employing ACE2 as a receptor, preferably, the virus comprises a coronavirus, preferably is selected from SARS-CoV, HCoV-NL63 or SARS-CoV2.

69. The method according to claim 67, wherein the disease is selected from pneumonia, severe acute respiratory infection, renal failure, heart failure, adult respiratory distress syndrome (ARDS), liver injury, intestinal disease, or severe acute respiratory syndrome.

70. The method according to claim 67, wherein the method is used for passive immunization of a medical worker and a person at risk of exposing to the virus.

71. The method according to claim 67, wherein the pharmaceutical composition is administrated by inhalation, intranasal or airway instillation, ocular and middle ear injection, ear drops, topical, transdermal, parenteral, subcutaneous and intravenous injection, intradermal injection, intramuscular injection, intrapleural instillation, intraperitoneal injection, intralesional administration, application to mucosa, or transplantation of a sustained-release carrier.

Description

BRIEF DESCRIPTION OF THE DRAWINGS

[0142] FIG. 1 shows SEC-HPLC peaks of fusion proteins ACE2-hFc-ACE2, ACE2-ACE2-hFc, ACE2-hFc5 and ACE2-hFc5-L309C obtained after purification.

[0143] FIG. 2 shows that the spike protein of the new coronavirus can induce the formation of syncytia.

[0144] FIG. 3 shows that the ACE2-hFc5 fusion protein significantly inhibits the intercellular membrane fusion mediated by the SARS S protein in vitro.

[0145] FIG. 4 shows an amino acid sequence (SEQ ID NO: 9) and Furin site of the Spike protein (S protein) of the SARS-CoV2.

[0146] FIG. 5 shows an amino acid sequence (SEQ ID NO: 10) of the SARS-CoV2 S protein having mutations at the Furin cleavage site.

[0147] FIG. 6 shows the expression of the SARS-CoV2 S protein at the cell surface and the cell surface analysis result of the SARS-CoV2 S protein having mutations at the Furin site.

[0148] FIG. 7 shows that no cell fusion occurs between control cells transfected with the empty vector (marked in red) and cells expressing the human ACE2 (marked in green), without the formation of multinucleated syncytia; in the group of wild-type SARS-CoV2 S protein-expressing cells (marked in red), it is observed that a large number of multinucleated syncytia is formed after co-culture with the cells expressing ACE2 (marked in green) for 3 h, and the formed syncytia died after 24 h of continuous culture; and the S protein having mutations at the furin site does not produce syncytia after being mixed with the cells expressing ACE.

[0149] FIG. 8 shows a wild-type Ectdomain (1-1208aa) (SEQ ID NO: 11) of the SARS-CoV2 S protein, and an Ectdomain (1-1208aa) (SEQ ID NO: 12) of the SARS-CoV2 S protein having mutations at the Furin cleavage site.

[0150] FIG. 9 shows affinity and avidity of the ACE2-hFc and ACE2-hFc5 fusion proteins with the RBD region of the SARS-CoV2 spike protein.

[0151] FIG. 10 shows that different forms of ACE2 fusion protein multimers inhibit the infection of a SARS-CoV2 pseudovirus (D614).

[0152] FIG. 11 shows that the ACE2-hFc5 fusion protein inhibits the infections of SARS-CoV2 pseudoviruses D614 and G614, a SARS virus, and a pangolin-CoV pseudovirus.

[0153] FIG. 12 shows that the ACE2-hFc5 fusion protein inhibits the infection of SARS-CoV2 live virus.

[0154] FIG. 13 shows the physicochemical properties of ACE2-hFc5 before and after nebulization as analyzed by SEC-HPLC.

[0155] FIG. 14 shows the evaluation results of the in vitro neutralization activity of the ACE2-hFc5 molecule against the SARS-CoV2 pseudovirus infection before and after nebulization.

[0156] FIG. 15 shows RT-qPCR quantitative analysis of the contents of SARS-CoV2 gRNA and sgRNA in hamster lungs.

[0157] FIG. 16 schematically shows the molecular structures of different forms of ACE2-IgG1 fusion proteins.

DETAILED DESCRIPTION OF THE EMBODIMENTS

[0158] The following embodiments are intended to illustrate the present disclosure, but not to limit the scope of the present disclosure. Modifications or substitutions made to the methods, steps or conditions of the present disclosure, without departing from the spirit and essence of the present disclosure, all fall within the scope of the present disclosure.

[0159] Unless otherwise specified, the chemical reagents used in the embodiments are all conventional commercially available reagents, and the technical means adopted in the embodiments are conventional means well known to those skilled in the art. The Fc throughout the embodiments and figures is derived from IgG1. The ACE2-hFc throughout the embodiments and figures is ACE2-NN-hFc in which one ACE2 truncated form and one heavy chain Fc domain have an amino acid sequence as shown by SEQ ID NO: 4. Unless otherwise specified, different forms of ACE2-hFc refer to all ACE2-hFc and ACE2-hFc multimers and mutants. The ACE2-hFc-ACE2s throughout the embodiments and figures are tetrameric ACE2(NN)-hFc-ACE2(NN), in which one ACE2 truncated form is linked to one heavy chain Fc domain and then linked to one ACE2 (ACE2-Fc-ACE2), resulting in an amino acid sequence as shown by SEQ ID NO: 13. The ACE2-ACE2-hFcs throughout the embodiments and figures are tetrameric ACE2(NN)-ACE2(NN)-hFc, in which one heavy chain Fc domain (ACE2-ACE2-Fc) are linked two ACE2s or truncated forms thereof that are linked in tandem, resulting in an amino acid sequence as shown by SEQ ID NO: 14. The ACE2-hFc5s throughout the embodiments and figures refers to ACE2(NN)-hFc(5), which is a tetramer assembled from 5 polypeptide monomer units via 10 tails located at the C-terminals of 5 Fc-domains, each of the polypeptide monomer unit comprises a dimer composed of two ACE2 truncated forms and two heavy chain Fc domains, wherein one ACE2 truncated form, one heavy chain Fc domain along with the tail comprise an amino acid sequence as shown by SEQ ID NO: 8. The ACE2-hFc5-L309C throughout the embodiments and figures refers to ACE2(NN)-hFc(5)-L309C, which is a tetramer assembled from 5 polypeptide monomer units via 10 tails located at the C-terminals of 5 Fc-domains, each of the polypeptide monomer unit comprises a dimer composed of two ACE2 truncated forms and two heavy chain Fc domains, wherein one ACE2 truncated form, one heavy chain Fc domain along with the tail comprise an amino acid sequence as shown by SEQ ID NO: 18, and the heavy chain Fc domain comprises an L309C mutation at position 309. Refer to FIG. 16.

EXAMPLE 1

Construction of ACE2-hFc Fusion Protein Expression Plasmid, SARS-CoV2 S Protein Expression Plasmid and Furin Site Mutated SARS-CoV2 S Protein Expression Plasmid

[0160] By using primers as shown in Table 1, DNA sequences encoding CD33 signal peptide, ACE2 metalloprotease domain extracellular region (containing H374N and H378N enzyme inactivation mutations) and hIgG1 Fc were obtained via Overlap PCR. The specific cloning steps comprise the following: regarding the construction of the ACE2-hFc expression plasmid, using pcDNA3.0-ACE2-NEMGE as a template, and using primers 2-FrontIn and 4-MidR to obtain, via PCR, DNA fragments encoding ACE2 extracellular region (19-615aa) containing enzymatic activity inactivation mutations H374N and H378N; using pCHOGS-HH009 as a template, and using primers 3-MidF and 5-IgG1Cterm to obtain, via PCR, DNA fragments encoding the hIgG1 Fc; then using the obtained products as templates, and using primers 6-FrontOutXhoI and 5-IgG1Cterm to synthesize, via Overlap PCR, a full-length DNA encoding CD33 signal peptide-ACE2 extracellular region-hFc, which then was inserted into human pCHOGS expression vector between XhoI and Pad cleavage sites to obtain pCHOGS-ACE2-NN-hIgG1 expression plasmid.

TABLE-US-00001 TABLE 1 Construction Primers of ACE2 IgG1 Fusion Protein Expression Plasmid Primer ID Sequence(5′-3′) 6-FrontOutXhoI aagCTCGAGgccaccATGCCGCTGCTGCTACTGCTGCCCCTGCTGTGGGC 2-FrontIn CTGCCCCTGCTGTGGGCAGGGGCGCTCGCTaccattgaggaacaggccaag 3-MidF gactggagtccatatgcagacgagcccaaatcttCtgacaaaactcacacatgcc 4-MidR ggcatgtgtgagttttgtcaGaagatttgggctcgtctgcatatggactccagtc 5-IgG1Cterm cccTTAATTAAtcatttacccg 7-Oligomer CATCACCAGAGACACGTTGTAGAGGGTGGGCTTGCCGGTagacagggagaggctcttc (pentamer)In 8-Oligomer cccTTAATTAAtcaGTAGCATGTGCCGGCGGTGTCGCTCATCACCAGAGACACG (pentamer)Out TTGTA

[0161] Regarding the construction of the coronavirus spike protein expression plasmid pCAGGS-SARS-CoV2 S-C9, pCMV3-2019-nCoV-Spike(S1+S2)-long (Sino Biological, Cat#: VG40589-UT) was used as a template, and SB-S-NheI: CGTGCTAGCcGTGAACCT GACCACCAGGACCCAA and SB-S-C9-XhoI: CGCCTCGAGCTAGGCGGGCGCCACCTGGCTGGTCTCGGTGGTGTAGTGCAGTTTCAC TCC were used as primers, to obtain DNA fragments encoding the SARS-CoV2 spike protein, which were inserted into a human pCAGGS vector between NheI and XhoI cleavage sites to obtain the SARS-CoV2 S protein expression plasmid. In the plasmid, the N-terminal signal peptide was a CD4 signal peptide, and a C9 tag was comprised at the C-terminal.

[0162] On the basis of this plasmid, primers SB-S-NheI, SB-S-C9-XhoI, and SB-Drs-f: CAGCCCAagcAGGGCAagcTCTGTGCAAGCCAG and SB-Drs-r: CTGGCTTGCCACAGAgctTGCCCTgctTGGGCTG were used, the Furin protease cleavage site PRRAR in the S protein was mutated to PSRAS via Overlap PCR, so as to obtain SARS-CoV2 S protein expression plasmid which comprised mutated Furin site.

EXAMPLE 2

Construction of ACE2-hFc-ACE2 Fusion Protein, ACE2-ACE2-hFc Fusion Protein, ACE2-hFc5 Fusion Protein and ACE2-hFc5-L309C Fusion Protein Expression Plasmids

[0163] The construction of the ACE2-hFc-ACE2 fusion protein, ACE2-ACE2-hFc fusion protein, ACE2-hFc5 fusion protein, and ACE2-hFc5-L309C fusion protein expression plasmids were similar to that of the ACE2-hFc fusion protein expression plasmid, and were constructed using the method similar to Example 1.

EXAMPLE 3

Expression, Purification and SEC-HPLC Analysis of ACE2-hFc Fusion Protein and ACE2-hFc5 Fusion Protein

[0164] The expression plasmid expressing the ACE2-hFc fusion protein obtained in Example 1 and the expression plasmid expressing the ACE2-hFc5 fusion protein obtained in Example 2 were respectively transfected into 293F cells by PEI. The culture supernatants were collected 5 days after transfection and purified via a Protein A column in one step, to obtain the purified ACE2-hFc fusion protein and ACE2-hFc5 fusion protein, respectively. After protein quantification by Nano drop2000, SEC-HPLC purity analysis was performed (FIGS. 1A and 1C). As can be seen from FIG. 1A, the purity analysis of the obtained ACE2-hFc fusion protein shows only one peak, and the main peak is 99.34%. As can be seen from FIG. 1C, the purity analysis of the obtained ACE2-hFc5 fusion protein shows only one peak, and the main peak is 66.94%.

EXAMPLE 4

Expression, Purification and SEC-HPLC Analysis of ACE2-hFc-ACE2 Fusion Protein, ACE2-ACE2-hFc Fusion Protein and ACE2-hFc5-L309C Fusion Protein

[0165] The expression plasmids expressing the ACE2-hFc-ACE2 fusion protein, the ACE2-ACE2-hFc fusion protein and the ACE2-hFc5-L309C fusion protein obtained in Example 2 were respectively transfected into 293F cells by PEI. The culture supernatants were collected 5 days after transfection, and purified via a Protein A and a molecular sieve in two steps, to obtain the purified ACE2-ACE2-hFc fusion protein, ACE2-hFc-ACE2 fusion protein and ACE2-hFc5-L309C fusion protein, respectively. After protein quantification by Nano drop2000, SEC-HPLC purity analysis was performed for each of them (FIGS. 1B, 1D and 1E). As can be seen from FIG. 1B, the main peak of the ACE2-ACE2-hFc fusion protein is 98.96%. As can be seen from FIG. 1D, the main peak of the ACE2-hFc-ACE2 fusion protein is 97.99%. As can be seen from FIG. 1E, the main peak of the ACE2-hFc5-L309C fusion protein is 97.99%.

EXAMPLE 5

Expression, Purification and SEC-HPLC Analysis of ACE2-hFc5 Fusion Protein

[0166] The expression plasmid expressing the ACE2-hFc5 fusion protein obtained in Example 2 was transfected into 293F cells by PEI. The culture supernatant was collected 5 days after transfection and purified in multiple steps, to obtain the purified ACE2-hFc5 fusion protein. After protein quantification by Nano drop2000, SEC-HPLC purity analysis was performed (FIG. 1F). As can be seen from FIG. 1F, the main peak of the ACE2-hFc5 fusion protein is 99.2%.

EXAMPLE 6

In Vitro Intercellular Membrane Fusion Inhibition Experiment

[0167] 6.1 Method

[0168] Experiment of the ACE2 fusion proteins inhibiting the formation of coronavirus (SARS-CoV2) syncytia

[0169] The pCAGGS control vector, and the plasmids expressing the SARS-CoV2 S-protein and the SARS S-protein were co-transfected, respectively, with pEGFP-N1 into 293T cells. The plasmid expressing hACE2-C9 (preserved in our laboratory) and the pmCherry-C1 vector were co-transfected into 293T cells by PEI. The cells were digested 24 h after transfection, washed once with a DMEM complete medium (10% FBS, 1×PS) and counted. Then, 10 μg/mL of the control protein and the ACE2-hFc5 fusion proteins were co-incubated, respectively, with 2.5E5/well pCAGGS control vector-transfected cells, SARS-CoV2-S and SARS-S transfected cells at 37° C. for 30 min. hACE2-C9 transfected cells were then added at 2.5E5/well. After co-culture in a 5% CO.sub.2 cell incubator at 37° C. for 3 h, the inhibition activities of the ACE2-hFc5 fusion proteins for the formation of coronavirus (SARS-CoV2) syncytia were observed under a fluorescence microscope. The experimental results were photographed and recorded.

[0170] 6.2 From FIG. 2, it can be seen that a large number of syncytia were formed in both the SARS-CoV2 virus group and the SARS virus group. The largest number of syncytia were formed in the SARS-CoV2 virus group. In contrast, no cell fusion was observed in the control vector group. This result shows that the SARS-CoV2 virus S protein is similar to the SARS virus S protein, and has the ability of inducing cell fusion to form the syncytia. The SARS-CoV2 virus S protein has stronger induction ability than that of the SARS virus S protein (the top panel in FIG. 3). This also indirectly proves that the SARS-CoV2 virus S protein has a stronger affinity with the receptor hACE2 than the SARS virus S protein. When the ACE2-hFc5 fusion protein was added, it was observed that, as compared with the control protein, the ACE2-hFc5 fusion protein could significantly inhibit the SARS-CoV2 virus S protein-induced formation of syncytia, with an inhibition rate of up to 90% or more, and even completely inhibit the formation of syncytia induced by the SARS virus.

[0171] In addition, it can also be seen (the bottom panel in FIG. 3) that a large number of syncytia were formed when the cells expressing the coronavirus S protein were co-incubated with the cells expressing the receptor ACE2, It showed that the coronavirus S protein could induce a membrane fusion process after binding to the receptor ACE2. The multinucleated syncytia were more obvious at 20 h. When 10 μg/mL ACE2-hFc5 was added into the experimental system, the number of syncytia was significantly reduced, with an inhibition rate of up to 90% or more. While, the inhibitory effect of the ACE2-hFc was non-obvious under the same conditions. Further, it can be seen that the ACE2-hFc5 inhibited the formation of syncytia in a dose-dependent manner. ACE2-hFc5 still had a significant inhibitory activity for the formation of syncytia at a low concentration of 0.3 μg/mL.

[0172] The enveloped virus (including coronaviruses)-cell (inner) membrane fusion process is critical for the virus infection. The formation of syncytia is a prominent pathological change that occurs in the lungs after the SARS-CoV2 virus infects the human body. Our experimental results show that the ACE2-hFc5 fusion protein has a strong activity of inhibiting syncytia formation and can block the infection of coronaviruses, especially the SARS-CoV2.

EXAMPLE 7

Cell Surface Expression and Syncytia Formation Assays for SARS-CoV2 Wild-type S Protein and Mutated S Protein containing mutations in Furin Protease Cleavage Site

[0173] The pCAGGS empty vector (control), and the plasmids expressing SARS-CoV2 S protein and Furin site-mutated SARS-CoV2 S protein (in which PRRAR was mutated to PSRAS) were respectively co-transfected, by PEI, with pmCherry-C1 into 293T cells. The plasmid expressing the full-length ACE2 having the extracellular, transmembrane and intracellular regions and the pEGFP-N1 vector were co-transfected into 293T cells by PEI. The cells were digested 24h after transfection, washed once with a DMEM complete medium (10% FBS, 1×PS) and counted. A part of the empty vector-transfected control cells and the cells expressing the SARS-CoV2 S protein (SEQ ID NO: 9) (FIG. 4) and the Furin site-mutated SARS-CoV2 S protein (SEQ ID NO: 10) (FIG. 5) were then examined for the cell surface expression of the SARS-CoV2 S proteins. The remaining part of the cells was used for the examination of the syncytia formation.

[0174] Regarding the examination of the cell surface expression of the SARS-CoV2 S protein, 20 μg/mL of the ACE2-NN-Fc fusion protein was respectively incubated with the above cells on ice for 45 min, the cells were then washed three times with the FACS buffer (PBS, 0.5% BSA), followed by the addition of a FITC-anti-human-Fc-secondary antibody (F9512, Sigma) diluted at 1:300 and incubation on ice for 30 min. The surface expressions of the SARS-CoV2 S protein and the Furin site-mutated SARS-CoV2 S protein were analyzed by the flow cytometer after the cells were washed three times with the FACS buffer (PBS, 0.5% BSA). The results were analyzed with FlowJo V10 software and showed in FIG. 6.

[0175] Regarding the examination of the syncytia formation experiment, the empty vector-transfected control cells, and the cells transfected with the SARS-CoV2 S plasmid and the Furin site-mutated SARS-CoV2 S plasmid were separately seeded into a 48-well cell culture plate at 2.5E5/well. After 30 min, the ACE2-transfected cells were then added into the above wells containing cells at 2.5E5/well. After continuous co-culture in a 5% CO.sub.2 cell incubator at 37° C. for 3 h, the formation of viral syncytia was observed under a fluorescence microscope. The experimental results were photographed and recorded. As shown in FIG. 7, neither cell fusion nor the formation of multinucleated syncytia was observed between the empty vector-transfected control cells (marked in red) and the cells expressing the human full-length ACE2 (marked in green). In contrast, a large number of multinucleated syncytia was formed after co-culture of the wild-type S protein-expressing cells (marked in red) with the cells expressing the human full-length ACE2 (marked in green) for 3 h. When the Furin cleavage site RRAR in the SARS-CoV2 S protein was mutated to SRAS, the cell membrane fusion was completely inhibited, and no multinucleated syncytia were observed. This indicates that the mutated S protein lost the ability of mediating the cell membrane fusion. Therefore, the Furin site in the SARS-CoV2 S protein is necessary for the S protein-mediated cell fusion.

[0176] Moreover, the Furin protease cleavage site-mutated SARS-CoV2 S protein has a significant effect in inhibiting virus-cell fusion and the formation of the multinucleated syncytia (see the rightmost image in FIG. 7).

EXAMPLE 8

Affinity and Avidity Analysis of Different Forms of ACE2-hFc Fusion Proteins

[0177] 8.1 Methods

[0178] The affinity (BIAcore T200) and avidity (Fortebio Octet RED384) of the ACE2-NN-hFc and ACE2-NN-hFc5 fusion proteins with the receptor binding region (RBD) (aa331-527) of the coronavirus (SARS-CoV-2) S protein were detected by surface plasmon resonance (SPR) and bio-layer interferometry (BLI), respectively.

[0179] In the affinity assay, the ACE2-hFc and ACE2-hFc5 fusion proteins were first captured on the surface of a CM5 biosensor chip coated with an anti-human Fc antibody. Then, 2-fold serial dilutions between 200 nM and 6.25 nM of the SARS-CoV-2 RBD protein, which has a His6-Avi tag at the C-terminal, were flowed through the chip at a rate of 30 μL/min, to detect the intermolecular binding and dissociation kinetics of the proteins. The 1:1 Langmuir binding model (BIA Evaluation Software) was used to calculate the association constant (Ka), dissociation constant (Kd), and equilibrium dissociation constant (KD). Regarding the avidity assay, 20 μg/mL of the SARS-CoV-2 RBD protein with a C-terminal His6-Avi tag was first captured on the surface of a streptavidin biosensor. Then, different concentrations of ACE2-hFc (0 nM, 2-fold serial dilutions between 1.65-105.3 nM) and ACE2-hFc5 fusion proteins (0 nM, 2-fold serial dilutions between 8.22-526.3 nM) were used as analytes, for binding to the RBD-bound sensor surface for 180 seconds, followed by dissociation for 300 seconds. The 1:1 binding model (Fortebio data Analysis 11.1-knetics software) was used to calculate the binding constants Ka, Kd and KD.

[0180] 8.2 Results

[0181] By employing a method for determining the affinity of monovalent binding (BIAcore T200) (FIG. 9), it was found that the ACE2-hFc and ACE2-hFc5 fusion proteins had the same affinity for the SARS-CoV-2 RBD, i.e., 26.4 nM and 29.1 nM, respectively. Fortebio was used to analyze the avidity of the ACE2-NN-hFc and ACE2-NN-hFc5 fusion proteins with the S protein RBD. In the experiments, 20 μg/mL of the RBD-His-avi protein was captured on the surface of the streptavidin biosensor, and different concentrations of the ACE2-NN-hFc and ACE2-NN-hFc5 fusion proteins were used as the mobile phases. Octet DataAnalysis 11.0 software was used to analyze the experimental data, and 0 nM was used as the background value for subtraction. The results show (FIG. 9) that, as compared with the ACE2-hFc fusion protein, the multimerized ACE2-hFc5 fusion protein significantly enhances the affinity with the spike protein RBD-His-avi, with KD values (<1.0 E-12 M) beyond the detection range of the instrument.

EXAMPLE 9

In Vitro Coronavirus Pseudovirus Neutralization Experiment

[0182] 9.1 Methods

[0183] 9.1.1 Package of Coronavirus Pseudovirus

[0184] Regarding the package the pseudovirus of a coronavirus strain (D614), HEK293T cells were inoculated in a 10cm cell culture dish. When the cells reached 80% confluence, a coronavirus full-length S protein expression plasmid pSARS-CoV2 S-C9 (D614) was co-transfected with the packaging plasmid psPAX2 and a fluorescein expression plasmid pHIV-Luc, at a ratio of 1:3:4, by means of Lipofactamine 3000 The medium was discarded after 6 h of the transfection, and fresh DMEM medium containing 2% FBS and penicillin was added and continuously cultured for 48 h. Then, the culture supernatant containing pseudovirus particles was collected, centrifuged and filtered to remove cell debris, and frozen at −80° C. for future use. For the package of other SARS-CoV-2 variants, SARS and pangolin coronaviruses, the preparation conditions were the same except that the pSARS-CoV2 S-C9 (D614) was replaced with a plasmid expressing the S proteins of the variants. The coronavirus pseudoviruses used in the present disclosure include: SARS-CoV2 initial strain D614; SARS-CoV2 initial strain D614 having mutated Furin site; SARS-CoV2 main epidemic strain G614; SARS-CoV2 variant D614 (L18F; A22V; V367F; N439K; Y453F; N501Y; T478I; P1263L); SARS; and, pangolin coronavirus.

[0185] 9.1.2 Neutralization Experiments of Coronavirus Pseudovirus

[0186] In the neutralization experiments of the coronavirus pseudovirus, 293T-ACE2 cells stably expressing human ACE2 were first seeded on an opaque 96-well cell culture plate at 1E5/well, and cultured in a CO.sub.2 incubator at 37° C. for 20 h for the neutralization experiment. On the day of the experiment, 75 μL of the coronavirus pseudoviruses were uniformly mixed with 25 μL of different forms of serial diluted soluble ACE2 fusion proteins, followed by incubation at room temperature for 30 min. Then, the cell culture supernatant in the 96-well cell culture plate was discarded. The premixed pseudovirus-ACE2 fusion protein mixtures were then added to 293T-ACE2 cells. After incubating in a CO.sub.2 incubator at 37° C. for 24 h, fresh DMEM medium containing 2% FBS was added instead to continue the culture. After 24 h, the luciferase activity was measured by means of a Bright-Glo luciferase assay system and a microplate luminometer. In the experiment, at least two duplicate wells and a PBS control well were provided.

[0187] 9.2 Results

[0188] 9.2.1 Neutralization of Coronavirus Pseudovirus Infection by Different Forms of ACE2-hFc Fusion Protein Multimers

[0189] Regarding the comparison of the different forms of ACE2-hFc fusion proteins for neutralizing the coronavirus pseudovirus infection, 293T cells stably expressing human ACE2 were used as the host cells, and the serially diluted ACE2-NN-hFc fusion proteins were mixed with the SARS-CoV-2 pseudoviruses to infect 293T-ACE2 cells. The intracellular luciferase activity (RLU) was detected on the second day after the infection. The percentage inhibition of the ACE2-NN-hFc fusion proteins at different concentrations was calculated based on the RLU of the virus-infected PBS control group. As shown in FIG. 10, the different forms of ACE2-hFc fusion proteins all have neutralizing activity against the SARS-CoV-2 pseudovirus D614 infection. In particular, the ACE2-hFc5 and the ACE2-hFc5 L309C have the strongest in vitro neutralizing activity, with IC50s of 9.86 ng/mL and 12.4 ng/mL respectively, followed by the ACE2-hFc-ACE2 tetramer and ACE2-ACE2-hFc tetramer with IC50s of 39.31 ng/mL and 260.8 ng/mL respectively, and the ACE2-NN-hFc has the worst neutralizing activity. This result indicates that the activity of the ACE2 fusion proteins for neutralizing the SARS-CoV-2 infection is proportional to their affinity with the S protein RBD, i.e, the higher the degree of multimerization, the better the neutralization effect. Thus, the neutralizing activity of the ACE2-hFc fusion protein is significantly enhanced by the multimerization modification.

[0190] 9.2.2 Broad-Spectrum Neutralizing Activity of ACE2-NN-hFc5 against Coronavirus Infection

[0191] In order to evaluate the broad-spectrum anti-infection activity of ACE2-NN-hFc5 against SARS-CoV-2 variants and related coronaviruses, we packaged multiple SARS-CoV-2 single-point mutant pseudoviruses based on the main prevalent variants present in the population, and evaluated the neutralizing activity of ACE2-NN-hFc5 by using the infection model of the 293T-ACE2 stable cell line. The results show that ACE2-NN-hFc5 has strong neutralizing activity and broad-spectrum antiviral activity against the initial strain D614, the main epidemic strain G614 and other SARS-CoV-2 variants, as well as SARS virus and pangolin coronavirus pseudovirus. ACE2-NN-hFc5 has neutralizing activity IC50 of 9.56 ng/mL for the main epidemic strain G614 pseudovirus (FIG. 1 and Table 2 below). In terms of the neutralizing activity for the pseudovirus infection of the main SARS-CoV-2 variants (see Table 3), the results show that the ACE2-NN-hFc5 multimer has a strong in vitro neutralizing ability. In particular,

[0192] ACE2-NN-hFc5 has stronger neutralizing activity with IC50 of 0.036 ng/mL for the N501Y variant. These results indicate that ACE2-NN-hFc5 has high-efficiency and broad-spectrum anti-coronavirus activity in vitro.

TABLE-US-00002 TABLE 2 Neutralizing Activity of ACE2-hFc5 Multimer against SARS-CoV-2 D614 and G614 strains, SARS virus, and Pangolin Coronavirus Pseudovirus Infection. SARS-CoV2 SARS-CoV2 pangolin initial strain D614 main epidemic strain G614 SARS virus coronavirus IC.sub.50(ng/mL) 17.09 ± 7.08 9.56 ± 0.25 84.54 ± 33.4 108.2

TABLE-US-00003 TABLE 3 Neutralizing Activity of ACE2-hFc5 Multimer against Pseudovirus Infection of SARS-CoV-2 Main Variants. SARS-CoV-2 variant pseudovirus L18F A222V V367F N439K Y453F N501Y T478I P1263L IC50(ng/mL) 0.669 1.151 1.975 0.2668 0.8352 0.036 0.86 2.168

EXAMPLE 10

In Vitro Live Virus Neutralization Assay for SARS-CoV-2

[0193] 10.1 Method

[0194] Vero cells were seeded into a 96-well plate at a density of approximately 2×10.sup.4 cells/well. On the following day, the cell culture medium was changed to 2% FBS-DMEM medium. The ACE2-hFc fusion protein was diluted with the 2% FBS-DMEM medium to working concentrations of 20 μg/mL, 2μg/mL and 0.2 μg/mL, three replicate wells per sample. The 2019-nCoV (virus strain: C-Tan-nCoV Wuhan strain 01) was diluted to 200 TCID.sub.500/100 μL with the 2% FBS-DMEM medium. 50 μL of the diluted sample was added with an equal volume of 200 TCID5o virus, and incubated at 37° C. for 1 h. 100 μL of the antibody-virus complexes were then added into the cells and incubated at 37° C. CPE was observed after incubation at 37° C. for 48 h. 100 μL of the culture supernatant was aspirated after 48 h for nucleic acid extraction, and 80 μL of an eluate was used for elution finally. 5 μL of nucleic acid extracts were taken to formulate a real-time fluorescent RT-PCR reaction mixture, which was analyzed on an ABI Q5 fluorescence quantitative PCR system. A standard curve was used to determine the virus TCID.sub.50 of the samples based on the measured CT values of the samples, according to the following formula: virus replication inhibition rate (%)=(control TCID.sub.50-fusion protein TCID.sub.50)/control TCID.sub.50×100%. The above experiment was completed in a Biosafety Level 3 laboratory.

[0195] 10.2 Results

[0196] The neutralization effect of ACE2-hFc5 on live 2019-nCoV (C-Tan-nCoV Wuhan strain 01) virus was evaluated in a biosafety laboratory using Vero cells as the host cells. The experimental results show (FIG. 12) that both ACE2-hFc5 and ACE2-hFc have significant neutralizing activity against the infection of the coronavirus, with IC50 of 0.02-0.06 μg/mL and 5.3-6.8 μg/mL, respectively. ACE2-NN-hFc5 has better in vitro neutralization effect (which is hundreds of times higher than that of ACE2-NN-hFc), and 80% inhibition of the virus can still be observed at a concentration of 0.2 μg/mL. The above results fully demonstrate that ACE2-NN-hFc5 has an efficient anti-coronavirus activity in vitro.

EXAMPLE 11

Nebulizer inhalation Evaluation of ACE2-hFc5 Fusion Protein in Hamsters

[0197] 11.1 Methods

[0198] 11.1.1 Deposition and Distribution Analysis of ACE2-NN-hFc5 in Respiratory Tracts and Lungs after Nebulizer inhalation

[0199] We selected a systemic exposure nebulizer delivery system for small animals, which included an air pump, a mass flow meter and an exposure box, for delivering Nebulized ACE2-hFc5. The nebulizer delivery system matched with an Aerogen solo nebulizer, an adapter and a nebulization collection device. For analysis of the deposition and distribution of the drug in respiratory tracts, the nasal lavage fluids (NLFs) of hamsters were collected by rinsing with normal saline at 0 h, 6 h and 24 h after drug delivery, respectively. The main trachea, bronchus and alveoli were collected and a portion of each was lysed with a tissue lysis buffer. The supernatant was taken by centrifugation to detect the contents of the ACE2-hFc5 multimers. For analysis of the deposition doses in lungs, each hamster was lavaged with 4 mL of normal saline to collect the bronchoalveolar lavage fluid (BALF), 15 min, 30 min and 60 min after nebulizer inhalation. The lungs were further taken out and homogenized. A proportion of lung homogenate was lysed with the tissue lysis buffer, and then the supernatant was taken by centrifugation to detect the contents of ACE2-hFc5 multimers.

[0200] 11.1.2 ELISA Analysis of the Contents of ACE2-hFc5

[0201] The contents of ACE2-hFc5 multimers were analyzed using ELISA assay for binding SARS-CoV-2 RBD. In particular, 2 μg/mL of streptavidin was coated for capturing 2 μg/mL of biotin-labeled SARS-CoV-2 RBD. The diluted lavage fluid or tissue lysis supernatant to be tested was added while using the purified ACE2-NN-hFc5 as a standard. An HRP-labeled anti-hFc secondary antibody was used for detection. OD.sub.450-OD.sub.630 values were read with a microplate reader.

[0202] 11.1.3 SEC-HPLC Analysis of Multimer Forms of ACE2-hFc5 before and after Nebulization

[0203] ACE2-hFc5 multimers before and after nebulization were subjected to aggregation and degradation analysis by an HPLC method. An Agilent 1260 high performance liquid chromatography analysis system, a G4000 TSK G4000SWx1 analytical column and a TSK gel guard column SWx1 were used. The buffer comprised 50 mM PB and 300 mM NaCl pH 6.7±0.1. The analysis was performed for 20 or 25 min at a flow rate of 0.8 mL/min.

[0204] 11.2 Result: ACE2-NN-hFc5 can be effectively deposited in hamster alveoli through nebulizer administration.

[0205] We explored the route of administration via the respiratory tract through nebulizer inhalation, since SARS-CoV-2 mainly causes infection of the respiratory tract, and the focus of infection mainly locates in the lung. We nebulized ACE2-hFc5 using the Aerogen's nebulizer and collected the nebulized droplets using matched glass tubes under ice bath with the recovery rate of 90% or more. We analyzed, by SEC-HPLC, the physicochemical properties of ACE2-hFc5 before and after nebulization, and its neutralizing activity against the infection of the SARS-CoV-2 pseudovirus. The results show that the nebulization does not cause aggregation and degradation of ACE2-NN-hFc5 (FIG. 13). Further, it shows that ACE2-NN-hFc5 can significantly inhibiting the infection of the SARS-CoV-2 pseudovirus, and its antiviral ability does not change significantly before and after nebulization (FIG. 14).

[0206] The nebulizer delivery system for small animals is further used to perform the administration through nebulizer inhalation (5 mg/mL ACE2-NN-hFc5) for the hamsters for 50 min. The nasal lavage fluid (NLF), main trachea, bronchus and alveoli of the hamsters were taken at 0 h, 6 h and 24 h after nebulization to analyze the deposition and distribution of ACE2-NN-hFc5 in each part of the respiratory tract. We found that the inhaled ACE2-hFc5 was mainly distributed in the alveoli (about 75%) at 0 h, 6 h and 24 h after inhalation. The distribution of ACE2-hFc5 in the NLF decreased rapidly, from 17.33% at 0 h to 0.7% at F24h after inhalation. The distribution of ACE2-hFc5 in the main trachea was less, ranging from 0.35% to 3.4%. The distribution of ACE2-hFc5 in the bronchus gradually increased from 5% to 19%. These results indicate that the inhaled ACE2-NN-hFc5 can effectively reach the alveoli, and mainly distribute in the alveoli within 24 h after inhalation.

[0207] We further investigated the relationship between the inhaled doses of ACE2-hFc5 and the lung deposition in hamsters, and analyzed the neutralizing activity for the pseudoviruses in the BALF. We collected the BALF and lung homogenate from the hamsters after the nebulizer inhalation of ACE2-hFc5 at a concentration of 5 mg/mL for 15 min, 30 min and 60 min. Then, contents of the ACE2-hFc5 were detected by ELISA. The amounts of the ACE2-NN-hFc5 in both the BALF and lung homogenate were calculated as the total amount of lung deposition. The results show that, after the nebulizer inhalation of the ACE2-hFc5, the amount of lung deposition in the the hamsters increases with the increasing doses. The deposition amounts correspond to 6.48 μg, 18.69 μg and 33.35 μg for inhalation for 15 min, 30 min and 60 min, respectively. The deposition amounts of ACE2-hFc5 in the hamster lungs decreased rapidly after the inhalation.

[0208] The deposition amounts at 12 hours after the inhalation were 14.73%-46% of that immediately after the inhalation. Nonetheless, when inhaling for 15 min and 30 min, the BALF obtained from the hamsters, each of which was lavaged with 4 mL of normal saline at 12 hours after inhalation, could still maintain 90% or more of the neutralizing activity against the SARS-CoV-2 pseudoviruses after being diluted 4 times.

EXAMPLE 12

Efficacy Evaluation of ACE2-NN-hFc5 in a Hamster Model for New Coronavirus (SARS-CoV-2) Infection

[0209] 12.1 Method

[0210] 12.1.1 Experimental Design

[0211] All animal experiments were approved by the Animal Ethics Committee of the Kunming Institute of Biomedical Sciences of the Chinese Academy of Medical Sciences, and complied with the laboratory practice and guidelines of the National Kunming High-Level Biosafety Laboratory in Yunnan, China.

[0212] Adult Specific-Pathogen-Free (SPF) hamsters were transferred to the high-level biosafety laboratory and raised individually in respective cages. The hamsters were equally divided into three groups based on the body weights: an untreated control group; a group subjected to nebulized treatment for 15 min twice daily; and a group subjected to nebulized treatment for 30 min twice daily, with 7 hamsters in each group. In the experiment, the hamsters were inoculated with 104 PFU of SARS-CoV-2 viruses (GD108#) through nasal cavities. 2 hours later, the first nebulization inhalation was performed, with nebulization for 15 min (25 mg ACE2-hFc5) and 30 min (50 mg ACE2-hFc5), respectively. The nebulization inhalation was performed once every 12 hours, for a total of 6 times. The hamsters were weighed before each of the nebulization inhalations. The experiment ended at 62 h after the virus challenge. The lung tissues were taken for SARS-CoV-2 viral (gRNA) and subviral (sgRNA) genomic load analysis. 1 mL of PBS was added per 100 mg of the lung tissue (left lung). 200 μL was taken for RNA extraction after rapid homogenization, followed by RT-qPCR assay for SARS-CoV-2 viral gRNA and sgRNA load analysis. Statistical analysis was performed by using GraphPad Prism 8 software. Two-tailed Mann-Whitney U was used for the analysis of differences between two groups.

[0213] 12.2 Results: The nebulizer administration of ACE2-hFc5 can effectively reduce the viral load in the hamster model for SARS-CoV-2 infection.

[0214] Based on the established nebulizer inhalation delivery mode, we evaluated the in vivo antiviral ability of the ACE2-NN-hFC5 using the hamster model for SARS-CoV-2 infection. Two dose groups were provided in the experiment to evaluate the efficacy of the ACE2-hFC5, one with nebulizer inhalation for 15 minutes and the other with nebulizer inhalation for 30 minutes. The virus titers reached the highest on the third day after the hamsters were infected with SARS-CoV-2, and viremia was gradually improved with time. Thus, we chose the third day after the virus challenge as the experimental endpoint. After treatment with ACE2-NN-hFc5, there was a slight improvement trend in the reduction of the hamster body weights. According to the quantitative results of gRNA and sgRNA in the lung tissues, the nebulizer inhalation of ACE2-hFc5 can significantly inhibit the replication of SARS-CoV-2 virus in the lung tissues (FIG. 15). In FIG. 15, qPCR analysis was performed at the end of the experiment (62 hours after the challenge) to determine the changes of the SARS-CoV-2 genome (gRNA) and subgenome (sgRNA) in the hamster lungs. .circle-solid. represents the untreated control group; .square-solid. represents the ACE2-hFc5-15min-BID group; .box-tangle-solidup. represents the ACE2-hFc5-30 min-BID group; and the horizontal line represents a median. Mann-Whitney U was used for statistical analysis of differences between two groups. Therefore, the nebulizer inhalation of ACE2-hFc5 can effectively reduce the viral load in the hamster model for SARS-CoV-2 infection, and has the potential to prevent and treat the pneumonia caused by SARS-CoV-2.

[0215] Although the present disclosure has been described in detail above with general description, specific embodiments and experiments, some modifications or improvements can be made on the basis of the present disclosure, which is obvious to those skilled in the art. Therefore, these modifications or improvements made without departing from the spirit of the present disclosure all fall within the scope of protection of the present disclosure.